KR20090009538A - Adam33 controlling the secretion of interleukin-18 and use thereof - Google Patents

Abstract

A composition comprising the material inhibiting the expression or activity of ADAM33(A Disintegrin A Metalloprotease) which controls the secretion of the interleukin-18(IL-18) is provided to reduce secretion of IL-18 by inhibiting the expression of ADAM33 and suppress the proliferation and transition of stomach cancer cell, thereby preventing and treating cancer. The composition for prevention and treatment of cancer comprises a material inhibiting the expression or activity of ADAM33 having the nucleotide sequence of SEQ ID NO:1, which is selected from siRNA(small interfering RNA) for ADAM33 of SEQ ID NO:2 to SEQ ID NO:5 and shRNA(short hairpin RNA) for ADAM33, or selected from ADAM33 neutralizing antibody and metalloprotease inhibitor.

Description

ADAM33 controlling the secretion of interleukin-18 and use about

The present invention relates to ADAM33 and the use thereof for regulating the secretion of interleukin-18, and more particularly to a pharmaceutical composition for preventing and treating cancer comprising a substance that inhibits the expression or activity of ADAM33.

Cancer is a complex disease that results from uncontrolled proliferation and disordered growth of transformed cells. Most cancers are caused by oncogenes and other factors caused by environmental and genetic factors. A mutation occurs in a tumor suppressor gene. Cancer cells initially proliferate, penetrate adjacent tissues, destroy them, and then gradually invade the circulatory system and spread to other parts of the body away from the cancerous site, eventually killing the individual.

These cancers are the leading cause of death worldwide, and one in four people in Korea die of cancer. Among them, gastric cancer is the most frequent cancer among cancers in Korea, and is twice as common in men as in women. In Western countries, the incidence of gastric cancer is gradually decreasing, but in Korea and Japan, the incidence of gastric cancer is still very high. Dietary habits in areas where gastric cancer is common include eating salts, nitrates, starch and grains, pickled fish, salted foods, smoked foods, and roasted foods, while eating less fat, protein, green-yellow vegetables, and fruits. have. Burned foods, smoked foods are highly carcinogenic polycyclic aromatic hydrocarbons (polycyclic aromatic hydrocarbons) are detected, and food nitrates have been reported to be carcinogenic. In addition, salt and red pepper powder are not carcinogenic by themselves, but gastric mucosal damage caused by excessive intake is analyzed to play a role in assisting the action of carcinogens. Due to this eating habit, domestic incidence of gastric cancer is very high compared to other cancers, but the recent increase in interest in health and development of diagnostic technology, early gastric cancer is rapidly increasing to 40 to 50% of the total gastric cancer.

Early gastric cancer is an early gastric cancer whose tumor invasion depth is limited to the mucosal layer or submucosal layer, and its size is small and the lymph node metastasis of gastric cancer cells is very low. Therefore, it can be treated by surgical methods such as mucosal resection or gastrectomy. In this case, it is very important to detect gastric cancer early because the prognosis is good enough that the rate of early gastric cancer reaches 90 to 100%. However, patients with early gastric cancer have few symptoms, or when antacids are temporarily eliminated, it is difficult to detect them early. In addition, symptoms occur when the size of the gastric cancer cells grows to a certain extent, and there are few typical symptoms of gastric cancer until they progress significantly. Therefore, when gastric cancer is detected by subjective symptoms, it is already difficult to treat by surgical methods alone, and in the case of gastric cancer, the metastasis rate is very fast, so when cancer cells metastasize to the liver, lung, or abdominal cavity, surgery is impossible. Becomes In this case, chemotherapy and radiation therapy are treated with chemotherapy. However, most of the chemotherapy and radiation therapy made with chemicals cause severe damage to normal cells. Therefore, in recent years, by enhancing the immune function of cancer patients, cancer cells specifically target cancer cells to specifically target cancer or immune cells. Aggressive therapies and diagnostics are also being developed, but are not yet in practical use.

