KR20080105792A - Implants for reconstructing mucosal lumen - Google Patents

Abstract

An implant for reconstructing mucosal lumen is provided to allow the damaged inner cavity of the mucosa of respiratory organ to be reconstructed effectively. An implant for reconstructing mucosal lumen contains the squamous epithelial cell as an effective ingredient. Preferably the squamous epithelial cell is prepared by cultivating and proliferating the epithelial cell in the retinoic acid (RA)-containing culture medium; and cultivating the proliferated epithelial cell in the retinoic acid-member culture medium so as to differentiate it to the squamous epithelial cell.

Description

Implants for Reconstructing Mucosal Lumen

FIG. 1 shows the results of keratinized squamous epithelium from human nasal epithelial cells and differentiation from squamous epithelium to mucociliary epithelium by retinoic acid by histological and scanning electron microscopy.

FIG. 2 shows the results of reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of markers of squamous and mucociliary differentiation during transmutation in nasal epithelial cells.

Figure 3 shows an example of maxillofacial reconstruction using conventional skin grafts and cultured nasal squamous epithelial platelets on the intimate glass root flap grafts. (A) Actual cultured squamous cell plate (2.4 cm diameter) to be used for reconstruction after elevation. (B) Histological analysis of squamous cell plate. (C) Squamous cell plate cultured on the forearm muscle of maxillary sinus cancer patient was transplanted 10 days before the reconstruction procedure (black arrow). (D) Schematic diagram of cultured squamous epithelium (black arrow) cell plate on forearm. The clerk indicates where the skin is to be transplanted. (E) Schematic diagram of reconstruction procedure with forearm glass flap graft. Cultured nasal epithelial cell plate (black arrow) and skin graft (S) are shown. (F) One year after the reconstructive procedure, the image was obtained using a 70-degree endoscopy. The location where the skin is implanted (white arrow) and the location where the cultured nasal squamous epithelium is implanted (black arrow) are observed. The location of the cultured nasal squamous epithelium was differentiated into healthy and normal nasal mucociliary epithelium. This result is a representative example of three cases.

4 shows trait changes of transplanted squamous cell plate. (A) Histological findings of squamous cells before transplantation. (B) Immunofluorescence staining of p63 protein showing basal cells in the cell plate to be transplanted. (C) Histological differentiation of squamous cells one month after reconstruction. (D) Histological findings showing that all squamous cells differentiated into mucosal ciliary epithelial cells 3 months after reconstruction. (E) Immunofluorescence staining of p63 protein showing an increase in basal cells after engraftment of cell plates. (F) Scanning electron microscopy findings of platelet grafts fully differentiated into mucociliary epithelial cells 3 months after reconstruction. This result is a representative example of three cases.

The present invention relates to implants for mucosal lumen reconstruction, in particular implants for respiratory mucosal reconstruction.

Complex reconstruction of the head and neck, particularly the respiratory mucosal defects, is essential for patients with sinonasal or tracheal tumors. These surgical defects can be successfully reconstructed by incorporating a glass root flap graft and a skin graft into the mucosal defect (1, 2). In respiratory defects, especially airway tumors and stenosis, skin can be used as a graft for reconstruction of mucosal defects after resection (3).

To date, skin is the most widely used material for reconstructing defects in the respiratory mucosa (4, 5). However, there are some serious problems with the use of the skin as a substitute for ciliated columnar epithelium present along the lumen of the respiratory tract. The problems are atrophy of the implant, desquamation, regrowth of hair and an unpleasant odor (6, 7).

Since ciliated columnar epithelium is the most physiologically suitable tissue for reconstruction of the lumen of the respiratory tract, the present inventors tried to use the cultured nasal ciliary columnar epithelium as it was without success, because the cultured ciliated columnar epithelial cells were sutured. It doesn't have enough strength to do so.

In our previous experiments, we have identified that nasal mucociliary epithelial cells can be differentiated into squamous epithelium such as skin under retinophosphate-deficient culture conditions (8) and squamous epithelium by supplementing retinoic acid to the medium Recovery from the mucociliary columnar epithelium was observed.

Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the level of the technical field to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method capable of efficiently making defects in the mucosal lumen, in particular, reconstruction of the respiratory mucosa. As a result, the present invention has been completed by confirming that mucosal defects can be efficiently reconstructed without problems of conventional skin grafts.

It is therefore an object of the present invention to provide an implant for mucosal lumen reconstruction.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to an aspect of the present invention, the present invention provides a mucosal lumen reconstruction (implant) comprising a squamous epithelial cell as an active ingredient.

The present inventors have sought to develop a method capable of efficiently reconstructing mucosal lumen, particularly respiratory mucosal lumen. As a result, when transplanting the graft containing squamous epithelium to the mucosal defect site, it was confirmed that the mucosal defect can be efficiently reconstructed without the problem of conventional skin transplantation such as the formation of crust.

The present invention is applied to the respiratory tract in which mucus ciliated cells are lining in organs in vivo.

According to a preferred embodiment of the present invention, squamous epithelial cells used in the present invention comprises the steps of (a) culturing and proliferating epithelial cells in a retinoic acid (RA) -containing medium; And (b) culturing the proliferated epithelial cells in a retinoic acid-free medium to differentiate into squamous cells.

According to a preferred embodiment of the present invention, step (b) is carried out in two steps in the process of obtaining squamous cells.

The first step is incubated in submerge conditions. Under submerge conditions, the epithelial cells seeded in the medium are cultured with the maximum possible amount of culture. Under these conditions, factors affecting the epithelial cells will act through the culture.

The second step is then carried out in semi-dry conditions. Under semi-dry conditions, the epithelial cells seeded in the medium are cultured with the minimum possible amount of culture. In this condition, the vesicle is covered as thinly as possible just above the epithelial cell layer, and the factors affecting the epithelial cell layer act through the culture medium and the air.

According to a preferred embodiment of the present invention, the manufacturing process of the squamous epithelial cells does not use a feeder cell layer (eg, 3T3 cells). This feature has the advantage of eliminating side effects caused by heterogeneous cells when the implant of the present invention is applied to the human body.

According to a specific embodiment of the present invention for obtaining nasal squamous epithelial cells or nasal squamous epithelium from nasal epithelial cells, a manufacturing process of squamous epithelial cells will be described. As follows:

Nasal mucosa samples are obtained from the nose and then nasal mucosa samples are treated with proteases to dissociate nasal epithelial cells. Subsequently, fibroblasts, endothelial cells and red blood cells are removed from the isolated nasal epithelial cell sample. Then, in the respiratory epithelial medium containing hydrocortisone 21-hemisuccinate, insulin, transferrin, epinephrine hydrochloride, 3,3 ', 5-triiodothyronine, gentamycin sulfate and amphotericin B, the epithelium Nasal epithelial cells are cultured and expanded in medium supplemented with growth factors, all-trans-retinoic acid and bovine serum albumin. The cultured nasal epithelial cells are then cultured in respiratory epithelial medium without retinoic acid to obtain squamous cells. Cultivation for obtaining squamous epithelial cells is preferably carried out in two stages. In the first stage, the cells are cultured in submerge conditions. Under submerge conditions, the epithelial cells seeded in the medium are cultured with the maximum possible amount of culture. The second step is then carried out in semi-dry conditions. Under semi-dry conditions, the epithelial cells seeded in the medium are cultured with the smallest possible amount of culture.

In this way a squamous cell yield as compared to mucosa ciliated epithelial cells exhibits high cor nipin -α (cornifin-α) gene expression, shows a low and MUC8 MUC5AC gene expression. More specifically, the MUC5AC gene and MUC8 gene are rarely expressed in squamous epithelial cells used in the present invention.

According to a preferred embodiment of the present invention, the squamous epithelial cells used in the present invention are keratinized squamous epithelial cells.

According to a preferred embodiment of the present invention, the squamous epithelial cells used in the present invention are differentiated into mucociliary epithelial cells when transplanted in vivo to reconstruct mucosal defects.

