KR20080023622A - Htsnp for determining a genotype of cytochrome p450 2d6 gene and genotyping chip using thereof - Google Patents

Abstract

An htSNP(haplotype tag single nucleotide polymorphism) for determining a genotype of cytochrome p450 2D6(CYP2D6) gene found in Korean people is provided to detect mutation of CYP2D6 gene, anticipate abnormality caused by individual difference of CYP2D6 enzyme activity or CYP2D6 deficiency, and analyze genotype of CYP2D6 in other Asian people. A screening method of htSNP of human CYP2D6 gene comprises the steps of: (a) collecting a biological sample from human; (b) extracting nucleic acids from the sample; (c) PCR amplifying the extracted nucleic acids by using primers having one nucleotide sequences selected from SEQ ID NOs: 2, 3, 17-23, 25-30, 31, 32, 34, 35 and 45-46; (d) determining the presence of mutation in the nucleotide sequence of the obtained PCR product; (e) analyzing the haplotype in the nucleotide sequence of PCR product to be determined as having the mutation; and (f) analyzing the analyzed haplotype nucleotide sequence by using an SNPtagger software. Further, the biological sample is selected from a group consisting of blood, skin cell, mucous membrane cell and hair.

Description

Haplotype marker single base mutation for genetic analysis of cytochrome P450 2di6 gene and gene analysis chip using the same {htSNP FOR DETERMINING A GENOTYPE OF CYTOCHROME P450 2D6 GENE AND GENOTYPING CHIP USING THEREOF}

1 to 6 illustrate the htSNP combination selected in the present invention.

7 and 8 are a result of performing a snapshot (SNaPshot) analysis for one type of htSNP combination selected in the present invention.

9 shows a process for analyzing genotype using a gene analysis chip.

10 shows a probe on a gene analysis chip.

11 illustrates amplification of the CYP2D6 gene using long PCR.

12 shows the ASPE reaction process.

Figure 13 is a gene chip showing the result of analyzing the mutation of the CYP2D6 gene according to Example 3.

The present invention relates to an htSNP for genotyping of cytochrome P450 2D6 gene and a gene analysis chip using the same, and more particularly, to a method for selecting htSNP for haplotype analysis of human CYP2D6 gene, using the htSNP for the CYP2D6 gene. The present invention relates to a method for determining genotype and a gene analysis chip therefor.

Genetic diversity between individuals results in differences between individuals in drug toxicity and efficacy. Therefore, considering the effects on the genetic diversity of such pharmaceutically important proteins in the early stages of drug development is an important factor that can reduce the risk of drug development failure. It is the "haplotype" to be one research group that measures the genetic diversity between these individuals. Haplotypes refer to the combination of polymorphisms in each gene sequence present in one population, which provides more accurate and reliable information about genetic diversity than individual polymorphisms.

Human cytochrome P450, on the other hand, is a member of heme proteins that promote the oxidation of foreign chemicals such as drugs, carcinogens and toxins and internal substrates such as steroids, fatty acids and vitamins (Nelson et al ., Pharmacogenetics 6: 1-42 , 1996). Various subtypes of cytochrome P450 have been found in organs such as the liver, kidneys, intestines and lungs. Among them, the human cytochrome P450 2D6 (Cytochrome P450 2D6, hereinafter referred to as 'CYP2D6') gene is located on the 22nd chromosome, and pseudogenes CYP2D7 and CYP2D8 are located on one side of the CYP2D6 gene. The enzyme encoded by the gene is known to metabolize more than 100 clinically important drugs, such as psychoactive drugs, cardiovascular drugs, morphine drugs.

Enzymes encoded by the CYP2D6 gene are produced mainly in the liver and make up about 2% of the total amount of cytochrome P450 enzymes but are important enzymes involved in drug metabolism of about 30%. The activity of the enzymes in the individual is so diverse that they are classified into groups of pore metabolizers (PM), intermediate metabolizers (IM), extensible metabolizers (EM) and ultrarapid metaboilzers (UM), respectively. As described above, the activity of the enzyme is different due to the genetic polymorphism of CYP2D6. Currently, more than 80 genetic polymorphisms of CYP2D6 are known (www.imm.ki.se/cypalleles/cyp2d6.htm), with distinct differences between species. However, since various types of gene mutations and haplotypes have been reported, it is important to determine the correct haplotype through minimal monobasic polymorphism (SNP) in order to increase analysis time and cost efficiency.

A method for analyzing 11 SNPs using SNaPshot analysis focusing on CYP2D6 gene mutation recently found mainly in Westerners (Sistonen J et al., Clin Chem . 2005 Jul; 51 (7): 1291-5 ), And the CYP2D6 diagnostic chip from Roche Corp. or Jury Lab. However, since the combination of CYP2D6 mutant genes is based only on mutations found in Westerners, studies on the diagnosis of CYP2D6 gene mutations in Asians, including Koreans, are very insufficient.

Therefore, the development of a method for determining a CYP2D6 genotype by constructing a minimal set of markers by selecting haplotype tag SNP (hereinafter referred to as 'htSNP') of the CYP2D6 gene mainly found in Koreans There is an urgent need.

Accordingly, an object of the present invention is to provide a method for selecting htSNPs capable of analyzing haplotypes of the CYP2D6 gene found in Koreans.

In addition, another object of the present invention to provide a method for determining the genotype of the human CYP2D6 gene using the htSNP.

In addition, another object of the present invention to provide a method for determining the genotype of the human CYP2D6 gene using a kit containing a gene analysis chip.

In order to achieve the above object, the present invention

(a) taking a biological sample from a human;

(b) extracting nucleic acids from the sample taken in step (a);

(c) performing PCR with a primer capable of amplifying the human CYP2D6 gene or fragment thereof as a template of the nucleic acid of step (b);

(d) confirming the presence or absence of a mutation in the base sequence of the PCR product obtained in step (c);

(e) analyzing haplotypes in the nucleotide sequence of the PCR product identified as having a mutation in step (d); And

(f) analyzing the nucleotide sequence of the haplotype analyzed in step (e) using SNP tagger (SNPtagger) software to provide a method for selecting htSNP of the human CYP2D6 gene, comprising the step of selecting htSNP.

In order to achieve the other object of the present invention,

(a) taking a biological sample from a human;

(b) extracting nucleic acids from the sample taken in step (a);

(c) performing PCR with a primer capable of amplifying the human CYP2D6 gene or fragment thereof as a template of the nucleic acid of step (b); And

(d) one from the group consisting of -1426C> T, 100C> T and 1039C> T in the nucleotide sequence of the PCR product obtained in step (c); -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And investigating the presence or absence of at least 11 CYP2D6 gene mutations selected from the group consisting of 2D6 duplications using the SNaPshot technique.

In order to achieve another object of the present invention, the present invention

(a) extracting a gene to be tested and then performing a multiplex PCR to obtain a PCR product including an SNP surrounding to be identified;

(b) performing an ASPE reaction using an allele specific primer extension (ASPE) primer capable of identifying a specific base of each allele;

(c) hybridizing the reaction product to a gene chip; And

It provides a method of determining the genotype of the human CYP2D6 gene using a gene analysis chip, comprising the step of (d) analyzing the chip.

The present invention also provides a genotyping chip including a genotyping kit of the SNaPshot method for CYP2D6 genotyping and a Zip Code oligobase chip for SNP testing.

In the present invention, a "biological sample" includes blood, skin cells, mucosal cells and hair of a subject, and preferably may be blood.

In the present invention, the nucleic acid may be DNA or RNA, preferably DNA, more preferably genomic DNA.

The variation described in this specification is as follows.

For example, the "-1584C> T" mutation refers to the substitution of C to T for the -1584th base in the nucleotide sequence of the human CYP2D6 gene.

The "2573insC" mutation refers to the insertion (addition) of C to the 2573th base in the nucleotide sequence of the human CYP2D6 gene, and the "4125-4133insGTGCCCACT" mutation refers to the nine positions of GTGCCCACT at the 4125th to 4133th bases of the human CYP2D6 gene. The base is inserted.

In addition, "2D6 deletion" mutations refer to the deletion of the entire human CYP2D6 gene on the chromosome.

Furthermore, in the present invention, "2D6 duplication" mutation means that two or more human CYP2D6 genes overlap on the same chromosome.

Hereinafter, the present invention will be described in detail.

The present invention is to identify the genotype of the CYP2D6 gene mainly found in Korean through mutation analysis of the Korean CYP2D6 gene, and based on this, htSNP, which is the optimal label set of each haplotype, was selected and confirmed its usefulness. There is this.

The method for selecting htSNPs of the human CYP2D6 gene according to the present invention comprises the following steps:

(a) taking a biological sample from a human;

(b) extracting nucleic acids from the sample taken in step (a);

(c) performing PCR with a primer capable of amplifying the human CYP2D6 gene or fragment thereof as a template of the nucleic acid of step (b);

(d) confirming the presence or absence of a mutation in the base sequence of the PCR product obtained in step (c);

(e) analyzing haplotypes in the nucleotide sequence of the PCR product identified as having a mutation in step (d); And

(f) selecting htSNP by analyzing the nucleotide sequence of the haplotype analyzed in step (e) using SNP tagging software.

The method of extracting nucleic acids from the sample collected in step (a) is not particularly limited, and techniques known in the art or commercially available kits for extraction may be used. For example, kits for DNA or RNA extraction can be purchased from Qiagen (USA) and Stratagene (USA). In the case of extracting and using RNA from the above, cDNA is prepared by reverse transcription.

In step (c), the fragment of the human CYP2D6 gene refers to a fragment containing a known variation of the human CYP2D6 gene, such as single nucleotide polymorphism (SNP). Primers capable of amplifying the human CYP2D6 gene or fragments thereof may be designed based on the nucleotide sequence of the human CYP2D6 gene or fragments thereof, for example, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 17 to SEQ ID NO: 23, SEQ ID NO: 25 to SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 45 and SEQ ID NO: 46, but may have a base sequence selected from the group consisting of Does not.

The mutations identified in step (d) include, but are not limited to, monobasic polymorphism, deletion of genes, and duplication of genes, and may include, for example, 33 mutations shown in Table 11.

In addition, the presence or absence of the mutation in the step (d) may be performed by a mutation detection method known in the art, and preferably, may be performed using sequencing, electrophoresis, RFLP analysis, and the like. . The sequencing can be performed using an autobase sequencer or using pyrosequencing. The pyro sequencing is a known SNP analysis method, which is also used for DNA sequencing, is a method of detecting the expression of light of PPi (inorganic pyrophosphate) emitted during DNA polymerization.

The presence or absence of the mutation can be confirmed by comparing with the nucleotide sequence of the wild type CYP2D6 gene. The base sequence of the wild type CYP2D6 gene is known in the art. For example, the base sequence of SEQ ID NO: 1 (GenBank accession No. AY545216), or each base sequence or information of CYP2D6 genotypes known in the art can be identified and compared (GenBank accession No. M33388, http: / /www.cypalleles.ki.se/cyp2d6.htm). Alternatively, RFLP may be performed to compare the restriction enzyme cleavage pattern of the wild-type CYP2D6 gene. Deletion or duplication of the CYP2D6 gene can be confirmed by electrophoretic analysis of PCR products.

