KR20090005880A - Marker genes based on thalidomide treatment for screening of drug inducing teratogenicity and screening method using thereof - Google Patents

Abstract

A marker gene, a DNA microarray chip for screening the teratogenecity inducing drugs, and a method for screening the teratogenecity inducing drugs by using the chip are provided to the drugs inducing teratogenecity to be screened effectively. A marker gene is used to screen the teratogenecity inducing drugs and comprises the gene selected from Genebank NM_032199 [AT rich interactive domain 5B (MRF1-like)], Genebank BX647857 [Ankyrin repeat and SOCS box-containing 5], Genebank NM_013314 [B-cell linker], Genebank AB018258 [ATPase, Class V, type 10B], Genebank BX111592 [Transcribed locus], etc.

Description

Marker genes based on Thalidomide treatment for screening of drug inducing teratogenicity and screening method using according to thalidomide treatment

The present invention relates to a marker gene for teratogenic drug search and a search method using the same, and more particularly, to a marker gene in which gene expression is increased or decreased by thalidomide, a teratogenic drug, and a method for searching for teratogenic drug using the same. .

Although it has recently been used for the treatment of rare diseases such as multiple severe aphthous ulcers, chronic lupus, leprosy nodule, and chronic host antagonism, the most well-known feature of thalidomide causes fetal limb malformations, heart, genital, kidney, and digestive organs. It is known to cause neurological disorders, eye and ear malformations and serious side effects in addition to adverse effects on the fetus. It has been used as a sleeping sedative or sedative for almost four years in the early European market, and it is effective for morning sickness of pregnant women, which has been used by many pregnant women. However, these side effects have been carefully prescribed as an anticancer agent because they have a therapeutic effect on multiple myeloma and the like that do not have an effect on chemotherapy.

The mechanism of thalidomide has been discussed in various ways, including the nervous system, early kidney, angiogenesis, and oxidative stress.

Thalidomide specifically binds to the GC promoter position. It binds to a number of GC boxes (GGGCGG) at the promoter sites of IGF-1 and FGF-2, genes related to angiogenesis, and reduces transcriptional efficiency. This interferes with angiogenesis and causes malformations of the limbs. In addition, the kidneys in the early stages of development induce cartilage formation to help the formation of limb tissues. Thalidomide binds to the body and interferes with the induction of cartilage (James and Lauri, Developmental). Biology 28 (1); 61-70 1972). In addition, it has been reported to affect the differentiation of cells derived from the neural crest (McCredie, Journal of the Neurological Sciences 28 (3): 373-387 1976), have been reported to induce ROS and disrupt angiogenesis in rodent embryonic stem cells ( Am J Pathol , 156 (1): 151-158, 2000).

Several genome sequencing projects, including six mammals and 292 microbes, have been completed and reported to the National Center for Biotechnology Information (NCBI). Genome-wide expression studies are being conducted to study the function of genes based on the vast amount of data obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment (Schena, M., et. al ., Proc . Natl . Acad . Sci. USA 93: 10614-10619, 1996).

Microarrays integrate a set of oligonucleotides of complementary DNA (cDNA) or 20-25 base pairs in length on glass. cDNA microarrays are produced by labs in schools or by companies such as Agilent and Genomic Solutions, either mechanically immobilizing cDNA collections on a chip or using ink jetting (Sellheyer, K and Belbin, TJ, J. Am). . Acad Dermatol 51:.. 681-692 , 2004). Oligonucleotide microarrays are made by Affymetrix using a photolithography method directly on the chip, and Agillent et al. Are produced by immobilizing synthesized oligonucleotides (Sellheyer, K. and Belbin). , TJ, J. Am . Acad . Dermatol . 51: 681-692, 2004).

To analyze gene expression, RNA is obtained from samples such as tissues and hybridized with oligonucleotides in DNA microarrays. The obtained RNA is labeled with fluorescence or isotope and converted to cDNA. Oligo microarrays are mainly labeled with two different fluorescences (e.g., Cye3 and Cye5) to perform hybridization reactions on the same chip at the same time. . Gene expression is determined by the ratio of the two fluorescence intensities (Somasundaram, K., et al ., Genomics Proteomics I: 1-10, 2002).

Combined with recent research on toxic genomics (Toxicogenomics), an advanced technique using DNA microarray technology, expression patterns of genes expressed in specific tissues or cell lines by all chemicals as well as drug and new drug candidates in high throughput And quantitative analysis are now possible. Accordingly, by analyzing the frequency of expression of specific genes in specific cells, it is possible to discover genes related to side effects of drugs, and through this, we will understand the molecular mechanisms according to the actions and side effects of drugs, Search and diagnosis of the material will be possible.

Therefore, the present inventors observed and analyzed the gene expression profile by thalidomide treatment, a representative drug causing teratogenicity, as an anticancer agent using oligomicroarray in which 41,000 human genes were accumulated, in the JEG-3 cell line of human placental choriocarcinoma cells. By detecting genes overexpressed or underexpressed by thalidomide and confirming expression of the genes by real-time quantitative RT-PCR method, a marker gene capable of detecting a teratogenic drug and a search method using the same The present invention has been completed.

An object of the present invention is to provide a marker gene overexpressed or underexpressed by a teratogenic drug and a method for searching for a teratogenic drug using the marker gene.

In order to achieve the above object, the present invention provides a marker gene for teratogenic drug search, characterized in that the expression changes in human placental choriocarcinoma cells stimulated by thalidomide which is a teratogenic drug.

The present invention also provides a DNA microarray chip for teratogenicity-induced drug search in which an oligonucleotide or its complementary strand molecule containing all or part of the marker gene sequence is integrated.

The present invention also provides a method for teratogenic drug search using the marker gene.

In addition, the present invention provides a teratogenic drug search kit comprising the DNA microarray chip.

Hereinafter, the present invention will be described in detail.

The present invention provides a marker gene for teratogenic drug search, characterized in that the expression changes in human placental chorionic cancer cells stimulated by thalidomide, a teratogenic drug.

The marker gene is composed of genes related to apoptosis, pregnancy, angiogenesis, and morphogenesis.