As squamous epithelial cells used in the present invention, other cells or autologous cells may be used, but are preferably autologous cells isolated from the patient itself. In the case of using autologous squamous epithelial cells, immune rejection does not occur, which is very advantageous.

According to a preferred embodiment of the invention, the mucosal defect reconstruction implant of the invention is applied to the reconstruction of a respiratory mucosal defect. In this case, nasal squamous epithelial cells are used.

Implants of the present invention can be produced in a variety of forms depending on the condition, shape and size of the affected area (ie, location to be implanted). Preferably, the implant has the form of squamous cell plate. Squamous epithelial cell plates are difficult to handle because of their thin thickness. Therefore, when transplanting squamous cell plate to the affected area, it is preferable to transplant the squamous cell plate using petrolatum gauze or a biodegradable polymer compound as a support.

When the size of the mucosal defect to be implanted of the present invention is large (eg, when the tumor is removed from a patient with a sinus or tracheal tumor), a three-dimensional free radical flap technique commonly known in the art (Piantanida, R. , et al, Reconstruction of major orbital -maxillary defects with free latissimus dorsi myocutaneous flap Facial Plast Surg 15:........ 297 (1999); Pribaz, JJ, et al, Plast Reconstr Surg 93: 285 (1994 )) Can be applied to the mucosal defect site.

The implant of the present invention was developed for the purpose of implanting directly into a mucosal defect site. Suitable dosages of the implants of the present invention may be prescribed in various ways, such as by the method of formulation, mode of administration, age, weight, sex, morbidity, condition of the patient, food, time of administration, route of administration and response. The number of squamous cells to be transplanted is not particularly limited, and for example, squamous cells can be transplanted with the number of 1 × 10 ⁴ -1 × 10 ¹⁰ cells.

Squamous epithelial cells contained in the graft of the present invention implanted in the affected area is differentiated into mucociliary epithelial cells, and by forming a tight junction with the surrounding cells at the site of transplantation to regenerate the normal mucosa to reconstruct the mucosal lumen.

Implants for reconstructing the mucosal defects of the present invention can be applied to organs having a mucosal lumen structure covered by mucociliary cells. For example, it can be applied to the respiratory tract (respiratory tract), stomach, small intestine, and large intestine to effectively rebuild mucosal lumen. Most preferably, the mucosal lumen reconstruction implant of the present invention is used for reconstruction of the respiratory lumen.

The implant for mucosal lumen reconstruction of the present invention has the advantage that, unlike the conventionally used skin graft, hardly induces crust formation or mucus stagnation after transplantation. The implant of the present invention is implanted in vivo to form mucociliary epithelial cells, which inhibits the formation of crust due to the movement of the ciliated on these epithelial cells.

To date, the materials used for the reconstruction of the mucosal lumen are skin and mucous ciliary epithelial cells. However, skin grafts have problems such as atrophy, exfoliation, hair regrowth and the formation of crusts, and mucociliary epithelial cell transplants are difficult to handle because of their low strength and are not sutured well at the site of implantation.

The implant of the present invention completely solves the problems of the skin and mucosal ciliary epithelial cell implants described above. That is, the implant of the present invention is free from problems such as atrophy, exfoliation and crust formation, has sufficient strength and is easier to handle than mucociliary epithelial grafts, and forms a tight bond with surrounding cells at the implantation site. do.

The features and advantages of the present invention are summarized as follows:

(a) The implant of the present invention uses squamous epithelial cells as an active ingredient to reconstruct the mucosal lumen.

(b) The implant of the present invention is transplanted into the affected area, differentiates into mucociliary epithelial cells, and forms a tight junction with surrounding cells to regenerate normal mucosa.

(c) The implant of the present invention, after implantation into the affected area, differentiates into mucociliary epithelial cells and hardly induces epidermal formation or mucus retention due to ciliary movement on epithelial cells.

(d) Since the squamous epithelial cells used in the implant of the present invention can be cultured and proliferated without a feeder cell layer, the implant of the present invention can be produced in a carrier-free form, thereby Side effects can be eliminated.