Analysis of the haplotype in the nucleotide sequence of the PCR product confirmed to exist in step (d) can be performed through full length sequencing.

The method of the present invention may further comprise repeating steps (a) to (e). If you want to analyze the variation of CYP2D6 gene in a specific population such as race or patient, the frequency of each CYP2D6 genotype is investigated and the CYP2D6 genotypes found in the population are selected, and then (f) Can be performed.

In step (f), the htSNP is selected by analyzing the nucleotide sequence of the haplotype analyzed in step (e) by SNP tagging software. The SNP tagger software is known in the art and includes, for example, Genehunter, Merlin, Allegro, SNPHAP, htSNP finder (PCA based), and preferably http://www.well.ox.ac. You can use uk / ~ xiayi / haplotype or the website at http://slack.ser.man.ac.uk/progs/htsnp.html.

The selected htSNPs can be verified to increase the accuracy in diplotype determination. Since the genotype of the human body is determined by two strands of chromosome, the reading of the genotype determines the combination of two haplotypes. However, when several SNPs are analyzed at the same time, there is a possibility that a specific haplotype combination shows the same mutation analysis result as a combination of other haplotypes. Therefore, it should be verified whether the correct genotype can be pointed out when the genotype is read using the diagnostic method developed by the present invention. This verification can be analyzed using the Matlab (The Math Works Inc., USA) program to ensure accurate genotyping from genetic analysis results.

In one embodiment of the present invention, in order to select htSNP for the CYP2D6 genotype found in Koreans, the mutation of the CYP2D6 gene found in Koreans was first examined. As a result, 33 mutations found in Koreans and 12 haplotypes (genotypes) were identified (see Tables 11 and 12).

In another embodiment of the present invention, in order to select htSNP, which is a minimum marker that can easily distinguish the CYP2D6 genotype found mainly in Koreans, nucleotide sequences of 12 CYP2D6 genotypes were analyzed using SNPtagger software. Examples of htSNP combinations selected in the present invention are shown in FIGS. 1 to 6.

The htSNP combination selected in the present invention by the above method can be used to analyze the genotype of the human CYP2D6 gene. Thus, the present invention provides a method for determining the genotype of the human CYP2D6 gene. The method includes the following steps:

(a) taking a biological sample from a human;

(b) extracting nucleic acids from the sample taken in step (a);

(c) performing PCR with a primer capable of amplifying the human CYP2D6 gene or fragment thereof as a template of the nucleic acid of step (b); And

(d) one from the group consisting of -1426C> T, 100C> T and 1039C> T in the nucleotide sequence of the PCR product obtained in step (c); -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And examining the presence or absence of at least 11 CYP2D6 gene mutations selected from the group consisting of 2D6 duplications.

Extracting the nucleic acid in the step (b) is as described above.

Such fragments of the human CYP2D6 gene refer to fragments containing known variations of the human CYP2D6 gene, such as monobasic polymorphisms as described above. Primers that can be used in step (c), but are not limited to, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 17 to SEQ ID NO: 23, SEQ ID NO: 25 to SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, It may have a nucleotide sequence selected from the group consisting of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 45 and SEQ ID NO: 46.

The mutation irradiated in step (d) may be selected from htSNPs shown in FIGS. 1 to 6. In the step (d), one in the group consisting of -1426C> T, 100C> T and 1039C> T shown in Figure 1; -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And the presence or absence of a mutation consisting of 2D6 overlap.

Furthermore, -1584C> G shown in FIG. 2; One in the group consisting of -1426C> T, 100C> T and 1039C> T; 1611T> A; 1758G> A; 2573insC; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; One in the group consisting of -1245insGA, -1028T> C, -377A> C, 3877G> A, 4388C> T and 4401C> T; 4125-4133insGTGCCCACT; 2D6 deletion; And presence of mutations consisting of 2D6 duplications.

In addition, one in the group consisting of -1426C> T, 100C> T and 1039C> T shown in FIG. 3; -1584C> G; -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 4125-4133insGTGCCCACT; 2D6 deletion; And presence of mutations consisting of 2D6 duplications.

Furthermore, -1584C> G shown in FIG. 4; One in the group consisting of -1426C> T, 100C> T and 1039C> T; 1611T> A; 1758G> A; 2573insC; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; One in the group consisting of -1245insGA, -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; 4125-4133insGTGCCCACT; -1235A> G; 1887insTA; 2D6 deletion; And presence of mutations consisting of 2D6 duplications.

In addition, one in the group consisting of -1426C> T, 100C> T, and 1039C> T shown in FIG. 5; -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; 1611T> A; One in the group consisting of 1661G> C and 4180G> C; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; -1235A> G; 1887insTA; 2D6 deletion; And presence or absence of a mutation consisting of 2D6 overlapping may be investigated in step (d).

 Furthermore, -1584C> G shown in FIG. 6; One in the group consisting of -1426C> T, 100C> T and 1039C> T; 1611T> A; 1758G> A; 2573insC; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; One in the group consisting of -1245insGA, -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; 1887insTA; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And presence of mutations consisting of 2D6 duplications.

Preferably, the presence or absence of the variation illustrated in FIG. 1 may be examined. As described above, the mutation examined in step (d) is for the CYP2D6 gene mutation mainly found in Koreans, and thus is very specific for determining the haplotype and genotype of the CYP2D6 gene in Koreans.

In the step (d), whether the mutation of the CYP2D6 gene is present in the base sequence of the PCR product may be performed using a polymorphism analysis method known in the art. Preferably, snapshot analysis (see Peter M. Vallone, et al., Int J Legal Med , 2004, 118: 147-157), electrophoretic analysis or a combination thereof may be performed. When the mutation of the CYP2D6 gene is monobasic polymorphism, snapshot analysis may be used.

The snapshot analysis is a method of genotyping through a PCR reaction using a ddNTP and a primer having a sequence annealed to the adjacent region of the SNP (not including the SNP region). Snapshot analysis used in the present invention can be designed and manufactured according to the known method based on the SNP of the CYP2D6 gene to be investigated in the step c), the base immediately next to the SNP position is 3 'end and It includes a sequence annealed to the adjacent region of the SNP position, and may be used without limitation as long as the T base is added to the 5 'end. At this time, the sequence annealed to the adjacent region of the SNP position is preferably about 20 bp in length, if you want to distinguish several SNPs at once the length of the 5 'terminal T base of the snapshot primers for each SNP Designed differently, for example, by adding 5 more T base at the 5 'position to make a difference in size between the primers can be synthesized by varying the length of the PCR product. The ddNTP complementary to each SNP is coupled to the snapshot primer thus made, and these compounds can be distinguished from several SNPs at a time because the length difference occurs depending on the SNP.

For example, when the htSNP combination shown in Figure 1 in the step (c) can be used a primer having a base sequence selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: 44, SEQ ID NO: 48 and SEQ ID NO: 49, Preferably, all primers of SEQ ID NO: 37 to SEQ ID NO: 44, SEQ ID NO: 48 and SEQ ID NO: 49 may be used. Thereafter, the nucleotide sequence of the PCR product amplified by the snapshot analysis can be analyzed by known sequencing methods. The sequencing method may be used without limitation as long as it is a method known in the art, and preferably may be an automatic sequencing method.

In another embodiment of the present invention confirmed the usefulness of the htSNP combination selected in the present invention. For this purpose, after performing a snapshot analysis using the htSNP combination shown in Figure 1, the base sequence of the obtained PCR product was analyzed. As a result, it was confirmed that the method of the present invention can simultaneously and rapidly analyze the CYP2D6 genotype found in Koreans (see FIGS. 7 and 8).

Genotypes of the CYP2D6 gene that can be analyzed by the methods of the present invention are CYP2D6 * 1A, CYP2D6 * 2A, CYP2D6 * 5, CYP2D6 * 2N, CYP2D6 * 10B, CYP2D6 * 14B, CYP2D6 * 18, CYP2D6 * 21B, CYP2D6 * 41A , CYP2D6 * 49, CYP2D6 * 52 and CYP2D6 * 60. Each genotype and the resulting variation is shown in Table 11. Referring to Table 11, for example, the CYP2D6 * 1A genotype is wild type, CYP2D6 * 2A genotype is SNP 1, SNP 5, SNP 8, SNP 9, SNP 12-SNP 18, SNP 21 in the base sequence of the wild type CYP2D6 gene , SNP 25 and SNP 28 are genotypes containing mutations. In addition, the CYP2D6 * 5 genotype is a genotype that includes a 2D6 deletion mutation, which completely lacks the CYP2D6 gene on the human chromosome and does not produce any enzyme production. The CYP2D6 * 2N genotype is a genotype containing 2D6 overlapping mutations in which two or more CYP2D6 genes are present on the same chromosome.

The present invention also provides a method for determining the genotype of human CYP2D6 gene using a gene analysis chip. The method includes the following steps:

(a) extracting a gene to be tested and then performing a multiplex PCR to obtain a PCR product including an SNP surrounding to be identified;

(b) performing an ASPE reaction using an allele specific primer extension (ASPE) primer capable of identifying a specific base of each allele;

(c) hybridizing the reaction product to a gene chip; And

(d) analyzing the chip.

The present invention also provides a kit for genotyping, including a Zip Code oligobase chip for SNP testing (see FIG. 9).

In the step (b), a pair of primers for each SNP is prepared for the ASPE reaction, wherein the ASPE primers include a polymorphic base (SNP site) at the 3 'end and the allele. It is produced in a specifically binding sequence, and the 5 'direction includes 24 bp of oligonucleotide Zip Code, which is prepared to have a different sequence for each allele.

In the present invention, an optimal Zip Code sequence that does not cross-react with other samples is selected through experimental verification among the sequences designed and selected through the publications and bioinformatics techniques disclosed in the paper. The T _m value was 61 ° C. ± 2 and the zip code was produced so as not to interfere with each other. Only sequences having a ΔG value of the hairpin secondary structure of −2 or more were selected.

When the ASPE reaction is performed using the ASPE primer configured as described above, only a sample having an allele corresponding to the 3 'end of the primer reacts with the primer to cause an allele specific extension reaction. At this time, when the extension reaction is performed by mixing dUTP (Cy5-dUTP) covalently bonded with a cyanine 5 (Cyanine 5, Cy5) fluorescent substance, only a sample having each allele is labeled with a Cy5 fluorescent substance (FIG. 12). Reference). In this case, the fluorescent material is not limited to Cy5, and various kinds of fluorescently available compounds in the art, such as Cy3, TAMRA, Texas-Red, Cy3.5, Rhodamin 6G, and SyBR Green, may be used.

