KR20060073815A - Amplification method of nucleic acid sequence using modified rca and second primer - Google Patents
Amplification method of nucleic acid sequence using modified rca and second primer Download PDFInfo
- Publication number
- KR20060073815A KR20060073815A KR1020040112235A KR20040112235A KR20060073815A KR 20060073815 A KR20060073815 A KR 20060073815A KR 1020040112235 A KR1020040112235 A KR 1020040112235A KR 20040112235 A KR20040112235 A KR 20040112235A KR 20060073815 A KR20060073815 A KR 20060073815A
- Authority
- KR
- South Korea
- Prior art keywords
- nucleic acid
- acid sequence
- sequence
- dna
- rca
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/30—Oligonucleotides characterised by their secondary structure
- C12Q2525/301—Hairpin oligonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/101—Temperature
Abstract
본 발명은, 목적 핵산 서열의 증폭 방법에 관한 것으로서,The present invention relates to a method for amplifying a nucleic acid sequence of interest,
(a) 하이브리다이제이션을 촉진하는 조건 하에서, 증폭하고자 하는 목적 표적 핵산 서열의 3 -말단 쪽 서열에 상보적인 핵산 서열 분절을 포함하는 원형 프로브와, 증폭하고자 하는 목적 핵산 서열이 접촉하여, 목적 핵산 서열의 3 -말단과 원형 프로브가 어닐링하는 단계;(a) Under conditions that promote hybridization, a circular probe comprising a nucleic acid sequence segment complementary to the 3-terminal sequence of the target nucleic acid sequence to be amplified with the target nucleic acid sequence to be amplified is brought into contact with the target nucleic acid. Annealing the 3-terminal end of the sequence with the circular probe;
(b) 증폭하고자 하는 목적 핵산 서열의 3 말단으로부터, 원형 프로브를 이용하여 RCA-촉진 효소에 의해 DNA 서열이 신장되는 단계;(b) stretching the DNA sequence from the three ends of the desired nucleic acid sequence to be amplified by the RCA-promoting enzyme using a circular probe;
(c) 상기 신장된 DNA 서열이 헤어핀 구조를 갖는 2차 프라이머의 머리 부분과 하이브리다이제이션된 후, 그 2차 프라이머의 다리 부분을 이루는 가닥에 원형 프로브가 어닐링하는 단계;(c) after the elongated DNA sequence is hybridized with the head of the secondary primer having the hairpin structure, the circular probe is annealed to strands forming the bridge of the secondary primer;
(d) 상기 2차 프라이머에 원형 프로브가 어닐링된 후 그로부터 RCA가 수행되어, 추가의 신장된 DNA 서열이 형성되는 것을 특징으로 하는 단계; 및(d) annealing the circular probe to the secondary primer and then performing RCA therefrom to form additional stretched DNA sequences; And
(e) 상기 (d)로부터 형성된 추가의 신장된 DNA 서열에 대하여, (c) 내지 (d)의 단계가 1회 이상 계속하여 반복되는 것을 특징으로 하는 단계;를 포함하는 방법을 제공한다.(e) with respect to the further stretched DNA sequence formed from (d), wherein the steps of (c) to (d) are repeated one or more times.
RCA(rolling circle amplification), 증폭, 헤어핀 구조Rolling circle amplification (RCA), amplification, hairpin structure
Description
도 1a 및 1b는 본 발명의 2차 프라이머의 형태 및 구조를 도식적으로 나타낸 도면이고,도 2는 또 다른 형태의 본 발명의 2차 프라이머의 형태 및 구조를 도식적으로 나타낸 도면이고, 1A and 1B are diagrams schematically showing the form and structure of the secondary primer of the present invention, and FIG. 2 is a diagram schematically showing the form and structure of the secondary primer of the present invention in another form.
도 3a 및 3b은 본 발명에 따른 2차 프라이머를 이용한 RCA 과정을 개략적으로 나타낸 도면이고,3a and 3b is a view schematically showing an RCA process using a secondary primer according to the present invention,
도 4는 본 발명에 따른 RCA 과정을 고체 지지체 상에서 적용한 예를 나타낸 도면이고,4 is a view showing an example of applying the RCA process according to the invention on a solid support,
도 5a 및 5b는 전위차를 이용한 DNA 검출 방법에 본 발명의 RCA 방법을 적용한 예를 나타낸 도면이다.5A and 5B show examples of applying the RCA method of the present invention to a DNA detection method using a potential difference.
본 발명은 핵산을 증폭하는 방법에 관한 것으로서, 더욱 상세하게는, 2차 프라이머를 이용함으로써 증폭 효율이 더욱 증대된 RCA에 의한 핵산 증폭 방법을 제공한다. The present invention relates to a method for amplifying a nucleic acid, and more particularly, to provide a method for amplifying a nucleic acid by RCA in which amplification efficiency is further increased by using a secondary primer.