The present invention provides a marker gene, characterized in that selected from the group consisting of: Genebank (Genebank) NM_032199 [AT rich interactive domain 5B (MRF1-like)], Genebank (Genebank) BX647857 [Ankyrin repeat and SOCS box-containing 5], Genebank AB018258 [ATPase, Class V, type 10B], Genebank NM_013314 [B-cell linker], Genebank BX111592 [Transcribed locus ], Genebank AK000652 [Chromosome 20 open reading frame 57], Genebank NM_203403 [Chromosome 9 open reading frame 150], Genebank AF239668 [Cholecystokinin B receptor], Gene accession number (Genebank) AY268104 [Carboxylesterase 1 (monocyte / macrophage serine esterase 1)], gene registration number (Genebank) NM_000735 [Glycoprotein hormones, alpha polypeptide], gene registration number (Genebank) BC067746 [C-type lectin domain family 1, member A ], Genebank CR749536 [C-type lectin domain family 7, member A], Genebank AL136922 [ClpX caseinolytic peptidase X homolog (E. coli)], Genebank NM_001874 [ Carboxypeptidase M], Genebank CR598482 [Chymotrypsin-like], Gene Registration Number (Genebank) NM_031226 [Cytochrome P450, family 19, subfamily A, polypeptide 1], Gene Registration Number (Genebank) NM_214462 [Dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)], gene accession number (Genebank) AF177395 [Dickkopf homolog 2 (Xenopus laevis)], gene accession number (Genebank) AL832598 [Erythrocyte membrane protein band 4.1-like 3], gene registration number Genebank BX092581 [Developmental pluripotency associated 5], Gene Registration Number (Genebank) BC064700 [Estrogen-related receptor gamma], Gene Registration Number (Genebank) AF075292 [Fibroblast growth factor 18], Gene Registration Number (Genebank) NM_005971 [FXYD domain containing ion tra nsport regulator 3], Genebank NM_000162 [Glucokinase (hexokinase 4, maturity onset diabetes of the young 2)], Genebank AB209105 [Huntingtin-associated protein 1 (neuroan 1)], Gene accession number Genebank AK057515 [CDNA FLJ32953 fis, clone TESTI2008099], Genebank AJ556711 [Immunoglobulin gamma heavy chain variable region (IGHV3-30.3 gene), clone 2B 3G 02], Genebank R63061 [Keratin 23 (histone deacetylase inducible)], Genebank NM_007360 [Killer cell lectin-like receptor subfamily K, member 1], Genebank NM_007015 [Leukocyte cell derived chemotaxin 1], Gene accession number (Genebank) BC013438 [Hypothetical gene supported by BC013438], Genebank NM_138703 [Melanoma antigen family E, 2], Gene Accession Number (Genebank) AJ007798 [Stromal antigen 3], Gene Accession Number (Genebank) AK096306 [Hypothetical protein MGC3032], Genebank (Genebank) NM_003681 [Pyridoxal (pyridoxine, vitamin B6) kinase], Gene Registration Number (Genebank) CR606430 [Pregnancy specific beta-1-glycoprotein 11], Genebank (Genebank) BC025767 [Rhophilin, Rho GTPase binding protein 1], gene registration number (Genebank) AB007937 [Syndecan 3], gene registration number (Genebank) NM_022367 [Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A], gene registration Number (Genebank) BX649005 [Serum / glucocorticoid regulated kinase], gene registration number (Genebank) BC063830 [ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2 , 6-sialyltransferase 1], Genebank NM_013356 [Solute carrier family 16, member 8 (monocarboxylic acid transporter 3)], Genebank NM_014585 [Solute carrier family 40 (iron-regulated transporter), member 1], Genebank BX648244 [Spermatogenesis associated 13], Genebank AK056709 [Thrombospondin, type I, domain containing 3], Gene accession number (Genebank) AY728143 [Transmembrane protein 16A], Genebank BC052977 [Tumor necrosis factor receptor superfamily, member 1B], Genebank AK023755 [Triggering receptor expressed on myeloid cells-like 2], Genebank NM_016113 [Transient receptor potential cation channel, subfamily V, member 2], Genebank (Kenebank) AK122757 [Tubulin, beta 3], gene registration number (GEO) A_23_P124177, gene registration number (GEO) A_23_P210297, gene registration number (Genebank) NM_003387 [WAS / WASL interacting protein family, member 1], gene registration number (Genebank) M23575 [ Pregnancy specific beta-1-glycoprotein 3], Genebank NM_002632 [Placental growth factor, vascular endothelial growth factor-related protein], Genebank AK096580 [CDNA FLJ39261 fis, clone O CBBF2009391], Genebank CD388102 [Similar to Placental tissue protein 13 (Placenta protein 13) (Galectin-13)], Genebank NM_002288 [Leukocyte-associated Ig-like receptor 2], Gene registration number (Genebank) AB002308 [KIAA0310], Genebank AL136646 [Rho GTPase activating protein 24], Genebank AB208809 [Solute carrier family 13 (sodium / sulfate symporters), member 4], Gene accession number ( Genebank) NM_004454 [Ets variant gene 5 (ets-related molecule)], Genebank AB075819 [ATPase, Class I, type 8B, member 4], Genebank NM_004235 [Kruppel-like factor 4 ( gut)], Genebank AF450487 [Kinesin family member 21A], Genebank AK075130 [G protein-coupled receptor 1], Genebank CR601901 [Insulin-like 4 (placenta)] , Genebank NM_022482 [Zinc finger protein 336], genes, etc. Genebank D90070 [Phorbol-12-myristate-13-acetate-induced protein 1], Gene Registration Number (Genebank) X97758 [Rho family GTPase 3], Gene Registration Number (Genebank) BC068585 [HERV-FRD provirus ancestral Env polyprotein], Genebank NM_000494 [Collagen, type XVII, alpha 1], Genebank NM_001005325 [Olfactory receptor, family 6, subfamily M, member 1], Genebank NM_004419 [ Dual specificity phosphatase 5], Genebank R45075 [Transcribed locus, weakly similar to XP_219319.3 PREDICTED: similar to deleted in malignant brain tumors 1 [Rattus norvegicus]], Genebank BX649112 [COBL-like 1], Genebank AI939596 [Transcribed locus], Genebank NM_004561 [Ovo-like 1 (Drosophila)], Genebank BG571732 [S100 calcium binding protein P], Gene accession number (Genebank) BX537382 [Solute carrier family 38, member 3] , Gene registration number (Genebank) CR749205 [DKFZP686A01247 hypothetical protein], gene registration number (Genebank) AK056776 [Hypothetical protein FLJ32214], gene registration number (Genebank) M57609 [GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)], gene registration Genebank BX386171 [Chorionic gonadotropin, beta polypeptide 8], Gene registration number (Genebank) BC063127 [Pregnancy specific beta-1-glycoprotein 4], Gene accession number (Genebank) BX648582 [Sprouty homolog 2 (Drosophila)], Gene registration Number (Genebank) NM_016569 [T-box 3 (ulnar mammary syndrome)], gene registration number (Genebank) NM_014365 [Heat shock 22kDa protein 8], gene registration number (Genebank) AF056434 [CDNA FLJ12815 fis, clone NT2RP2002546], gene registration Number (Genebank) NM_002182 [Interleukin 1 receptor accessory protein], gene registration number (Genebank) NM_004570 [Phosphoinositide-3-kinase, class 2, gamma polypeptide], gene registration number (Genebank) AK128505 [Keratin 7], Genebank AI074002 [Transcribed locus, strongly similar to NP_083546.1 Rho GTPase activating protein 24 isoform 1 [Mus musculus]], Genebank AK095632 [Ankyrin repeat and BTB (POZ) domain containing 2], Genebank No. NM_002356 Myristoylated alanine-rich protein kinase C substrate, Genebank BC042755 [Regulator of G-protein signaling 2, 24kDa], Genebank NM_033393 [KIAA1727 protein], Gene Genebank BC005839 [Follistatin-like 3 (secreted glycoprotein)], Gene accession number (Genebank) NM_031246 [Pregnancy specific beta-1-glycoprotein 2], Gene accession number (Genebank) AY358486 [Plexin domain containing 2], gene Registration Number (Genebank) BM715650 [MRNA; cDNA DKFZp313O2015 (from clone DKFZp313O2015)], gene registration number (Genebank) NM_004155 [Serpin peptidase inhibitor, clade B (ovalbumin), member 9], gene registration number (Genebank) BC037275 [Tudor domain containing 4], gene registration number (Genebank) ) NM_001848 [Collagen, type VI, alpha 1], Genebank Y18483 [Solute carrier family 7 (cationic amino acid transporter, y + system), member 8], Genebank NM_004120 [Guanylate binding protein 2 , interferon-inducible], genebank BM923753 [Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in)], genebank AK075446 [26 serine protease], genebank (Genebank) NM_005668 [ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4], Genebank NM_001031802 [Similar to hypothetical testis protein from macaque], Genebank NM_016354 [Solute carrier organic anion transporter family , member 4A1], Genebank BC036846 [Protease, serine, 33], Genebank XM_371015 [Ubiquitin specific peptidase 43], Genebank NM_014590 [Endogenous retroviral family W, env (C7) , member 1 (syncytin)], Genebank AK097398 [Nucleobindin 2], Genebank NM_173675 [Hypothetical protein FLJ33708], Genebank NM_005975 [PTK6 protein tyrosine kinase 6], Gene registration Number (Genebank) AK021606 [CDNA FLJ11544 fis, clone HEMBA1002826], gene registration number (Genebank) NM_005935 [AF4 / FMR2 family, member 1], gene registration number (Genebank) NM_212482 [Fibronectin 1], gene registration number (Genebank) NM_001753 [Caveolin 1, caveolae protein, 22kDa], Genebank BX537968 [Hypothetical LOC51149], Genebank NM_181659 [Nuclear receptor coactivator 3], Genebank BX111520 [Transcribed locus], Gene registration time (Genebank) CR749722 [RAS p21 protein activator (GTPase activating protein) 1], the gene registered number (Genebank) AK128870 [Synapse defective 1, Rho GTPase, homolog 1 (C. elegans)], Genebank NM_022153 [Chromosome 10 open reading frame 54], Gene Registration Number (TIGR) THC2301901 [Zinc finger CCCH-type containing 3], Genebank NM_015117 [Zinc finger CCCH-type containing 3], Genebank AF343078 [ATPase family, AAA domain containing 3B], Gene Registration Number (Genebank) D89974 [Vanin 2], Gene Registration Number (Genebank) NM_001006946 [Syndecan 1], Gene Registration Number (Genebank) ) AY055760 [Decay accelerating factor for complement (CD55, Cromer blood group system)], gene accession number (Genebank) AB016901 [Chromosome 6 open reading frame 123], gene accession number (Genebank) AK096355 [Myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)], Genebank NM_182898 [CAMP responsive element binding protein 5], Genebank BC036890 [Grainyhead-like 3 (Drosophila)], Gene accession number (Genebank) AK094505 [Cysteine conjug ate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)], genebank number (Genebank) AB007940 [RAB GTPase activating protein 1-like], genebank number (Genebank) CR936755 [Guanylate binding protein 3], genebank number (Genebank) NM_006291 [ Tumor necrosis factor, alpha-induced protein 2], Genebank NM_006778 [Tripartite motif-containing 10], Genebank NM_020809 [Rho GTPase activating protein 20], Genebank BQ186674 [Hypothetical gene supported by AF086204], Genebank NM_003966 [Sema domain, seven thrombospondin repeats (type 1 and type 1- like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A], gene registration number ( Genebank) BM810215 [Chorionic gonadotropin, beta polypeptide], Genebank NM_003167 [Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1], Gene accession number (Geneban k) NM_001620 [AHNAK nucleoprotein (desmoyokin)], gene accession number (Genebank) NM_004615 [Tetraspanin 7], gene accession number (Genebank) CR609484 [Kynureninase (L-kynurenine hydrolase)], gene accession number (Genebank) NM_014400 [LY6 / PLAUR domain containing 3], Genebank AB209845 [Transcription termination factor, RNA polymerase II], Genebank AK091125 [Hypothetical protein LOC162427], Genebank BX649103 [Chondroitin beta1,4 N- acetylgalactosaminyltransferase], Genebank AY217348 [Armadillo repeat containing 5], Genebank AK126079 [Zinc finger protein 692], Genebank AK096685 [Transforming growth factor, beta receptor associated protein 1], Genebank No. NM_198479 [Tetra-peptide repeat homeobox 1], Genebank No. AK127349 [Major histocompatibility complex, class I, C], Genebank No. AB02317 7 [KIAA0960 protein], Genebank AK126731 [Glucocorticoid induced transcript 1], Genebank NM_014619 [Glutamate receptor, ionotropic, kainate 4], Genebank R31293 [suppressor of cytokine signaling 2 ], Genebank AK055190 [Chromosome X open reading frame 36], Genebank (Genebank) BC038504 [SNF1-like kinase], Genebank (Genebank) NM_018018 [Solute carrier family 38, member 4], Genebank AK123704 [Similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162], Genebank BX647357 [Iduronate 2-sulfatase (Hunter syndrome)], Gene accession number (Genebank) NM_001343 [Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)], Genebank (Genebank) NM_001904 [Catenin (cadherin-associated protein), beta 1, 88kDa], Genebank CR599551 [EF-hand domain family, member D1], Genebank AK172837 [Organic solute transporter alpha], Gene registration Number (Genebank) BC027456 [Similar to interspersed repeat antigen, putative], Gene Registration Number (Genebank) NM_001025598 [Rho GTPase activating protein 30], Gene Registration Number (Genebank) NM_001003793 [RNA binding motif, single stranded interacting protein], Gene registration Number (Genebank) AB022718 [Chromosome 10 open reading frame 10], gene registration number (Genebank) NM_023915 [G protein-coupled receptor 87], gene registration number (Genebank) NM_006200 [Proprotein convertase subtilisin / kexin type 5], Genebank XM_496826 [NHS-like 1], Genebank AK124904 [FYVE, RhoGEF and PH domain containing 6], Genebank NM_006317 [Brain abundant, membrane attached signal protein 1], Genebank AL136861 [Cysteine-rich secretory protein LCCL domain containing 2], Genebank AK222648 [Calbindin 2, 29kDa (calretinin)], Genebank AK023628 [Hypothetical protein LOC199725], Gene Registration Number (Genebank) NM_006907 [Pyrroline-5-carboxylate reductase 1], Gene Registration Number (Genebank) CR622352 [Brain specific protein], Gene Registration Number (Genebank) BC030666 [Ring finger protein 182], Gene Registration Number (Genebank) BC053619 [Arrestin domain containing 3], Gene Registration Number (Genebank) NM_003670 [Basic helix-loop-helix domain containing, class B, 2], Gene Registration Number (Genebank) NM_005576 [Lysyl oxidase-like 1], Gene Registration Number (Genebank) AF217990 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, Genebank NM_182485 Cytoplasmic polyadenylation element binding protein 2, Genebank AK125877 [Hypothetical protein MGC27016] Number (Genebank) AK001879 [Hypothetical protein FLJ11017], gene registration number (Genebank) BG618056 [Transcribed locus], gene registration number (Genebank) AI741395 [MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)], Genebank AF291673 [Giant axonal neuropathy (gigaxonin)], Genebank AK056794 [Cytochrome P450, family 11, subfamily A, polypeptide 1], Genebank AF001893 [Trophoblast -derived noncoding RNA], Genebank NM_024342 [Glucocorticoid receptor DNA binding factor 1], Genebank NM_181645 [Hypothetical protein FLJ25393], Genebank AK092368 [Empty spiracles homolog 1 (Drosophila) , Genebank AB051464 [Kelch-like 15 (Drosophila)], Gene Registration Number (Genebank) NM_032484 [Homolog of mouse LGP1], Genebank NM_022371 [Torsin family 3, member A], Gene Genebank NM_002033 Fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific), Genebank AK125154 [Plexin A2], Genebank AK125559 [Zymogen granule protein 16], Gene Registration Genebank NM_176822 [NACHT, leucine rich repeat and PYD containing 14], Genebank NM_001620 [AHNAK nucleoprotein (desmoyokin)], Genebank AK097654 [SPT2, Suppressor of Ty, domain containing 1 ( S. cerevisiae)], Genebank NM_004821 [Heart and neural crest derivatives expressed 1], Genebank X89399 [RAS p21 protein activator 3], Genebank AK090470 [CD33 antigen (gp67)] , Genebank NM_018013 [Hypothetical protein FLJ10159], Genebank BC038369 [Interleukin 17 receptor D], Genebank AJ009985 [Annexin A9], Genebank AB032417 [Frizzled homolog 4 (Drosophila)], Genebank NM_003873 [Neuropilin 1], Genebank NM_015335 [Thyroid hormone receptor associated protein 2], Genebank NM_015270 [Adenylate cyclase 6], Gene accession number (Genebank) NM_001995 [Acyl-CoA synthetase long-chain family member 1], gene registration number (Genebank) NM_004457 [Acyl-CoA synthetase long-chain family member 3], gene registration number (Genebank) NM_005933 [Myeloid / lymphoid or mixed -lin eage leukemia (trithorax homolog, Drosophila)], Genebank NM_002843 [Protein tyrosine phosphatase, receptor type, J], Genebank AK023414 [Steroid 5 alpha-reductase 2-like], Gene Registration Number ( Genebank) U06936 [D site of albumin promoter (albumin D-box) binding protein], Genebank DQ097177 [HECT, UBA and WWE domain containing 1], Genebank AF234887 [Cadherin, EGF LAG seven -pass G-type receptor 2 (flamingo homolog, Drosophila)], Genebank BG483345 [Secretory leukocyte peptidase inhibitor], Genebank AK074614 [Insulin-like growth factor 2 (somatomedin A)], gene Genebank NR_000041 [RNA, U12 small nuclear], Genebank BC009383 [Kringle containing transmembrane protein 2], Genebank AY358127 [Leucine rich repeat and fibronectin type III domain containing 3], gene Registration Number (Genebank ) NM_007313 [V-abl Abelson murine leukemia viral oncogene homolog 1], Genebank AB020647 [F-box and leucine-rich repeat protein 7], Genebank NM_014476 [PDZ and LIM domain 3], Genebank AK123302 [CDNA FLJ41308 fis, clone BRAMY2042612], Genebank BC063872 [Tripartite motif-containing 9], Genebank AB007944 [Family with sequence similarity 20, member B], Genebank No. AK027155 [CDNA: FLJ23502 fis, clone LNG02862], Genebank No. (Genebank) NM_178556 [Hypothetical protein FLJ36180], Genebank No. NM_003617 [Regulator of G-protein signaling 5], Gene Registration No. (Genebank) NM_001007271 [Dual specificity phosphatase 13], gene registration number (Genebank) BC045642 [Metadherin], gene registration number (Genebank) NM_001618 [Poly (ADP-ribose) polymerase family, member 1], gene registration number (Genebank) AY358815 Neural cell adhesio n molecule 1], Genebank NM_000448 [Recombination activating gene 1], Genebank NM_178509 [Syntaxin binding protein 4], Genebank AB209376 [SATB family member 2], Gene accession number (GEO) A_24_P918364, Gene Registration Number (TIGR) THC2328806, Gene Registration Number (TIGR) THC2272137, Gene Registration Number (TIGR) THC2433340, Gene Registration Number (TIGR) THC2343493, Gene Registration Number (TIGR) THC2288230, Gene Registration Number (GEO) ) A_32_P145515, gene registration number (GEO) A_24_P921636.