(e) Implants of the invention are particularly advantageous for reconstructing the respiratory lumen.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Experimental Materials and Experimental Methods

From the patient Nasal epithelial  Isolation and propagation

After obtaining the approval of the Institutional Review Board (IRB) of Yonsei University College of Medicine for the process described in this study, the inventors conducted the study with the consent of three maxillary cancer patients. For isolation and proliferation of nasal epithelial cells, the nasal mucosa sample is first used as a middle turbinate opposite the maxillary sinus tumor (1 patient with adenocystic carcinoma and 2 patients with squamous cell carcinoma). From). To isolate epithelial cells, nasal mucosal samples were 1: 1 of DMEM / F12 (Dulbecco's modified Eagle's medium and Ham's nutrient F12) supplemented with penicillin G sodium (50 IU / Ml) and streptomycin sulfate (50 μg / ml). The mixed cultures were treated with 1.0% Pronase (type XIV protease, Sigma-Aldrich, St. Louis, Mo.) at 4 ° C. for 16-20 hours. Isolated epithelial cells were washed three times in antibiotic-containing DMEM / F12 and suspended in DMEM / F12 supplemented with antibiotics and 10% fetal calf serum. The cells were then plated in a plastic culture dish at 37 ° C. for 1 hour to remove fibroblasts, endothelial cells and red blood cells. Suspended epithelial cells were plated and reseeded at a 3 × 10 ⁴ cell density (500 cells per cm ² ) per culture dish. The medium used was respiratory epithelial medium (BEGM; Clonetics Corp., Walkersville, MD), which was hydrocortisone 21-hemisuccinate (0.5 μg / ml), insulin (5 μg / ml), transferrin (10 μg). / ml), epinephrine hydrochloride (0.5 μg / ml), 3,3 ′, 5-triiodothyronine (6.5 ng / ml), gentamycin sulfate (50 μg / ml) and amphotericin B (50 μg / ml), epidermal growth factor (EGF; 25 ng / ml; Collaborative Research, Bedford, Mass.), all-trans-retinoic acid (10 ^-7 mol / L; Sigma-Aldrich) and bovine serum albumin (1.5 μg) / mL; Sigma-Aldrich). Cultures were maintained in an incubator of 5% carbon dioxide at 37 ° C. After seeding, the medium was replaced on the first day, and then the medium was changed every other day until the culture reached 50-60% confluency. Then, the cells were separated using EDTA (Clonetics Corp., San Diego, Calif.). The cell number was determined by hemocytometry, and the cells were plated twice. When the Passage 2 cell culture reached 50-60% confluence, cells were again isolated (9).

Squamous  Induce differentiation in vitro

Passage 2 nasal epithelial cells (10 ⁵ cells per culture, 2 x 10 per cm 2) obtained from the patient in 0.5 ml of medium on the surface of a 24.5-mm transwell clear culture insert (CostarCo., Cambridge, Mass.) With 0.45 μm pore size. ⁴ cells) were seeded.

Cells were cultured in a 1: 1 mixed culture of BEGM: DMEM containing 0.5 ng / ml EGF, not including retinoic acid, containing the same concentrations of the aforementioned supplements. The first 9 days were incubated in submerge conditions, the medium was replaced on day 1 and then once every 2 days. On day 9 of culture, the upper medium was removed and the culture was fed only from the lower part to form an air-liquid boundary culture. To obtain squamous epithelium, retinophosphate-deficient media was replaced daily after formation of air-liquid boundary cultures up to 14 days after confluence.

Sack Glass Root Flap Graft  On carrier -absence Nasal epithelium Cell plate  Transplant and Reconstruction

On day 14 of cell culture reaching confluence, the cultured nasal squamous epithelium is lifted from each culture insert using a giant bed, placed on petrolatum gauze, and then sutured inside the right forearm glass root flap graft. 3C and 3D, and then placed on one side of the nose for reconstructive surgery. To compare the clinical results of cultured nasal squamous epithelium grafts and skin grafts (often used for reconstruction of the respiratory lumen, 10), skin from the right thigh was implanted under the cultured nasal epithelium. Ten days later, a maxillofacial reconstruction was performed. The reason for the staged surgery was to determine whether the cultured squamous cell plate engrafted after transplantation before reconstruction. After confirming well engraftment, the present inventors completely removed the tumor including the maxilla and the skin. Finally, the cultured nasal squamous epithelium implanted forearm vitreous flap was sutured to the mucosal defect site from which the maxilla was removed and reconstructed so as to be located on one side of the nasal cavity from which the transplanted cell plate and skin graft were removed (FIG. 3E). .