On the other hand, the ADAM family (A Disintegrin A Metalloprotease family) is a generic name for a cell membrane protein consisting of 34 members, and since most of them include a metalloprotease domain and a disintegrin domain, It is believed to play an important role in the movement of the. In particular, at least 50% of the ADAM family is protease-type ADAM and contains an active site having the HEXXHXXGXXH amino acid sequence in the metalloprotease domain. These ADAMs include ADAM8, ADAM8, ADAM9, ADAM10, ADAM12, ADAM15, ADAM17, ADAM19, ADAM20, ADAM21, ADAM28, ADAM30. Many reports have reported that MMP (matrix metalloproteinase), which is known to have a very strong effect on cancer metastasis, has the same amino acid sequence, so protease-type ADAM is also expected to induce cancer metastasis. In the case of ADAM17, the most research is carried out, it is known that it affects the secretion of various kinds of chemokine (cytokine), cytokine (cytokine), adhesion molecules, growth factor (growth factor). In addition, ADAM10 regulates the shedding of CD30, which has increased expression in hematologic cancers, suggesting a potential for effective immunotherapy. In addition, the effects of ADAM28 on the proliferation of breast cancer and ADAM family, such as ADAM9, ADAM12, ADAM15, which have increased expression in gastric cancer, have been reported to play an important role in the development and progression of cancer. However, there are no known studies of cancer metastasis of ADAM33, and ADAM33 is known as a gene related mainly to asthma.

Therefore, the present inventors studied to study the relationship between cancer in ADAM33, which has not been studied in cancer, and as a result, the expression of ADAM33 increases with the metastasis of gastric cancer induced by VEGF-D, and ADAM33 is a type of cytokine. The present invention was found to be involved in the activation of the phosphorus IL-18 precursor and to promote its secretion, and the present invention was completed by recognizing that ADAM33 expression can be suppressed to inhibit the proliferation and metastasis of gastric cancer. .

It is therefore an object of the present invention to provide ADAM33 and its use to modulate the secretion of interleukin-18.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing and treating cancer comprising ADAM33 expression inhibitor as an active ingredient.

In order to achieve the other object of the present invention, the present invention provides a pharmaceutical composition for preventing and treating cancer comprising ADAM33 activity inhibitor as an active ingredient.

In order to achieve another object of the present invention, there is provided an siRNA that inhibits the expression of ADAM33.

Hereinafter, the content of the present invention will be described in more detail.

The pharmaceutical composition of the present invention is characterized in that it comprises ADAM33 expression inhibitors as an active ingredient.

A Disintegrin A Metalloprotease 33 (ADAM33) may be known ADAM33, but preferably Genbank Accession No. NM_153202, NM_025220, NM_001082418, AL109804, AL356755, CH471133, Q995342, BC125112, BC125113, AC_000063, NW_927317, NC_000020, NT_011387, BC062663, AB055891, AY358314, AY223855, AY223854, AY22852466 A223 AF223 AF223 AF223 It may be ADAM33 described, and more preferably may be one encoded by the nucleotide sequence represented by SEQ ID NO: 1.

ADAM33 expression inhibitor means a substance that inhibits the expression of ADAM33 in the cell, thereby reducing its intracellular level, i.e., the amount present in the cell, which can be controlled by various methods known to those skilled in the art. For example, but not limited to, intracellular levels can be regulated through regulation at the transcriptional stage or regulation at the post-transcriptional stage. Modulation at the transcriptional stage is a method for inhibiting the expression of genes known to those of skill in the art, for example, by inducing mutations in a promoter or gene region, which inhibits promoter activity or protein function, and which expresses antisense genes. Method, “RNAi” or “microRNA” method, or the like.

Modulation at the post-transcriptional stage is a method for enhancing or inhibiting protein expression known to those skilled in the art, for example, a method for inhibiting the stability of mRNA of SEQ ID NO: 1, a method for inhibiting the stability of a protein or polypeptide, or a protein or polypeptide. It can be carried out by a method of inhibiting the activity of

More specific examples of the method may be transformed into DNA sequences encoding RNAs that act on transcribed mRNA such as group 1 intron type, M1 RNA type, hammerhead type, hairpin type or microRNA type, or Couppression may be induced through transformation of DNA having a sequence identical or similar to a target gene sequence.