1) Among the marker genes, marker genes whose expression is increased by treatment of teratogenic drugs are as follows: Genebank NM_032199 [AT rich interactive domain 5B (MRF1-like)], Genebank (Genebank) BX647857 [Ankyrin repeat and SOCS box-containing 5], Genebank AB018258 [ATPase, Class V, type 10B], Genebank NM_013314 [B-cell linker], Genebank BX111592 Transcribed locus, Genebank NM_203403, Chromosome 9 open reading frame 150, Genebank AY268104 Carboxylesterase 1 (monocyte / macrophage serine esterase 1), Genebank NM_000735 Glycoprotein hormones, alpha polypeptide], Genebank BC067746 [C-type lectin domain family 1, member A], Genebank CR749536 [C-type lectin domain family 7, member A], gene registration number ( Genebank) AL136922 [ClpX caseinolytic peptidase X homolog (E. coli)], gene registration number (Genebank) NM_001874 [Carboxypeptidase M], gene registration number (Genebank) CR598482 [Chymotrypsin-like], gene registration number (Genebank) NM_031226 [Cytochrome P450, family 19, subfamily A, polypeptide 1], Genebank NM_214462 [Dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)], Genebank AF177395 [Dickkopf homolog 2 (Xenopus laevis)], Genebank AL832598 [Erythrocyte membrane protein band 4.1-like 3], Genebank BX092581 [Developmental pluripotency associated 5], Genebank BC064700 [Estrogen-related receptor gamma], Gene registry number (Genebank) AF075292 [Fibroblast growth factor 18], Genebank NM_000162 [Glucokinase (hexokinase 4, maturity onset diabetes of the young 2)], Genebank AB209105 [Huntingtin-associated protein 1 (neuroan 1) )], Genebank AK057515 [CDNA FLJ32953 fis, clone TESTI2008099], Genebank AJ556711 [Immunoglobulin gamma heavy chain variable region (IGHV3-30.3 gene), clone 2B 3G 02], Genebank (Genebank) R63061 [Keratin 23 (histone deacetylase inducible)], Genebank NM_007360 [Killer cell lectin-like receptor subfamily K, member 1], Genebank NM_007015 [Leukocyte cell derived chemotaxin 1], Gene registration number ( Genebank) BC013438 [Hypothetical gene supported by BC013438], Genebank Number (Genebank) NM_003681 [Pyridoxal (pyridoxine, vitamin B6) kinase], Genebank Number (Genebank) CR606430 [Pregnancy specific beta-1-glycoprotein 11], Gene Registration Number (Genebank) BC025767 [Rhophilin, Rho GTPase binding protein 1], Gene Registration Number (Genebank) AB007937 [Syndecan 3], Gene Registration Number (Genebank) NM_022367 [Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and shortcytoplasmic domain, (semaphorin) 4A], Genebank BX649005 [Serum / glucocorticoid regulated kinase], Genebank BC063830 [ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-) 1,3) -N-acetylgalactosaminide alpha-2,6-sylyltransferase 1], Genebank NM_013356 [Solute carrier family 16, member 8 (monocarboxylic acid transporter 3)], Genebank NM_014585 [Solute carrier family 40 (iron-regulated transporter), member 1], Genebank BX648244 [Spermatogenesis associated 13], Genebank AK056709 [Thrombospondin, type I, domain containing 3], Gene accession number (Genebank) ) AY728143 [Transmembrane protein 16A], Genebank BC052977 [Tumor necrosis factor receptor superfamily, member 1B], Genebank AK023755 [Triggering receptor expressed on myeloid cells-like 2], Gene accession number (Genebank) ) NM_016113 [Transient receptor potential cation channel, subfamily V, member 2], gene accession number (Genebank) AK122757 [Tubulin, beta 3], gene accession number (GEO) A_23_P124177, gene identification number (GEO) A_23_P210297, gene accession number (Genebank) NM_003387 [WAS / WASL interacting protein family, member 1], Genebank M23575 [Pregnancy specific beta-1-glycoprotein 3], Genebank NM_002632 [Placental growth factor, vascular endothelial growth factor-related protein], gene Genebank AK096580 [CDNA FLJ39261 fis, clone OCBBF2009391], Genebank CD388102 [Similar to Placental tissue protein 13 (Placenta protein 13) (Galectin-13)], Genebank NM_002288 [Leukocyte -associated Ig-like receptor 2], gene registration number (Genebank) AB002308 [KIAA0310], gene registration number (Genebank) AL136646 [Rho GTPase activating protein 24], gene registration number (Genebank) AB208809 [Solute carrier family 13 (sodium / sulfate sy mporters), member 4], Genebank NM_004454 [Ets variant gene 5 (ets-related molecule)], Genebank AB075819 [ATPase, Class I, type 8B, member 4], gene registration number (Genebank) NM_004235 [Kruppel-like factor 4 (gut)], gene registration number (Genebank) AF450487 [Kinesin family member 21A], gene registration number (Genebank) AK075130 [G protein-coupled receptor 1], gene registration number (Genebank) ) CR601901 [Insulin-like 4 (placenta)], Genebank NM_022482 [Zinc finger protein 336], Genebank D90070 [Phorbol-12-myristate-13-acetate-induced protein 1], Gene Registration Number (Genebank) X97758 [Rho family GTPase 3], Gene Registration Number (Genebank) BC068585 [HERV-FRD provirus ancestral Env polyprotein], Gene Registration Number (Genebank) NM_000494 [Collagen, type XVII, alpha 1], Gene Registration Number (Genebank) NM_001005325 [Olfactory receptor, family 6, subfamily M, member 1], gene registration number (Geneb ank) NM_004419 [Dual specificity phosphatase 5], Genebank R45075 [Transcribed locus, weakly similar to XP_219319.3 PREDICTED: similar to deleted in malignant brain tumors 1 [Rattus norvegicus]], Genebank BX649112 [COBL-like 1], Genebank AI939596 [Transcribed locus], Genebank NM_004561 [Ovo-like 1 (Drosophila)], Genebank BG571732 [S100 calcium binding protein P] , Genebank BX537382 [Solute carrier family 38, member 3], Genebank (Genebank) CR749205 [DKFZP686A01247 hypothetical protein], Genebank AK056776 [Hypothetical protein FLJ32214], Genebank (Genebank) M57609 [GLI- Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)], gene accession number (Genebank) BX386171 [Chorionic gonadotropin, beta polypeptide 8], gene accession number (Genebank) BC063127 [Pregnancy specific beta-1-glycoprot ein 4], Genebank BX648582 [Sprouty homolog 2 (Drosophila)], Genebank No. (Genebank) NM_016569 T-box 3 (ulnar mammary syndrome), Genebank NM_014365 [Heat shock 22kDa protein 8], Genebank AF056434 [CDNA FLJ12815 fis, clone NT2RP2002546], Genebank (Genebank) NM_002182 [Interleukin 1 receptor accessory protein], Genebank NM_004570 [Phosphoinositide-3-kinase, class 2, gamma polypeptide], gene registration number (Genebank) AK128505 [Keratin 7], gene registration number (Genebank) AI074002 [Transcribed locus, strongly similar to NP_083546.1 Rho GTPase activating protein 24 isoform 1 [Mus musculus]], gene registration Number (Genebank) AK095632 [Ankyrin repeat and BTB (POZ) domain containing 2], gene registration number (Genebank) NM_002356 [Myristoylated alanine-rich protein kinase C substrate], gene registration number (Genebank) BC042755 [Regulator of G-protein signaling 2, 24kDa], U Genebank No. NM_033393 [KIAA1727 protein], Genebank No. BC005839 [Follistatin-like 3 (secreted glycoprotein)], Genebank No. NM_031246 [Pregnancy specific beta-1-glycoprotein 2], Gene registration Genebank AY358486 [Plexin domain containing 2], Genebank BM715650 [MRNA; cDNA DKFZp313O2015 (from clone DKFZp313O2015)], gene registration number (Genebank) NM_004155 [Serpin peptidase inhibitor, clade B (ovalbumin), member 9], gene registration number (Genebank) BC037275 [Tudor domain containing 4], gene registration number ( Genebank) NM_001848 [Collagen, type VI, alpha 1], Genebank Y18483 [Solute carrier family 7 (cationic amino acid transporter, y + system), member 8], Genebank NM_004120 [Guanylate binding protein 2, interferon-inducible], Genebank BM923753 [Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in)], Genebank AK075446 [26 serine protease], Genebank (Genebank) NM_005668 [ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4], gene registration number (Genebank) NM_001031802 [Similar to hypothetical testis protein from macaque], gene registration number (Genebank) NM_016354 [Solute carrier organic anion transporter family, member 4A1], Genebank BC036846 [Protease, serine, 33], Genebank XM_371015 [Ubiquitin specific peptidase 43], Genebank NM_014590 [Endogenous retroviral family W, env (C7) , member 1 (syncytin)], Genebank AK097398 [Nucleobindin 2], Genebank NM_173675 [Hypothetical protein FLJ33708], Genebank NM_005975 [PTK6 protein tyrosine kinase 6], Gene registration Number (Genebank) AK021606 [CDNA FLJ11544 fis, clone HEMBA1002826], gene registration number (Genebank) NM_005935 [AF4 / FMR2 family, member 1], gene registration number (Genebank) NM_212482 [Fibronectin 1], gene registration number (Genebank) NM_001753 [Caveolin 1, caveolae protein, 22kDa], Genebank BX537968 [Hypothetical LOC51149], Genebank NM_181659 [Nuclear receptor coactivator 3], Genebank BX111520 [Transcribed locus], Gene registration time Genebank CR749722 [RAS p21 protein activator (GTPase activating protein) 1], Genebank AK128870 [Synapse defective 1, Rho GTPase, homolog 1 (C. elegans)], Genebank NM_022153 [Chromosome 10 open reading frame 54], Gene Registration Number (TIGR) THC2301901 [Zinc finger CCCH-type containing 3], Genebank NM_015117 [Zinc finger CCCH-type containing 3], Genebank AF343078 [ATPase family, AAA domain containing 3B], Gene Registration Number (Genebank) D89974 [Vanin 2], Gene Registration Number (Genebank) NM_001006946 [Syndecan 1], Gene Registration Number (Genebank) ) AY055760 [Decay accelerating factor for complement (CD55, Cromer blood group system)], gene accession number (Genebank) AB016901 [Chromosome 6 open reading frame 123], gene accession number (Genebank) AK096355 [Myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)], Genebank NM_182898 [CAMP responsive element binding protein 5], Genebank BC036890 [Grainyhead-like 3 (Drosophila)], Gene accession number (Genebank) AK094505 [Cysteine conjuga te-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)], genebank number (Genebank) AB007940 [RAB GTPase activating protein 1-like], genebank number (Genebank) CR936755 [Guanylate binding protein 3], genebank number (Genebank) NM_006291 [ Tumor necrosis factor, alpha-induced protein 2], Genebank NM_006778 [Tripartite motif-containing 10], Genebank NM_020809 [Rho GTPase activating protein 20], Genebank BQ186674 [Hypothetical gene supported by AF086204], Genebank NM_003966 [Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A], gene registration number ( Genebank) BM810215 [Chorionic gonadotropin, beta polypeptide], Genebank NM_003167 [Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1], Gene accession number (Geneban k) NM_001620 [AHNAK nucleoprotein (desmoyokin)], gene accession number (Genebank) NM_004615 [Tetraspanin 7], gene accession number (Genebank) CR609484 [Kynureninase (L-kynurenine hydrolase)], gene accession number (Genebank) NM_014400 [LY6 / PLAUR domain containing 3], Genebank AB209845 [Transcription termination factor, RNA polymerase II], Genebank AK091125 [Hypothetical protein LOC162427], Genebank BX649103 [Chondroitin beta1,4 N- acetylgalactosaminyltransferase], Genebank AY217348 [Armadillo repeat containing 5], Genebank AK126079 [Zinc finger protein 692], Genebank AK096685 [Transforming growth factor, beta receptor associated protein 1], Genebank No. NM_198479 [Tetra-peptide repeat homeobox 1], Genebank No. AK127349 [Major histocompatibility complex, class I, C], Genebank No. AB0231 77 [KIAA0960 protein], Genebank AK126731 [Glucocorticoid induced transcript 1], Genebank NM_014619 [Glutamate receptor, ionotropic, kainate 4], Genebank R31293 [suppressor of cytokine signaling 2 ], Genebank AK055190 [Chromosome X open reading frame 36], Genebank (Genebank) BC038504 [SNF1-like kinase], Genebank NM_018018 [Solute carrier family 38, member 4], Gene Genebank AK123704 [Similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162], Genebank BX647357 [Iduronate 2-sulfatase (Hunter syndrome)], Gene accession number (Genebank) NM_001343 [Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)], Genebank (Genebank) NM_001904 [Catenin (cadherin-associated protein), beta 1, 88kDa], Genebank CR599551 [EF-hand domain family, member D1], Genebank AK172837 [Organic solute transporter alpha], Gene registration Number (Genebank) BC027456 [Similar to interspersed repeat antigen, putative], Gene Registration Number (Genebank) NM_001025598 [Rho GTPase activating protein 30], Gene Registration Number (Genebank) NM_001003793 [RNA binding motif, single stranded interacting protein], Gene registration Number (Genebank) AB022718 [Chromosome 10 open reading frame 10], gene registration number (Genebank) NM_023915 [G protein-coupled receptor 87], gene registration number (Genebank) NM_006200 [Proprotein convertase subtilisin / kexin type 5], Genebank XM_496826 [NHS-like 1], Genebank AK124904 [FYVE, RhoGEF and PH domain containing 6], Genebank NM_006317 [Brain abundant, membrane attached signal protein 1], Genebank AL136861 [Cysteine-rich secretory protein LCCL domain containing 2], Genebank (Genebank) AK222648 [Calbindin 2, 29kDa (calretinin)], Genebank (Kenebank) AK023628 [Hypothetical protein LOC199725 ], Genebank No. NM_006907 [Pyrroline-5-carboxylate reductase 1], Genebank No. CR622352 [Brain specific protein], Genebank No. BC030666 [Ring finger protein 182], Gene Registration No. ( Genebank) BC053619 [Arrestin domain containing 3], Genebank NM_003670 [Basic helix-loop-helix domain containing, class B, 2], Genebank NM_005576 [Lysyl oxidase-like 1], Gene registration Number (Genebank) AF217990 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, Genebank NM_182485 Cytoplasmic polyadenylation element binding protein 2, Genebank AK125877 [Hypothetical protein MGC27016] Number (Genebank) AK001879 [Hypothetical protein FLJ11017], gene registration number (Genebank) BG618056 [Transcribed locus], gene registration number (Genebank) AI741395 [MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)], Genebank AF291673 [Giant axonal neuropathy (gigaxonin)], Genebank AK056794 [Cytochrome P450, family 11, subfamily A, polypeptide 1], Genebank AF001893 [Trophoblast -derived noncoding RNA], Gene Registration Number (TIGR) THC2343493, Gene Registration Number (TIGR) THC2288230, Gene Registration Number (GEO) A_32_P145515, Gene Registration Number (GEO) A_24_P921636.

