CN108913767A - A kind of Parkinson's disease Disease-causing gene, kit and application - Google Patents
A kind of Parkinson's disease Disease-causing gene, kit and application Download PDFInfo
- Publication number
- CN108913767A CN108913767A CN201810806455.0A CN201810806455A CN108913767A CN 108913767 A CN108913767 A CN 108913767A CN 201810806455 A CN201810806455 A CN 201810806455A CN 108913767 A CN108913767 A CN 108913767A
- Authority
- CN
- China
- Prior art keywords
- disease
- chr6
- seq
- gene
- parkinson
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of Parkinson's disease Disease-causing gene, kit and applications, wherein the Disease-causing gene includes Chr6:118015345,Chr6:118014264,Chr6:118014276,Chr6:118015279 and Chr6:118028193, nucleotide sequence is respectively as shown in SEQ ID NO.1-5.Detection method is the extraction of sample tissue DNA；Polymerase chain amplified reaction is carried out to DNA sample, obtains product；To the product carry out nucleotide sequencing, in the determination biological sample whether the mutation containing NUS1 gene.
Description
Technical field
The invention belongs to gene engineering technology fields, specifically, be related to a kind of Parkinson's disease Disease-causing gene, kit and
Using.
Background technique
Parkinson's disease (Parkinson ' s Disease, PD), for a kind of common neurodegenerative disease
(Neurodegenerative diseases), illness rate is high, and domestic and international epidemiological survey shows the elderly of over-65s
The illness rate of PD is about 1~2% in group, and elderly population illness rate is up to 4% within 80 years old or more.Existing about 2,500,000 PD in China suffer from
Person, with China human mortality aging and the extension of the average life span, it is contemplated that the year two thousand thirty, China will have about 5,000,000 PD patients, and account for
The 57% of world PD patient populations.PD patient is hidden to attack onset, and how unobvious early clinical manifestation is, to early diagnosing in clinical position
Very big difficulty is brought, and when typical parkinson symptom progress clinical diagnosis occurs in patient, patient has entered disease more at this time
Middle and advanced stage has missed the best therapeutic intervention phase, has brought heavy burden to patient and family.Therefore, to the cause of disease of PD and morbidity machine
The discussion of system will seem urgent and necessary preferably to carry out early diagnosis and prevention and treatment early to PD.
PD main clinical manifestation includes that bradykinesia (bradykinesia), static tremor (rest tremor), flesh are strong
The directly motor symptoms such as (rigidity) and dysosmia (hyposmia), snap-action eye phase disturbance in sleep behavior (Rapid eye
Movement sleep behavior disorder, RBD), anxiety/depression (anxiety/depression), autonomic nerve
The non-motor symptoms (non-motor symptoms) such as dysfunction (autonomic nervous dysfunction).Its disease
Reason feature is mainly Lewy body (Lewy in substantia nigra of midbrain degeneration of dopaminergic neurons missing and remaining neurons cell space
Body), the formation of Louis aixs cylinder (Lewy neurities).So far, the cause of disease and pathogenesis of PD be not still very clear, now more
Think astogeny factor (aging), inherent cause (genetic factors) and environmental factor (environmental
Factors) and its collective effect and participate in disease.
Since the nineties in last century identifies first Disease-causing gene-SNCA of PD, inherent cause to the contribution of PD by
To more and more concerns.Currently, inherent cause is in PD study of incident mechanism, medicament research and development, disease early diagnosis/study of warning etc.
Aspect provides new approaches.So far, in terms of Disease-causing gene research, existing 20 heredity PD Disease-causing genes are defined：Wherein
SNCA, UCH-L1, LRRK2, HTRA2, GIGYF2, VPS35, EIF4G1, DNAJC13, CHCHD2 and TMEM230 gene and often dye
Dominant (autosomal dominant, AD) the heredity PD of colour solid is related；Parkin,DJ-1,PINK1,ATP13A2,PLA2G6,
FBXO7, DNAJC6, SYNJ1 and VPS13C gene and autosomal recessive (autosomal recessive, AR) heredity PD
It is related；RAB39B is related with chain (X-linked) the heredity PD of X.The discovery of above-mentioned Disease-causing gene, for parsing PD disease because
Provide new approaches.