On the analysis chip of the present invention, a probe (cZip Code) is implanted with an oligonucleotide that complementarily binds to the Zip Code, and thus, alleles included in the extended sample can be identified using the Zip Code primer as described above. (See FIG. 10).

The probe was inserted into the spacer 10 bp sequence in the 3 'direction to induce hybridization with the target well, for example, the spacer sequence is preferably 5'-CAG GCC AAGT-3'.

In addition, in the present invention, the probe preferably has a nucleotide sequence of SEQ ID NO: 53 to SEQ ID NO: 79.

In the steps (c) and (d), the method of hybridizing the reaction product to the gene chip and analyzing the hybridized chip may be performed according to a method known in the art, and any of the general DNA chip scanners may be used. Can be. More preferably, Axon's GenePix 4100B scanner can be used, and the scanned image can be analyzed using GenePix Pro 6.0 software.

When the mutation of the CYP2D6 gene is analyzed using the gene analysis chip of the present invention, the same result as that obtained through sequencing can be obtained, and thus it can be usefully used for economically and easily analyzing the variation of various genes.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1 : Genotyping of CYP2D6 Gene in Koreans

<1-1> Isolation of Genomic DNA

Genomic DNA was isolated from the blood samples taken from 174 Koreans using a genomic DNA separation kit (Qiagen).

<1-2> Amplification and Full-length Sequence Analysis of the CYP2D6 Gene

Nine exons and 1.8 kb promoters constituting the human CYP2D6 gene by PCR of the following primer pairs were used as a template with 51 samples arbitrarily selected from a total of 174 genomic DNA samples isolated in Example <1-1>. The site was allowed to amplify.

Primers used for gene amplification Primer Name Sequence (5 '→ 3') SEQ ID NO: CYP505 CACTGGCTCCAAGCATGGCAG 2 3'2D6 ACTGAGCCCTGGGAGGTGGTA 3

PCR was carried out for 1 minute at 94 ° C, then repeated 30 cycles at 98 ° C for 10 seconds, 64 ° C for 30 seconds, and 72 ° C for 7 minutes, and finally at 72 ° C for 10 minutes. As a result, a PCR product of 6,569 bp size was obtained (see Table 2 below).

Position of primer and size of PCR product Primer Name location Size of PCR Product CYP505 -1848-1828 6,569 bp 3'2D6 4732 ~ 4749

Thereafter, the amplified PCR product was used as a template, and the nucleotide sequence of the amplified CYP2D6 gene was analyzed using a total of 13 primers shown in Table 3 below.

Primers used for full length sequencing Primer Name Sequence (5 '→ 3') SEQ ID NO: CYP505 CACTGGCTCCAAGCATGGCAG 2 3'2D6 ACTGAGCCCTGGGAGGTAGGTA 3 CYP507 AACGTTCCCACCAGATTTC 4 CYP509 GTAAGTGCCAGTGACAGATAAG 5 2d6-11 AGGATCCTTTGTTCAGGATATGTTGC 6 2d6-12 CACCAAGTACCCCACTTCCC 7 2d6-1 CATGTGGACTTCCAGAACACACC 8 2d6-2 GGTTCAAACCTTTTGCACTG 9 2d6-3 GTCGTGCTCAATGGGCTG 10 2d6-4 AAGGTGGATGCACAAAGAGT 11 2d6-5 GACCTAGCTCAG GAGGGACT 12 2d6-6 AGCTGGATGAGCTGCTAACT 13 2d6-7 CCTGACCTCCTCCAACATAG 14 2d6-8 CACCTAGTCCTCAATGCCAC 15 2d6-9 GAGTCTTGCAGGGGTATCAC 16

<1-3> Individual analysis of each genotype

For the remaining 123 genomic DNA samples isolated in Example <1-1>, * 2A, * 5, * 2N, * 10B, * 14B, * 18, * 21B, which are mainly found in Asians, were Genotyping analyzes for * 41A, * 49, * 52, * 60 mutations were performed separately.

a) Analysis of CYP2D6 * 5 Genotypes

PCR was performed using the primers described in Table 4 below to analyze the CYP2D6 * 5 genotype. As the PCR reaction conditions, the reaction was performed at 94 ° C. for 1 minute, then repeated 30 cycles at 98 ° C. for 10 seconds, 64 ° C. for 30 seconds, and 72 ° C. for 5 minutes, followed by reaction at 72 ° C. for 10 minutes. As a result, a 5.1 kb PCR product containing nine exons was amplified in the wild type, and a 3.5 kb PCR product was amplified in the CYP2D6 * 5 variant.

 Sequence, position of primer and size of PCR product Primer Name Sequence (5 '→ 3') SEQ ID NO: location Size of PCR Product 5'2D6 CCAGAAGCCTTTGCAGGCTTC 17 1279-1300 5.1 kb 3'2D6 ACTGAGCCCTGGGAGGTGGTA 3 6350-6371 5'2D6 * 5 CACCAGGCACCTGTACTCCTC 18 7396-7416 3.5 kb 3'2D6 * 5 CAGGCATGAGCTAAGGCACCCAGAC 19 9353-9377

b) Analysis of CYP2D6 * 2N Genotypes

PCR was performed using the primers described in Table 4 below to analyze the CYP2D6 * 2N genotype. PCR was performed for 1 minute at 94 ° C., then repeated 30 cycles at 98 ° C. for 10 seconds, 64 ° C. for 30 seconds, and 72 ° C. for 8 minutes and at 72 ° C. for 10 minutes. As a result, a 7.8 kb PCR product was obtained for the CYP2D6 * 2N variant.

Sequence, position of primer and size of PCR product Primer Name Sequence (5 '→ 3') SEQ ID NO: location Size of PCR Product 4268Cnew TGGGTGTTTGCTTTCCTGGTGAC 20 4245-4268 7.8kb Primer 10B GTGGTGGGGCATCCTCAGT 21 302-321

c) Analysis of CYP2D6 * 2 and * 41 genotypes

For CYP2D6 * 2 genotypes and CYP2D6 * 41 genotypes, gene conversions from the same mutation (-1235A>G;-740C>T;-678G>A; intron 1 to CYP2D7 except for the -1584C> G mutation ); 1661G>C;2850C>T;4180G> C). Therefore, first, the mutant sequence of gene conversion to CYP2D7 in Intron 1 was analyzed by the AS-PCR method (Johanson, Molecular Pharmacology , 46: 452-459, 1994) using the primers described in Table 6 below.

When the gene conversion from CY 2D7 to Intron 1 occurred, PCR amplification was carried out using primer 9 of SEQ ID NO: 25 and primer 10B of SEQ ID NO: 21 to obtain an amplification product. In normal cases, primer 9 of SEQ ID NO: 25 and sequence The amplification product is obtained only when the reaction is performed with the combination of primer 10 of No. 26. Therefore, the gene conversion from intron 1 to CYP2D7 can be confirmed depending on the presence or absence of the amplified product by reacting with a combination of two primers, namely, primer 9 / primer 10 and primer 9 / primer 10B.

PCR reaction was carried out for 5 minutes at 94 ℃, then repeated 35 cycles for 30 seconds at 94 ℃, 30 seconds at 64 ℃ and 30 seconds at 72 ℃ and the reaction was carried out for 10 minutes at 72 ℃. The -1584C> G mutation was then analyzed by pyro sequencing using the sequencing primers described in Table 6 below to determine the case of -1584G as the CYP2D6 * 2 genotype and the case of -1584C as the CYP2D6 * 41 genotype.

Sequence of primer transition Primer Name Sequence (5 '→ 3') SEQ ID NO:  -1584C> G F Biotin-TCACCCCAGGAATTCAAGAC 22 R GGCTTCAAGCAATTCTCCTG 23 Pyro Sequencing Primer GTATTTTTTGTAGAGACC 24

d) Analysis of CYP2D6 * 10B, * 14, * 18 and * 49 genotypes

CYP2D6 * 10B, * 14, * 18 and * 49 genotypes were analyzed by PCR-RFLP method (Johanson, Molecular Pharmacology , 46: 452-459, 1994; Wang, Drug Metabolism and Dispososition , 27: 385-388, 1998; And Geadigk, Pharmacogenetics , 9: 669-682, 1999). The primers used at this time are as shown in Table 7, and the experimental conditions are as shown in Table 8 below.

Sequence and position of primer according to each genotype Genotype Primer Name Sequence (5 '→ 3') SEQ ID NO: location * 10 Primer 9 ACCAGCCCCCTCCACCGG 25 -196-197 Primer 10 TCTGGTAGGGGAGCCTCA 26 302 ～ 321 Primer 10B GTGGTGGGGCATCCTCAGT 21 302 ～ 321 * 14, * 49 Primer e GTGGATGGTGGGGCTAATGCCTT 27 1637 ～ 1659 Primer f CAGAGACTCCTCGGTCTCTCGCT 28 2124-2102 * 18 5'4213 GCATCCTAGAGTCCAGTCC 29 5371 ～ 5389 3'4213 CCTGTCTCAGCGGCCAGGCGGTGGG 30 5985 ～ 6015

Restriction Enzymes and RFLP Patterns for Each Genotype Genotype PCR product size (bp) Restriction enzyme RFLP Aspects of Wild-type (bp) RFLP Aspects of Variants (bp)  * 10B 534 Hph I 474 + 60 376 + 98 + 60 * 14b 486 Msp I 279 + 207 486 * 18 645 or 654 Mwo i 348 + 258 + 39 272 + 258 + 85 + 39 * 49 486 Sau3A I 347 + 142 286 + 142 + 61

e) Analysis of CYP2D6 * 21, * 52 and * 60 genotypes

Analysis of CYP2D6 * 21, * 52 and * 60 genotypes was analyzed by PCR-pyro sequencing. The sequences of the primers used for analysis are shown in Table 9 below.

Sequence of primers for each genotype Genotype Primer Name Sequence (5 '→ 3') SEQ ID NO: * 21B F biotin-TGGTGTAGGTGCTGAATGCTGT 31 R AGCCACTCTCACCTTCTCCATC 32 Pyro Sequencing Primer TCAGGTCTCGGGGGGG 33 * 52 F Biotin-AGGCAACGACACTCATCACC 34 R GATACCCCTGCAAGACTCCA 35 Pyro Sequencing Primer GGCATCCAGGAAGTGT 36 * 60 F biotin-ATCTCCCACCCCCAGGAC 45 R AGGGAGGCGATCACGTTG 46 Pyro Sequencing Primer GGCGATCACGTTGCT 47

The data obtained in Examples <1-2> and <1-3> were used as GenBank accession No. Based on the sequence of CYP2D6 known in M33388 Comparative analyzes and frequency of each allele were examined. As a result, the type and frequency of the CYP2D6 gene haplotype mainly found in Korean are shown in Table 10 below.