2) Among the marker genes, marker genes whose expression is reduced by teratogenic drug treatment are as follows: Genebank NM_005971 [FXYD domain containing ion transport regulator 3], Genebank AK096306 [Hypothetical protein MGC3032], Genebank AF239668 [Cholecystokinin B receptor], Genebank AK000652 [Chromosome 20 open reading frame 57], Genebank NM_138703 [Melanoma antigen family E, 2], Gene Genebank AJ007798 [Stromal antigen 3], Genebank NM_024342 [Glucocorticoid receptor DNA binding factor 1], Genebank NM_181645 [Hypothetical protein FLJ25393], Genebank AK092368 [Empty spiracles homolog 1 (Drosophila)], Genebank AB051464 [Kelch-like 15 (Drosophila)], Genebank NM_032484 [Homolog of mouse LGP1], U Genebank NM_022371 [Torsin family 3, member A], Genebank NM_002033 [Fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)], Genebank AK125154 [Plexin A2], Genebank AK125559 [Zymogen granule protein 16], Genebank NM_176822 [NACHT, leucine rich repeat and PYD containing 14], Genebank NM_001620 [AHNAK nucleoprotein (desmoyokin)] , Genebank AK097654 [SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)], Genebank NM_004821 [Heart and neural crest derivatives expressed 1], Genebank X89399 [RAS p21 protein activator 3], Genebank AK090470 [CD33 antigen (gp67)] , Genebank NM_018013 [Hypothetical protein FLJ10159], Genebank BC038369 [Interleukin 17 receptor D], Genebank AJ009985 [Annexin A9], Genebank AB032417 [Frizzled homolog 4 (Drosophila)], Genebank NM_003873 [Neuropilin 1], Genebank NM_015335 [Thyroid hormone receptor associated protein 2], Genebank NM_015270 [Adenylate cyclase 6], Gene accession number (Genebank) NM_001995 [Acyl-CoA synthetase long-chain family member 1], gene registration number (Genebank) NM_004457 [Acyl-CoA synthetase long-chain family member 3], gene registration number (Genebank) NM_005933 [Myeloid / lymphoid or mixed -lin eage leukemia (trithorax homolog, Drosophila)], Genebank NM_002843 [Protein tyrosine phosphatase, receptor type, J], Genebank AK023414 [Steroid 5 alpha-reductase 2-like], Gene Registration Number ( Genebank) U06936 [D site of albumin promoter (albumin D-box) binding protein], Genebank DQ097177 [HECT, UBA and WWE domain containing 1], Genebank AF234887 [Cadherin, EGF LAG seven -pass G-type receptor 2 (flamingo homolog, Drosophila)], Genebank BG483345 [Secretory leukocyte peptidase inhibitor], Genebank AK074614 [Insulin-like growth factor 2 (somatomedin A)], gene Genebank NR_000041 [RNA, U12 small nuclear], Genebank BC009383 [Kringle containing transmembrane protein 2], Genebank AY358127 [Leucine rich repeat and fibronectin type III domain containing 3], gene Registration Number (Genebank ) NM_007313 [V-abl Abelson murine leukemia viral oncogene homolog 1], Genebank AB020647 [F-box and leucine-rich repeat protein 7], Genebank NM_014476 [PDZ and LIM domain 3], Genebank (Genebank) AK123302 [CDNA FLJ41308 fis, clone BRAMY2042612], Genebank (Genebank) BC063872 [Tripartite motif-containing 9], Genebank AB007944 [Family with sequence similarity 20, member B], gene Registration Number (Genebank) AK027155 [CDNA: FLJ23502 fis, clone LNG02862], Gene Registration Number (Genebank) NM_178556 [Hypothetical protein FLJ36180], Gene Registration Number (Genebank) NM_003617 [Regulator of G-protein signaling 5], Gene Registration Number (Genebank) NM_001007271 [Dual specificity phosphatase 13], gene registration number (Genebank) BC045642 [Metadherin], gene registration number (Genebank) NM_001618 [Poly (ADP-ribose) polymerase family, member 1], gene registration number (Genebank) AY358815 Neural cell adhesio n molecule 1], Genebank NM_000448 [Recombination activating gene 1], Genebank NM_178509 [Syntaxin binding protein 4], Genebank AB209376 [SATB family member 2], Gene accession number (GEO) A_24_P918364, Gene Registration Number (TIGR) THC2328806, Gene Registration Number (TIGR) THC2272137, Gene Registration Number (TIGR) THC2433340.

In order to discover marker genes for teratogenicity-induced drug search, the present inventors treated thalidomide, an anticancer agent showing teratogenicity, with human placental chorionic cancer cell line (JEG-3) to confirm cytotoxicity. As a result, the thalidomide was confirmed to be toxic to human placental chorionic cancer cell line (JEG-3) (see Fig. 1), and the concentration for the treatment of thalidomide was determined based on the experiment. Subsequently, thalidomide was treated to human placental chorionic carcinoma cell line at the determined concentration, mRNA was isolated from the drug-treated cell line, and labeled with fluorescent substance Cy5 while synthesizing cDNA. Labeled. The fluorescently labeled cDNA was hybridized with a 44 k Human whole genome oligomicroarray chip (Agilent, USA), and the fluorescence image was scanned to analyze differences in gene expression patterns (see FIGS. 2 and 3). In the analysis, when the median ratio (Cy5 / Cy3 ratio) was 1.5 times or more, it was classified as a gene with increased expression, and when it was 0.666 or less, it was classified as a gene with reduced expression. As a result, it was confirmed that the gene with increased expression was 0.44% (197 of 44,290 genes) and 0.16% (71 of 44,290 genes) with reduced expression. At this time, genes related to apoptosis, pregnancy, angiogenesis, and morphogenesis that were determined to function on teratogenicity were selected (see Table 2). The genes have not been reported to be associated with toxicity in human placental chorionic cancer cells when treated with thalidomide used in the present invention.

Subsequently, the present inventors separated six apoptosis related genes, two pregnancy related genes, and one angiogenesis related gene, and re-expressed the expression pattern by real-time reverse transcript polymerase chain reaction (RT-PCR) method. I checked. As a result, it was confirmed that the expression patterns of the nine genes appeared similar to the oligomicroarray chip results (see Table 4).

The present invention also provides a DNA microarray chip for teratogenicity-induced drug search in which an oligonucleotide or its complementary strand molecule containing all or part of the marker gene sequence is integrated. The oligonucleotide or its complementary strand molecule comprises 18 to 30 nucleic acids of the marker gene, preferably 20 to 25 nucleic acids.

DNA microarray chip for teratogenicity drug search of the present invention can be produced by methods known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the detected marker gene as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method or a pin-shaped spotter using a piezoelectric method is used. It is preferable to use a used method and the like, but is not limited thereto. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde, It is not limited to this. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto, and preferably, amino-silane-coated slide glass. Was used.

The present invention also provides a method for teratogenic drug search using the marker gene.

The present invention provides a method for teratogenicity-induced drug search, comprising the following steps: 1) treating a test compound with a cell of human uterine tissue; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) synthesizing RNA of the experimental group and the control group of step 2) with cDNA and labeling the fluorescent substance of the experimental group and the control group, respectively; 4) hybridizing cDNA labeled with different fluorescent materials of step 3) with DNA microarray chip; 5) analyzing the reacted DNA microarray chip of step 4); And 6) confirming the expression level of the marker gene of the present invention in the analyzed data of step 5) by comparing with the control group.

In the search method, the human uterine tissue-derived cells of step 1) preferably use human placental choriocarcinoma cells, but are not limited thereto, and any cell derived from human uterine cells and tissues can be used.

In the search method, the fluorescent material of step 3) is preferably selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). One is not limited thereto, and any fluorescent material known to those skilled in the art may be used.

In the search method, the DNA microarray chip of step 5) preferably uses Whole Human Genome Oligo Microarray (Agilent, USA) and the like, but is not limited thereto. Can be used as long as the microarray chip is loaded, and it is most preferable to use the DNA microarray chip produced by the present inventor. In addition, the analysis method of step 5) preferably uses GenePix 4.1 software (Axon Instruments, USA), but is not limited thereto, and analysis software known to those skilled in the art may be used.

In addition, the present invention provides a method for teratogenicity-induced drug search comprising the following steps: 1) treating a test compound on a cell derived from human uterine tissue; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 2) using a primer complementary to the marker gene of the present invention and capable of amplifying the marker gene; And 4) confirming the expression level by comparing the amplification product of step 3) with the control.

In the search method, the human uterine tissue-derived cells of step 1) preferably use human placental choriocarcinoma cells, but are not limited thereto, and any cell derived from human uterine cells and tissues can be used.

In the above search method, the primer is complementary to the marker gene searched in the present invention, any primer that can amplify the marker gene and designed to be 100 to 300 bp amplification products can be used, the length of the primer is 15 To 30 mer, preferably 18 to 28 mer. In the present invention, 9 pairs of forward and reverse primers set forth in SEQ ID NOs: 1 to 18 are provided, but the present invention is not limited thereto.

In addition, the present invention provides a kit for teratogenicity-induced drug search comprising the DNA microarray chip.

The present invention provides a kit for teratogenicity drug search comprising a DNA microarray chip produced by the method of the present invention.

The present invention provides a kit for teratogenicity-induced drug search comprising human uterine tissue-derived cells in addition to the search kit. The human uterine tissue-derived cells are preferably human placental choriocarcinoma cells, but are not limited thereto. Any cells derived from human uterine cells and tissues may be used.

In addition to the search kit may include a fluorescent material, the fluorescent material is a streptavidin-like phosphatease conjugate (streptavidin-like phosphatease conjugate), chemifluorescence (chemifluorescence) and chemiluminescent (chemiluminescent) It is preferably selected from the group consisting of, but is not limited thereto. In the preferred embodiment of the present invention, the fluorescent material Cy3 and the fluorescent material Cy5 were used. In addition, the detection kit may further include a reaction reagent, the reaction reagent used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), fluorescence It may include, but is not limited to, a marker reagent such as a chemical inducing agent of a dye, a washing buffer, and the like, and may include all reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art.

In another aspect, the present invention provides a kit for teratogenic drug search comprising a primer that is complementary to the marker gene, a primer capable of amplifying the marker gene.

The primer of the search kit is preferably to use two or more forward and reverse primers selected from the group consisting of the sequences set forth in SEQ ID NO: 1 to 18, but is not limited thereto, complementary to the marker gene, a marker Both forward and reverse primer pairs designed to amplify genes and designed for amplification products of 100 to 300 bp are available.

A marker gene for teratogenic drug search and a method for screening for teratogenic drug using the same according to the present invention can be used as a marker gene using a response gene selected through a DNA microarray chip to monitor and risk a drug or chemical having a risk of new teratogenicity. It is useful for judgment and can be used as a tool to identify mechanisms of action that cause teratogenicity.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1> Cell Culture and Chemical Treatment

<1-1> Cell Culture

JEG-3 cells (HTB-36, ATCC, USA), a human placental chorionic cancer cell line, were made to 5 × 10 ⁵ cells / ml in a T75 flask using DMEM medium (Gibro-BRL, USA) with 10% FBS. Incubated. The present inventors have selected thalidomide, a representative drug having teratogenicity as a side effect, and dissolved it in DMSO through previous studies and reports. Vehicle concentration was less than 0.1% in all experiments.

<1-2> Cytotoxicity Test ( MTT assay ) And chemical processing

MTT experiment using JEG-3 cell line was performed by the method of Mossman et al . ( J. Immunol . Methods , 65, 55-63, 1983). Cells were treated with thalidomide dissolved in DMSO in DMEM medium (Gibro-BRL, USA) at 5 × 10 ⁴ / well cell number in 24-well plates and after 48 hours, MTT (3- (4,5-dimethylthiazol-2, 5 mg / ml 5-diphenyltetra zolium bromide) was added to the tube and incubated for 3 hours at 37 ° C. The medium was then removed and the formed formazan crystal was dissolved in 500 μl of DMSO. The plate was aliquoted and the OD value was measured at an absorbance of 540 nm.

As a result of examining the cytotoxicity of thalidomide in the JEG-3 cell line, the concentration showing the 70% survival rate (IC ₃₀ ) was 4.283 mM (FIG. 1), and the microarray experiment was performed by determining the concentration.

< Example  2> Microarray  Experiment

<2-1> target RNA Isolation and Labeling of Fluorescent Materials

After dispensing JEG-3 cells in a 100 mm dish at a concentration of 1.8 × 10 ⁶ cells / ml, the concentration of thalidomide determined in Example 1-2 was treated for 48 hours. Thereafter, the whole cells were separated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using the RNeasy mini kit (Qiagen, USA). Genomic DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The amount of each total RNA sample was measured by spectrophotometer, and the purity was confirmed by Agilent 2100 Bioanalyzer (Agilent Technologies, USA).

<2-2> Labeled cDNA  Produce

CDNA was prepared using total RNA of the thalidomide treated group obtained in Example 2-1 for oligo microarray analysis. The obtained total RNA 30 ㎍ and oligo (dT) primer 2 ㎍ (1 ㎍ /)) was mixed and reacted for 10 minutes at 65 ℃ immediately annealed in ice. Reagents were mixed as shown in Table 1 for Reverse Transcript reaction of the annealed RNA.