표적 핵산의 효율적인 증폭은 핵산의 검출 뿐만 아니라, DNA 시퀀싱, 클로닝 등에 있어서도 매우 중요한 요소이다. DNA로 이루어진 선택된 표적 및/또는 프로브를 증폭하기 위한 여러 가지 방법이 제안되고 있으며, 그 예로는, PCR(polymerase chain reaction), LCR(ligase chain reaction), 3SR(self-sustained sequence replication), NASBA(nucleic acid sequence based amplification), 및 SDA(strand displacement amplification) 등이 있다. 이러한 방법들 중 다수는 정량적인 측정에 있어서 정확도가 다소 떨어졌으며, 고가의 장비를 요구하며, 특히 동시에 한 가지 이상의 타겟을 분석하고자 하는 경우에는 그 정도가 더 심하였다. 이러한 단점들을 보완하고자 개발된 것이 RCA(rolling circle amplification) 방법이었다.즉, 종래, 원형 DNA 분자를 증폭하기 위하여 PCR과 같은 몇몇 기술들이 채용되었으나, 이러한 방법들은 다소 시간이 오래 걸리고 효율이 떨어지며, 고가의 비용과 인력이 소모된다는 단점이 있었다.Efficient amplification of target nucleic acids is a very important factor not only for the detection of nucleic acids but also for DNA sequencing and cloning. Several methods have been proposed for amplifying selected targets and / or probes consisting of DNA, for example polymerase chain reaction (PCR), ligand chain reaction (LCR), self-sustained sequence replication (3SR), NASBA ( nucleic acid sequence based amplification, and strand displacement amplification (SDA). Many of these methods are somewhat less accurate in quantitative measurements and require expensive equipment, especially if you want to analyze more than one target at the same time. Rolling circle amplification (RCA) was developed to compensate for these shortcomings.In other words, conventional techniques such as PCR have been employed to amplify circular DNA molecules, but these methods are somewhat time-consuming, inefficient, and expensive. The cost and manpower was consumed.
PCR 방법은, 프라이머상, 주형, 중합효소, 및 dNTP를 포함하는 반응 용액 중에서, 온도를 고온으로 높여서 DNA를 단일가닥으로 분리하는 변성 과정, 온도를 낮추어서 상기 분리된 각 DNA 단일사슬에 상보적인 프라이머를 주형에 결합시키는 어닐링 과정, 다시 온도를 높여서 중합효소에 의한 중합반응에 의해 새로운 가닥을 중합하는 과정으로 이루어지며, 이 증폭을 통하여 DNA 사슬은 지수적으로 증가한다. 그러나, PCR 과정은 상기와 같은 단계를 거치기 때문에 온도의 변화를 필연적으로 수반하고, 따라서, PCR을 위한 장치에는 온도 컨트롤러 및 히팅 수단을 구비해야하만 한다. 그러나 랩온어칩(lab-on-a-chip, LOC) 등에서 표적 핵산의 증폭을 위해 PCR을 이용하는 경우, LOC를 위한 검출 장치 등의 장치 외에 PCR 반응을 위한 온도 콘트롤러 및 히터를 별도로 요구하기 때문에, 장비가 복잡해지고, 장비 단가가 높아진다는 단점이 있었다.In the PCR method, a denaturation process of separating DNA into single strands by raising the temperature to a high temperature in a reaction solution containing a primer phase, a template, a polymerase, and dNTP, and a primer complementary to each separated DNA single chain by lowering the temperature Annealing process that binds to the template, the temperature is increased again to polymerize a new strand by the polymerization reaction by the polymerase, through the amplification, the DNA chain is increased exponentially. However, since the PCR process goes through the above steps, it is inevitably accompanied by a change in temperature, and therefore, the apparatus for PCR must have a temperature controller and heating means. However, when PCR is used to amplify a target nucleic acid in a lab-on-a-chip (LOC), a temperature controller and a heater for a PCR reaction are separately required in addition to a device such as a detection device for a LOC. There is a disadvantage that the equipment is complicated, the equipment cost increases.
이러한 단점을 개선할 수 있는 방법으로서, RCA 방법이 제안되었다. RCA 방법은 상기한 바와 같이 PCR 증폭에서 요구되는 온도변화를 요구하지 않음으로써, 등온 상태에서 표적 핵산의 증폭이 가능하다는 장점을 갖는다. 따라서, 증폭이 요구되는 공정에서 별도의 온도 조절 장치의 요구 없이 증폭이 가능하고, 장치의 복잡성과 비용을 줄일 수 있다. LRCA(linear rolling circle amplification) 방법은, 표적 DNA 서열과 개방 원형 프로브를 하이브리다이징시켜 복합체를 형성한 후, 라이게이션하여 증폭 표적 서클을 만든 후, 프라이머 서열과 DNA 중합효소를 넣어준다. 그리고 나서 증폭 표적 서클은 새로운 DNA가 형성된 주형을 형성하고, 프라이머로부터 신장시켜서 증폭 표적 서클에 상보적인 반복 서열의 계속된 서열로 연장함으로써, 한시간에 수천 카피의 핵산을 만들어낸다.As a method to alleviate this disadvantage, the RCA method has been proposed. The RCA method does not require the temperature change required for PCR amplification as described above, and thus has the advantage that the target nucleic acid can be amplified in an isothermal state. Therefore, amplification can be performed in a process requiring amplification without requiring a separate temperature control device, and the complexity and cost of the device can be reduced. In the linear rolling circle amplification (LRCA) method, a hybrid DNA is formed by hybridizing a target DNA sequence and an open circular probe, followed by ligation to form an amplification target circle, and then a primer sequence and a DNA polymerase are added thereto. The amplification target circle then forms a template in which new DNA has been formed, and extends from the primer to extend into a continued sequence of repeat sequences complementary to the amplification target circle, producing thousands of copies of the nucleic acid per hour.