In decades, many researchers study PD family both at home and abroad, it is desirable to identify more PD candidate bases
Cause.The first identified of the present invention new candidate gene NUS1 of PD, to diagnosing and treating, the pathogenesis of PD provides new approaches.
NUS1 includes 5 exons (NM_138459.4), and total 31345bp encodes one and is made of 293 amino acid
Transmembrane protein.NUS1 sequence is highly conserved, and the expression of brain height (containing black substance and Basal ganglia), and concrete function is not still ten clearly demarcated
Really.It is Nogo-B receptor (Nogo-B receptor) that NUS1, which encodes albumen, can be may participate in intracellular with NPC2 interactions between protein
Cholesterol metabolic, α-synuclein metabolism etc..
Currently, PD treatment is mainly etiological treatment, it there is no healing means.It is early diagnosed, patient will be made to have an opportunity to obtain
Obtain intervention in time, effectively and reasonably；With the discovery and research of stylish candidate gene, will also be provided newly for PD study of incident mechanism
Thinking.Therefore the excavation of the new candidate gene of PD and its detection in mutational site will send out the diagnosis of the extreme early of potential PD patient, PD
Sick Mechanism Study is of great significance.
Summary of the invention
In view of this, the present invention provides a kind of Parkinson's disease Disease-causing gene, kit and applications.
In order to solve the above-mentioned technical problem, the invention discloses a kind of Parkinson's disease Disease-causing genes, including Chr6:
118015345,Chr6:118014264,Chr6:118014276,Chr6:118015279 and Chr6:118028193, have
The sequence of SEQ ID NO.1-5.
The invention also discloses a kind of detection kits of Parkinson's disease Disease-causing gene, which is characterized in that includes to be used for
Expand the kit of above-mentioned Disease-causing gene.
Optionally, the primer sequence in the kit is as follows：For expanding Chr6:Draw in 118015345 sites
Object group：SEQ ID NO:10 and SEQ ID NO:11；For expanding Chr6:The primer sets in 118014264 sites：SEQ ID NO:
8 and SEQ ID NO:9；For expanding Chr6:The primer sets in 118014276 sites：SEQ ID NO:8 and SEQ ID NO:9；With
In amplification Chr6:The primer sets in 118015279 sites：SEQ ID NO:10 and SEQ ID NO:11, for expanding Chr6:
The primer sets in 118028193 sites：SEQ ID NO:14 and SEQ ID NO:15.
Optionally, include in the reaction system of the detection kit：DNTP, for PCR reaction archaeal dna polymerase and
Its buffer.
The invention also discloses a kind of PCR methods for detecting above-mentioned Parkinson's disease Disease-causing gene, which is characterized in that including such as
Lower step：
(1) extraction of sample tissue DNA；
(2) polymerase chain amplified reaction is carried out by primer pair DNA sample as claimed in claim 3, obtains product；
(3) nucleotide sequencing is carried out to the product, whether to contain NUS1 gene in the determination biological sample
Mutation.
Compared with prior art, the present invention can be obtained including following technical effect：
1) the present invention provides a kind of PD Disease-causing genes, by carrying out outside full-length genome to an early onset PD nuclear family
Aobvious subgroup sequencing and Sanger sequencing analysis, it was found that a kind of fresh mutation-of a new PD Disease-causing gene NUS1 gene
c.691+2->A designs diagnostic primers for the coding sequence, and invention detection kit is applied to PCR amplification in vitro base
It because of a group DNA, is sequenced in conjunction with Sanger, detects the mutation of PD Disease-causing gene NUS1 gene, be applied to clinical gene and diagnose.