Configuration Volume (μl) 5X first strand buffer 6 dNTPs 0.6 0.1 M DDT 3 SuperScript II enzyme 3 Cy-3 or Cy-5 dUTP 2

Total RNA isolated from the control JEG-3 cell line was labeled with Cy3-dUTP (green), and RNA isolated from thalidomide treated JEG-3 cell line was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

<2-3> Hybridization  reaction

Hybridization and washing procedures were carried out according to the instructions of Genome Co., Ltd .. Hybridization was performed in a 62 ° C. oven for 12 hours. A 44 k Whole Human Genome oligo microarray (Agilent, USA) was used as the DNA microarray chip. After washing (washing in 2SSC / 0.1% SDS for 2 minutes, washing 1SSC for 3 minutes, 0.2SSC for 2 minutes), the slides were dried by centrifugation at 800 rpm for 3 minutes.

<2-4> Fluorescence Image Acquisition

Hybridization images on the slides were scanned with the Genepix 4000B (Axon Instruments, USA). Chips washed with unbound genes were obtained with a fluorescence image using a laser fluorescence scanner. In this case, the green fluorescence image in the control group, the red fluorescence image represents the activity level of the gene specifically expressed only in the experimental group, and the yellow fluorescence image is the complementary color of green and red, which means that there is no significant difference between the two groups. Scanned images were analyzed with GenePix 4.1 software (Axon Instruments, USA) to obtain gene expression rates. Marker genes for thalidomide were selected from the data thus obtained (FIGS. 2 and 3).

As a result, among the approximately 44,000 genes present on the oligo chip, 0.44% (44,290) of genes showing an increase in gene expression with a median ratio (ratio of Cy5 / Cy3) more than 1.5 times by thalidomide treatment. 197 of the genes), and the gene showing a decrease in gene expression up to 0.666-fold was 0.16% (71 of 44,290 genes).

At this time, when genes whose expression is significantly changed by thalidomide are classified by function, genes related to apoptosis, pregnancy, angiogenesis, and morphogenesis, which are judged to function in teratogenicity Were screened (see Table 2). There is no report that these genes are associated with toxicity in human placental choriocarcinoma cells when treated with thalidomide used in the present invention.

Functional classification of genes whose expression was significantly changed by thalidomide Registration Number Gene abbreviation Gene name Ratio of medians Angiogenesis NM_002632 PGF placental growth factor, vascular endothelial growth factor-related protein 1.989 NM_006291 TNFAIP2 tumor necrosis factor, alpha-induced protein 2 1.601 AK074614 IGF2 insulin-like growth factor 2 (somatomedin a) 0.641 NM_003873 NRP1 neuropilin 1 0.623 Pregnant CR601901 INSL4 insulin-like 4 (placenta) 1.908 AK075446 P11 26 serine protease 1.700 CR606430 PSG11 pregnancy specific beta-1-glycoprotein 11 2.117 NM_031246 PSG2 pregnancy specific beta-1-glycoprotein 2 1.747 M23575 PSG3 pregnancy specific beta-1-glycoprotein 3 1.989 BC063127 PSG4 pregnancy specific beta-1-glycoprotein 4 1.811 Formability AK095632 ABTB2 ankyrin repeat and btb (poz) domain containing 2 1.782 BX649103 ChGn chondroitin beta1,4 n-acetylgalactosaminyltransferase 1.578 NM_001874 CPM carboxypeptidase m 2.044 NM_014590 ERVWE1 endogenous retroviral family w, env (c7), member 1 (syncytin) 1.676 AK124904 FGD6 fyve, rhogef and ph domain containing 6 1.538 AF075292 FGF18 fibroblast growth factor 18 2.008 M57609 GLI3 gli-kruppel family member gli3 (greig cephalopolysyndactyly syndrome) 1.838 NM_004235 KLF4 kruppel-like factor 4 (gut) 1.917 CR749722 RASA1 ras p21 protein activator (gtpase activating protein) 1 1.638 NM_014585 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 2.137 BX648582 SPRY2 sprouty homolog 2 (drosophila) 1.806 NM_016569 TBX3 t-box 3 (ulnar mammary syndrome) 1.806 NM_024342 GRLF1 glucocorticoid receptor dna binding factor 1 0.554 NM_004821 HAND1 heart and neural crest derivatives expressed 1 0.606 Apoptosis BX386171 CGB5 Chorionic gonadotropin, beta polypeptide 8 1.824 BM810215 CGB8 chorionic gonadotropin, beta polypeptide 1.589 NM_001904 CTNNB1 catenin (cadherin-associated protein), beta 1, 88kda 1.549 NM_002182 IL1RAP Interleukin 1 receptor accessory protein 1.798 AK096355 MX1 myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) 1.606 NM_004570 PIK3C2G Phosphoinositide-3-kinase, class 2, gamma polypeptide 1.795 NM_021127 PMAIP1 Phorbol-12-myristate-13-acetate-induced protein 1 1.903 CR749722 RASA1 rasp21proteinactivator (gtpaseactivatingprotein) 1 1.638 NM_001003793 RBMS3 RNA binding motif, single stranded interacting protein 1.545 NM_004155 SERPINB9 serpin peptidase inhibitor, clade b (ovalbumin), member9 1.733 BX649005 SGK serum / glucocorticoid regulated kinase 2.981 R31293 SOCS2 suppressor of cytokine signaling 2 1.557 BC052977 TNFRSF1B tumor necrosis factor receptor superfamily, member 1b 2.026 NM_007313 ABL1 v-abl abelson murine leukemia viral oncogene homolog 1 0.652

< Example  3> Real time RT - PCR  ( Real - time reverse transcriptase polymerase chain reaction Quantification

Twelve genes related to apoptosis, pregnancy, and angiogenesis were selected as a mechanism for teratogenicity caused mainly by thalidomide among the overexpressed and underexpressed genes selected in Example 2 by expression induced by thalidomide. These genes are genebank NM_004155 [Serpin peptidase inhibitor, clade B (ovalbumin), member 9], genebank (Genebank) BC063127 [Pregnancy specific beta-1-glycoprotein 4], genebank NM_005627 [Serum / glucocorticoid regulated kinase], Genebank NM_002182 [Interleukin 1 receptor accessory protein], Genebank NM_004570 [Phosphoinositide-3-kinase, class 2, gamma polypeptide], Generegistration Number (Genebank) NM_001003793 [RNA binding motif, single stranded interacting protein], Genebank NM_021127 [Phorbol-12-myristate-13-acetate-induced protein 1], Genebank NM_001066 [Tumor necrosis factor receptor superfamily, member 1B], Genebank NM_002632 [Placental growth factor, vascular endothelial growth factor-related protein].

In order to investigate and quantify the expression changes of the genes, quantitative real-time RT-PCR was performed using a My IQ Real-time PCR (Bio-rad, USA) machine.

Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). 0.2 μl of the cDNA, 3.8 μl of water, 0.5 μl of sense primer, 0.5 μl of antisense primer, 5 μl of Cyberrin I staining supermix (Bio-rad, USA), mixed in a PCR tube, Step 1: 95 ° C., 3 minutes ; Step 2 (repeat 45): Step 2-1: 95 ° C., 10 seconds; Step 2-2: 55 to 65 ° C. 45 seconds; Step 3: 95 ° C., 1 minute; Step 4: 55 ° C., 1 minute; Step 5 (80 repetitions): The reaction was performed on a My IQ real-time PCR machine designed program at 55 ° C., 10 seconds. Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, primers (SEQ ID NO: 19 and SEQ ID NO: 20) for the target gene and endogenous control (GAPDH) used for PCR were added to the Cyberin master mix, and then PCR was selected. Primer optimization was performed. The synthesized cDNA samples and each primer (Table 3) were mixed, real-time RT-PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (Table 4).

primer  order Registration Number Gene name PCR primer  order (5 '-> 3') primer Reaction temperature (℃) NM_004155 Serpin peptidase inhibitor, clade B (ovalbumin), member 9 Sense (SEQ ID NO: 1) TGAGAAACTCACAGCCTGGACCAA 64.3 Antisense (SEQ ID NO: 2) CCAAATGCCGAAGCACAGATTCCA BC063127 Pregnancy specific beta-1-glycoprotein 4 Sense (SEQ ID NO: 3) TGTGAGCCACTCAGAACTCACCAA 61.2 Antisense (SEQ ID NO: 4) AGGCATGAGCAAGGACGGTTAAGA BX649005 Serum / glucocorticoid regulated kinase Sense (SEQ ID NO: 5) CCTGAGCTTATGAATGCCAAC 63.1 Antisense (SEQ ID NO: 6) GCCAAGGTTGATTTGCTGAG NM_002182 Interleukin 1 receptor accessory protein Sense (SEQ ID NO: 7) CCTCTCAGCTTCCCAAGAAA 55.8 Antisense (SEQ ID NO: 8) GGGCAAGAGTGAGGCTTCTA NM_004570 Phosphoinositide-3-kinase, class 2, gamma polypeptide Antisense (SEQ ID NO: 9) GCACAACCACTTAAAGGCAGA 58.7 Antisense (SEQ ID NO: 10) CCCAGGATGAATGTTACCACA NM_001003793 RNA binding motif, single stranded interacting protein Antisense (SEQ ID NO: 11) CCACCAGCTGTTGTGTCAGT 58.7 Antisense (SEQ ID NO: 12) CACAGGCGTGTACTGAGGAA NM_021127 Phorbol-12-myristate-13-acetate-induced protein 1 Antisense (SEQ ID NO: 13) TTGGAGACAAACTGAACTTCCGGC 61.2 Antisense (SEQ ID NO: 14) GCACCCATGAATGCACCTTCACAT BC052977 Tumor necrosis factor receptor superfamily, member 1B Antisense (SEQ ID NO: 15) CTCCTTCCTGCTCCCAATG 63.1 Antisense (SEQ ID NO: 16) CACACCCACAATCAGTCCAA NM_002632 Placental growth factor, vascular endothelial growth factor-related protein Antisense (SEQ ID NO: 17) CGCACCCGGCTCGTGTATTTATTA 57 Antisense (SEQ ID NO: 18) TGTGGCTGGCTTCTCTCTTTCTCT

Registration Number Gene name real time PCR (Relative magnification) cDNA Microarray ( Cy3 Of Cy5  ratio) NM_004155 Serpin peptidase inhibitor, clade B (ovalbumin), member 9 2.3866 1.7327 BC063127 Pregnancy specific beta-1-glycoprotein 4 1.5139 1.8113 BX649005 Serum / glucocorticoid regulated kinase 3.2963 2.9805 NM_002182 Interleukin 1 receptor accessory protein 1.9282 1.7982 NM_004570 Phosphoinositide-3-kinase, class 2, gamma polypeptide 2.4337 1.7953 NM_0010037 93 RNA binding motif, single stranded interacting protein 1.4883 1.5449 NM_021127 Phorbol-12-myristate-13-acetate-induced protein 1 2.2390 1.9032 BC052977 Tumor necrosis factor receptor superfamily, member 1B 1.7493 2.0262 NM_002632 Placental growth factor, vascular endothelial growth factor-related protein 2.5908 1.9886

As a result, it was confirmed that the gene expression amounts of the nine overexpressed genes were very similar to the oligo microarray results of gene expression by teratogenic drugs.

1 is a graph of cytotoxicity in human placental chorionic cancer cell line by thalidomide.

FIG. 2 shows the expression of the thalidomide-treated and untreated mRNAs labeled with Cy3 and Cy5, respectively, in a microarray chip, and then analyzed by a volcano plot.

Figure 3 shows the results of analyzing the gene expression of human placental chorionic cancer cell line treated with thalidomide using a microarray chip.