Preferably, the ADAM33 expression inhibitory substance in the present invention may be siRNA or shRNA for ADAM33. In this case, siRNA refers to a short double-chain RNA that can induce RNAi phenomenon through cleavage of specific mRNA, preferably the nucleotide sequence of SEQ ID NO: 2 to SEQ ID NO: 5, more preferably SEQ ID NO: 2 And combinations of 3 or combinations of SEQ ID NOs: 4 and 5. Methods of preparing siRNAs and introducing them into cells or animals may vary depending on the purpose of the experiment and the cellular biological function of the target gene product, which is well known to those skilled in the art. In addition, shRNA is a single-stranded RNA having a length of 50 to 70 nucleotides, forming a stem-loop structure in vivo, and complementarily 19 to both loop regions of 5 to 10 nucleotides. Long RNA of 29 nucleotides base pairs to form a double stranded stem. The shRNA is generally transcribed and synthesized by the Pol III promoter in vivo, and then the shRNA is cleaved by Dicer and acts with RISC like siRNA.

Preferably, the preparation and introduction of the siRNA may be performed by a method of preparing a recombinant vector comprising a polynucleotide encoding a promoter and siRNA operably linked thereto, and introducing the same into a host cell. The method of introduction into the host cell is preferably calcium chloride method, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation ( known methods such as liposome-mediated method) can be used.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

Cancer to which the pharmaceutical composition of the present invention may be applied is not limited thereto, but is not limited thereto, gastric cancer, colon cancer, lung cancer, liver cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, Chorionic cancer, ovarian cancer, breast cancer, thyroid cancer, brain cancer, head and neck cancer, malignant melanoma, lymphoma, and the like, and preferably gastric cancer.

In the present invention, to find out that the new function of ADAM33, which is known to be related to asthma, is involved in the proliferation and metastasis of gastric cancer by participating in the secretion of IL-18. The effect of ADAM33 inhibition on the proliferation and metastasis of gastric cancer was confirmed. Previous studies have shown that IL-18 is secreted out of cells after the pro-domain has been cut by caspase-1. It is known to have a very high effect on the mechanism of metastasis, immune evasion. In light of this, inhibition of ADAM33 activity inhibits the progression of gastric cancer by reducing IL-18 secretion. As such, the involvement of ADAM33 in the secretion of IL-18 was first discovered by the present inventors, and the discovery of a new mechanism that regulates the secretion process of IL-18 is a method of inhibiting various biological functions of IL-18 in cancer cells. In addition to the proliferation and metastasis of gastric cancer, it is expected to be the cornerstone of mechanism research that inhibits many other factors that induce cancer progression.

In one embodiment of the present invention, it was confirmed that the expression of ADAM33 is significantly increased when VEGF-D is treated to increase the metastasis of gastric cancer, and that the expression of ADAM33 affects the migration, invasion and metastasis of gastric cancer cells. I could confirm that.

In another embodiment of the present invention, the siRNA transformation technique was used to inhibit the expression of ADAM33 in order to inhibit the biological function of ADAM33, and the resulting change reduced the secretion capacity of IL-18 and the ability of gastric cancer cells to migrate. I could confirm that.

In another embodiment of the present invention by using the siRNA transformation technique transformed gastric cancer cells suppressed ADAM33 expression in the mouse to determine their proliferation and metastasis, when the ADAM33 expression is suppressed the growth of gastric cancer It was found that the metastasis was significantly reduced.

Accordingly, the present invention provides a pharmaceutical composition for preventing and treating cancer comprising ADAM33 expression inhibiting substance as an active ingredient.

The pharmaceutical compositions according to the invention may comprise a pharmaceutically effective amount of a substance of the invention alone or may comprise one or more pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically effective amount” refers to an amount that exhibits a higher response than a negative control, and preferably an amount sufficient to treat or prevent cancer.

Pharmaceutically effective amounts of the substances according to the invention are 0.0001 to 100 mg / day / kg body weight, preferably 0.01 to 1 mg / day / kg body weight. However, the pharmaceutically effective amount may be appropriately changed depending on various factors such as the disease and its severity, the patient's age, weight, health condition, sex, route of administration and duration of treatment.

As used herein, "pharmaceutically acceptable" is a non-toxic composition that, when administered physiologically to humans, does not inhibit the action of the active ingredient and typically does not cause an allergic reaction such as gastrointestinal disorders, dizziness, or the like. Say Such carriers include all kinds of solvents, dispersion media, oil-in-water or water-in-oil emulsions, aqueous compositions, liposomes, microbeads and microsomes.