2) the present invention provides a kind of for detecting the detection kit of PD Disease-causing gene, by mentioning sample tissue DNA
It takes, then passes through design all exons of Disease-causing gene NUS1 of PCR amplification and its drawing for exon: intron boundary region sequence
Object, provides a kind of detection kit for the mutation of PD Disease-causing gene, and the kit is easy to detect, convenient.
3) study of incident mechanism that the present invention is PD has established important foundation, provides completely new theoretical foundation for treatment, answers
With the detection kit of PD Disease-causing gene, important foundation and reference value can be provided for clinical definite disease, it can also be used to open
Gene diagnosis and genetic counselling are opened up, is conducive to the early diagnosis and early stage prophylactic treatment to the disease, instructs prenatal and postnatal care.
Certainly, it implements any of the products of the present invention it is not absolutely required to while reaching all the above technical effect.
Detailed description of the invention
The drawings described herein are used to provide a further understanding of the present invention, constitutes a part of the invention, this hair
Bright illustrative embodiments and their description are used to explain the present invention, and are not constituted improper limitations of the present invention.In the accompanying drawings：
Fig. 1 is the schematic diagram of mutant nucleotide sequence SEQ ID NO.1-5 of the present invention, i.e. the mutation sequence of PD patient NUS1 gene sequencing
Column result figure；Wherein a indicates to find a kind of fresh mutation-of NUS1 gene c.691+2- in an early onset PD nuclear family>
A, the Chr6 on pcr amplification product:118015345 bit bases are inserted into A base；B is indicated on the pcr amplification product of 1 PD patient
There is Chr6:118014264 bit base C are mutated A；There is Chr6 on the pcr amplification product of c 2 PD patients of expression:118014276
Bases G is mutated C；There is Chr6 on the pcr amplification product of d 1 PD patient of expression:118015279 bit base G are mutated C；E indicates 1
There is Chr6 on the pcr amplification product of PD patient:118028193 bit base A mutation Ts；It wherein illustrates and is followed successively by from top to bottom (a-e)
SEQ ID NO.1、2、3、4、5。
Specific embodiment
Carry out the embodiment that the present invention will be described in detail below in conjunction with embodiment, thereby to the present invention how application technology hand
Section solves technical problem and reaches the realization process of technical effect to fully understand and implement.
Embodiment 1
The present invention has found NUS1 in an early onset PD nuclear family by the method for full-length genome sequencing of extron group
A kind of fresh mutation (de novo mutation)-of gene is c.691+2->A, the mutation are located at conservative shearing site, can be to base
Because of potential impact caused by transcription, specific mutant nucleotide sequence such as SEQ ID NO:Shown in 1.The present invention again to other 1852 PD patients and
1565 normal controls carry out the abrupt climatic change of NUS1 gene, and primer sequence is as shown in table 1, wherein 6 PD Finding cases carry
The rare variation of NUS1 gene, and the rare variation of NUS1 gene is carried without normal control.The result can determine that NUS1 gene is
The new candidate gene of PD.
The present invention relates to the variations of 5 PD correlation candidate genes (NUS1 gene), as shown in Figure 1, the sequence of this 5 variations
It is as follows：
1, NUS1 gene C hr6:118015345 insertion A bases, the mutation are located at conservative shearing site region, can influence
The shearing of NUS1 genetic transcription version, this mutation find in 1 PD patient, sequence such as SEQ ID NO:Shown in 1.
2, NUS1 gene C hr6:118014264C allelic mutation is A, can lead to 159 amino acids and is become by leucine
For isoleucine, this mutation is found in 1 PD patient, sequence such as SEQ ID NO:Shown in 2, the nucleosides of gene before being mutated
Acid sequence such as SEQ ID NO:Shown in 16.
3, NUS1 gene C hr6:118014276G allelic mutation is C, can lead to 163 amino acids by aspartic acid
Become histidine, this mutation is found in 2 PD patients, sequence such as SEQ ID NO:Shown in 3, the nucleosides of gene before being mutated
Acid sequence such as SEQ ID NO:Shown in 17.