MUC5AC , MUC8  And Krinipine RT- for -α PCR  Amplification

Oligonucleotide primers were constructed using the following known sequences: mucin differentiation marker (9), mucin gene 5AC (MUC5AC GenBank accession No. U06711, 680 bp, 5 'primer: TCCGGCTCCATCTTCTCC, 3' primer: ACTTGGGCACTGGTGCTG), Cilia differentiation marker (11) mucin gene 8 (MUC8 GenBank accession No. U14383, 239 bp, 5 'primer: ACAGGGTTTCTCCTCATTG, 3' primer: CGTTTATTCCAGCACTGTTC), and squamous cell marker, cornipin-α (GenBank accession No. BC056240, 172 bp, 5 'primer: CATTCTGTCTCCCCCAAAAA, 3' primer: ATGGGGGTATAAGGGAGCTG). Oligonucleotide cancer plymer against β2 microglobulin (β2M Clontech Laboratories Inc., Palo Alto, Calif.) was used as a control gene for RT-PCR. RT-PCRs were performed using a Perkin Elmer Cetus DNA Thermal Cycler (Perkin Elmer, Wellesley, Mass.) And performed according to the manufacturer's recommendations. Annealing was performed for 1 minute at 55 ° C. for MUC8 and cornipine-α and for 1 minute at 60 ° C. for MUC5AC and β2M. The stretch reaction was carried out at 72 ° C. for 1 minute. Comparative kinetic analysis was performed to determine mRNA levels for each gene in each culture set. PCR products were separated by electrophoresis on 2% Seakem agarose gel (FMC; Rockland, ME) containing 50 ng / ml ethidium bromide and photographed on Polaroid Type 55 films. The same experiment was repeated three times.

Histological examination, Immunofluorescence  Staining and Scanning Electron Microscopy Analysis

In order to obtain a biosample for determining histological traits, nasal tissue biopsy was performed under an endoscope at intervals of 1 month and 3 months after reconstruction. Samples were fixed in 10% neutral buffered formalin, sections were 5 μm thick and then stained with hematoxylin-eosin. For immunofluorescence staining, adjacent sections were cloned into monoclonal anti-p63 antibodies (4A4, Santa Cruz Biotechnology, Santa Cruz, CA) and fluorescein isothiocyanate-labeled secondary antibody (Jackson ImmunoResearch Laboratories Inc., West Grove, PA ). Equal concentrations of nonspecific IgG were used as negative controls. For scanning electron microscopy, samples were fixed by exposure to chilled 2.5% glutaraldehyde for 4-6 hours and washed with 0.1 M phosphate-buffered saline. Post-fixation was performed by exposing the cells to 1% osmium tetroxide for 2 hours. Then, the sample was observed under the runner electron microscope (H-800, Hitachi, Ibaraki, Japan).

Experiment result

Squamous epithelium  In vitro and Retinoic acid  Variation of Mucociliary Epithelium by

Nasal epithelial cells were completely differentiated into squamous epithelium containing keratin layers in retinoic acid-free medium (FIG. 1). By treating retinoic acid on completely differentiated squamous epithelial cells, keratin layers began to peel off from keratinized squamous epithelium 2 days after retinoic acid treatment, and differentiated squamous epithelial cells were detached until day 4 of treatment. At 7 days of treatment, the epithelium differentiated into cuboidal epithelium with cilia, which ultimately differentiated into ciliary columnar epithelium with abundant cilia (FIG. 1).