Haplotype of CYP2D6 Gene Found in Koreans Haplotype (Allele) activation Allele frequency In vivo In vitro * 1A Normal Normal 31 * 2A Normal (dx, d, s) 10 * 2XN (* 2N) Incr (d) 1.4 * 5 None 6.3 * 10B Decr (d) Decr (b) 42.2 * 14B None (d) 0.86 * 18 None (d) Decr (d) 0.57 * 21B None 0.86 * 41 A Decr (s) 3.7 * 49 Decr (dx) 2.58 * 52 Incr (dx) 0.29 * 60 0.29

In Table 10, Normal indicates a normal level, Incr increases, Decr decreases, and None indicates no activity. In addition, the notation in parentheses is the abbreviation of the labeling drug used for the analysis: b, bufuralol; d, debrisoquine; dx, dextromethorphan; s, sparteine.

Genes were selected based on 12 genotypes mainly found in Koreans and mutations of each genotype based on the Cytochrome P450 (CYP) Allele Nomenclature Committee (http://www.cypalleles.ki.se/cyp2d6.htm) Table 11 shows. In Table 11, '1' represents wild type and '2' represents variant.

Example 2 : Screening and Validation of htSNP

In order to distinguish the 12 CYP2D6 genotypes found in Koreans identified in Example 1, analyzing all 33 variations shown in Table 11 is very inefficient in terms of time and cost. Therefore, if genotype is determined by selecting htSNP, which is a marker gene variant, using detailed haplotype information, economic genotyping can be determined. The htSNP is a marker necessary for accurate display of each haplotype and constitutes various combinations. This optimized label set, htSNP combination, was selected using SNP tagger software (http://www.well.ox.ac.uk/~xiayi/haplotype/). Examples of selected htSNP combinations are shown in FIGS. 1 to 6, where each selected htSNP combination is an optimal label set, with '1' representing wild type and '2' variant, and the V designation representing htSNP.

Then, it was analyzed using Matlab software (version 7.1, The Math Works Inc., USA) to determine whether diplotype genotypes could be determined without overlapping each other in consideration of diplotypes. The combination was then determined.

As a result of the verification, it was confirmed that the diplotype genotype could be determined without overlapping each other. This indicates that the htSNP combinations selected in the present invention are not identical to each other, and thus there is no inaccurate analysis in determining the genotype.

Example 3 : SNaPshot Analysis

The htSNP combination selected in Example 2 was used to perform a snapshot analysis, which is one of high speed genotyping techniques of the CYP2D6 gene. For this purpose, the htSNP combination of FIG. 1 was selected, and the positions of the mutations selected by each htSNP are shown in Table 12 below. In Table 12, in the case of htSNP1 to htSNP3, genotyping can be performed by analyzing only one SNP among a plurality of variations. In addition, in the case of htSNP9, since 9 bases (GTGCCCACT) are inserted and repeated, the genotyping is determined by analyzing only the base position of any one of the 4125 th to 4133 th base positions and comparing it with the base sequence of the wild type gene. It is possible.

 Location of mutations screened with htSNP combinations according to the present invention htSNP Corresponding variations Mutation position htSNP 1 SNP 2, 7, 19 -1426 C> T htSNP 2 SNP 3,6,10,27,30,31 3877 G> A htSNP 3 SNP 8, 9, 12, 13, 14, 15, 16, 17, 18, 25 2850 C> T htSNP 4 SNP 20 1611 T> A htSNP 5 SNP 22 1758 G> A htSNP 6 SNP 23 1887insTA htSNP 7 SNP 24 2573insC htSNP 8 SNP 26 2988 G> A htSNP 9 SNP 29 4125-4133 ins9 bp htSNP 10 SNP 32 fruition htSNP 11 SNP 33 overlap

The product of about 6.7 kb was obtained by amplifying the CYP2D6 gene in the same manner as in Example <1-2>. In order to distinguish CYP2D6 * 5, a primer CYP2D6_3 (5'-ACCTCTCTGGGCCCTCAGGGA-3 ') of SEQ ID NO: 50 and primer 3'2D6 * 5 of SEQ ID NO: 19 were used to amplify the CYP-REP-Del site. After reacting at 94 ° C for 1 minute, 30 cycles were repeated at 98 ° C for 10 seconds, at 64 ° C for 30 seconds, and at 72 ° C for 3 minutes, and finally, at 72 ° C for 10 minutes. As a result, a PCR product of 6,569 bp size was obtained.

As unreacted primers and dNTPs of the PCR product amplified as described above may affect the snapshot process, to remove them, add 2 µl of ExoSAP-IT (USB Corporation) per 5 µl of the PCR product at 37 ° C. After reacting for 30 minutes at, and then reacted for 15 minutes at 80 ℃ to deactivate the remaining enzyme. 3 μl of the enzyme-treated product (mixture of 2 μl of 6.7 kb CYP2D6 gene and 1 μl of 3.5 kb CYP-REP-DEL), 1 μl of Snapshot Multiplex Ready Reaction Mix (ABI), 4 μl of 1/2 term buffer (200 mM Tris-HCl, 5 mM MgCl ₂ , pH 9) and Pooled SNaPshot primers were added to adjust the total amount of the reaction to 10 μl, followed by 10 seconds at 96 ° C. and 50 ° C. PCR was performed by repeating 40 cycles of 5 seconds at 60 ° C. for 30 seconds. PCR reaction. The treatment concentration of the used Pooled SNaPshot primer is shown in Table 13 below.

Sequence and Processing Concentration of Pooled SNaPshot Primer Primer Name Sequence (5 '→ 3') Concentration (m) SEQ ID NO: 2D6-1426R GCCACCACGTCTAGCTTTTT 0.05 37 2D6 + 1611R (P30) TTTTTTTTTTGGGCCCATAGCGCGCCAGGA 0.3 38 2D6 + 1758 CGCCTTCGCCAACCACTCC 0.2 39 2D6 + 2573 (P38) TTTTTTTTTTTTTTTTTGGGACCCAGCCCAGCCCCCCC 0.02 40 2D6 + 2850R (P55) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGGTCAGCCACCACTATGC 0.06 41 2D6 + 2988 (P39) TTTTTTTTTTTTTTTTTTTTAGTGCAGGGGCCGAGGGAG 0.3 42 2D6 + 3877 (P45) TTTTTTTTTTTTTTTTTTTTTTTTTCTGGGCATCCAGGAAGTGTT 0.3 43 2D6 + 4125 (P50) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGCTTCTCGGTGCCCACTG 0.04 44 2D6 + 1887R (P60) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGGAGGCGATCACGTTGCT 0.2 48 2D6-5R (P65) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCGTCACTGGTCAGGGGTC 0.05 49

After the reaction was completed, 1 μl of SAP (USB Corporation) was added to 10 μl of the reaction, and reacted at 37 ° C. for 1 hour and 65 ° C. for 15 minutes. At the end of the reaction, 0.5 μl of the reaction, 0.2 μl of LIZ120 (ABI), and 9.3 μl of Hi-Di formamide (ABI) were mixed and dispensed into a 96 well plate. Aliquoted samples were reacted for 2 minutes at 95 ° C. and then analyzed by 3100 Genetic Analyzer (ABI). The analyzed result is as shown in FIG.

As a result, as shown in Figure 7, it can be seen that the color and size of the peak according to each SNP and the wild type and mutant is clearly distinguished.

In addition, the CYP-REP-Dup site was analyzed using Dup-F_2 (5'-CCTCACCACAGGACTGGCCACC-3 ') of SEQ ID NO: 51 and Dup-R (5'-CACGTGCAGGGCACCTAGAT-) of SEQ ID NO: 52 to analyze CYP2D6 duplication using snapshots. Amplification was carried out in the same manner as above except for using 3 ′) to obtain a 3.3 kb PCR product. After the PCR reaction, 2 μl of ExoSAP-IT (USB Corporation) was added per 5 μl of the PCR product in order to remove the remaining primers from the PCR product and reacted at 37 ° C. for 30 minutes.

Subsequently, the remaining ExoSAP-IT was inactivated by reaction at 80 ° C. for 15 minutes. Add 3 μl of the enzyme-treated product, 1 μl of Snapshot Multiplex Ready Reaction Mix, 4 μl of 1/2 Term Buffer and NaPshot Primer (CYP2D6-5R, 5′-CTCGTCACTGGTCAGGGGTC-3 ′) of SEQ ID NO: 53 to complete reaction. After adjusting the amount of 10 μl, the snapshot reaction was performed under the same conditions as above, and analyzed by 3100 gene analyzer, and the results are shown in FIG. 8.

As a result, as shown in Figure 8, according to the SNP color and size of the peak peak is consistent, it can be seen that the wild type and mutant is clearly distinguished.

In this manner, validation of the 50 samples including wild type and mutated genotypes by sequencing resulted in 100% agreement. This indicates that the method of the present invention is highly reproducible and accurate.

Therefore, this method is capable of analyzing the CYP2D6 genotypes by these combinations at the same time by distinguishing 12 CYP2D6 haplotypes mainly found in Koreans, and including the genetic mutations found in Koreans to accurately determine genotypes. Is high. In addition, almost all genotypes can be analyzed in the case of Japanese, whose genetic characteristics are very similar to those of Koreans, and it is considered that the CYP2D6 genotype can be determined in the range of 90% or more from Chinese known results.

Example 3 : Genotyping Using Genetic Analysis Chips

<3-1> Zip Code Chip Fabrication

1) Probe Fabrication

Designed with base sequence complementary to ZipCode used for ASPE PCR reaction, the probe inserts a 10 bp nucleotide sequence (5'-CAG GCC AAGT-3 ') into the 3' direction as a spacer to facilitate hybridization with the target. Induced.

In addition, the zip code oligobase of 24 bp is included in the 5 'direction of the spacer, and the base sequence of the probe (cZip Code) is as described in Table 14 below. In this case, bold letters are 10 spacer sequences (FIG. 10).