On the other hand, the pharmaceutical composition according to the present invention can be formulated with a suitable carrier depending on the route of administration. The route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but may be administered orally or parenterally. Parenteral routes of administration include, for example, several routes such as transdermal, nasal, abdominal, muscle, subcutaneous or intravenous.

In the case of oral administration of the pharmaceutical composition of the present invention, the pharmaceutical composition of the present invention is prepared in powder, granule, tablet, pill, dragee, capsule, liquid, gel according to a method known in the art together with a suitable oral carrier. , Syrups, suspensions, wafers and the like. Examples of suitable carriers include sugars, including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol and starch, cellulose, starch including corn starch, wheat starch, rice starch and potato starch, and the like. Fillers such as cellulose, gelatin, polyvinylpyrrolidone, and the like, including methyl cellulose, sodium carboxymethylcellulose, hydroxypropylmethyl-cellulose, and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate and the like may optionally be added as a disintegrant. Furthermore, the pharmaceutical composition may further include an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, and a preservative.

In addition, when administered parenterally, the pharmaceutical compositions of the present invention may be formulated according to methods known in the art in the form of injections, transdermal and nasal inhalants together with suitable parenteral carriers. Such injections must be sterile and protected from contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media comprising water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycols, etc.), mixtures thereof and / or vegetable oils Can be. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanol amine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be further included. In addition, the injection may in most cases further comprise an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administrations, ointments, creams, lotions, gels, external preparations, pasta preparations, linen preparations, air rolls and the like are included. As used herein, "transdermal administration" means that the pharmaceutical composition is topically administered to the skin such that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975, Mack Publishing Company, Easton, Pennsylvania, a prescription generally known in pharmaceutical chemistry.

In the case of inhaled dosages, the compounds used according to the invention may be pressurized packs or by means of suitable propellants, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be delivered conveniently from the nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or blowers can be formulated to contain a mixture of the compound and a suitable powder base such as lactose or starch.

Other pharmaceutically acceptable carriers may be referred to those described in the following documents (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

In addition, the pharmaceutical compositions according to the invention may comprise one or more buffers (e.g. saline or PBS), carbohydrates (e.g. glucose, mannose, sucrose or dextran), antioxidants, bacteriostatic agents, chelating agents (Eg, EDTA or glutathione), adjuvants (eg, aluminum hydroxide), suspending agents, thickening agents, and / or preservatives.

In addition, the pharmaceutical compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

In addition, the pharmaceutical composition of the present invention can be administered in combination with a known compound having the effect of treating cancer. The known compound may be used without limitation as long as it is a known anticancer agent, but preferably iodoin ( ¹³¹ I), paclitaxel, doxorubicin, vincristine, daunorubicin, vinblastine, liquid Such as actinomycin-D, docetaxel, etoposide, teniposide, bisantrene, homoharringtonine, Gleevec (STI-571) It may be an anticancer agent.

On the other hand, since it is possible to reduce the secretion of IL-18 by inhibiting the intracellular activity of ADAM33, the present invention provides a pharmaceutical composition for preventing and treating cancer comprising ADAM33 activity inhibitor as an active ingredient, for such a composition What has been described above may likewise be applied.

Preferably, the ADAM33 activity inhibitor in the present invention may be a neutralizing antibody to ADAM33 or a commercial metalloprotease inhibitor.

In addition, the present invention provides an siRNA that suppresses the expression of ADAM33, wherein the siRNA may preferably have a nucleotide sequence of SEQ ID NO: 2 to SEQ ID NO: 5.

The pharmaceutical composition of the present invention has the effect of inhibiting the expression of ADAM33 to reduce the secretion of IL-18, thereby inhibiting the proliferation and metastasis of gastric cancer cells. Therefore, the pharmaceutical composition of the present invention can be used for the purpose of preventing and treating cancer.

Below. The present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

<Example 1>

Increased Mobility of Gastric Cancer Cells by VEGF-D

To investigate whether VEGF-D (vascular endothelial growth factor-D) affects cancer cell metastasis, gastric cancer cells (SNU-601, Korea Cell Line Bank) were used to express VEGF-D by concentration (25ng / ml, 50ng / ml, 100 ng / ml) after 48 hours of treatment each, the migration capacity of gastric cancer cells was compared. As a control group, a group not treated with VEGF-D was used.