이것을 더욱 개선한 방법이, ERCA(exponential RCA) 방법이다. ERCA는, 증폭 표적 서클에 상보적인 복제된 서열에 결합하는 추가적인 프라이머 서열을 이용하여 새로운 증폭 중심을 제공하고, 그로 인하여 기하 급수적으로 증가하는 증폭을 제공한다. ERCA 방법은 가닥 이동(strand displacment) 방법이 연속되는 형태를 이용하지만, 부가적인 RCA 없이 상기 생성물에 부착되는 개별적인 단일 가닥의 선형 프라이머를 이용하여 초기의 단일 가닥 RCA 생성물을 또 다른 DNA 합성의 주형으로 이용하는 것에 한정된다.본 발명에서는, 별도의 장치와 방법의 변형 없이 모든 핵 산의 검출 및 증폭 반응에서 응용가능한, 특이성과 검출 감도가 높은 핵산 증폭 효율의 개선 방법을 제공하고자 한다.A further improvement of this is the ERCA (exponential RCA) method. ERCA provides new amplification centers using additional primer sequences that bind to replicated sequences complementary to amplification target circles, thereby providing exponentially increasing amplification. The ERCA method uses a continuous form of strand displacment method, but uses the initial single stranded RCA product as another template for DNA synthesis, with individual single stranded linear primers attached to the product without additional RCA. The present invention seeks to provide a method for improving nucleic acid amplification efficiency with high specificity and high detection sensitivity, which is applicable to the detection and amplification reaction of all nucleic acids without modification of a separate apparatus and method.
상기 문제점을 해결하기 위하여 위하여, 본 발명은, 원형 프로브 및 2차 프라이머를 이용한 RCA 방법에 의한 핵산의 증폭 방법을 제공하고자 한다.In order to solve the above problems, the present invention is to provide a nucleic acid amplification method by the RCA method using a circular probe and a secondary primer.
상기 목적을 달성하기 위하여, 본 발명은,In order to achieve the above object, the present invention,
(a) 하이브리다이제이션을 촉진하는 조건 하에서, 증폭하고자 하는 목적 표적 핵산 서열의 3 -말단 쪽 서열에 상보적인 핵산 서열 분절을 포함하는 원형 프로브와, 증폭하고자 하는 목적 핵산 서열이 접촉하여, 목적 핵산 서열의 3 -말단과 원형 프로브가 어닐링하는 단계;(a) Under conditions that promote hybridization, a circular probe comprising a nucleic acid sequence segment complementary to the 3-terminal sequence of the target nucleic acid sequence to be amplified with the target nucleic acid sequence to be amplified is brought into contact with the target nucleic acid. Annealing the 3-terminal end of the sequence with the circular probe;
(b) 증폭하고자 하는 목적 핵산 서열의 3 말단으로부터, 원형 프로브를 이용하여 RCA-촉진 효소에 의해 DNA 서열이 신장되는 단계;(b) stretching the DNA sequence from the three ends of the desired nucleic acid sequence to be amplified by the RCA-promoting enzyme using a circular probe;
(c) 상기 신장된 DNA 서열이 헤어핀 구조를 갖는 2차 프라이머의 머리 부분과 하이브리다이제이션된 후, 그 2차 프라이머의 다리 부분을 이루는 가닥에 원형 프로브가 어닐링하는 단계;(c) after the elongated DNA sequence is hybridized with the head of the secondary primer having the hairpin structure, the circular probe is annealed to strands forming the bridge of the secondary primer;
(d) 상기 2차 프라이머에 원형 프로브가 어닐링된 후 그로부터 RCA가 수행되어, 추가의 신장된 DNA 서열이 형성되는 것을 특징으로 하는 단계; 및(d) annealing the circular probe to the secondary primer and then performing RCA therefrom to form additional stretched DNA sequences; And
(e) 상기 (d)로부터 형성된 추가의 신장된 DNA 서열에 대하여, (c) 내지 (d)의 단계가 1회 이상 계속하여 반복되는 것을 특징으로 하는 단계; (e) for the further stretched DNA sequence formed from (d), wherein steps (c) to (d) are repeated one or more times in succession;
를 포함하는, 목적 핵산 서열의 증폭 방법을 제공한다.It provides a method of amplifying a nucleic acid sequence of interest.
이하, 상기 방법을 더욱 상세히 설명한다.The method is described in more detail below.
본 발명은, 기존의 어떠한 RCA(rolling circle amplification) 방법에도 간단하게 적용할 수 있는 RCA를 더욱 개선시킨 증폭 방법에 관한 것이다. RCA에 의한 증폭 방법은 상기한 바와 같이 PCR 증폭에서 요구되는 온도변화를 요구하지 않음으로써, 등온 상태에서 표적 핵산의 증폭이 가능하다는 장점을 갖는다. 따라서, 증폭이 요구되는 공정에서 별도의 온도 조절 장치의 요구 없이 증폭이 가능하고, 장치의 복잡성과 비용을 줄일 수 있다는 장점이 있다.The present invention relates to an amplification method further improved RCA that can be easily applied to any existing rolling circle amplification (RCA) method. The amplification method by RCA does not require the temperature change required for PCR amplification as described above, and thus has the advantage that the target nucleic acid can be amplified in an isothermal state. Therefore, in a process requiring amplification, it is possible to amplify without requiring a separate temperature control device, and there is an advantage in that the complexity and cost of the device can be reduced.
이러한 RCA를 이용한 본 발명의 개선된 증폭 방법은, 당업자에게 공지된 어떠한 검출 방법과도 조합하여 사용가능하며, 다양한 수단과 경로를 통하여 검출 감도를 획기적으로 높여 준다.The improved amplification method of the present invention using such RCA can be used in combination with any detection method known to those skilled in the art, and dramatically increases the detection sensitivity through various means and pathways.