<110> Korea Institute of Science and Technology <120> Marker genes based on Thalidomide treatment for screening of drug          inducing teratogenicity and screening method using marie <130> 7P-06-38 <160> 20 <170> KopatentIn 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SERPINB9 sense primer <400> 1 tgagaaactc acagcctgga ccaa 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SERPINB9 antisense primer <400> 2 ccaaatgccg aagcacagat tcca 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PSG4 sense primer <400> 3 tgtgagccac tcagaactca ccaa 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PSG4 antisense primer <400> 4 aggcatgagc aaggacggtt aaga 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SGK sense primer <400> 5 cctgagctta tgaatgccaa c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SGK antisense primer <400> 6 gccaaggttg atttgctgag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1RAP sense primer <400> 7 cctctcagct tcccaagaaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1RAP antisense primer <400> 8 gggcaagagt gaggcttcta 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PIK3C2G sense primer <400> 9 gcacaaccac ttaaaggcag a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PIK3C2G antisense primer <400> 10 cccaggatga atgttaccac a 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RBMS3 sense primer <400> 11 ccaccagctg ttgtgtcagt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RBMS3 antisense primer <400> 12 cacaggcgtg tactgaggaa 20 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PMAIP1 sense primer <400> 13 ttggagacaa actgaacttc cggc 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PMAIP1 antisense primer <400> 14 gcacccatga atgcaccttc acat 24 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TNFRSF1B sense primer <400> 15 ctccttcctg ctcccaatg 19 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFRSF1B antisense primer <400> 16 cacacccaca atcagtccaa 20 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> P223 sense primer <400> 17 cgcacccggc tcgtgtattt atta 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> P223 antisense primer <400> 18 tgtggctggc ttctctcttt ctct 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH sense primer <400> 19 tgcaccacca actgcttagc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH antisense primer <400> 20 ggcatggact gtggtcatga 20  

Claims (15)