Mobility was measured through a migration assay based on the Boyden chamber technique. In other words, 600 μl of medium (RPMI1640, Gibco) containing 1% FBS (fetal bovine serum) was placed in a 24 well plate (lower chamber), and a membrane (insert, upper chamber) to which a membrane was attached was inserted. Serum-free medium was added and 5 x 10 ⁴ cells were each dispensed. After 24 hours, the cells adhered to the membrane after passing through 8 μm pores were observed using an optical microscope. The cells were dissolved in 10% acetic acid, and the OD value at a wavelength of 570 nm was measured using an ELISA reader. Was measured.

As a result, as shown in Figure 1, the number of cells attached to the membrane after passing the hole in the group treated with 50ng / ml VEGF-D (VEGF-D 50ng / ml) compared to the control (control) (See FIG. 1A), the treatment of VEGF-D was found to increase the mobility of gastric cancer cells compared to the control group (see FIG. 1B). In particular, when VEGF-D was added at 50ng / ml, it was found that the mobility of gastric cancer cells increased more than two times.

<Example 2>

Increased expression of ADAM33 by VEGF-D

In order to confirm whether the increase in gastric cancer cell migration ability by VEGF-D confirmed in Example 1 is related to ADAM33, the concentration of VEGF-D for each concentration (25ng / ml, 50ng / ml, 100ng / ml) for 3 hours After treatment, mRNA levels of untreated cells were compared and analyzed using RT-PCR and real time-PCR.

Briefly, after treatment with VEGF-D in SNU-601 cells, mRNA was isolated using trizole (invitrogen). cDNA was prepared according to the manufacturer's instructions using the cDNA kit (Intron, Korea), and then 94 ° C. for 5 minutes to amplify ADAM33 mRNA using 500ng of cDNA as a template; 30 times of 94 degreeC 30 second, 52 degreeC 1 minute, 72 degreeC 1 minute; And PCR was performed on condition of 72 degreeC and 5 minutes. PCR products were subjected to electrophoresis on 1.5% agarose gel to confirm the expression of ADAM33.

For real-time PCR, except that 40 times of 94 ℃ 20 seconds, 52 ℃ 20 seconds, 72 ℃ 20 seconds in the PCR amplification process was carried out in the same manner as the PCR conditions, and then β-actin based on the obtained values Relative ADAM33 expression was quantified compared to the amount of (β-actin). The ADAM33 primer sequences used in PCR are as follows: sense (tcccccattctgtgtgtgtc, SEQ ID NO: 8), antisense (ttcagcctcctgagcagcta, SEQ ID NO: 9)

As a result, as shown in Figure 2, it was found that the expression of ADAM33 is significantly increased by the treatment of VEGF-D.

<Example 3>

Reduced IL-18 Secretion by ADAM33 siRNA Transformation

<3-1> Construction of transformation vector

Based on the sequence of ADAM33 (Genbank Accession No. NM_025220), two kinds of siRNA sequences were determined, respectively, and ADAM33 siRNA # 1 (sense: CAA ACA GCG UCU CCU GGA ATT (SEQ ID NO: 2), antisense: UUC CAG GAG ACG CUG UUU) GTT (SEQ ID NO: 3)) and ADAM33 siRNA # 2 (sense: GGA CUC UAC CGU UCA CCU ATT (SEQ ID NO: 4), antisense: UAG GUG AAC GGU AGA GUC CTT (SEQ ID NO: 5)).

In addition, siRNA consisting of irrelevant nucleotide sequences that do not affect the expression of ADAM33 were negative (-) siRNA (sense: CUU ACG CUG AGU ACU UCG ATT (SEQ ID NO: 6), antisense: UCG AAG UAC UCA GCG UAA GTT (SEQ ID NO: 6) Number 7)).

Each oligomer was synthesized by a base sequence synthesis company (Samchully Pharmaceutical) according to the sequence information described above.

<3-2> SiRNA Introduction of

Each siRNA prepared in Example <3-1> was introduced into SNU-601 cells, which are gastric cancer cell lines, by lipofection using a commercial kit as follows. To explain this in detail, 6 μl of a reagent composed of lipid was uniformly solved in 0.4 ml of serum-free medium (Opti-MEM, Gibco), and 100ng of siRNA was added thereto. It was left to incubate for 30 minutes to allow liposomes to form. The liposomes formed were diluted in 1.6 ml of serum-free medium (Opti-MEM) and then incubated with the cells for 4 hours to allow siRNAs in the liposomes to be introduced into the cells. The transformed cells were incubated for 24 hours in RPMI1640 medium containing 10% of FBS to stabilize the cells.