4, NUS1 gene C hr6:118015279G allelic mutation is C, can lead to 209 amino acids by glutamine
For histidine, this mutation is found in 1 PD patient, sequence such as SEQ ID NO:Shown in 4, the nucleotide of gene before being mutated
Sequence such as SEQ ID NO:Shown in 18.
5, NUS1 gene C hr6:118028193A allelic mutation is T, which is located at shearing site region, may
The shearing of NUS1 genetic transcription version is influenced, while the mutation is located at 3 ' UTR regions, can influence the courier of microRNA and NUS1
RNA is combined, this mutation is found in 1 PD patient, sequence such as SEQ ID NO:Shown in 5, the nucleotide of gene before being mutated
Sequence such as SEQ ID NO:Shown in 19.
1 NUS1 gene primer sequence of table
Embodiment 2 detects the kit of mutation of the biological sample with the presence or absence of the gene
The kit includes pcr reagent, such as dNTP, the archaeal dna polymerase and its buffer that react for PCR；
Primer pair used in PCR amplification system (as shown in table 1), sequence such as SEQ ID NO:Shown in 6-15.Ability
Field technique personnel are it is known that the above component is only illustrative, for example, the primer can be set according to known nucleotide sequence
Meter, usually 15-30 base, G/C content are 45-50% or so, can at a proper temperature in conjunction with terminal specificity
Using special computer program design, the archaeal dna polymerase for PCR reaction can be used for the enzyme of PCR amplification.
Embodiment 3NUS1 gene C hr6:The detection method of 118015345 insertion A base mutations
(1) collection of specimens and processing.Inventor carries out detailed medical history, family history to patient A and its parent (normal person)
Investigation and comprehensive physical examination and related auxiliary examination.After signing informed consent form, everyone takes ulnar vein blood 10ml
(sodium citrate is anticoagulant), 4 DEG C of preservations, two weeks it is interior according to《Molecular cloning》The method that the second edition extracts DNA from blood is extracted
DNA。
(2) PCR amplification in vitro is carried out to sample DNA target fragment.Design following primer；
Forward primer；5 ' AGATGCGTGAAAATTTGTTAGCT, 3 ' (SEQ ID NO.10)
Reverse primer；5 ' TCATACTGTATCCTCGTGTGACA, 3 ' (SEQ ID NO.11)
Reaction system and reaction condition is as shown in the following table 2,3：
2 PCR reaction system (TaKaRaTaq of tableTMHot StartVersion)
3 PCR response procedures of table
Mutant analysis results are as follows：
(1) DNA sequencing is carried out to this PD patient and its parent's pcr amplification product.
(2) sequencing result is analyzed：
Sequencing result is analyzed using SEQUENCE ANALYSIS software, it may be found that mutant nucleotide sequence and genome
Sequence is compared, and is compared and analyzed to sequencing result.
Sequencing analysis is shown：
1) Chr6 on the pcr amplification product of this patient:118015345 bit bases are inserted into A base (SEQ ID
NO.1)。
2) above-mentioned mutation and other significant mutation are not found on this patient parent NUS1 gene.
The detection method of other site mutations of embodiment 4NUS1 gene
1852 PD patients, 1565 normal persons；Basic skills and step are directed in specific method referring to embodiment 1
The mutational site and neighbouring sequence carry out PCR amplification, and the PCR primer sequence used is shown in (SEQ ID NO.6-SEQ ID
NO.15)。
(1) to this 1852 PD patients, 1565 normal person's pcr amplification products carry out DNA sequencing.
(2) sequencing result is analyzed
Sequencing result is analyzed using SEQUENCE ANALYSIS software.The mutant nucleotide sequence and genome that will be seen that
Sequence is compared, and is compared and analyzed to sequencing result.
Sequencing analysis is shown：
1) there is Chr6 on the pcr amplification product of 1 PD patient:118014264 bit base C are mutated A (SEQD ID NO.2).
2) there is Chr6 on the pcr amplification product of 2 PD patients:118014276 bit base G are mutated C (SEQ ID NO.3).