Marker gene for teratogenic drug search comprising a gene selected from the following groups: Genebank (Genebank) NM_032199 [AT rich interactive domain 5B (MRF1-like)], Genebank (Genebank) BX647857 [Ankyrin repeat and SOCS box-containing 5], Genebank AB018258 [ATPase, Class V , type 10B], Genebank NM_013314 [B-cell linker], Genebank BX111592 [Transcribed locus], Genebank AK000652 [Chromosome 20 open reading frame 57], Gene registry number (Genebank) NM_203403 [Chromosome 9 open reading frame 150], gene registration number (Genebank) AF239668 [Cholecystokinin B receptor], gene registration number (Genebank) AY268104 [Carboxylesterase 1 (monocyte / macrophage serine esterase 1)], gene registration number ( Genebank) NM_000735 [Glycoprotein hormones, alpha polypeptide], Genebank BC067746 [C-type lectin domain family 1, member A], Genebank CR749536 [C-type lectin domain family 7, member A] , Genebank AL1 36922 [ClpX caseinolytic peptidase X homolog (E. coli)], gene registration number (Genebank) NM_001874 [Carboxypeptidase M], gene registration number (Genebank) CR598482 [Chymotrypsin-like], gene registration number (Genebank) NM_031226 [Cytochrome P450, family 19, subfamily A, polypeptide 1], Genebank NM_214462 [Dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)], Genebank AF177395 [Dickkopf homolog 2 (Xenopus laevis)] , Genebank AL832598 [Erythrocyte membrane protein band 4.1-like 3], Genebank BX092581 [Developmental pluripotency associated 5], Genebank BC064700 [Estrogen-related receptor gamma], Gene registration Number (Genebank) AF075292 [Fibroblast growth factor 18], gene registration number (Genebank) NM_005971 [FXYD domain containing ion transport regulator 3], gene registration number (Genebank) NM_000162 [Glucokinase (hexokinase 4, maturity onset diabetes of the y) oung 2)], Genebank AB209105 [Huntingtin-associated protein 1 (neuroan 1)], Gene Registration Number (Genebank) AK057515 [CDNA FLJ32953 fis, clone TESTI2008099], Gene Registration Number (Genebank) AJ556711 [Immunoglobulin gamma heavy chain variable region (IGHV3-30.3 gene), clone 2B 3G 02], Genebank R63061 [Keratin 23 (histone deacetylase inducible)], Genebank NM_007360 [Killer cell lectin-like receptor subfamily K , member 1], Genebank NM_007015 [Leukocyte cell derived chemotaxin 1], Genebank BC013438 [Hypothetical gene supported by BC013438], Genebank NM_138703 [Melanoma antigen family E, 2] , Gene Registration Number (Genebank) AJ007798 [Stromal antigen 3], Gene Registration Number (Genebank) AK096306 [Hypothetical protein MGC3032], Gene Registration Number (Genebank) NM_003681 [Pyridoxal (pyridoxine, vitamin B6) kinase], Gene Registration Number (Genebank) ) CR 606430 [Pregnancy specific beta-1-glycoprotein 11], gene registration number (Genebank) BC025767 [Rhophilin, Rho GTPase binding protein 1], gene registration number (Genebank) AB007937 [Syndecan 3], gene registration number (Genebank) NM_022367 [Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A], genebank (Genebank) BX649005 [Serum / glucocorticoid regulated kinase], genebank (Genebank) BC063830 [ST6 (alpha) -N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 1], Genebank NM_013356 [Solute carrier family 16, member 8 (monocarboxylic) acid transporter 3)], Genebank NM_014585 [Solute carrier family 40 (iron-regulated transporter), member 1], Genebank BG648244 [Spermatogenesis associated 13], Genebank AK056709 [ Thrombospondin, type I, domain containing 3], gene registration number (Genebank) AY728143 [Transmembrane protein 16A], gene accession number (Genebank) BC052977 [Tumor necrosis factor receptor superfamily, member 1B], gene accession number (Genebank) AK023755 [Triggering receptor expressed on myeloid cells-like 2], gene accession number (Genebank) NM_016113 [Transient receptor potential cation channel, subfamily V, member 2], gene registration number (Genebank) AK122757 [Tubulin, beta 3], gene registration number (GEO) A_23_P124177, gene registration number (GEO) A_23_P210297, gene registration Number (Genebank) NM_003387 [WAS / WASL interacting protein family, member 1], gene registration number (Genebank) M23575 [Pregnancy specific beta-1-glycoprotein 3], gene registration number (Genebank) NM_002632 [Placental growth factor, vascular endothelial growth factor-related protein], Genebank AK096580 [CDNA FLJ39261 fis, clone OCBBF2009391], Genebank CD388102 [Similar to Placental tissue protein 13 (Placenta protein 13) (Galec tin-13)], Genebank NM_002288 [Leukocyte-associated Ig-like receptor 2], Genebank AB002308 [KIAA0310], Genebank AL136646 [Rho GTPase activating protein 24], Genebank AB208809 [Solute carrier family 13 (sodium / sulfate symporters), member 4], Genebank NM_004454 [Ets variant gene 5 (ets-related molecule)], Genebank AB075819 [ATPase, Class I, type 8B, member 4], Genebank NM_004235 [Kruppel-like factor 4 (gut)], Genebank AF450487 [Kinesin family member 21A], Genebank (Genebank) ) AK075130 [G protein-coupled receptor 1], Genebank CR601901 [Insulin-like 4 (placenta)], Genebank NM_022482 [Zinc finger protein 336], Genebank D90070 [ Phorbol-12-myristate-13-acetate-induced protein 1], Genebank X97758 [Rh o family GTPase 3], Genebank BC068585 [HERV-FRD provirus ancestral Env polyprotein], Genebank NM_000494 [Collagen, type XVII, alpha 1], Genebank NM_001005325 [Olfactory receptor, family 6, subfamily M, member 1], Genebank NM_004419 [Dual specificity phosphatase 5], Genebank R45075 [Transcribed locus, weakly similar to XP_219319.3 PREDICTED: similar to deleted in malignant brain tumors 1 [Rattus norvegicus]], Genebank BX649112 [COBL-like 1], Genebank AI939596 [Transcribed locus], Genebank NM_004561 [Ovo-like 1 (Drosophila) ], Genebank BG571732 [S100 calcium binding protein P], Genebank BX537382 [Solute carrier family 38, member 3], Genebank (Genebank) CR749205 [DKFZP686A01247 hypothetical protein], Gene accession number (Genebank) AK056776 Hypothetical protein FLJ32214, Genebank M57609 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome), Genebank BX386171 Chorionic gonadotropin, beta polypeptide 8, Genebank BC063127 [Pregnancy specific beta-1-glycoprotein 4], Genebank BX648582 [Sprouty homolog 2 (Drosophila)], Genebank NM_016569 [T-box 3 (ulnar mammary syndrome)], Gene accession number ( Genebank) NM_014365 [Heat shock 22kDa protein 8], Genebank AF056434 [CDNA FLJ12815 fis, clone NT2RP2002546], Genebank NM_002182 [Interleukin 1 receptor accessory protein], Genebank NM_004570 [ Phosphoinositide-3-kinase, class 2, gamma polypeptide], Genebank AK128505 [Keratin 7], Genebank ID (Genebank) AI074002 [Transcribed locus, strongly similar to NP_083546.1 Rho GTPase activating protein 2 4 isoform 1 [Mus musculus]], Genebank AK095632 [Ankyrin repeat and BTB (POZ) domain containing 2], Genebank (Genebank) NM_002356 [Myristoylated alanine-rich protein kinase C substrate], Gene accession number (Genebank) BC042755 [Regulator of G-protein signaling 2, 24kDa], gene registration number (Genebank) NM_033393 [KIAA1727 protein], gene registration number (Genebank) BC005839 [Follistatin-like 3 (secreted glycoprotein)], gene registration number ( Genebank) NM_031246 [Pregnancy specific beta-1-glycoprotein 2], Genebank AY358486 [Plexin domain containing 2], Genebank BM715650 [MRNA; cDNA DKFZp313O2015 (from clone DKFZp313O2015)], gene registration number (Genebank) NM_004155 [Serpin peptidase inhibitor, clade B (ovalbumin), member 9], gene registration number (Genebank) BC037275 [Tudor domain containing 4], gene registration number (Genebank) ) NM_001848 [Collagen, type VI, alpha 1], Genebank Y18483 [Solute carrier family 7 (cationic amino acid transporter, y + system), member 8], Genebank NM_004120 [Guanylate binding protein 2 , interferon-inducible], genebank BM923753 [Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in)], genebank AK075446 [26 serine protease], genebank (Genebank) NM_005668 [ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4], Genebank NM_001031802 [Similar to hypothetical testis protein from macaque], Genebank NM_016354 [Solute carrier organic anion transporter family , member 4A1], Genebank BC036846 [Protease, serine, 33], Genebank XM_371015 [Ubiquitin specific peptidase 43], Genebank NM_014590 [Endogenous retroviral family W, env (C7) , member 1 (syncytin)], Genebank AK097398 [Nucleobindin 2], Genebank NM_173675 [Hypothetical protein FLJ33708], Genebank NM_005975 [PTK6 protein tyrosine kinase 6], Gene registration Number (Genebank) AK021606 [CDNA FLJ11544 fis, clone HEMBA1002826], gene registration number (Genebank) NM_005935 [AF4 / FMR2 family, member 1], gene registration number (Genebank) NM_212482 [Fibronectin 1], gene registration number (Genebank) NM_001753 [Caveolin 1, caveolae protein, 22kDa], Genebank BX537968 [Hypothetical LOC51149], Genebank NM_181659 [Nuclear receptor coactivator 3], Genebank BX111520 [Transcribed locus], Gene registration time (Genebank) CR749722 [RAS p21 protein activator (GTPase activating protein) 1], the gene registered number (Genebank) AK128870 [Synapse defective 1, Rho GTPase, homolog 1 (C. elegans)], Genebank NM_022153 [Chromosome 10 open reading frame 54], Gene Registration Number (TIGR) THC2301901 [Zinc finger CCCH- type containing 3], Genebank NM_015117 [Zinc finger CCCH-type containing 3], Genebank AF343078 [ATPase family, AAA domain containing 3B], Gene Registration Number (Genebank) D89974 [Vanin 2], Gene Registration Number (Genebank) NM_001006946 [Syndecan 1], Gene Registration Number (Genebank) ) AY055760 [Decay accelerating factor for complement (CD55, Cromer blood group system)], gene accession number (Genebank) AB016901 [Chromosome 6 open reading frame 123], gene accession number (Genebank) AK096355 [Myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)], Genebank NM_182898 [CAMP responsive element binding protein 5], Genebank BC036890 [Grainyhead-like 3 (Drosophila)], Gene accession number (Genebank) AK094505 [Cysteine conjug ate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)], genebank number (Genebank) AB007940 [RAB GTPase activating protein 1-like], genebank number (Genebank) CR936755 [Guanylate binding protein 3], genebank number (Genebank) NM_006291 [ Tumor necrosis factor, alpha-induced protein 2], Genebank NM_006778 [Tripartite motif-containing 10], Genebank NM_020809 [Rho GTPase activating protein 20], Genebank BQ186674 [Hypothetical gene supported by AF086204], Genebank NM_003966 [Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A], gene registration number ( Genebank) BM810215 [Chorionic gonadotropin, beta polypeptide], Genebank NM_003167 [Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1], Gene accession number (Geneban k) NM_001620 [AHNAK nucleoprotein (desmoyokin)], gene accession number (Genebank) NM_004615 [Tetraspanin 7], gene accession number (Genebank) CR609484 [Kynureninase (L-kynurenine hydrolase)], gene accession number (Genebank) NM_014400 [LY6 / PLAUR domain containing 3], Genebank AB209845 [Transcription termination factor, RNA polymerase II], Genebank AK091125 [Hypothetical protein LOC162427], Genebank BX649103 [Chondroitin beta1,4 N- acetylgalactosaminyltransferase], Genebank AY217348 [Armadillo repeat containing 5], Genebank AK126079 [Zinc finger protein 692], Genebank AK096685 [Transforming growth factor, beta receptor associated protein 1], Genebank No. NM_198479 [Tetra-peptide repeat homeobox 1], Genebank No. AK127349 [Major histocompatibility complex, class I, C], Genebank No. AB02317 7 [KIAA0960 protein], Genebank AK126731 [Glucocorticoid induced transcript 1], Genebank NM_014619 [Glutamate receptor, ionotropic, kainate 4], Genebank R31293 [suppressor of cytokine signaling 2 ], Genebank AK055190 [Chromosome X open reading frame 36], Gene Accession Number (Genebank) BC038504 [SNF1-like kinase], Genebank Number NM_018018 [Solute carrier family 38, member 4], Gene Genebank AK123704 [Similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162], Genebank BX647357 [Iduronate 2-sulfatase (Hunter syndrome)], Gene accession number (Genebank) NM_001343 [Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)], Genebank (Genebank) NM_001904 [Catenin (cadherin-associated protein), beta 1, 88kDa], Genebank CR599551 [EF-hand domain family, member D1], Genebank AK172837 [Organic solute transporter alpha], Gene registration Number (Genebank) BC027456 [Similar to interspersed repeat antigen, putative], Gene Registration Number (Genebank) NM_001025598 [Rho GTPase activating protein 30], Gene Registration Number (Genebank) NM_001003793 [RNA binding motif, single stranded interacting protein], Gene registration Number (Genebank) AB022718 [Chromosome 10 open reading frame 10], gene registration number (Genebank) NM_023915 [G protein-coupled receptor 87], gene registration number (Genebank) NM_006200 [Proprotein convertase subtilisin / kexin type 5], Genebank XM_496826 [NHS-like 1], Genebank AK124904 [FYVE, RhoGEF and PH domain containing 6], Genebank NM_006317 [Brain abundant, membrane attached signal protein 1], Genebank AL136861 [Cysteine-rich secretory protein LCCL domain containing 2], Genebank (Genebank) AK222648 [Calbindin 2, 29kDa (calretinin)], Genebank (Kenebank) AK023628 [Hypothetical protein LOC199725 ], Genebank No. NM_006907 [Pyrroline-5-carboxylate reductase 1], Genebank No. CR622352 [Brain specific protein], Genebank No. BC030666 [Ring finger protein 182], Gene Registration No. ( Genebank) BC053619 [Arrestin domain containing 3], Genebank NM_003670 [Basic helix-loop-helix domain containing, class B, 2], Genebank NM_005576 [Lysyl oxidase-like 1], Gene registration Number (Genebank) AF217990 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, Genebank NM_182485 Cytoplasmic polyadenylation element binding protein 2, Genebank AK125877 [Hypothetical protein MGC27016] Number (Genebank) AK001879 [Hypothetical protein FLJ11017], gene registration number (Genebank) BG618056 [Transcribed locus], gene registration number (Genebank) AI741395 [MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)], Genebank AF291673 [Giant axonal neuropathy (gigaxonin)], Genebank AK056794 [Cytochrome P450, family 11, subfamily A, polypeptide 1], Genebank AF001893 [Trophoblast -derived noncoding RNA], Genebank NM_024342 [Glucocorticoid receptor DNA binding factor 1], Genebank NM_181645 [Hypothetical protein FLJ25393], Genebank AK092368 [Empty spiracles homolog 1 (Drosophila) , Genebank AB051464 [Kelch-like 15 (Drosophila)], Gene Registration Number (Genebank) NM_032484 [Homolog of mouse LGP1], Genebank NM_022371 [Torsin family 3, member A], Gene Genebank NM_002033 Fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific), Genebank AK125154 [Plexin A2], Genebank AK125559 [Zymogen granule protein 16], Gene Registration Genebank NM_176822 [NACHT, leucine rich repeat and PYD containing 14], Genebank NM_001620 [AHNAK nucleoprotein (desmoyokin)], Genebank AK097654 [SPT2, Suppressor of Ty, domain containing 1 ( S. cerevisiae)], Genebank NM_004821 [Heart and neural crest derivatives expressed 1], Genebank X89399 [RAS p21 protein activator 3], Genebank AK090470 [CD33 antigen (gp67)] , Genebank NM_018013 [Hypothetical protein FLJ10159], Genebank BC038369 [Interleukin 17 receptor D], Genebank AJ009985 [Annexin A9], Genebank AB032417 [Frizzled homolog 4 (Drosophila)], Genebank NM_003873 [Neuropilin 1], Genebank NM_015335 [Thyroid hormone receptor associated protein 2], Genebank NM_015270 [Adenylate cyclase 6], Gene accession number (Genebank) NM_001995 [Acyl-CoA synthetase long-chain family member 1], gene registration number (Genebank) NM_004457 [Acyl-CoA synthetase long-chain family member 3], gene registration number (Genebank) NM_005933 [Myeloid / lymphoid or mixed -lin eage leukemia (trithorax homolog, Drosophila)], Genebank NM_002843 [Protein tyrosine phosphatase, receptor type, J], Genebank AK023414 [Steroid 5 alpha-reductase 2-like], Gene Registration Number ( Genebank) U06936 [D site of albumin promoter (albumin D-box) binding protein], Genebank DQ097177 [HECT, UBA and WWE domain containing 1], Genebank AF234887 [Cadherin, EGF LAG seven -pass G-type receptor 2 (flamingo homolog, Drosophila)], Genebank BG483345 [Secretory leukocyte peptidase inhibitor], Genebank AK074614 [Insulin-like growth factor 2 (somatomedin A)], gene Genebank NR_000041 [RNA, U12 small nuclear], Genebank BC009383 [Kringle containing transmembrane protein 2], Genebank AY358127 [Leucine rich repeat and fibronectin type III domain containing 3], gene Registration Number (Genebank ) NM_007313 [V-abl Abelson murine leukemia viral oncogene homolog 1], Genebank AB020647 [F-box and leucine-rich repeat protein 7], Genebank NM_014476 [PDZ and LIM domain 3], Genebank (Genebank) AK123302 [CDNA FLJ41308 fis, clone BRAMY2042612], Genebank (Genebank) BC063872 [Tripartite motif-containing 9], Genebank AB007944 [Family with sequence similarity 20, member B], gene Genebank AK027155 [CDNA: FLJ23502 fis, clone LNG02862], Gene Registration Number (Genebank) NM_178556 [Hypothetical protein FLJ36180], Genebank NM_003617 [Regulator of G-protein signaling 5], Gene Registration Number ( Genebank) NM_001007271 [Dual specificity phosphatase 13], Gene Registration Number (Genebank) BC045642 [Metadherin], Gene Registration Number (Genebank) NM_001618 [Poly (ADP-ribose) polymerase family, member 1], Gene Registration Number (Genebank) AY358815 [ Neural cell adhesio n molecule 1], Genebank NM_000448 [Recombination activating gene 1], Genebank NM_178509 [Syntaxin binding protein 4], Genebank AB209376 [SATB family member 2], Gene accession number (GEO) A_24_P918364, Gene Registration Number (TIGR) THC2328806, Gene Registration Number (TIGR) THC2272137, Gene Registration Number (TIGR) THC2433340, Gene Registration Number (TIGR) THC2343493, Gene Registration Number (TIGR) THC2288230, Gene Registration Number (GEO) ) A_32_P145515, gene registration number (GEO) A_24_P921636. The marker gene according to claim 1, wherein the gene is increased in expression by treatment of teratogenic drug. Genebank (Genebank) NM_032199 [AT rich interactive domain 5B (MRF1-like)], Genebank (Genebank) BX647857 [Ankyrin repeat and SOCS box-containing 5], Genebank AB018258 [ATPase, Class V , type 10B], Genebank NM_013314 [B-cell linker], Genebank BG111592 [Transcribed locus], Genebank NM_203403 [Chromosome 9 open reading frame 150] (Genebank) AY268104 [Carboxylesterase 1 (monocyte / macrophage serine esterase 1)], gene registration number (Genebank) NM_000735 [Glycoprotein hormones, alpha polypeptide], gene registration number (Genebank) BC067746 [C-type lectin domain family 1, member A ], Genebank CR749536 [C-type lectin domain family 7, member A], Genebank AL136922 [ClpX caseinolytic peptidase X homolog (E. coli)], Genebank NM_001874 [ Carboxypeptidase M], Gene Registration Number (Geneban k) CR598482 [Chymotrypsin-like], Genebank NM_031226 [Cytochrome P450, family 19, subfamily A, polypeptide 1], Genebank NM_214462 [Dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)], Genebank AF177395 [Dickkopf homolog 2 (Xenopus laevis)], Genebank (Genebank) AL832598 [Erythrocyte membrane protein band 4.1-like 3], Genebank BX092581 [Developmental pluripotency associated 