<3-3> IL -18 ( interleukin Secretion of -18)

Each cell culture solution in Example <3-2> was obtained and then centrifuged to obtain only the supernatant. As a sample, ELISA and western blot were performed as follows.

ELISA dispensed 100 μl of each cell culture into a plate coated with IL-18 antibody. After 3 hours at room temperature (incubation) biotin-attached IL-18 antibody (MBL, USA) was added. After 1 hour, the reaction was terminated and each well was washed and then streptavidin-HRP (streptavidin-Horse Radish Peroxidse, R & D systems, USA) was added. After 1 hour, the TMB solution (Sigma) was added and reacted for 30 minutes in a 37 ℃ incubator and the color development was measured by the ELISA reader (reader) at a wavelength of 450nm.

Western blot lysed each cell and separated and quantified the protein. 50 μg of protein was electrophoresed on an SDS-PAGE gel, separated by size, and transferred to a PVDF membrane. It was combined with IL-18 antibody followed by washing and binding again by addition of biotin bound anti-IL-18 antibody. After washing this, streptavidin-HRP was added again to check each band.

As a result, as shown in Figure 3, the secretion of IL-18 in the culture medium was measured, it was found that the secretion of IL-18 by ADAM33 siRNA transformation. In addition, as shown in Figure 4, the pro-form of IL-18 in the cell (pro-form) of 24 kDa IL-18 is increased by the transformation, it can be seen that the active 18 kDa IL-18 is reduced there was. Taken together, the secretion of IL-18 is reduced by ADAM33 siRNA transformation, and precursors accumulate in the cells, suggesting that ADAM33 induces the pro-domain of IL-18 to release the secretory process. It was found to adjust.

< Example  4>

ADAM33 siRNA  Reduction of gastric cancer migration ability by transformation

Each transformed cell transformed in Example 3 was used to compare the migration capacity of gastric cancer cells when ADAM33 was inhibited. Measurement of the mobility was measured in the same manner as in Example 1.

As a result, as shown in Figure 5, when the control capacity of gastric cancer cells of the control group to 100, the cells transformed with siRNA of ADAM33 shows the value of 40 and 54, respectively, the ability of gastric cancer cells to inhibit ADAM33 expression You can see that this decreases by about half.

As described above, the pharmaceutical composition of the present invention inhibits the expression of ADAM33 and reduces the secretion of IL-18, thereby having the effect of inhibiting the proliferation and metastasis of gastric cancer cells. Therefore, the pharmaceutical composition of the present invention can be used for the purpose of preventing and treating cancer.

Figure 1 is a result of quantifying the mobility of the cancer cell by the VEGF-D gastric cancer cell ability and concentration by concentration (B).

Figure 2 is a result of confirming that the expression of ADAM33 by VEGF-D is increased (A) and quantified it (B).

Figure 3 shows the IL-18 secretion reduction by ADAM33 siRNA transformation.

Figure 4 shows the results confirmed by Western blot expression of IL-18 and ADAM33 by ADAM33 siRNA transformation.

Figure 5 is a result showing a decrease in gastric cancer migration ability by ADAM33 siRNA transformation.