In nasal epithelial cells  During transmutation Flat  And mucociliary differentiation Marker  Expression

In retinophosphate-free cultures, MUC5AC and MUC8 gene expression decreased over time, and cornipine- α gene expression increased over time. In keratinized squamous epithelium, the MUC5AC and MUC8 genes were expressed at least levels and the cornipine- α gene expression was high. However, after RA treatment, cornipine- α gene expression was It drastically decreased, and MUC5AC and MUC8 gene expression increased over time. In mucociliary epithelium, the cornipine- α gene was expressed at a minimum level and the MUC5AC and MUC8 genes were expressed at high levels (FIG. 2).

Squamous epithelium Cell plate  Fabrication, after biotransplantation Cell plate  Engraftment and transformation

Previously, we used mucociliary epithelial cell plates for transplantation, but these cell plates were not strong enough to suture for transplantation. However, cultured squamous epithelium platelets (FIGS. 3A and 3B) were well sutured to the graft muscle fragments during reconstructive procedures, which were observed under surgical microscope (Figures for the location of squamous cell plate and skin grafts, FIGS. 3C, 3D). And 3e).

Epithelial cell plate showed a phenotype of a typical squamous epithelium containing a keratinous layer upon reconstruction (FIG. 4A). By 1 month after the procedure, the transplanted squamous epithelium platelets differentiated into cubic epithelium (FIG. 4C). Three months after the procedure, the cubic epithelium was further differentiated into ciliary cone epithelium (FIGS. 4D and 4F), which is a typical phenotype of human respiratory epithelium. Three months after the procedure, no crust or mucus stagnation, which is commonly observed when skin grafts were used for respiratory lumen reconstruction, was observed. In addition, the number of basal cells expressing p63 was increased, indicating that most of the basal cells were p63-positive (FIGS. 4B and 4E).

One year after the reconstructive procedure, the endoscopy image obtained by 70-degree endoscopy (FIG. 3f) showed that the cultured squamous epithelium (black arrow) was implanted in the upper part of the nasal cavity and the skin (white arrow) was implanted in the lower part of the nasal cavity. Able to know. It can be clearly confirmed that the site transplanted into squamous cell plate was regenerated into the nasal mucosa with normal appearance. Since autologous nasal epithelial cells were used for cell plate transplantation, there was no immune response or host rejection in the mucosa. Most importantly, all three cases had no clinical abnormalities over a 12 month period.

As described in detail above, the implant of the present invention is transplanted into the affected area, differentiated into mucociliary epithelial cells, and regenerated into normal mucosa by forming a tight junction with surrounding cells. In addition, the implants of the present invention, after implantation into the affected area, differentiate into mucin ciliary epithelial cells and hardly induce epidermal formation or mucus retention due to ciliary movement on epithelial cells. Implants of the invention are particularly advantageous for reconstructing mucosal defects of the respiratory lumen.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Reference

1.Piantanida, R., Roselli, R., Pellini, R., Ferrario, F., Boschini, P., and Spriano, G. Reconstruction of major orbital-maxillary defects with free latissimus dorsi myocutaneous flap. Facial Plast. Surg. 15, 297, 1999.

2. Pribaz, J. J., Morris, D. J., and Mulliken, J. B. Three-dimensional folded free-flap reconstruction of complex facial defects using intraoperative modeling. Plast. Reconstr. Surg. 93, 285, 1994.

Duff, B.E., Wenig, B.L., Applebaum, E.L., Yeates, D.B., Wenig, B.M., and Holinger, L.D. Tracheal reconstruction using an epithelial equivalent. Laryngoscope 104, 409, 1994.

4.Andhoga, M.A., Wilson, G.R., McLaughlin, W., and McLean, N.R. Split-thickness skin grafted stent for upper airway patency after medial maxillectomy. Br. J. Oral Maxillofac. Surg. 31, 385, 1993.

5. Eliachar, I., Sebek, B.A., Levine, S., and Tucker, H.M. Histologic changes in skin implanted into the larynx and trachea by myocutaneous flap reconstruction. Otolaryngol. Head Neck Surg. 93, 754, 1985.