그럼에도 불구하고, 본 발명의 방법은, 복잡한 장비나 컨트롤러를 요구하지 않으며, 반응에 부수적인 영향을 미칠 수 있는 별도의 시약을 요구하지 않는다. 단지, 기존의 알려진 RCA 방법에 간단한 2차 프라이머만을 첨가하는 방법을 채용한다. 이러한 2차 프라이머에 의해 제 2, 제 3, 제 4의 증폭이 급속하게 일어나면서 증폭산물이 크게 증가하게 된다. 즉, 본래의 RCA 방법에 요구되는 원형 프로브 및 여기에 본 발명의 독특한 구조의 2차 프라이머만을 더 이용함으로써, 증폭 효율을 획기적으로 높일 수 있는 방법을 제공한다. 이와 같이 개선된 RCA 방법을 제공하는 본 발명의 방법은,Nevertheless, the method of the present invention does not require complex equipment or controllers and does not require a separate reagent that can have a secondary effect on the reaction. Only a simple secondary primer is added to the known RCA method. The secondary primer rapidly increases the second, third, and fourth amplification products, and the amplification products are greatly increased. That is, by further using only the circular probe required for the original RCA method and the secondary primer of the unique structure of the present invention, there is provided a method that can dramatically increase amplification efficiency. The method of the present invention to provide such an improved RCA method,
(a) 하이브리다이제이션을 촉진하는 조건 하에서, 증폭하고자 하는 목적 표 적 핵산 서열의 3 -말단 쪽 서열에 상보적인 핵산 서열 분절을 포함하는 원형 프로브와, 증폭하고자 하는 목적 핵산 서열이 접촉하여, 목적 핵산 서열의 3 말단과 원형 프로브가 어닐링하는 단계;(a) under conditions that promote hybridization, a circular probe comprising a nucleic acid sequence segment complementary to the 3-terminal sequence of the target nucleic acid sequence to be amplified with the target nucleic acid sequence to be amplified Annealing the three ends of the nucleic acid sequence and the circular probe;
(b) 증폭하고자 하는 목적 핵산 서열의 3 말단으로부터 원형 프로브를 이용하여 RCA(rolling circle amplification)가 촉진되는 조건 하에서, RCA-촉진 효소에 의해 DNA 서열이 신장되는 단계로서, 상기 조건은 신장된 DNA 서열의 형성을 가능하게 하는 하나 이상의 dNTP의 존재를 포함하는 것을 특징으로 하는 단계;(b) stretching the DNA sequence by RCA-promoting enzyme under conditions in which rolling circle amplification is promoted using a circular probe from three ends of the nucleic acid sequence to be amplified, wherein the conditions are extended DNA Characterized in that it comprises the presence of one or more dNTPs that allow formation of a sequence;
(c) 상기 신장된 DNA 서열이 헤어핀 구조를 갖는 2차 프라이머의 머리 부분과 하이브리다이제이션된 후, 그 2차 프라이머의 다리 부분을 이루는 가닥에 언형 프로브가 어닐링하는 단계로서, 상기 2차 프라이머의 헤어핀 구조의 머리 부분은, 상기 신장된 핵산 서열의 적어도 일부에 상보적이며, 헤어핀의 다리 부분을 이루는 2개의 가닥은 서로 상보적으로 결합되어 있으면서 상기 신장된 DNA 서열에는 상보적이지 않으며, 헤어핀 다리 부분을 이루는 가닥 중 하나는, 상기 원형 프로브의 적어도 일부에 상보적이면서 동시에 3 -말단을 가지고 프라이머로 작용하는 것을 특징으로 하는 단계;(c) the extended DNA sequence is hybridized with the head of the secondary primer having a hairpin structure, and then an anneal probe is annealed to a strand forming the bridge of the secondary primer, wherein The head of the hairpin structure is complementary to at least a portion of the elongated nucleic acid sequence, the two strands forming the leg of the hairpin are complementary to each other and are not complementary to the elongated DNA sequence, and the hairpin leg One of the constituent strands is characterized in that it is complementary to at least a portion of said circular probe and at the same time acts as a primer with a 3-terminal;
(d) 하나 이상의 dNTP 및 RCA-촉진 효소의 존재 하에서, 상기 2차 프라이머의 3 -말단에 원형 프로브가 어닐링된 후 그로부터 RCA가 수행되어, 추가의 신장된 DNA 서열이 형성되는 것을 특징으로 하는 단계; 및(d) in the presence of one or more dNTPs and RCA-promoting enzymes, wherein the circular probe is annealed at the 3-terminus of the secondary primer followed by RCA to form additional elongated DNA sequences. ; And
(e) 상기 (d)로부터 형성된 추가의 신장된 DNA 서열에 대하여, (c) 내지 (d)의 단계가 1회 이상 계속하여 반복되는 것을 특징으로 하는 단계를 포함한다. (e) for the further stretched DNA sequence formed from (d) above, the steps of (c) to (d) are repeated one or more times in succession.
또한 목적 핵산 서열은, 증폭하고자 하는 어떠한 단일가닥 서열도 될 수 있으며, 초기의 핵산 서열 뿐만 아니라, 2차 프라이머에 의해 증폭된 서열을 다시 증폭하는 경우도 포함한다. 이러한 목적 핵산 서열은 그 5 -말단이 고체 지지체에 지지된 또 다른 검출 프로브에 상보적으로 결합되는 형태일 수도 있고, 용액 중에 존재하는 형태일 수도 있다.In addition, the target nucleic acid sequence may be any single-stranded sequence to be amplified and includes amplification of not only the initial nucleic acid sequence but also the sequence amplified by the secondary primer. This desired nucleic acid sequence may be in the form where its 5-terminal is complementarily bound to another detection probe supported on a solid support, or may be in the form of a solution present in solution.