Probe Name Sequence (5 '→ 3') SEQ ID NO: cZip2 CAGGCCAAGT ATCTTGCGCGGCAGCTCGTCGACCG 54 cZip7 CAGGCCAAGT GTGGTCCATCACAAACAGGGAGTCG 55 cZip8 CAGGCCAAGT CTTGAGCGATGACGGACGGGAAAAG 56 cZip9 CAGGCCAAGT AAGTTGGGGATCTGTAGACCCAGCC 57 cZip14 CAGGCCAAGT GGATTGCACCGTCAGCACCACCGAG 58 cZip15 CAGGCCAAGT TCCCAGGACGGCGCTGGCACGTTGA 59 cZip16 CAGGCCAAGT CGGCGTCCACGTCGAGTTCCTTCGC 60 cZip19 CAGGCCAAGT TTCGGGGAAACTCCGCACCGCCACG 61 cZip20 CAGGCCAAGT TAGGTTTGCCAGTGCGTTGGATCG 62 cZip21 CAGGCCAAGT TCGACAACCCGGTTGGAGGATTCAG 63 cZip22 CAGGCCAAGT CCAAAAGCTTTACGCCAGCGCCGAA 64 cZip24 CAGGCCAAGT AGATCGGTGAGCAGTTCAAAGCCGG 65 cZip27 CAGGCCAAGT GGGTATCCGTTCGGTGTTGCGTAGT 66 cZip31 CAGGCCAAGT TGGTGCTGGCGCAGACCTTTGTCTC 67 cZip32 CAGGCCAAGT ACCGCGCAAATGGACAGTGTGGCCA 68 cZip33 CAGGCCAAGT GACCCCAACTTGACACGTCGCAAGG 69 cZip40 CAGGCCAAGT CGTAAGCCTCGTCAGCTATCCGGGG 70 cZip41 CAGGCCAAGT CCAAACGCACCCCAACCTGTCCGGA 71 cZip44 CAGGCCAAGT CGGCGGTGGCATTGTCACTGCTGCT 72 cZip50 CAGGCCAAGT GCAGTTCGTGGCCATGGTGACCGCT 73 cZip56 CAGGCCAAGT CGTTGTGGTAGCGGCACTGGTGGTG 74 cZip61 CAGGCCAAGT CTGGGTGTGGGTGCTCGTACGCCGA 75 cZip101 CAGGCCAAGT CGGCACATAGGACGGGGTTCAGATA 76 cZip102 CAGGCCAAGT GAACAAGATTGGTCCTGGAGGTGCG 77 cZip104 CAGGCCAAGT TCGGATGGCGTTCAGTAGGAGAAGG 78 cZip106 CAGGCCAAGT ACACTCTCCATGCGGTAGACCTGAC 79 cZip109 CAGGCCAAGT GAACCTAATGAAGACGGGGGGTGCT 80

2) Spotting and Probe Locking

The substrate for chip fabrication used a Corning GAPSII glass slide coated with an amine. The SMP4XB pin was used to spot the OmniGrid100 spotter, and the spotting conditions were 22 ° C. and 54% humidity, and 27 probes were spotted in two replicates. After spotting, the probe was fixed to the glass slide by irradiation of 7,500 μJ / cm 2 UV.

3) Composition of genotyping chip for Zip Code test

Eleven genotypes (CYP2D6 * 1, * 2, * 5, * 10B, * 14A, * 14B, * 18, * 21, using nine genotypic markers of the CYP2D6 gene (SNP; bolded in the table above) , * 41, * 49, * 2N).

Allele of CYP2D6 Base change *One None (wt) *2 1584C>G;1235A>G;2850C>T;4180G> C * 5 CYP2D6 deleted * 10B 100C>T;4180G> C * 14A 100C>T;1758G>A;2850C>T;4180G> C * 14B 1758G>A;2850C>T;4180G> C * 18 4125-4133insGTGCCCACT * 21 1584C>G;1235A>G; 2573 insC ; 2850C> T * 41 1584C; 1235A>G;2850C>T;4180G> C * 49 1235A>G;100C>T;1611T>A;4180G> C * 2N CYP2D6 duplicate

<3-2> Target production

1) Long PCR

2 μl of CYP 2D6 genomic DNA sample, 1 × LA buffer, 2.5 mM MgCl ₂ , 0.4 mM dNTP, each 0.2 pmol / μl primer of Table 16, LA tagged DNA polymerase (taq DNA polymerase, TAKARA: cat.No. RR002A) 2.5 units, tertiary distilled water was added to 50 μl, and then denatured once at 94 ° C. for 1 minute, followed by prolonged reaction at 72 ° C. for 10 minutes at 98 ° C. for 10 seconds, 64 ° C. 30 seconds, and 72 ° C. for 6 minutes. Amplified (FIG. 11). (The CYP2D6 gene obtained three types of 1 ^st PCR products for * 5, * 2N alleles, and other alleles, and the conditions were the same as above.)

 Long PCR Primer Sequence gene primer Sequence (5 '→ 3') SEQ ID NO: CYP2D6 cyp505 CACTGGCTCCAAGCATGGCAG 2 3’2D6 ACTGAGCCCTGGGAGGTAGGTA 3 CYP2D6 * 5 CYP2D6_3 ACCTCTCTGGGCCCTCAGGGA 50 3'2D6 * 5 CAGGCATGAGCTAAGGCACCCAGAC 19 CYP2D6 * 2N Dup-F_2 CCTCACCACAGGACTGGCCACC 51 Dup-r CACGTGCAGGGCACCTAGAT 52

2) Multiplex PCR

Long PCR product obtained above 0.5 μl, 1 × amplitaq buffer, 0.2 mM dNTP, 0.5 pmol / μl of each primer, and 0.5 μl of Ampli taq gold (Applied Biosystems: cat.No. N8080242) were added to 10 μl of tertiary distilled water. After denaturation once, the reaction was amplified by extending the reaction for 1 minute at 72 ° C for 30 cycles of 94 ° C 45 seconds, 57 ° C 45 seconds, 72 ° C for 1 minute. 2 ^nd PCR was carried out as a multi-stylized PCR, and amplified by the four sets of the following table 17, the primer sequences are as described in Table 18.

Multiple PCR Set set template location PCR products  One  CYP2D6 1st PCR Product -1584C> G 502 bp 100C> T 460 bp 1611T> A 347 bp 2850C> T 477 bp  2  CYP2D6 1st PCR Product 1758G> A 468 bp 2573insC 495 bp 4125 4133ins9 484 bp 3 CYP2D6 * 5 1st PCR Product * 5 allele 222 bp 4 CYP2D6 * 2N 1st PCR Product * 2N allele 222 bp

Multiple PCR Primer Sequence (Genome PCR Primer) location Primer Name Sequence (5 '→ 3') SEQ ID NO: -1584C> G -1584 F1 GCTGCCATACAATCCACCTG 81 -1584 R1 GCTCACTACAACCTTCACCTC 82 100C> T 100 F2 GTCCTGCCTGGTCCTCTG 83 100 R2 CTTGCCCTACTCTTCCTTGG 84 1611T> A 5'1611 GTGGGCAGAGACGAGGTG 85 3'1611 CGGAGTGGTTGGCGAAGG 86 2850C> T 1758 F1 CTTCTCCGTGTCCACCTTG 87 1758 R1 TGTCCTTTCCCAAACCCATC 88 1758G> A 5 '2573 GTCCAGGTGAACGCAGAG 89 3 '2573 CGGCAGAGAACAGGTCAG 90 2573insC 5 '2850 CAGAGATGGAGAAGGTGAGAG 91 3 '2850 TGGAGGAGGTCAGGCTTAC 92 4125-4133ins9 4125 F2 ACTCATCACCAACCTGTCATC 93 4125 R2 GGAACTACCACATTGCTTTATTG 94 * 5 allele D & D-F 1 ACCTCTCTGGGCCCTCA 95 D & D-R 1 ATGCCACCTCCTCCTTCTC 96 * 2N allele D & D-F 1 ACCTCTCTGGGCCCTCA 95 D & D-R 1 ATGCCACCTCCTCCTTCTC 96

3) ASPE (allele specific primer extension) reaction

Each of the multiple PCR products obtained above 6 μl, 1X amplitaq buffer, Cy5 dUTP (ginchem) 10 μM, 125 nM each ASPE primer, 1 unit AmpliTaq gold (Applied Biosystems: cat.No. N8080242), 1X Band doctor (solgent) and tertiary distilled water 20 After denaturation, the cells were denatured once at 94 ° C. for 5 minutes, and then amplified by 30 cycles of 94 seconds at 30 ° C., 60 ° C. for 1 minute, and 72 ° C. for 1 minute (see FIG. 12). Primer sequences are as described in Tables 19 and 20 below.

ASPE reaction set set template location   One   2nd PCR Products of CYP2D6 1 Set -1584C> G 100C> T 1611T> A 2850C> T Positive control  2  2nd PCR Products of CYP2D6 2 Sets 1758G> A 2573insC 4125 4133ins9 3 2nd PCR Products of 3 Sets of CYP2D6 * 5 allele 4 2nd PCR Products of CYP2D6 4 Sets * 2N allele

ASPE primer sequence location Primer Name Sequence (5 '→ 3') SEQ ID NO: -1584C> G -1584 (C) zip15 TCAACGTGCCAGCGCCGTCCTGGGAGCTAATTTTGTATTTTTTGTAGAGACCG 97 -1584 (G) zip16 GCGAAGGAACTCGACGTGGACGCCGGCTAATTTTGTATTTTTTGTAGAGACCC 98 100C> T 100 (C) Zip27 ACTACGCAACACCGAACGGATACCCCGCTGGGCTGCACGCTACC 99 100 (T) Zip2 CGGTCGACGAGCTGCCGCGCAAGATCGCTGGGCTGCACGCTACT 100 1611T> A 1611 (T) zip40 CCCCGGATAGCTGACGAGGCTTACGCCCATAGCGCGCCAGGAA 101 1611 (A) zip44 AGCAGCAGTGACAATGCCACCGCCGCCCATAGCGCGCCAGGAT 102 1758G> A 1758 (G) Zip101R ATCTGAACCCCGTCCTATGTGCCGCCTTCTGCCCATCACCCACC 103 1758 (A) zip109 AGCACCCCCCGTCTTCATTAGGTTCCCTTCTGCCCATCACCCACT 104 2573insC 2573 (G) Zip9 GGCTGGGTCTACAGATCCCCAACTTGTCAGGTCTCGGGGGGGC 105 2573 (C) Zip41 TCCGGACAGGTTGGGGTGCGTTTGGGTCAGGTCTCGGGGGGGG 106 2850C> T 2850 (C) zip61 TCGGCGTACGAGCACCCACACCCAGGAACAGGTCAGCCACCACTATGCG 107 2850 (T) Zip31 GAGACAAAGGTCTGCGCCAGCACCAGAACAGGTCAGCCACCACTATGCA 108 4125-4133ins9 4125-4133Zip21 CTGAATCCTCCAACCGGGTTGTCGAGCTTCTCGGTGCCCACTGGA 109 4125-4133insZip22 TTCGGCGCTGGCGTAAAGCTTTTGGGCTTCTCGGTGCCCACTGTG 110 * 5 allele 6 (A) zip106 GTCAGGTCTACCGCATGGAGAGTGTGCCCTCAGGGATGCTGCTGTA 111 7 (C) zip102 CGCACCTCCAGGACCAATCTTGTTCCCCTCAGGGATGCTGCTGTC 112 * 2N allele 7 (C) zip32 TGGCCACACTGTCCATTTGCGCGGTCCTCAGGGATGCTGCTGTC 113 6 (A) zip19 CGTGGCGGTGCGGAGTTTCCCCGAACCTCAGGGATGCTGCTGTA 114 Positive control 2D6pc-1460 (zip14) CTCGGTGGTGCTGACGGTGCAATCCCCAACATGGTGAAACCCTATCTCTAC 115

4) PCR Purification

One to four sets of products obtained in the ASPE reaction were pooled and purified using the Qiagen purification kit (Qiagen: ca. no. 28106) according to the manufacturer's manual and the final elution volume was 50 μl.

Purification Each product was dried using a concentrator (Speed Vacuum concentrator, BioTron Corp. module 4080C) until the volume remained about 1-2 μl.