3) there is Chr6 on the pcr amplification product of 1 PD patient:118015279 bit base G are mutated C (SEQ ID NO.4).
4) there is Chr6 on the pcr amplification product of 1 PD patient:118028193 bit base A mutation Ts (SEQ ID NO.5).
5) above-mentioned mutation and other significant mutation are not found on 1565 normal person's NUS1 genes.
The rare variation of NUS1 gene is not found in above-mentioned 1565 normal controls, determines that above-mentioned mutation is the important new of PD
Candidate gene.
Above description has shown and described several preferred embodiments of invention, but as previously described, it should be understood that invention is not
It is confined to form disclosed herein, should not be regarded as an exclusion of other examples, and can be used for various other combinations, modification
And environment, and can be carried out within that scope of the inventive concept describe herein by the above teachings or related fields of technology or knowledge
Change.And changes and modifications made by those skilled in the art do not depart from the spirit and scope of invention, then it all should be in the appended power of invention
In the protection scope that benefit requires.
Sequence table
<110>The Chinese Academy of Sciences
<120>A kind of Parkinson's disease Disease-causing gene, kit and application
<130> 2018
<160> 19
<170> SIPOSequenceListing 1.0
<210> 1
<211> 153
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 1
ttttaaattg ccatttggca gtgaaggtgc tgtctccgga agatggaaaa gcagatattg 60
taagagctgc tcaggacttt tgccagttag tagcccagaa gcaaaagaga cccacagatt 120
tggatgtaga tacgttagcc agtttactta gta 153
<210> 2
<211> 126
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 2
gtattttcaa aagaaataat tccagattga tggatgaaat tttaaaacaa cagcaagaaa 60
ttctgggcct agattgttca aaatactcac cagaatttgc aaatagtaat gacaaagatg 120
atcaag 126
<210> 3
<211> 126
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 3
gtattttcaa aagaaataat tccagattga tggatgaaat tttaaaacaa cagcaagaac 60
ttctgggcct acattgttca aaatactcac cagaatttgc aaatagtaat gacaaagatg 120
atcaag 126
<210> 4
<211> 150
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 4
ttttaaattg ccatttggca gtgaaggtgc tgtctccgga agatggaaaa gcagatattg 60
taagagctgc tcaggacttt tgccacttag tagcccagaa gcaaaagaga cccacagatt 120
tggatgtaga tacgttagcc agtttactta 150
<210> 5
<211> 135
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 5
ctctttgcct tcccacctaa acatcagtta tgaggacttt ttctctgccc ttcgtcaata 60
tgcagcctgt gaacagcgtc tgggaaagta gtggtcattg gttgcttaat ttgatttgag 120
gcttgtggag gaaag 135
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 6
gaggtgttgg cagtggaaag 20
<210> 7
<211> 19
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 7
gtgatttgca gagaggccg 19
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 8
agtgttgttt tcatagcaag ca 22
<210> 9
<211> 22
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 9
acagaaattg ccatgaaaca ca 22
<210> 10
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 10
agatgcgtga aaatttgtta gct 23
<210> 11
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 11
tcatactgta tcctcgtgtg aca 23
<210> 12
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 12
gtgtttctgt gtgtgtgtgt g 21
<210> 13
<211> 21
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 13
ccccaccaga tctagtacag t 21
<210> 14
<211> 23
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 14
tggtggagga taatttggtg tat 23
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence (Artificial sequence)
<400> 15
cctccacaag cctcaaatca 20
<210> 16
<211> 126
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 16
gtattttcaa aagaaataat tccagattga tggatgaaat tttaaaacaa cagcaagaac 60
ttctgggcct agattgttca aaatactcac cagaatttgc aaatagtaat gacaaagatg 120
atcaag 126
<210> 17
<211> 126
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 17
gtattttcaa aagaaataat tccagattga tggatgaaat tttaaaacaa cagcaagaac 60
ttctgggcct agattgttca aaatactcac cagaatttgc aaatagtaat gacaaagatg 120
atcaag 126
<210> 18
<211> 150
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 18
ttttaaattg ccatttggca gtgaaggtgc tgtctccgga agatggaaaa gcagatattg 60
taagagctgc tcaggacttt tgccagttag tagcccagaa gcaaaagaga cccacagatt 120
tggatgtaga tacgttagcc agtttactta 150
<210> 19
<211> 135
<212> DNA
<213>Parkinson's disease (Parkinson's Disease, PD)
<400> 19
ctctttgcct tcccacctaa acatcagtta tgaggacttt ttctctgccc ttcgtcaata 60
tgcagcctgt gaacagcgtc tgggaaagta gtggtcattg gttgcataat ttgatttgag 120
gcttgtggag gaaag 135
Claims (5)
1. a kind of Parkinson's disease Disease-causing gene, which is characterized in that including Chr6:118015345,Chr6:118014264,Chr6:
118014276,Chr6:118015279 and Chr6:118028193, nucleotide sequence is respectively as shown in SEQ ID NO.1-5.