5], Genebank BC064700 [Estrogen-related receptor gamma], Genebank AF075292 [Fibroblast growth factor 18], Genebank NM_000162 [Glucokinase (hexokinase 4, maturity onset diabetes of the) young 2)], Genebank AB209105 [Huntingtin-associated protein 1 (neuroan 1)], Genebank AK057515 [CDNA FLJ32953 fis, clone TESTI2008099], Genebank AJ556711 [Immunoglobulin gamma h eavy chain variable region (IGHV3-30.3 gene), clone 2B 3G 02], Genebank R63061 [Keratin 23 (histone deacetylase inducible)], Genebank NM_007360 [Killer cell lectin-like receptor subfamily K , member 1], Genebank NM_007015 [Leukocyte cell derived chemotaxin 1], Genebank BC013438 [Hypothetical gene supported by BC013438], Genebank NM_003681 [Pyridoxal (pyridoxine, vitamin B6) kinase], Genebank CR606430 [Pregnancy specific beta-1-glycoprotein 11], Genebank number (Genebank) BC025767 [Rhophilin, Rho GTPase binding protein 1], Genebank AB007937 [Syndecan 3], Genebank No. NM_022367 [Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A], Genebank (Genebank) BX649005 [Serum / glucocorticoid regulated kinase], Gene registration Number (Ge nebank) BC063830 [ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 1], gene accession number (Genebank) NM_013356 [Solute carrier family 16, member 8 (monocarboxylic acid transporter 3)], Genebank NM_014585 [Solute carrier family 40 (iron-regulated transporter), member 1], Genebank BX648244 [Spermatogenesis associated 13], gene Genebank AK056709 [Thrombospondin, type I, domain containing 3], Gene accession number (Genebank) AY728143 [Transmembrane protein 16A], Gene accession number (Genebank) BC052977 [Tumor necrosis factor receptor superfamily, member 1B], Gene registration Number (Genebank) AK023755 [Triggering receptor expressed on myeloid cells-like 2], gene accession number (Genebank) NM_016113 [Transient receptor potential cation channel, subfamily V, member 2], gene accession number (Genebank) AK122757 [Tubulin, beta 3 ], Gene registration number (GEO) A_23_P1 24177, gene registration number (GEO) A_23_P210297, genebank number (Genebank) NM_003387 [WAS / WASL interacting protein family, member 1], genebank number M23575 [Pregnancy specific beta-1-glycoprotein 3], gene registration number (Genebank) NM_002632 [Placental growth factor, vascular endothelial growth factor-related protein], gene registration number (Genebank) AK096580 [CDNA FLJ39261 fis, clone OCBBF2009391], gene registration number (Genebank) CD388102 [Similar to Placental tissue protein 13 (Placenta) protein 13) (Galectin-13)], Genebank NM_002288 [Leukocyte-associated Ig-like receptor 2], Genebank AB002308 [KIAA0310], Genebank AL136646 [Rho GTPase activating protein 24], Genebank AB208809 [Solute carrier family 13 (sodium / sulfate symporters), member 4], Genebank NM_004454 [Ets variant gene 5 (ets-related molecule)], gene registration number (Genebank) AB 075819 [ATPase, Class I, type 8B, member 4], Genebank NM_004235 [Kruppel-like factor 4 (gut)], Genebank AF450487 [Kinesin family member 21A], Gene Registration Number ( Genebank) AK075130 [G protein-coupled receptor 1], Genebank CR601901 [Insulin-like 4 (placenta)], Genebank NM_022482 [Zinc finger protein 336], Genebank # G900 [Phorbol-12-myristate-13-acetate-induced protein 1], gene registration number (Genebank) X97758 [Rho family GTPase 3], gene registration number (Genebank) BC068585 [HERV-FRD provirus ancestral Env polyprotein], gene registration number (Genebank) NM_000494 [Collagen, type XVII, alpha 1], Genebank NM_001005325 [Olfactory receptor, family 6, subfamily M, member 1], Genebank NM_004419 [Dual specificity phosphatase 5], Gene Registration Number (Genebank) R45075 [Transcribed locus, weakly similar to XP_219319.3 PREDICT ED: similar to deleted in malignant brain tumors 1 [Rattus norvegicus]], gene accession number (Genebank) BX649112 [COBL-like 1], gene accession number (Genebank) AI939596 [Transcribed locus], gene accession number (Genebank) NM_004561 [ Ovo-like 1 (Drosophila)], Genebank BG571732 [S100 calcium binding protein P], Genebank BX537382 [Solute carrier family 38, member 3], Genebank (Genebank) CR749205 [DKFZP686A01247 hypothetical protein], Genebank AK056776 [Hypothetical protein FLJ32214], Genebank (Genebank) M57609 [GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)], Genebank BX386171 [Chorionic gonadotropin, beta polypeptide 8], Genebank BC063127 [Pregnancy specific beta-1-glycoprotein 4], Genebank BX648582 [Sprouty homolog 2 (Drosophila)], Genebank (Genebank) NM_016569 [T-box 3 (ulnar mam mary syndrome)], Genebank NM_014365 [Heat shock 22kDa protein 8], Genebank AF056434 [CDNA FLJ12815 fis, clone NT2RP2002546], Genebank NM_002182 [Interleukin 1 receptor accessory protein] , Genebank NM_004570 [Phosphoinositide-3-kinase, class 2, gamma polypeptide], Genebank AK128505 [Keratin 7], Genebank ID (Genebank) AI074002 [Transcribed locus, strongly similar to NP_083546. 1 Rho GTPase activating protein 24 isoform 1 [Mus musculus]], Genebank AK095632 [Ankyrin repeat and BTB (POZ) domain containing 2], Genebank (Genebank) NM_002356 [Myristoylated alanine-rich protein kinase C substrate ], Genebank BC042755 [Regulator of G-protein signaling 2, 24kDa], Genebank number (Genebank) NM_033393 [KIAA1727 protein], Genebank BC005839 [Follistatin-like 3 (secreted glycoprotein)] , Genebank NM_031246 [Pregnancy specific beta-1-glycoprotein 2], Genebank A (Genebank) AY358486 [Plexin domain containing 2], Genebank BM715650 [MRNA; cDNA DKFZp313O2015 (from clone DKFZp313O2015)], gene registration number (Genebank) NM_004155 [Serpin peptidase inhibitor, clade B (ovalbumin), member 9], gene registration number (Genebank) BC037275 [Tudor domain containing 4], gene registration number (Genebank) ) NM_001848 [Collagen, type VI, alpha 1], Genebank Y18483 [Solute carrier family 7 (cationic amino acid transporter, y + system), member 8], Genebank NM_004120 [Guanylate binding protein 2 , interferon-inducible], genebank BM923753 [Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in)], genebank AK075446 [26 serine protease], genebank (Genebank) NM_005668 [ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4], Genebank NM_001031802 [Similar to hypothetical testis protein from macaque], Genebank NM_016354 [Solute carrier organic anion transporter family , m ember 4A1], Genebank BC036846 [Protease, serine, 33], Genebank XM_371015 [Ubiquitin specific peptidase 43], Genebank NM_014590 [Endogenous retroviral family W, env (C7) , member 1 (syncytin)], Genebank AK097398 [Nucleobindin 2], Genebank NM_173675 [Hypothetical protein FLJ33708], Genebank NM_005975 [PTK6 protein tyrosine kinase 6], Gene registration Number (Genebank) AK021606 [CDNA FLJ11544 fis, clone HEMBA1002826], gene registration number (Genebank) NM_005935 [AF4 / FMR2 family, member 1], gene registration number (Genebank) NM_212482 [Fibronectin 1], gene registration number (Genebank) NM_001753 [Caveolin 1, caveolae protein, 22kDa], Genebank BX537968 [Hypothetical LOC51149], Genebank NM_181659 [Nuclear receptor coactivator 3], Genebank BX111520 [Transcribed locus], Gene registration time (Genebank) CR749722 [RAS p21 protein activator (GTPase activating protein) 1], the gene registered number (Genebank) AK128870 [Synapse defective 1, Rho GTPase, homolog 1 (C. elegans)], Genebank NM_022153 [Chromosome 10 open reading frame 54], Gene Registration Number (TIGR) THC2301901 [Zinc finger CCCH-type containing 3], Genebank NM_015117 [Zinc finger CCCH-type containing 3], Genebank AF343078 [ATPase family, AAA domain containing 3B], Gene Registration Number (Genebank) D89974 [Vanin 2], Gene Registration Number (Genebank) NM_001006946 [Syndecan 1], Gene Registration Number (Genebank) ) AY055760 [Decay accelerating factor for complement (CD55, Cromer blood group system)], gene accession number (Genebank) AB016901 [Chromosome 6 open reading frame 123], gene accession number (Genebank) AK096355 [Myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)], Genebank NM_182898 [CAMP responsive element binding protein 5], Genebank BC036890 [Grainyhead-like 3 (Drosophila)], Gene accession number (Genebank) AK094505 [Cysteine conjuga te-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)], genebank number (Genebank) AB007940 [RAB GTPase activating protein 1-like], genebank number (Genebank) CR936755 [Guanylate binding protein 3], genebank number (Genebank) NM_006291 [ Tumor necrosis factor, alpha-induced protein 2], Genebank NM_006778 [Tripartite motif-containing 10], Genebank NM_020809 [Rho GTPase activating protein 20], Genebank BQ186674 [Hypothetical gene supported by AF086204], Genebank NM_003966 [Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A], gene registration number ( Genebank) BM810215 [Chorionic gonadotropin, beta polypeptide], Genebank NM_003167 [Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1], Gene accession number (Geneban k) NM_001620 [AHNAK nucleoprotein (desmoyokin)], gene accession number (Genebank) NM_004615 [Tetraspanin 7], gene accession number (Genebank) CR609484 [Kynureninase (L-kynurenine hydrolase)], gene accession number (Genebank) NM_014400 [LY6 / PLAUR domain containing 3], Genebank AB209845 [Transcription termination factor, RNA polymerase II], Genebank AK091125 [Hypothetical protein LOC162427], Genebank BX649103 [Chondroitin beta1,4 N- acetylgalactosaminyltransferase], Genebank AY217348 [Armadillo repeat containing 5], Genebank AK126079 [Zinc finger protein 692], Genebank AK096685 [Transforming growth factor, beta receptor associated protein 1] , Genebank No. NM_198479 [Tetra-peptide repeat homeobox 1], Genebank No. AK127349 [Major histocompatibility complex, class I, C], Genebank No. AB0231 77 [KIAA0960 protein], Genebank AK126731 [Glucocorticoid induced transcript 1], Genebank NM_014619 [Glutamate receptor, ionotropic, kainate 4], Genebank R31293 [suppressor of cytokine signaling 2 ], Genebank AK055190 [Chromosome X open reading frame 36], Genebank (Genebank) BC038504 [SNF1-like kinase], Genebank NM_018018 [Solute carrier family 38, member 4], Gene Genebank AK123704 [Similar to pleckstrin homology domain containing, family M (with RUN domain) member 1; adapter protein 162], Genebank BX647357 [Iduronate 2-sulfatase (Hunter syndrome)], Gene accession number (Genebank) NM_001343 [Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)], Genebank (Genebank) NM_001904 [Catenin (cadherin-associated protein), beta 1, 88kDa], Genebank CR599551 [EF-hand domain family, member D1], Genebank AK172837 [Organic solute transporter alpha], Gene registration Number (Genebank) BC027456 [Similar to interspersed repeat antigen, putative], Gene Registration Number (Genebank) NM_001025598 [Rho GTPase activating protein 30], Gene Registration Number (Genebank) NM_001003793 [RNA binding motif, single stranded interacting protein], Gene registration Number (Genebank) AB022718 [Chromosome 10 open reading frame 10], gene registration number (Genebank) NM_023915 [G protein-coupled receptor 87], gene registration number (Genebank) NM_006200 [Proprotein convertase subtilisin / kexin type 5], Genebank XM_496826 [NHS-like 1], Genebank AK124904 [FYVE, RhoGEF and PH domain containing 6], Genebank NM_006317 [Brain abundant, membrane attached signal protein 1], Genebank AL136861 [Cysteine-rich secretory protein LCCL domain containing 2], Genebank (Genebank) AK222648 [Calbindin 2, 29kDa (calretinin)], Genebank (Kenebank) AK023628 [Hypothetical protein LOC199725 ], Genebank No. NM_006907 [Pyrroline-5-carboxylate reductase 1], Genebank No. CR622352 [Brain specific protein], Genebank No. BC030666 [Ring finger protein 182], Gene Registration No. ( Genebank) BC053619 [Arrestin domain containing 3], Genebank NM_003670 [Basic helix-loop-helix domain containing, class B, 2], Genebank NM_005576 [Lysyl oxidase-like 1], Gene registration Number (Genebank) AF217990 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, Genebank NM_182485 Cytoplasmic polyadenylation element binding protein 2, Genebank AK125877 [Hypothetical protein MGC27016] Number (Genebank) AK001879 [Hypothetical protein FLJ11017], gene registration number (Genebank) BG618056 [Transcribed locus], gene registration number (Genebank) AI741395 [MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)], Genebank AF291673 [Giant axonal neuropathy (gigaxonin)], Genebank AK056794 [Cytochrome P450, family 11, subfamily A, polypeptide 1], Genebank AF001893 [Trophoblast -derived noncoding RNA], Gene Registration Number (TIGR) THC2343493, Gene Registration Number (TIGR) THC2288230, Gene Registration Number (GEO) A_32_P145515, Gene Registration Number (GEO) A_24_P921636. The marker gene according to claim 1, wherein the following genes are reduced in expression by treatment of teratogenic drugs. Genebank No. NM_005971 [FXYD domain containing ion transport regulator 3], Genebank No. AK096306 [Hypothetical protein MGC3032], Genebank No. AF239668 [Cholecystokinin B receptor], Genebank No. (Genebank) AK000652 [Chromosome 20 open reading frame 57], Genebank NM_138703 [Melanoma antigen family E, 2], Gene Accession Number (Genebank) AJ007798 [Stromal antigen 3], Gene Accession Number (Genebank) NM_024342 [Glucocorticoid receptor DNA binding factor 1], Genebank number NM_181645 [Hypothetical protein FLJ25393], Genebank number AK092368 [Empty spiracles homolog 1 (Drosophila)], Genebank number AB051464 [Kelch-like 15 (Drosophila)] , Genebank NM_032484 [Homolog of mouse LGP1], Genebank NM_022371 [Torsin family 3, member A], Genebank NM_002033 [Fucosyltransferase 4 (alpha (1,3) ) fucosyltransferase, myeloid-specific), genebank AK125154 [Plexin A2], genebank AK125559 [Zymogen granule protein 16], genebank NM_176822 [NACHT, leucine rich repeat and PYD containing 14], Genebank NM_001620 [AHNAK nucleoprotein (desmoyokin)], Genebank AK097654 [SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)], Genebank NM_004821 [Heart and neural crest derivatives expressed 1], Genebank X89399 [RAS p21 protein activator 3], Genebank AK090470 [CD33 antigen (gp67)] , Genebank NM_018013 [Hypothetical protein FLJ10159], Genebank BC038369 [Interleukin 17 receptor D], Genebank AJ009985 [Annexin A9], Genebank AB032417 [Frizzled homolog 4 (Drosophila)], Genebank NM_003873 [Neuropilin 1], Genebank NM_015335 [Thyroid hormone receptor associated protein 2], Genebank NM_015270 [Adenylate cyclase 6], Gene accession number (Genebank) NM_001995 [Acyl-CoA synthetase long-chain family member 1], gene registration number (Genebank) NM_004457 [Acyl-CoA synthetase long-chain family member 3], gene registration number (Genebank) NM_005933 [Myeloid / lymphoid or mixed -lin eage leukemia (trithorax homolog, Drosophila)], Genebank NM_002843 [Protein tyrosine phosphatase, receptor type, J], Genebank AK023414 [Steroid 5 alpha-reductase 2-like], Gene Registration Number ( Genebank) U06936 [D site of albumin promoter (albumin D-box) binding protein], Genebank DQ097177 [HECT, UBA and WWE domain containing 1], Genebank AF234887 [Cadherin, EGF LAG seven -pass G-type receptor 2 (flamingo homolog, Drosophila)], Genebank BG483345 [Secretory leukocyte peptidase inhibitor], Genebank AK074614 [Insulin-like growth factor 2 (somatomedin A)], gene Genebank NR_000041 [RNA, U12 small nuclear], Genebank BC009383 [Kringle containing transmembrane protein 2], Genebank AY358127 [Leucine rich repeat and fibronectin type III domain containing 3], gene Registration Number (Genebank ) NM_007313 [V-abl Abelson murine leukemia viral oncogene homolog 1], Genebank AB020647 [F-box and leucine-rich repeat protein 7], Genebank NM_014476 [PDZ and LIM domain 3], Genebank No. AK123302 [CDNA FLJ41308 fis, clone BRAMY2042612], Genebank No. BC063872 [Tripartite motif-containing 9], Genebank AB007944 [Family with sequence similarity 20, member B], Genebank No. AK027155 [CDNA: FLJ23502 fis, clone LNG02862], Genebank No. (Genebank) NM_178556 [Hypothetical protein FLJ36180], Genebank No. NM_003617 [Regulator of G-protein signaling 5], Gene Registration No. (Genebank) NM_001007271 [Dual specificity phosphatase 13], gene registration number (Genebank) BC045642 [Metadherin], gene registration number (Genebank) NM_001618 [Poly (ADP-ribose) polymerase family, member 1], gene registration number (Genebank) AY358815 Neural cell adhesio n molecule 1], Genebank NM_000448 [Recombination activating gene 1], Genebank NM_178509 [Syntaxin binding protein 4], Genebank AB209376 [SATB family member 2], Gene accession number (GEO) A_24_P918364, Gene Registration Number (TIGR) THC2328806, Gene Registration Number (TIGR) THC2272137, Gene Registration Number (TIGR) THC2433340. The marker gene according to claim 1, wherein the teratogenic drug is thalidomide. A DNA microarray chip for teratogenicity-induced drug search in which an oligonucleotide or its complementary strand molecule including all or a portion of the marker gene sequence of claim 1 is integrated. 1) treating the test compound to human uterine tissue-derived cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) labeling the experimental group and the control group with different fluorescent materials while synthesizing the RNA of the experimental group and the control group of step 2) with cDNA; 4) hybridizing cDNA labeled with the different fluorescent materials of step 3) with the DNA microarray chip of claim 5; 5) analyzing the reacted DNA microarray chip of step 4); And 6) teratogenic drug search method comprising the step of confirming the expression level of the marker gene of claim 1 in the analyzed data of step 5) compared to the control. The method of claim 6, wherein the human uterine tissue-derived cells of step 1) are human placental chorionic cancer cells or placental cells. The method of claim 6, wherein the fluorescent material of step 3) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). Search method characterized in that. 1) treating the test compound to human uterine tissue-derived cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) real-time reverse transcript polymerase chain reaction (RT-PCR) using a primer complementary to the marker gene of claim 1 and amplifying the marker gene, using the RNA of step 2); 4) teratogenic drug search method comprising the step of confirming the expression level compared to the amplification product of step 3). 10. The method of claim 9, wherein the human uterine tissue-derived cells of step 1) are human placental chorionic cancer cells or placental cells. 10. The method of claim 9, wherein the primer of step 3) comprises a primer that is complementary to the marker gene and capable of amplifying the marker gene. Teratogenicity-inducing drug search kit comprising a DNA microarray chip of claim 5. 13. The kit of claim 12, further comprising human placental chorionic cancer cells or human uterine tissue derived cells of the placental cells. Teratogenicity-induced drug search kit comprising a primer capable of amplifying a marker gene and complementary to the marker gene of claim 1. The kit for teratogenic drug search according to claim 14, wherein the primers are two or more forward and reverse directions selected from the group consisting of the sequences set forth in SEQ ID NOs: 1-18.

Images