5) Chip Hybridization

Prehybridization buffer (25% formamide, 5X SSC, 0.1% SDS, 10 mg / ml BSA) was warmed at 42 ° C., then the chips were immersed in the buffer and incubated at 42 ° C. for at least 30 minutes. After washing the chip three times with distilled water for 1 minute, the chip was placed in a conical tube and dried by centrifugation at 800 rpm for 5 minutes.

Then, hybridization buffer (25% formamide, 5X SSC, 0.1% SDS, 0.5 mg / ml poly A, 25 μg / ml Cot-1 DNA, 10% dextran sulfate) was previously warmed at 42 ° C., and then obtained above. The dried sample was dissolved here. The dissolved sample was transferred to a 0.5 ml PCR tube and then heated at 95 ° C. for 5 minutes. Hybridization chambers were prepared, 3M paper flakes were placed in the chamber space and 20 μl of 3X SSC was dropped. The heated sample was loaded onto the prehybridized chip and then assembled into the chamber in the chamber and hybridized overnight at 42 ° C.

The chip was washed once for 10 minutes in a 2X SSC 0.1% SDS solution previously warmed to 50 ° C, and then washed 4 times at room temperature for 1 minute with 0.1X SSC solution. The washed chips were immediately placed in conical tubes and dried by centrifugation at 800 rpm for 5 minutes.

6) Analysis

The chip prepared as described above was scanned using Axon's GenePix 4100B scanner at an output wavelength of about 650 nm, and the scanned image was analyzed using the GenePix Pro 6.0 software to analyze the intensity of the fluorescence signal. 21 is shown.

Wild type spot Mutant spot century century order Allele Sequencing results -1584C -1584G 336 24343 GG     2D6 * 2 / * 2     * 2 / * 2 100C 100T 32411 155 CC 1611T 1611A 6753 228 TT 1758G 1758A 3812 370 WW 2573WT 2573insC 5865 842 WW 2850C 2850T 803 13919 TT 4125WT 4125ins9bp 13044 608 WW  del A del C 18326 381 WW dup CTG dup ACA 12457 553 WW Positive control PC2D6 28948

As a result, the mutation of the CYP2D6 gene analyzed using the gene analysis chip was the same as the result confirmed through sequencing.

As described above, the methods provided by the present invention can be usefully used for testing the mutated genes of the CYP2D6 gene found in Koreans. In addition, it can be useful for predicting abnormalities caused by individual differences in CYP2D6 enzymatic activity or CYP2D6 deficiency in Koreans. It can also be used for CYP2D6 genotyping of other Asian ethnic groups with similar genetic characteristics.