2. a kind of detection kit of Parkinson's disease Disease-causing gene, which is characterized in that include for expanding such as claim 1 institute
The kit for the Disease-causing gene stated.
3. detection kit according to claim 2, which is characterized in that the following institute of primer sequence in the kit
Show：For expanding Chr6:The primer sets in 118015345 sites：SEQ ID NO:10 and SEQ ID NO:11；For expanding
Chr6:The primer sets in 118014264 sites：SEQ ID NO:8 and SEQ ID NO:9；For expanding Chr6:118014276
The primer sets of point：SEQ ID NO:8 and SEQ ID NO:9；For expanding Chr6:The primer sets in 118015279 sites：SEQ ID
NO:10 and SEQ ID NO:11, for expanding Chr6:The primer sets in 118028193 sites：SEQ ID NO:14 and SEQ ID
NO:15。
4. detection kit according to claim 2, which is characterized in that wrapped in the reaction system of the detection kit
It includes：DNTP, the archaeal dna polymerase and its buffer reacted for PCR.
5. a kind of PCR method of Parkinson's disease Disease-causing gene described in detection claim 1, which is characterized in that include the following steps：
(1) extraction of sample tissue DNA；
(2) polymerase chain amplified reaction is carried out by primer pair DNA sample as claimed in claim 3, obtains product；
(3) nucleotide sequencing is carried out to the product, with whether prominent containing NUS1 gene in the determination biological sample
Become.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810806455.0A CN108913767A (en) | 2018-07-20 | 2018-07-20 | A kind of Parkinson's disease Disease-causing gene, kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810806455.0A CN108913767A (en) | 2018-07-20 | 2018-07-20 | A kind of Parkinson's disease Disease-causing gene, kit and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108913767A true CN108913767A (en) | 2018-11-30 |
Family
ID=64416627
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810806455.0A Pending CN108913767A (en) | 2018-07-20 | 2018-07-20 | A kind of Parkinson's disease Disease-causing gene, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108913767A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20090027537A (en) * | 2007-09-12 | 2009-03-17 | (주)아모레퍼시픽 | Method and kit for diagnosis of abnormal keratinization |
| CN102206701A (en) * | 2010-09-19 | 2011-10-05 | 深圳华大基因科技有限公司 | Identification method for genetic disease-related gene |
| CN103667500A (en) * | 2013-12-27 | 2014-03-26 | 中南大学湘雅医院 | Diagnosis chip of recessive pathogenic genetic genes of Parkinson disease |
| US20140162933A1 (en) * | 2012-09-14 | 2014-06-12 | Population Diagnostics, Inc. | Methods and Compositions for Diagnosing, Prognosing, and Treating Neurological Conditions |
| CN104561309A (en) * | 2015-01-04 | 2015-04-29 | 北京大学第三医院 | Kit for predicting birth safety before people-assisted reproduction blastosphere implantation |
-
2018
- 2018-07-20 CN CN201810806455.0A patent/CN108913767A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20090027537A (en) * | 2007-09-12 | 2009-03-17 | (주)아모레퍼시픽 | Method and kit for diagnosis of abnormal keratinization |
| CN102206701A (en) * | 2010-09-19 | 2011-10-05 | 深圳华大基因科技有限公司 | Identification method for genetic disease-related gene |
| US20140162933A1 (en) * | 2012-09-14 | 2014-06-12 | Population Diagnostics, Inc. | Methods and Compositions for Diagnosing, Prognosing, and Treating Neurological Conditions |