6. Conley, J.J. Regional skin flaps in partial laryngectomy. Laryngoscope 85, 942, 1975.

7. Toohill, R.J. Autologous graft reconstruction of the larynx and upper trachea. Otolaryngol. Clin. North am. 12, 909, 1979.

8. Yoon, J.H., Koo, J.S., Gray, T., Guzman, K., and Nettesheim, P. Lysozyme expression during metaplastic squamous differentiation of retinoic acid-deficient human tracheobronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 20, 573, 1999.

9. Yoon, J.H., Kim, K.S., Kim, S.S., Lee, J.G., and Park, I.Y. Secretory differentiation of serially passaged normal human nasal epithelial cells by retinoic acid: Expression of mucin and lysozyme. Ann. Otol. Rhinol. Laryngol. 109, 594, 2000.

10. Santamaria, E., Granados, M., and Barrera-Franco, J.L. Radial forearm free tissue transfer for head and neck reconstruction: Versatility and reliability of a single donor site. Microsurgery 20, 195, 2000.

11.Kim, C.H., Kim, H.J., Song, K.S., Seong, J.K., Kim, K.S., Lee, J.G., and Yoon, J.H. MUC8 as a ciliated cell marker in human nasal epithelium. Acta Otolaryngol. 125, 76, 2005.

12. Yoon, J.H., Moon, H.J., Seong, J.K., Kim, C.H., Lee, J.J., Choi, J.Y., Song, M.S., and Kim SH. Mucociliary differentiation according to time in human nasal epithelial cell culture. Differentiation 70, 77, 2002.

13.Nishida, K., Yamato, M., Hayashida, Y., Watanabe, K., Yamamoto, K., Adachi, E., Nagai, S., Kikuchi, A., Maeda, N., Watanabe, H ., Okano, T., and Tano, Y. Corneal reconstruction with tissue-engineered cell sheets composed of autogenous oral mucosal epithelium. New Engl. J. Med. 351, 1187, 2004.

14.Hansbrough, JF, Cooper, ML, Cohen, R., Spielvogel, R., Greenleaf, G., Bartel, RL, and Naughton, G. Evaluation of biodegradable matrix containing cultured human fibroblasts as a dermal replacement beneath meshed skin grafts on athymic mice. Surgery 111, 438, 1992.

15. Merguerian, P., Chavez, D. R., and Hakim, S. Grafting of cultured uroepithelium and bladder mucosa into deepithelized segments of colon in rabbits. J. Urol. 152, 671, 1994.

16. Best, C.D., Lowe, R., Shu, J., and Terris, M.K. Comparison of the breaking strength of polyglactin mesh in urine, serum, and cell culture media. Urology 53, 1239, 1999.

Claims (9)

Implants for mucosal lumen reconstruction including squamous epithelial cells as an active ingredient. 2. The method of claim 1, wherein said squamous epithelial cell comprises: (a) culturing and propagating epithelial cells in a retinoic acid (RA) -containing medium; And (b) the proliferation of epithelial cells the retinoinsan-vitro mucosal cavity implant for reconstruction, characterized in that is manufactured by the steps of culturing in medium member differentiate into epithelial cells. The method of claim 2, wherein the manufacturing process of the squamous epithelial graft for mucosal lumen reconstruction characterized in that it does not use a feeder cell layer. According to claim 1, wherein said squamous cell mucociliary epithelial cells and high cor nipin -α (cornifin-α) implant for reconstruction mucosal lumen, characterized in that represent the low and MUC8 MUC5AC gene expression indicates the gene expression compared to . The method of claim 1, wherein the squamous epithelial cells are transplanted in vivo, mucociliary epithelial cells (mucociliary epithelial cells) characterized in that the implant for mucosal reconstruction. The implant of claim 1, wherein the squamous epithelial cell is an autologous cell. The method of claim 1, wherein the squamous epithelial cells are nasal squamous epithelial cells (imal squamous epithelial cells), characterized in that the implant for mucosal lumen reconstruction. 2. The mucosal lumen reconstruction implant of claim 1, wherein the lumen is in the airway. The implant for mucosal lumen reconstruction according to claim 1, wherein the implant has a form of squamous cell plate.

Images