<110> Inje university Industry-academic cooperation foundation <120> htSNP FOR DETERMINING A GENOTYPE OF CYTOCHROME P450 2D6 GENE AND          GENOTYPING CHIP USING THEREOF <130> DPP070151KR <160> 115 <170> KopatentIn 1.71 <210> 1 <211> 6597 <212> DNA <213> Homo sapiens <400> 1 cactggctcc aagcatggca gctgccatac aatccacctg tagagggccc ggtcctcctg 60 tcctcagtgg atgatcccgt agaagtccag agctcggcag ctgccctccc acaaaagaca 120 ggattttgaa agcagcaaga gagaagagac gtatcaggta gtcacagtgg ctcaggcctg 180 taatcccagc actttgggag gcccaggtgg gaggatcgct tcaccccagg aattcaagac 240 cagcctggac aacttggaag aacccggtct ctacaaaaaa tacaaaatta gctgggattg 300 ggtgcggtgg ctcatgccta taatcccagc actttgggag cctgaggtgg gtggatcacc 360 tgaagtcagg agttcaagac tagcctggcc aacatggtga aaccctatct ctactgaaaa 420 tacaaaaagc tagacgtggt ggcacacacc tgtaatccca gctacttagg aggctgaggc 480 aggagaattg cttgaagcct agaggtgaag gttgtagtga gccgagattg catcattgca 540 caatggaggg gagccaccag cctgggcaac aagaggaaat ctccgtctcc aaaaaaaaaa 600 aaaaaaaaaa aagaattagg ctgggtggtg cctgtagtcc cagctacttg ggaggcaggg 660 ggtccacttg atgtcgagac tgcagtgagc catgatcctg ccactgcact ccggcctggg 720 caacagagtg agaccctgtc taaagaaaaa aaaaataaag caacatatcc tgaacaaagg 780 atcctccata acgttcccac cagatttcta atcagaaaca tggaggccag aaagcagtgg 840 aggaggacga ccctcaggca gcccgggagg atgttgtcac aggctggggc aagggccttc 900 cggctaccaa ctgggagctc tgggaacagc cctgttgcaa acaagaagcc atagcccggc 960 cagagcccag gaatgtgggc tgggctggga gcagcctctg gacaggagtg gtcccatcca 1020 ggaaacctcc ggcatggctg ggaagtgggg tacttggtgc cgggtctgta tgtgtgtgtg 1080 actggtgtgt gtgagagaga atgtgtgccc taagtgtcag tgtgagtctg tgtatgtgtg 1140 aatattgtct ttgtgtgggt gattttctgc gtgtgtaatc gtgtccctgc aagtgtgaac 1200 aagtggacaa gtgtctggga gtggacaaga gatctgtgca ccatcaggtg tgtgcatagc 1260 gtctgtgcat gtcaagagtg caaggtgaag tgaagggacc aggcccatga tgccactcat 1320 catcaggagc tctaaggccc caggtaagtg ccagtgacag ataagggtgc tgaaggtcac 1380 tctggagtgg gcaggtgggg gtagggaaag ggcaaggcca tgttctggag gaggggttgt 1440 gactacatta gggtgtatga gcctagctgg gaggtggatg gccgggtcca ctgaaaccct 1500 ggttatccca gaaggctttg caggcttcag gagcttggag tggggagagg gggtgacttc 1560 tccgaccagg cccctccacc ggcctaccct gggtaagggc ctggagcagg aagcaggggc 1620 aagaacctct ggagcagccc atacccgccc tggcctgact ctgccactgg cagcacagtc 1680 aacacagcag gttcactcac agcagagggc aaaggccatc atcagctccc tttataaggg 1740 aagggtcacg cgctcggtgt gctgagagtg tcctgcctgg tcctctgtgc ctggtggggt 1800 gggggtgcca ggtgtgtcca gaggagccca tttggtagtg aggcaggtat ggggctagaa 1860 gcactggtgc ccctggccgt gatagtggcc atcttcctgc tcctggtgga cctgatgcac 1920 cggcgccaac gctgggctgc acgctaccca ccaggccccc tgccactgcc cgggctgggc 1980 aacctgctgc atgtggactt ccagaacaca ccatactgct tcgaccaggt gagggaggag 2040 gtcctggagg gcggcagagg tgctgaggct cccctaccag aagcaaacat ggatggtggg 2100 tgaaaccaca ggctggacca gaagccaggc tgagaagggg aagcaggttt gggggacgtc 2160 ctggagaagg gcatttatac atggcatgaa ggactggatt ttccaaaggc caaggaagag 2220 tagggcaagg gcctggaggt ggagctggac ttggcagtgg gcatgcaagc ccattgggca 2280 acatatgtta tggagtacaa agtcccttct gctgacacca gaaggaaagg ccttgggaat 2340 ggaagatgag ttagtcctga gtgccgttta aatcacgaaa tcgaggatga agggggtgca 2400 gtgacccggt tcaaaccttt tgcactgtgg gtcctcgggc ctcactgctc accggcatgg 2460 accatcatct gggaatggga tgctaactgg ggcctctcgg caattttggt gactcttgca 2520 aggtcatacc tgggtgacgc atccaaactg agttcctcca tcacagaagg tgtgaccccc 2580 acccccgccc cacgatcagg aggctgggtc tcctccttcc acctgctcac tcctggtagc 2640 cccgggggtc gtccaaggtt caaataggac taggacctgt agtctggggt gatcctggct 2700 tgacaagagg ccctgaccct ccctctgcag ttgcggcgcc gcttcgggga cgtgttcagc 2760 ctgcagctgg cctggacgcc ggtggtcgtg ctcaatgggc tggcggccgt gcgcgaggcg 2820 ctggtgaccc acggcgagga caccgccgac cgcccgcctg tgcccatcac ccagatcctg 2880 ggtttcgggc cgcgttccca aggcaagcag cggtggggac agagacagat ttccgtggga 2940 cccgggtggg tgatgaccgt agtccgagct gggcagagag ggcgcggggt cgtggacatg 3000 aaacaggcca gcgagtgggg acagcgggcc aagaaaccac ctgcactagg gaggtgtgag 3060 catggggacg agggcggggc ttgtgacgag tgggcggggc cactgccgag acctggcagg 3120 agcccaatgg gtgaggctgg cgcatttccc agctggaatc cggtgtcgaa gtggggggcg 3180 gggaccgcac ctgtgctgta agctcagtgt gggtggcgcg gggcccgcgg ggtcttccct 3240 gagtgcaaag gcggtcaggg tgggcagaga cgaggtgggg caaagccctg ccccagccaa 3300 gggagcaagg tggatgcaca aagagtgggc cctgtgacca gctggacaga gccagggact 3360 gcgggagacc agggggagca tagggttgga gtgggtggtg gatggtgggg ctaatgcctt 3420 catggccacg cgcacgtgcc cgtcccaccc ccaggggtgt tcctggcgcg ctatgggccc 3480 gcgtggcgcg agcagaggcg cttctccgtg tccaccttgc gcaacttggg cctgggcaag 3540 aagtcgctgg agcagtgggt gaccgaggag gccgcctgcc tttgtgccgc cttcgccaac 3600 cactccggtg ggtgatgggc agaagggcac aaagcgggaa ctgggaaggc gggggacggg 3660 gaaggcgacc ccttacccgc atctcccacc cccaggacgc ccctttcgcc ccaacggtct 3720 cttggacaaa gccgtgagca acgtgatcgc ctccctcacc tgcgggcgcc gcttcgagta 3780 cgacgaccct cgcttcctca ggctgctgga cctagctcag gagggactga aggaggagtc 3840 gggctttctg cgcgaggtgc ggagcgagag accgaggagt ctctgcaggg cgagctcccg 3900 agaggtgccg gggctggact ggggcctcgg aagagcagga tttgcataga tgggtttggg 3960 aaaggacatt ccaggagacc ccactgtaag aagggcctgg aggaggaggg gacatctcag 4020 acatggtcgt gggagaggtg tgcccgggtc agggggcacc aggagaggcc aaggactctg 4080 tacctcctat ccacgtcaga gatttcgatt ttaggtttct cctctgggca aggagagagg 4140 gtggaggctg gcacttgggg agggacttgg tgaggtcagt ggtaaggaca ggcaggccct 4200 gggtctacct ggagatggct ggggcctgag acttgtccag gtgaacgcag agcacaggag 4260 ggattgagac cccgttctgt ctggtgtagg tgctgaatgc tgtccccgtc ctcctgcata 4320 tcccagcgct ggctggcaag gtcctacgct tccaaaaggc tttcctgacc cagctggatg 4380 agctgctaac tgagcacagg atgacctggg acccagccca gcccccccga gacctgactg 4440 aggccttcct ggcagagatg gagaaggtga gagtggctgc cacggtgggg ggcaagggtg 4500 gtgggttgag cgtcccagga ggaatgaggg gaggctgggc aaaaggttgg accagtgcat 4560 cacccggcga gccgcatctg ggctgacagg tgcagaattg gaggtcattt gggggctacc 4620 ccgttctgtc ccgagtatgc tctcggccct gctcaggcca aggggaaccc tgagagcagc 4680 ttcaatgatg agaacctgcg catagtggtg gctgacctgt tctctgccgg gatggtgacc 4740 acctcgacca cgctggcctg gggcctcctg ctcatgatcc tacatccgga tgtgcagcgt 4800 gagcccatct gggaaacagt gcaggggccg agggaggaag ggtacaggcg ggggcccatg 4860 aactttgctg ggacacccgg ggctccaagc acaggcttga ccaggatcct gtaagcctga 4920 cctcctccaa cataggaggc aagaaggagt gtcagggccg gaccccctgg gtgctgaccc 4980 attgtgggga cgcatgtctg tccaggccgt gtccaacagg agatcgacga cgtgataggg 5040 caggtgcggc gaccagagat gggtgaccag gctcacatgc cctacaccac tgccgtgatt 5100 catgaggtgc agcgctttgg ggacatcgtc cccctgggtg tgacccatat gacatcccgt 5160 gacatcgaag tacagggctt ccgcatccct aaggtaggcc tggcgccctc ctcaccccag 5220 ctcagcacca gcacctggtg atagccccag catggctact gccaggtggg cccactctag 5280 gaaccctggc cacctagtcc tcaatgccac cacactgact gtccccactt gggtgggggg 5340 tccagagtat aggcagggct ggcctgtcca tccagagccc ccgtctagtg gggagacaaa 5400 ccaggacctg ccagaatgtt ggaggaccca acgcctgcag ggagaggggg cagtgtgggt 5460 gcctctgaga ggtgtgactg cgccctgctg tggggtcgga gagggtactg tggagcttct 5520 cgggcgcagg actagttgac agagtccagc tgtgtgccag gcagtgtgtg tcccccgtgt 5580 gtttggtggc aggggtccca gcatcctaga gtccagtccc cactctcacc ctgcatctcc 5640 tgcccaggga acgacactca tcaccaacct gtcatcggtg ctgaaggatg aggccgtctg 5700 ggagaagccc ttccgcttcc accccgaaca cttcctggat gcccagggcc actttgtgaa 5760 gccggaggcc ttcctgcctt tctcagcagg tgcctgtggg gagcccggct ccctgtcccc 5820 ttccgtggag tcttgcaggg gtatcaccca ggagccaggc tcactgacgc ccctcccctc 5880 cccacaggcc gccgtgcatg cctcggggag cccctggccc gcatggagct cttcctcttc 5940 ttcacctccc tgctgcagca cttcagcttc tcggtgccca ctggacagcc ccggcccagc 6000 caccatggtg tctttgcttt cctggtgagc ccatccccct atgagctttg tgctgtgccc 6060 cgctagaatg gggtacctag tccccagcct gctccctagc cagaggctct aatgtacaat 6120 aaagcaatgt ggtagttcca actcgggtcc cctgctcacg ccctcgttgg gatcatcctc 6180 ctcagggcaa ccccacccct gcctcattcc tgcttacccc accgcctggc cgcatttgag 6240 acaggggtac gttgaggctg agcagatgtc agttaccctt gcccataatc ccatgtcccc 6300 cactgaccca actctgactg cccagattgg tgacaaggac tacattgtcc tggcatgtgg 6360 ggaaggggcc agaatgggct gactagaggt gtcagtcagc cctggatgtg gtggagaggg 6420 caggactcag cctggaggcc catatttcag gcctaactca gcccacccca catcagggac 6480 agcagtcctg ccagcaccat cacaacagtc acctcccttc atatatgaca ccccaaaacg 6540 gaagacaaat catggcgtca gggagctata tgccagggct acctacctcc cagggct 6597 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYP505 primer <400> 2 cactggctcc aagcatggca g 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 3'2D6 primer <400> 3 actgagccct gggaggtggt a 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CYP507 primer <400> 4 aacgttccca ccagatttc 19 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CYP509 primer <400> 5 gtaagtgcca gtgacagata ag 22 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 2d6-11 primer <400> 6 aggatccttt gttcaggata tgttgc 26 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-12 primer <400> 7 caccaagtac cccacttccc 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 2d6-1 primer <400> 8 catgtggact tccagaacac acc 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-2 primer <400> 9 ggttcaaacc ttttgcactg 20 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 2d6-3 primer <400> 10 gtcgtgctca atgggctg 18 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-4 primer <400> 11 aaggtggatg cacaaagagt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-5 primer <400> 12 gacctagctc aggagggact 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-6 primer <400> 13 agctggatga gctgctaact 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-7 primer <400> 14 cctgacctcc tccaacatag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-8 primer <400> 15 cacctagtcc tcaatgccac 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2d6-9 primer <400> 16 gagtcttgca ggggtatcac 20 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5'2D6 primer <400> 17 ccagaagcct ttgcaggctt c 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5'2D6 * 5 primer <400> 18 caccaggcac ctgtactcct c 21 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 3'2D6 * 5 primer <400> 19 caggcatgag ctaaggcacc cagac 25 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> 4223 Cnew primer <400> 20 tgggtgtttg ctttcctggt gac 23 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 10B <400> 21 gtggtggggc atcctcagt 19 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F primer for -1584C> G <400> 22 tcaccccagg aattcaagac 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R primer for -1584C> G <400> 23 ggcttcaagc aattctcctg 20 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pyrosequencing primer for -1584C> G <400> 24 gtattttttg tagagacc 18 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> Primer 9 <400> 25 accagccccc tccaccgg 18 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <220> Primer 10 <400> 26 tctggtaggg gagcctca 18 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer e <400> 27 gtggatggtg gggctaatgc ctt 23 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer f <400> 28 cagagactcc tcggtctctc gct 23 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 5'4213 primer <400> 29 gcatcctaga gtccagtcc 19 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 3'4213 primer <400> 30 cctgtctcag cggccaggcg gtggg 25 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> F primer for * 21B genotype <400> 31 tggtgtaggt gctgaatgct gt 22 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> R primer for * 21B genotype <400> 32 agccactctc accttctcca tc 22 <210> 33 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> pyrosequencing primer for * 21B genotype <400> 33 tcaggtctcg gggggg 16 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F primer for * 52 genotype <400> 34 aggcaacgac actcatcacc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R primer for * 52 genotype <400> 35 gatacccctg caagactcca 20 <210> 36 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> pyrosequencing primer for * 52 genotype <400> 36 ggcatccagg aagtgt 16 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2D6-1426R primer <400> 37 gccaccacgt ctagcttttt 20 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 1611R (P30) primer <400> 38 tttttttttt gggcccatag cgcgccagga 30 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 1758 primer <400> 39 cgccttcgcc aaccactcc 19 <210> 40 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 2573 (P38) primer <400> 40 tttttttttt tttttttggg acccagccca gccccccc 38 <210> 41 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 2850R (P55) primer <400> 41 tttttttttt tttttttttt tttttttttt tttttcaggt cagccaccac tatgc 55 <210> 42 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 2988 (P39) primer <400> 42 tttttttttt tttttttttt agtgcagggg ccgagggag 39 <210> 43 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 3877 (P45) primer <400> 43 tttttttttt tttttttttt tttttctggg catccaggaa gtgtt 45 <210> 44 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 4125 (P50) primer <400> 44 tttttttttt tttttttttt tttttttttt cagcttctcg gtgcccactg 50 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> F primer for * 60 genotype <400> 45 atctcccacc cccaggac 18 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> R primer for * 60 genotype <400> 46 agggaggcga tcacgttg 18 <210> 47 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> pyrosequencing primer for * 60 genotype <400> 47 ggcgatcacg ttgct 15 <210> 48 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> 2D6 + 1887R (P60) <400> 48 tttttttttt tttttttttt tttttttttt tttttttttt agggaggcga tcacgttgct 60                                                                           60 <210> 49 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> 2D6-5R (P65) <400> 49 tttttttttt tttttttttt tttttttttt tttttttttt tttttctcgt cactggtcag 60 gggtc 65 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYP2D6_3 <400> 50 acctctctgg gccctcaggg a 21 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Dup-F_2 <400> 51 cctcaccaca ggactggcca cc 22 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dup-R <400> 52 cacgtgcagg gcacctagat 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CYP2D6-5R <400> 53 ctcgtcactg gtcaggggtc 20 <210> 54 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip2 <400> 54 caggccaagt atcttgcgcg gcagctcgtc gaccg 35 <210> 55 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip7 <400> 55 caggccaagt gtggtccatc acaaacaggg agtcg 35 <210> 56 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip8 <400> 56 caggccaagt cttgagcgat gacggacggg aaaag 35 <210> 57 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip9 <400> 57 caggccaagt aagttgggga tctgtagacc cagcc 35 <210> 58 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip14 <400> 58 caggccaagt ggattgcacc gtcagcacca ccgag 35 <210> 59 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip15 <400> 59 caggccaagt tcccaggacg gcgctggcac gttga 35 <210> 60 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip16 <400> 60 caggccaagt cggcgtccac gtcgagttcc ttcgc 35 <210> 61 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip19 <400> 61 caggccaagt ttcggggaaa ctccgcaccg ccacg 35 <210> 62 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> cZip20 <400> 62 caggccaagt taggtttgcc agtgcgttgg atcg 34 <210> 63 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip21 <400> 63 caggccaagt tcgacaaccc ggttggagga ttcag 35 <210> 64 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip22 <400> 64 caggccaagt ccaaaagctt tacgccagcg ccgaa 35 <210> 65 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip24 <400> 65 caggccaagt agatcggtga gcagttcaaa gccgg 35 <210> 66 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip27 <400> 66 caggccaagt gggtatccgt tcggtgttgc gtagt 35 <210> 67 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip31 <400> 67 caggccaagt tggtgctggc gcagaccttt gtctc 35 <210> 68 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip32 <400> 68 caggccaagt accgcgcaaa tggacagtgt ggcca 35 <210> 69 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip33 <400> 69 caggccaagt gaccccaact tgacacgtcg caagg 35 <210> 70 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip40 <400> 70 caggccaagt cgtaagcctc gtcagctatc cgggg 35 <210> 71 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip41 <400> 71 caggccaagt ccaaacgcac cccaacctgt ccgga 35 <210> 72 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip44 <400> 72 caggccaagt cggcggtggc attgtcactg ctgct 35 <210> 73 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip50 <400> 73 caggccaagt gcagttcgtg gccatggtga ccgct 35 <210> 74 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip56 <400> 74 caggccaagt cgttgtggta gcggcactgg tggtg 35 <210> 75 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip61 <400> 75 caggccaagt ctgggtgtgg gtgctcgtac gccga 35 <210> 76 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip101 <400> 76 caggccaagt cggcacatag gacggggttc agata 35 <210> 77 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip102 <400> 77 caggccaagt gaacaagatt ggtcctggag gtgcg 35 <210> 78 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip104 <400> 78 caggccaagt tcggatggcg ttcagtagga gaagg 35 <210> 79 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip106 <400> 79 caggccaagt acactctcca tgcggtagac ctgac 35 <210> 80 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cZip109 <400> 80 caggccaagt gaacctaatg aagacggggg gtgct 35 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> -1584 F1 <400> 81 gctgccatac aatccacctg 20 <210> 82 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> -1584 R1 <400> 82 gctcactaca accttcacct c 21 <210> 83 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 100 F2 <400> 83 gtcctgcctg gtcctctg 18 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 100 R2 <400> 84 cttgccctac tcttccttgg 20 <210> 85 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 5'1611 <400> 85 gtgggcagag acgaggtg 18 <210> 86 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 3'1611 <400> 86 cggagtggtt ggcgaagg 18 <210> 87 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 1758 F1 <400> 87 cttctccgtg tccaccttg 19 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1758 R1 <400> 88 tgtcctttcc caaacccatc 20 <210> 89 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 5 '2573 <400> 89 gtccaggtga acgcagag 18 <210> 90 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 3 '2573 <400> 90 cggcagagaa caggtcag 18 <210> 91 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5 '2850 <400> 91 cagagatgga gaaggtgaga g 21 <210> 92 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 3 '2850 <400> 92 tggaggaggt caggcttac 19 <210> 93 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4125 F2 <400> 93 actcatcacc aacctgtcat c 21 <210> 94 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 4125 R2 <400> 94 ggaactacca cattgcttta ttg 23 <210> 95 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> D & D-F 1 <400> 95 acctctctgg gccctca 17 <210> 96 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> D & D-R 1 <400> 96 atgccacctc ctccttctc 19 <210> 97 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> -1584 (C) zip15 <400> 97 tcaacgtgcc agcgccgtcc tgggagctaa ttttgtattt tttgtagaga ccg 53 <210> 98 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> -1584 (G) zip16 <400> 98 gcgaaggaac tcgacgtgga cgccggctaa ttttgtattt tttgtagaga ccc 53 <210> 99 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> 100 (C) Zip27 <400> 99 actacgcaac accgaacgga taccccgctg ggctgcacgc tacc 44 <210> 100 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> 100 (T) Zip2 <400> 100 cggtcgacga gctgccgcgc aagatcgctg ggctgcacgc tact 44 <210> 101 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 1611 (T) zip40 <400> 101 ccccggatag ctgacgaggc ttacgcccat agcgcgccag gaa 43 <210> 102 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 1611 (A) zip44 <400> 102 agcagcagtg acaatgccac cgccgcccat agcgcgccag gat 43 <210> 103 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> 1758 (G) Zip101R <400> 103 atctgaaccc cgtcctatgt gccgccttct gcccatcacc cacc 44 <210> 104 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 1758 (A) zip109 <400> 104 agcacccccc gtcttcatta ggttcccttc tgcccatcac ccact 45 <210> 105 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 2573 (G) Zip9 <400> 105 ggctgggtct acagatcccc aacttgtcag gtctcggggg ggc 43 <210> 106 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> 2573 (C) Zip41 <400> 106 tccggacagg ttggggtgcg tttgggtcag gtctcggggg ggg 43 <210> 107 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> 2850 (C) zip61 <400> 107 tcggcgtacg agcacccaca cccaggaaca ggtcagccac cactatgcg 49 <210> 108 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> 2850 (T) Zip31 <400> 108 gagacaaagg tctgcgccag caccagaaca ggtcagccac cactatgca 49 <210> 109 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 4125-4133 Zip21 <400> 109 ctgaatcctc caaccgggtt gtcgagcttc tcggtgccca ctgga 45 <210> 110 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 4125-4133insZip22 <400> 110 ttcggcgctg gcgtaaagct tttgggcttc tcggtgccca ctgtg 45 <210> 111 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> 6 (A) zip 106 <400> 111 gtcaggtcta ccgcatggag agtgtgccct cagggatgct gctgta 46 <210> 112 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 7 (C) zip102 <400> 112 cgcacctcca ggaccaatct tgttcccctc agggatgctg ctgtc 45 <210> 113 <211> 44 <212> DNA <213> Artificial Sequence <220> (223) 7 (C) zip32 <400> 113 tggccacact gtccatttgc gcggtcctca gggatgctgc tgtc 44 <210> 114 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> 6 (A) zip 19 <400> 114 cgtggcggtg cggagtttcc ccgaacctca gggatgctgc tgta 44 <210> 115 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 2D6pc-1460 (zip14) <400> 115 ctcggtggtg ctgacggtgc aatccccaac atggtgaaac cctatctcta c 51  