본 발명의 RCA 반응에 있어서, 상기 목적 핵산 서열의 3 -말단 쪽 서열은 프라이머로서 작용하여, 원형 프로브가 3 -말단에 어닐링된 후, RCA-촉진 효소에 의해 RCA 반응이 개시된다. RCA-촉진 효소라 함은, 통상적으로 당업자에게 알려진 어떠한 효소라도 사용가능하다. RCA-촉진 효소의 예로는, φ29 DNA 폴리머라아제, 파아지 M2 DNA 폴리머라아제, 파아지 φ-PRD1 DNA 폴리머라아제, VENT.RTM DNA 폴리머라아제, 클레노우 단편 DNA 폴리머라아제 I, T5 DNA 폴리머라아제, PRD1 DNA 폴리머라아제, T4 DNA 폴리머라아제 홀로엔자임, T7 네이티브 폴리머라아제, Bst 폴리머라아제 등이 가능하다. 특히 바람직한 예는, φ29 DNA 폴리머라아제이다. In the RCA reaction of the present invention, the 3-terminal sequence of the target nucleic acid sequence acts as a primer so that the RCA reaction is initiated by the RCA-promoting enzyme after the circular probe is annealed at the 3-terminal. RCA-promoting enzymes may be any enzyme commonly known to those skilled in the art. Examples of RCA-promoting enzymes include φ29 DNA polymerase, phage M2 DNA polymerase, phage φ-PRD1 DNA polymerase, VENT.RTM DNA polymerase, Klenow fragment DNA polymerase I, T5 DNA polymer Laase, PRD1 DNA polymerase, T4 DNA polymerase holozyme, T7 native polymerase, Bst polymerase and the like are possible. Particularly preferred example is φ29 DNA polymerase.
RCA 반응의 틀이 되는 원형 프로브는, 도 2에 나타낸 바와 같이, 프라이머에 상보적인 서열 뿐만 아니라, 증폭 및 검출하고자 하는 서열에 상보적인 서열을 포함하는 단일 가닥의 원형 올리고뉴클레오티드로서, 그 크기는 특별히 제한되지 않으며 당업자가 적절하게 선택할 수 있으나, 15 bp 이상의 크기를 가질 수 있다. 이러한 원형 프로브를 틀로 하여 RCA가 계속적으로 진행됨으로써 DNA 서열이 증폭되며, 신장된 DNA 서열은 원형 프로브의 서열에 상보적인 서열이 반복되는 형태가 된다.상기 RCA에 의한 증폭을 위하여, 당업자라면 누구나 알 수 있듯이, dNTP의 존 재가 필요하다. dNTP에는 dATP, dTTP, dGTP, dCTP 가 포함된다. 이러한 dNTP를 이용하여 DNA 서열이 신장된다.Circular probes that form the RCA reaction are single-stranded circular oligonucleotides that include not only sequences complementary to primers but also sequences complementary to sequences to be amplified and detected, as shown in FIG. It is not limited and may be appropriately selected by those skilled in the art, but may have a size of 15 bp or more. RCA proceeds continuously by using such a circular probe, and the DNA sequence is amplified, and the expanded DNA sequence becomes a form in which the sequence complementary to the sequence of the circular probe is repeated. As can be seen, the presence of dNTP is required. dNTPs include dATP, dTTP, dGTP, dCTP. DNA sequences are stretched using this dNTP.
본 발명의 태양에 의하면, 상기와 같이 RCA에 의해 일차적으로 샘플의 증폭이 일어남과 동시에, 그 일차적으로 신장된 DNA 서열을 이용하여 다시 2차 프라이머에 의한 증폭이 중첩적으로 진행된다.According to the aspect of the present invention, as described above, amplification of the sample is first performed by RCA, and amplification by the secondary primer is further superimposed again using the first elongated DNA sequence.
2차 프라이머라 함은, 도 1a와 같이 헤어핀 구조를 갖는 올리고뉴클레오티드로서, 그 크기는 제한이 없으며, 증폭하고자 하는 서열에 따라서 당업자가 쉽게결정할 수 있으며, 15 bp 이상의 길이일 수 있다. 상기 2차 프라이머의 헤어핀 구조 라 함은 하나의 단일 올리고뉴클레오티드 가닥의 가운데 부분이 구부러져서 양 말단이 만나는 형태가 된 구조를 말하며, 이 때, 구부러진 가운데 부분은 동그란 형태로 휘어져서 헤어핀의 머리 부분 이라 하고, 서로 만나는 양 말단 부분은 다리 부분 이라고 한다. 상기 2차 프라이머 헤어핀 구조의 머리 부분은 신장된 핵산 서열의 적어도 일부에 상보적인 서열을 포함하며, 상기 두 가닥의 다리는 서로 상보적인 관계로서 초기에는 서로 결합된 형태로 붙어서 존재한다. 상기 헤어핀 다리의 두 가닥 중 한 가닥은 상기 원형 프로브의 적어도 일부에 상보적이면서, 동시에 3 -말단을 가지고 있으며, 그리고 상기 두 가닥 모두 신장된 DNA 서열에는 상보적이지 않다. The secondary primer is an oligonucleotide having a hairpin structure as shown in FIG. 1A, and is not limited in size, and may be easily determined by those skilled in the art according to a sequence to be amplified, and may be 15 bp or more. The hairpin structure of the secondary primer refers to a structure in which a center portion of one single oligonucleotide strand is bent to meet both ends, and at this time, the bent center portion is bent in a round shape to form a hairpin portion of the hairpin. And, both ends meet each other is called the leg. The head portion of the secondary primer hairpin structure comprises a sequence complementary to at least a portion of the stretched nucleic acid sequence, wherein the two strands are complementary to each other and are initially attached to each other in a bonded form. One of the two strands of the hairpin leg is complementary to at least a portion of the circular probe, and at the same time has a 3-terminal, and both strands are not complementary to the stretched DNA sequence.