<110> Sookmyung University Corporate-industry Relations Foundation          Samsung life welfare foundation <120> ADAM33 controlling the secretion of interleukin-18 and use          about <130> NP07-0078 <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 3554 <212> DNA <213> Homo sapiens <400> 1 gctgcaccgg gcacgggtcg gccgcaatcc agcctgggcg gagccggagt tgcgagccgc 60 tgcctagagg ccgaggagct cacagctatg ggctggaggc cccggagagc tcgggggacc 120 ccgttgctgc tgctgctact actgctgctg ctctggccag tgccaggcgc cggggtgctt 180 caaggacata tccctgggca gccagtcacc ccgcactggg tcctggatgg acaaccctgg 240 cgcaccgtca gcctggagga gccggtctcg aagccagaca tggggctggt ggccctggag 300 gctgaaggcc aggagctcct gcttgagctg gagaagaacc acaggctgct ggccccagga 360 tacatagaaa cccactacgg cccagatggg cagccagtgg tgctggcccc caaccacacg 420 actaccaagg gcgagtaagg ggcttccccg actcctgggt agtcctctgc acctgctctg 480 ggatgagtgg cctgatcacc ctcagcagga atgccagcta ttatctgcgt ccctggccac 540 cccggggctc caaggacttc tcaacccacg agatctttcg gatggagcag ctgctcacct 600 ggaaaggaac ctgtggccac agggatcctg ggaacaaagc gggcatgacc agccttcctg 660 gtggtcccca gagcaggggc aggcgagaag cgcgcaggac ccggaagtac ctggaactgt 720 acattgtggc agaccacacc ctgttcttga ctcggcaccg aaacttgaac agcgtctcct 780 ggaagtcgcc aactacgtgg accagcttct caggactctg gacattcagg tggcgctgac 840 cggcctggag gtgtggaccg agcgggaccg cagccgcgtc acgcaggacg ccaacgccac 900 gctctgggcc ttcctgcagt ggcgccgggg gctgtgggcg cagcggcccc acgactccgc 960 gcagctgctc acgggccgcg ccttccaggg cgccacagtg ggcctggcgc ccgtcgaggg 1020 catgtgccgc gccgagagct cgggaggcgt gagcacggac cactcggagc tccccatcgg 1080 cgccgcagcc accatggccc atgagatcgg ccacagcctc ggcctcagcc acgaccccga 1140 cggctgctgc gtggaggctg cggccgagtc cggaggctgc cggccaccgg gcacccgttt 1200 ccgcgcgtgt tcagcgcctg cagccgccgc cagctgcgcg ccttcttccg caaggggggc 1260 ggcgcttgcc tctccaatgc cccggacccc ggactcccgg tgccgccggc gctctgcggg 1320 aacggcttcg tggaagcggg cgaggagtgt gactgcggcc ctggccagga gtgccgcgac 1380 ctctgctgct ttgctcacaa ctgctcgctg cgcccggggg cccagtgcgc ccacggggac 1440 tgctgcgtgc gctgcctgct gaagccggct gccgccaggc catgggtgac tgtgacctcc 1500 ctgagttttg cacgggcacc tcctcccact gtcccccaga cgtttaccta ctggacggct 1560 caccctgtgc caggggcagt ggctactgct gggatggcgc atgtcccacg ctggagcagc 1620 agtgccagca gctctggggg cctggctccc acccagctcc cgaggcctgt ttccaggtgg 1680 tgaactctgc gggagatgct catggaaact gcggccagga cagcgagggc cacttcctgc 1740 cctgtgcagg gagggatgcc ctgtgtggga agctgcagtg ccagggtgga aagcccagcc 1800 tgctcgcacc gcacatggtg ccagtggact ctaccgttca cctagatggc caggaagtga 1860 cttgtcgggg agccttggca ctccccagtg cccagctgga cctgcttggc ctgggcctgg 1920 tagagccagg cacccagtgt ggacctagaa tggtgtgcca gagcaggcgc tgcaggaaga 1980 atgccttcca ggagcttcag cgctgcctga ctgcctgcca cagccacggg gtttgcaata 2040 gcaaccataa ctgccactgt gctccaggct gggctccacc cttctgtgac aagccaggct 2100 ttggtggcag catggacagt ggccctgtgc aggctgaaaa ccatgacacc ttcctgctgg 2160 ccatgctcct cagcgtcctg ctgcctctgc tcccaggggc cggcctggcc tggtgttgct 2220 accgactccc aggagcccat ctgcagcgat gcagctgggg ctgcagaagg gaccctgcgt 2280 gcagtggccc caaagatggc ccacacaggg accaccccct gggcggcgtt caccccatgg 2340 agttgggccc cacagccact ggacagccct ggcccctgga ccctgagaac tctcatgagc 2400 ccagcagcca ccctgagaag cctctgccag cagtctcgcc tgacccccaa gcagatcaag 2460 tccagatgcc aagatcctgc ctctggtgag aggtagctcc taaaatgaac agatttaaag 2520 acaggtggcc actgacagcc actccaggaa cttgaactgc aggggcagag ccagtgaatc 2580 accggacctc cagcacctgc aggcagcttg gaagtttctt ccccgagtgg agcttcgacc 2640 cacccactcc aggaacccag agccacatta gaagttcctg agggctggag aacactgctg 2700 ggcacactct ccagctcaat aaaccatcag tcccagaagc aaaggtcaca cagcccctga 2760 cctccctcac cagtggaggc tgggtagtgc tggccatccc aaaagggctc tgtcctggga 2820 gtctggtgtg tctcctacat gcaatttcca cggacccagc tctgtggagg gcatgactgc 2880 tggccagaag ctagtggtcc tggggcccta tggttcgact gagtccacac tcccctggag 2940 cctggctggc ctctgcaaac aaacataatt ttggggacct tccttcctgt ttcttcccac 3000 cctgtcttct cccctaggtg gttcctgagc ccccaccccc aatcccagtg ctacacctga 3060 ggttctggag ctcagaatct gacagcctct cccccattct gtgtgtgtcg gggggacaga 3120 gggaaccatt taagaaaaga taccaaagta gaagtcaaaa gaaagacatg ttggctatag 3180 gcgtggtggc tcatgcctat aatcccagca ctttgggaag ccggggtagg aggatcacca 3240 gaggccagca ggtccacacc agcctgggca acacagcaag acaccgcatc tacagaaaaa 3300 ttttaaaatt agctgggcgt ggtggtgtgt acctgtaggc ctagctgctc aggaggctga 3360 agcaggagga tcacttgagc ctgagttcaa cactgcagtg agctatggtg gcaccactgc 3420 actccagcct gggtgacaga gcaagaccct gtctctaaaa taaattttaa aaagacataa 3480 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 3540 aaaaaaaaaa aaaa 3554 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ADAM33 siRNA # 1 sense <220> <221> variation (222) (20) .. (21) <223> 20th uracil base and 21th uracil base are thymine base,          respectively <400> 2 caaacagcgu cuccuggaau u 21 <210> 3 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ADAM33 siRNA # 1 antisense <220> <221> variation (222) (20) .. (21) <223> 20th uracil base and 21th uracil base are thymine base,          respectively. <400> 3 uuccaggaga cgcuguuugu u 21 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ADAM33 siRNA # 2 sense <220> <221> variation (222) (20) .. (21) <223> 20th uracil base and 21th uracil base are thymine base,          respectively. <400> 4 ggacucuacc guucaccuau u 21 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ADAM33 siRNA # 2 antisense <400> 5 uaggugaacg guagaguccu u 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> control siRNA sense <220> <221> variation (222) (20) .. (21) <223> 20th uracil base and 21th uracil base are thymine base,          respectively. <400> 6 cuuacgcuga guacuucgau u 21 <210> 7 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> control siRNA antisense <220> <221> variation (222) (20) .. (21) <223> 20th uracil base and 21th uracil base are thymine base,          respectively. <400> 7 ucgaaguacu cagcguaagu u 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADAM33 PCR sense primer <400> 8 caggaatgcc agctattatc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADAM33 PCR antisense primer <400> 9 gtttggtgtg gttcaagttt 20  