Claims (21)

(a) taking a biological sample from a human; (b) extracting nucleic acids from the sample taken in step (a); (c) performing PCR with a primer capable of amplifying the human CYP2D6 gene or fragment thereof as a template of the nucleic acid of step (b); (d) confirming the presence or absence of a mutation in the base sequence of the PCR product obtained in step (c); (e) analyzing haplotypes in the nucleotide sequence of the PCR product identified as present in step (d); And (f) analyzing the nucleotide sequence of the haplotype analyzed in step (e) using SNP tagger (SNPtagger) software to select htSNP, the method for selecting htSNP of the human CYP2D6 gene. The method of claim 1, The biological sample of step (a) is characterized in that is selected from the group consisting of blood, skin cells, mucosal cells and hair. The method of claim 1, The primer of step (c) is SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 17 to SEQ ID NO: 23, SEQ ID NO: 25 to SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, sequence And a nucleotide sequence selected from the group consisting of SEQ ID NO: 45 and SEQ ID NO: 46. The method of claim 1, The variation of step (d) is characterized in that it is selected from the group consisting of monobasic polymorphism, deletion of the gene and duplication of the gene. The method of claim 1, In step (d), the presence or absence of the presence of a mutation is characterized in that performed using one selected from the group consisting of sequencing, electrophoretic analysis and RFLP analysis. The method of claim 1, And repeating steps (a) to (e). (a) taking a biological sample from a human; (b) extracting nucleic acids from the sample taken in step (a); (c) performing PCR with a primer capable of amplifying the human CYP2D6 gene or fragment thereof as a template of the nucleic acid of step (b); And (d) one from the group consisting of -1426C> T, 100C> T and 1039C> T in the nucleotide sequence of the PCR product obtained in step (c); -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And examining the presence or absence of at least eleven CYP2D6 gene mutations selected from the group consisting of 2D6 duplications. The method of claim 7, wherein The biological sample of step (a) is characterized in that is selected from the group consisting of blood, skin cells, mucosal cells and hair. The method of claim 7, wherein The primer of step (c) is SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 17 to SEQ ID NO: 23, SEQ ID NO: 25 to SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 45 and SEQ ID NO: 46 characterized in that it has a nucleotide sequence selected from the group consisting of. The method of claim 7, wherein One from the group consisting of -1426C> T, 100C> T and 1039C> T in step (d); -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And examining the presence or absence of a mutation consisting of 2D6 overlap. The method of claim 7, wherein In step (d) -1584C> G; One in the group consisting of -1426C> T, 100C> T and 1039C> T; 1611T> A; 1758G> A; 2573insC; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; One in the group consisting of -1245insGA, -1028T> C, -377A> C, 3877G> A, 4388C> T and 4401C> T; 4125-4133insGTGCCCACT; 2D6 deletion; And examining the presence or absence of a mutation consisting of 2D6 overlap. The method of claim 7, wherein One from the group consisting of -1426C> T, 100C> T and 1039C> T in step (d); -1584C> G; -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; 1611T> A; 1758G> A; 1887insTA; 2573insC; 4125-4133insGTGCCCACT; 2D6 deletion; And examining the presence or absence of a mutation consisting of 2D6 overlap. The method of claim 7, wherein In step (d) -1584C> G; One in the group consisting of -1426C> T, 100C> T and 1039C> T; 1611T> A; 1758G> A; 2573insC; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; One in the group consisting of -1245insGA, -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; 4125-4133insGTGCCCACT; -1235A> G; 1887insTA; 2D6 deletion; And examining the presence or absence of a mutation consisting of 2D6 overlap. The method of claim 7, wherein One from the group consisting of -1426C> T, 100C> T and 1039C> T in step (d); -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; 1611T> A; One in the group consisting of 1661G> C and 4180G> C; 1758G> A; 1887insTA; 2573insC; 2988G> A; 4125-4133insGTGCCCACT; -1235A> G; 1887insTA; 2D6 deletion; And examining the presence or absence of a mutation consisting of 2D6 overlap. The method of claim 7, wherein In step (d) -1584C> G; One in the group consisting of -1426C> T, 100C> T and 1039C> T; 1611T> A; 1758G> A; 2573insC; One from the group consisting of -740C> T, -678G> A, 214G> C, 221C> A, 223C> G, 227T> C, 232G> C, 233A> C, 245A> G and 2850C> T; One in the group consisting of -1245insGA, -1028T> C, -377A> G, 3877G> A, 4388C> T and 4401C> T; 1887insTA; 2988G> A; 4125-4133insGTGCCCACT; 2D6 deletion; And examining the presence or absence of a mutation consisting of 2D6 overlap. The method of claim 7, wherein In the step (d), the presence or absence of the investigation of the method characterized in that it is carried out using a snapshot (SNaPshot) analysis. The method of claim 16, The snapshot analysis includes a sequence in which the base next to the monobasic polymorphism position is 3 'end and is annealed to an adjacent portion of the monobasic polymorphism position, and the 5' terminus is performed using a primer added with a T base. How to feature. The method of claim 17, The primer has a base sequence selected from the group consisting of SEQ ID NO: 37 to SEQ ID NO: 44, SEQ ID NO: 48 and SEQ ID NO: 49. (a) extracting a gene to be tested and then performing a multiplex PCR to obtain a PCR product including an SNP surrounding to be identified; (b) performing an ASPE reaction using an allele specific primer extension (ASPE) primer capable of identifying a specific base of each allele; (c) hybridizing the reaction product to a gene chip; And (D) method for determining the genotype of the human CYP2D6 gene using a gene analysis chip, comprising the step of analyzing the chip. The method of claim 19, Gene chip has a probe having a nucleotide sequence of SEQ ID NO: 54 to 80. A kit for CYP2D6 genotyping, comprising a Zip Code oligobase chip for SNP testing.

Images