상기 2차 프라이머를 RCA 반응액 중에 포함시키면, 헤어핀 구조의 머리 부분이, 신장된 핵산 서열에 하이브리다이제이션되면서 선형으로 벌어지게 되고, 상보적으로 결합되어 있던 두 가닥의 다리도 따라서 벌어지게 된다. 이 때, 상기 헤어 핀 구조의 다리 중 3 -말단을 갖는 부분이 원형 프로브에 어닐링되고, 이로부터 다시 2차적인 RCA가 진행된다. 상기 2차 프라이머의 헤어핀 구조의 머리 부분은 신장된 핵산 서열과 10~30bp 범위에서 상보적인 것이 바람직하다. 10bp이하이거나, 30bp 이상에서는, 하이브리다이제이션 효율이 저하되기 때문이다. When the secondary primer is included in the RCA reaction solution, the head of the hairpin structure is linearly opened while being hybridized to the extended nucleic acid sequence, and the two strands which are complementarily bound are also opened. At this time, the three-terminal part of the legs of the hairpin structure is annealed to the circular probe, from which secondary RCA proceeds. The head portion of the hairpin structure of the secondary primer is preferably complementary to the elongated nucleic acid sequence in the 10 ~ 30bp range. This is because hybridization efficiency is lowered at 10 bp or less or 30 bp or more.
또한, 상기 2차 프라이머의 헤어핀 구조의 다리 부분을 이루는 2개의 가닥은, 헤어핀 구조의 머리 부분과 신장된 핵산 서열이 하이브리다이제이션하였을 때, 각각 단일가닥으로 될 수 있도록, 수소결합을 형성하는 다리부분의 길이를 조절할 수 있다. 이러한 태양에 있어서, 도 1b와 같이, 상기 헤어핀 구조의 다리 부분을 이루는 2개의 가닥이 그 말단에서 길이의 차이가 있는 경우, 2차 프라이머가 신장된 DNA 서열에 하이브리다이제이션 될 때, 두 다리의 상보적인 결합이 더욱 잘 떨어지게 되고, 반응이 더욱 정확하고 신속하게 진행될 수 있다.In addition, the two strands constituting the bridge portion of the hairpin structure of the secondary primer is a bridge that forms a hydrogen bond so that when the head portion of the hairpin structure and the extended nucleic acid sequence is hybridized, each strand becomes a single strand. The length of the part can be adjusted. In this embodiment, as shown in FIG. 1B, when the two strands forming the leg portion of the hairpin structure have a difference in length at their ends, when the secondary primer is hybridized to the stretched DNA sequence, Complementary binding is more likely to drop, and the reaction can proceed more accurately and quickly.
상기와 같이, 그리고 도 3a 및 도 3b에 도시된 바와 같이, 신장된 DNA 서열에 다시 2차 프라이머가 다수 결합되어 거기서부터 RCA가 진행되는 과정은, 신장된 DNA 서열 모두에 대하여 각각 반복될 수 있으며, 이는 짧은 시간 안에 더욱 많은 양의 DNA가 증폭됨으로써, 검출 감도를 높이고, 단시간 안에 증폭을 행함으로써 오염의 기회를 현저히 감소시킬 수 있다.본 발명에 따른 증폭 방법은, 별도의 장치 및 추가의 공정이 필요 없이, 핵산 서열의 증폭이 필요한 경우라면 어떠한 경우라도 부작용 없이 적용이 가능한 방법이다. 용액 상태에서 증폭이 필요한 경우도 적용이 가능하며, 고체 상에서 증폭이 필요한 경우 등 어떠한 적용 형태로도 응용이 가능하다(도 4). 고체 상에서 고정화된 상태로 실시하는 경우, 고체 지지체는 당 업계에서 알려진 어떠한 것이라도 사용가능하며, 예를 들면 LOC 등에 사용되는 유리 기판, 플라스틱 기판 등도 가능하고, 비드 형태의 지지체도 가능하다.As described above, and as shown in FIGS. 3A and 3B, a plurality of secondary primers are further coupled to the stretched DNA sequence, and the RCA process from there may be repeated for each of the stretched DNA sequences. This can increase the detection sensitivity and significantly reduce the chances of contamination by amplifying in a short time by amplifying a larger amount of DNA in a short time. Without this, if the nucleic acid sequence amplification is required in any case can be applied without side effects. It can be applied when amplification is required in solution, and can be applied in any application form, such as when amplification is required in solid state (FIG. 4). When the solid support is carried out in a solid state, any solid support may be used in the art, for example, a glass substrate, a plastic substrate, or the like used in a LOC or the like, and a support in the form of beads may be used.
특히, 비드나 LOC 등에 사용되는 유리 또는 플라스틱 기판 등의 고정화된 상태에서 RCA를 수행하고자 하는 경우에 본 발명의 방법을 매우 효과적으로 적용할 수 있는데, 이러한 태양에 의하면, 목적 서열의 5 -말단 쪽의 하나 이상의 뉴클레오티드와 상보적인 서열을 포함하는 프로브가, 비드나 기판 상에 부착된 형태를 이용한다. 상기 목적 핵산 서열의 5 -말단 쪽 부분이 상기 고체상에 지지된 프로브에 결합되고, 그 상태에서 본 발명에 따른 RCA가 진행되는 형태도 가능하다. In particular, the method of the present invention can be applied very effectively when the RCA is to be carried out in an immobilized state such as glass or plastic substrates used for beads or LOC. According to this aspect, the 5-term side of the target sequence Probes comprising sequences complementary to one or more nucleotides utilize forms attached to beads or substrates. The 5-terminal portion of the target nucleic acid sequence is bound to the probe supported on the solid phase, and in this state, the RCA according to the present invention is also possible.