| CN103667500A (en) * | 2013-12-27 | 2014-03-26 | 中南大学湘雅医院 | Diagnosis chip of recessive pathogenic genetic genes of Parkinson disease |
| CN104561309A (en) * | 2015-01-04 | 2015-04-29 | 北京大学第三医院 | Kit for predicting birth safety before people-assisted reproduction blastosphere implantation |
Non-Patent Citations (1)
| Title |
|---|
| SHIRO FUJITA等: "Single nucleotide variant sequencing errors in whole exome sequencing using the Ion Proton System", 《BIOMEDICAL REPORTS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mtiraoui et al. | Contribution of common variants of ENPP1, IGF2BP2, KCNJ11, MLXIPL, PPARγ, SLC30A8 and TCF7L2 to the risk of type 2 diabetes in Lebanese and Tunisian Arabs | |
| CN105385774B (en) | Purposes of the TMF1 as parkinsonism diagnosis marker | |
| CN103725798B (en) | For detecting primer, test kit, the detection method of hemorrhagic fever with renal syndrome virus with RT-LAMP method | |
| Kanters et al. | Flecainide provocation reveals concealed brugada syndrome in a long QT syndrome family with a novel L1786Q mutation in SCN5A | |
| Tafti et al. | Novel and heteroplasmic mutations in mitochondrial tRNA genes in Brugada syndrome | |
| CN109486938A (en) | Detect method, primer and the application of SMN1 and SMN2 gene mutation | |
| CN109680056A (en) | A kind of kit, detection method and its application detecting MCR gene | |
| CN110551728B (en) | FOXC1 gene mutant and application thereof | |
| CN109402132B (en) | Nucleic acid for coding SCN1A gene mutant and application thereof | |
| CN107419008B (en) | Method and kit for accurately diagnosing Parkinson's disease in early stage | |
| CN104745592B (en) | CYP4V2 gene mutant and application thereof | |
| CN108913767A (en) | A kind of Parkinson's disease Disease-causing gene, kit and application | |
| WO2017092483A1 (en) | Kit for diagnosing tuberculosis through detecting free nucleic acid and use thereof | |
| Shaikh et al. | Exposure of fat mass obesity gene polymorphism in diabetes mellitus type-II females of Hyderabad, Sindh | |
| CN108823303A (en) | A kind of detection kit and its purposes for assessing schizophrenia genetic risk | |
| CN109593849A (en) | One group of blood plasma LncRNA marker relevant to colorectal cancer and its application | |
| CN104388553A (en) | Detection primers, method and kit for myodystonia VPS16 gene | |
| CN113322317A (en) | Primer pair, probe set and kit for mitochondrial obesity gene mutation detection | |
| CN111733227B (en) | Molecular marker circRNA for diagnosing idiopathic optic neuritis, kit and application | |
| CN104404044B (en) | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction | |
| CN102732616A (en) | Detection kit for c.403>T mutation of CDH23 gene | |
| CN107083429B (en) | A kind of SNP parting kit and its application for the detection of atrial fibrillation tumor susceptibility gene | |
| CN106929601A (en) | A kind of type kit for detecting nucleic acid of highly sensitive HPV 6,11 | |
| CN105671198A (en) | Reagent kit for detecting glycogen storage disease type III (GSD III) AGL gene mutation and application of reagent kit | |
| CN108342404A (en) | INPP5E gene mutation bodies and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181130 |
|
| RJ01 | Rejection of invention patent application after publication |