Claims (9)

A pharmaceutical composition for preventing and treating cancer, comprising an ADAM33 expression inhibiting substance as an active ingredient. The composition of claim 1, wherein ADAM33 is represented by SEQ ID NO: 1. The composition of claim 1, wherein the ADAM33 expression inhibitory substance is siRNA for ADAM33 or shRNA for ADAM33. The composition of claim 3, wherein the siRNA has any one nucleotide sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 5. According to claim 1, wherein the cancer is stomach cancer, colon cancer, lung cancer, liver cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, chorionic cancer, ovarian cancer, breast cancer, thyroid cancer , Brain cancer, head and neck cancer, malignant melanoma, lymphoma, characterized in that the composition is selected from the group consisting of. A pharmaceutical composition for preventing and treating cancer, comprising an ADAM33 activity inhibitor as an active ingredient. The composition of claim 6, wherein the ADAM33 activity inhibitor is an ADAM33 neutralizing antibody or a metalloprotease inhibitor. According to claim 6, wherein the cancer is stomach cancer, colon cancer, lung cancer, liver cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, chorionic cancer, ovarian cancer, breast cancer, thyroid cancer , Brain cancer, head and neck cancer, malignant melanoma, lymphoma, characterized in that the composition is selected from the group consisting of. SiRNA for the ADAM33 gene consisting of any one sequence selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 5.

Images