특히 유리한 점은, 2차 프라이머의 구조 특성상, 증폭되어진 목적 서열이 없는 경우에는 아무런 역할을 하지 못하며, 증폭된 서열이 있을 때만 특이적으로 2차 프라이머에 의한 증폭이 진행되므로, 특이성이 매우 높고, 따라서 검출 신호가 매우 뚜렷하게 나타날 수 있다는 점이다.Particularly advantageous, due to the structural characteristics of the secondary primer, it does not play any role in the absence of the target sequence to be amplified, and only when the amplified sequence is specifically amplified by the secondary primer, the specificity is very high. Therefore, the detection signal can appear very clearly.
또한, 본 발명의 한 태양에 따르면, 목적 핵산 서열을 검출하는 단계를 더 포함한다. 상기 검출은, 공지된 어떠한 검출 방법을 통해서도 가능한데, 예를 들면, 핵산 신장 반응을 위해 첨가하는 dNTP 대신에 변형된 dNTP를 사용하여 형광 검출할 수 있다. 변형된 dNTP는 형광물질이나 비오틴 등이 표지된 dNTP를 포함한다. 또한, 헤어핀 구조의 다리부분 5 쪽에 형광물질이 부착된 2차 프라이머를 사용하여 검출할 수도 있다. In addition, according to one aspect of the invention, the method further comprises the step of detecting the desired nucleic acid sequence. The detection can be by any known detection method, for example, fluorescence can be detected using modified dNTPs instead of dNTPs added for nucleic acid extension reactions. Modified dNTPs include dNTPs labeled with fluorescent or biotin. In addition, it can also be detected by using a secondary primer attached to the fluorescent substance on the
본 발명의 방법에 따라 증폭된 DNA를 광학 측정 방식으로 검출하는 경우에는 헤어핀 구조의 2차 프라이머를 사용하지 않는 일반 RCA 방법보다 단시간 내에 훨씬 더 잡음 없고 뚜렷한 신호를 얻을 수 있으며, 전위차 변화에 의해 검출하는 경우에는 기존의 방법에 비하여 전위 변화를 더욱 극대화할 수 있다.When the DNA amplified according to the method of the present invention is detected by an optical measurement method, a much quieter and clearer signal can be obtained in a shorter time than a general RCA method that does not use a secondary primer having a hairpin structure. In this case, it is possible to maximize the potential change more than the conventional method.
그 예를 도 5a 및 도 5b에 나타내었다. 도 5a 및 도 5b를 보면, 한쪽에는 프로브가 부착되어 있고, 반대쪽에는 전하를 띈 표면을 가지도록 제작된 비드에 프로브를 부착하고, 그것을 이용하여 본 발명의 방법에 따른 RCA를 행할 수 있다. 이 때, 신장된 DNA 서열 가닥의 길이가 길어짐과 동시에 가닥의 개수도 동시에 늘어나므로, 전하의 반전이 극대화될 수 있고, 따라서 비드의 방향이 단시간 안에 크게 역전하게 되고, 그러한 과정에 필요한 시간은 종래 RCA 방법에 비하여 크게 단축된 것이다.Examples are shown in FIGS. 5A and 5B. 5A and 5B, a probe is attached to a bead having a probe attached to one side and a charged surface on the other side, and the RCA according to the method of the present invention can be performed using the probe. At this time, since the length of the extended DNA sequence strands is increased at the same time, the number of strands increases at the same time, the charge reversal can be maximized, and thus the direction of the beads is greatly reversed in a short time, the time required for such a process is Compared to the RCA method is greatly shortened.
본 발명에 따라 사용되는 원형 프로브와 2차 프라이머는, 잘 알려진 올리고뉴클레오티드 합성법을 통하여 제작할 수 있다. 그러한 방법은 당업계에 주지된 방법을 이용한다. Circular probes and secondary primers used in accordance with the present invention can be prepared through well-known oligonucleotide synthesis methods. Such methods utilize methods well known in the art.
또한 본 발명의 방법은 온도 조절에 구애받지 않으므로, 특별한 온도 조절 장치를 요구하지 않는다.In addition, the method of the present invention is independent of temperature control and therefore does not require a special temperature control device.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명한다.Hereinafter, the present invention will be described in more detail with reference to Examples.
(실시예)(Example)
- 원형 프로브의 제작-Fabrication of Circular Probes
하기와 같은 서열(서열 번호 1)을 갖는 원형 프로브를 제작하였다.Circular probes having the following sequence (SEQ ID NO: 1) were prepared.
5'-gccaccagacctctaactctttaagcttgtct gccaccactacctcatccattt caggatacggtgtagaatgggttag-3' 5'-gccaccagacctctaactctttaagcttgtct gccaccactacctcatccattt caggatacggtgtagaatgggttag-3 '
상기 서열의 5 -말단과 3 -말단의 양끝이 붙게 되어 원형의 올리고뉴클레오티드를 형성하였다.Both ends of the 5- and 3-terminal ends of the sequence are attached to form a circular oligonucleotide.
- 2차 프라이머의 제작-Preparation of secondary primer
하기와 같은 서열(서열 번호 2)을 갖는 2차 프라이머를 제작하였다. 하기 2차 프라이머는 양 말단 서열의 14 bp가 서로 상보적인 관계로 결합되게 되므로, 헤어핀 구조를 갖는다.A secondary primer having the following sequence (SEQ ID NO: 2) was prepared. The following secondary primer has a hairpin structure because 14 bp of both terminal sequences are bound to each other in a complementary relationship.
5' -gtagaatgggttag gccaccagacctctaactctttaagcttgtct CTAACCCATTCTAC -3' 5 '-gtagaatgggttag gccaccagacctctaactctttaagcttgtct CTAACCCATTCTAC -3'
아울러, 헤어핀 구조의 머리 부분과 신장된 핵산 서열이 하이브리다이제이션하였을 때, 다리 부분을 이루는 2개의 가닥이 단일가닥으로 변환되는 것을 더욱 용이하게 하기 위해서, 헤어핀 구조의 양 말단 중 어느 하나가 더 짧아지도록 제작하였다. 즉, 하기와 같은 서열(서열 번호 3 및 4), 5'-말단이 각각 3bp 및 5bp 더 짧은 형태의 서열을 갖는 2차 프라이머를 제작하였다.In addition, when the head portion of the hairpin structure and the extended nucleic acid sequence are hybridized, either of the two ends of the hairpin structure is shorter to make it easier to convert the two strands forming the leg portion into a single strand. Made to lose. That is, secondary primers were prepared having the following sequences (SEQ ID NOs: 3 and 4) and 5′-terminal shorter sequences of 3bp and 5bp, respectively.
5' - gtagaatgggt gccaccagacctctaactctttaagcttgtct CTAACCCATTCTAC -3' 5 '-gtagaatgggt gccaccagacctctaactctttaagcttgtct CTAACCCATTCTAC -3'
5' - gtagaatgg gccaccagacctctaactctttaagcttgtct CTAACCCATTCTAC -3' 5 '-gtagaatgg gccaccagacctctaactctttaagcttgtct CTAACCCATTCTAC -3'
- 증폭Amplification
증폭반응은 일반적인 RCA 방법에 따라서 수행하였다. 즉, 증폭하고자 하는 목적 표적 핵산 서열을 포함하고 있는 주형 DNA(template), 상기에서 제작한 원형 프로브, dNTP를 함께 혼합하고, 94℃에서 5분간 가열한 후 4℃에서 5분간 보관하였다. 그런 다음, 2차 프라이머와 증폭효소를 넣고 효소가 작용하는 온도에서 반응시켰다. 그 반응산물을 전기영동한 결과, 헤어핀 구조의 2차 프라이머를 사용하 지 않은 대조군에 비해 증폭산물이 많음을 확인하였다.The amplification reaction was performed according to the general RCA method. That is, the template DNA (template) containing the target nucleic acid sequence to be amplified, the circular probe prepared above, dNTP were mixed together, heated at 94 ° C. for 5 minutes, and stored at 4 ° C. for 5 minutes. Then, a secondary primer and an amplification enzyme were added and reacted at the temperature at which the enzyme works. As a result of electrophoresis of the reaction product, it was confirmed that the amplification product was more than the control group which did not use the secondary primer of hairpin structure.
본 발명의 방법에 의해 핵산 서열의 증폭을 행할 경우, 증폭 효율이 현저하게 향상된 증폭 산물을 얻을 수 있다.When amplifying a nucleic acid sequence by the method of the present invention, an amplification product with remarkably improved amplification efficiency can be obtained.
<110> Samsung electronics.co.,ltd. <120> Amplification method of nucleic acid sequence using modified RCA and second primer <130> pn058647 <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> circle probe <400> 1 gccaccagac ctctaactct ttaagcttgt ctgccaccac tacctcatcc atttcaggat 60 acggtgtaga atgggttag 79 <210> 2 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gtagaatggg ttaggccacc agacctctaa ctctttaagc ttgtctctaa cccattctac 60 60 <210> 3 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gtagaatggg tgccaccaga cctctaactc tttaagcttg tctctaaccc attctac 57 <210> 4 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gtagaatggg ccaccagacc tctaactctt taagcttgtc tctaacccat tctac 55 <110> Samsung electronics.co., Ltd. <120> Amplification method of nucleic acid sequence using modified RCA and second primer <130> pn058647 <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> circle probe <400> 1 gccaccagac ctctaactct ttaagcttgt ctgccaccac tacctcatcc atttcaggat 60 acggtgtaga atgggttag 79 <210> 2 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gtagaatggg ttaggccacc agacctctaa ctctttaagc ttgtctctaa cccattctac 60 60 <210> 3 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gtagaatggg tgccaccaga cctctaactc tttaagcttg tctctaaccc attctac 57 <210> 4 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gtagaatggg ccaccagacc tctaactctt taagcttgtc tctaacccat tctac 55
Claims (9)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020040112235A KR20060073815A (en) | 2004-12-24 | 2004-12-24 | Amplification method of nucleic acid sequence using modified rca and second primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020040112235A KR20060073815A (en) | 2004-12-24 | 2004-12-24 | Amplification method of nucleic acid sequence using modified rca and second primer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR20060073815A true KR20060073815A (en) | 2006-06-29 |
Family
ID=37166693
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020040112235A KR20060073815A (en) | 2004-12-24 | 2004-12-24 | Amplification method of nucleic acid sequence using modified rca and second primer |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR20060073815A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8278051B2 (en) | 2007-10-11 | 2012-10-02 | Samsung Electronics Co., Ltd. | Method of amplifying a target nucleic acid by rolling circle amplification |
| KR20190121000A (en) * | 2018-04-17 | 2019-10-25 | 건국대학교 산학협력단 | Detection of Target Nucleic Acid Sequences by PCR-coupled Rolling Circle Amplification |
-
2004
- 2004-12-24 KR KR1020040112235A patent/KR20060073815A/en not_active Application Discontinuation
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8278051B2 (en) | 2007-10-11 | 2012-10-02 | Samsung Electronics Co., Ltd. | Method of amplifying a target nucleic acid by rolling circle amplification |
| KR101414713B1 (en) * | 2007-10-11 | 2014-07-03 | 삼성전자주식회사 | Method of amplifying target nucleic acids by rolling circle amplification in the presence of ligase and endonuclease |
| KR20190121000A (en) * | 2018-04-17 | 2019-10-25 | 건국대학교 산학협력단 | Detection of Target Nucleic Acid Sequences by PCR-coupled Rolling Circle Amplification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2239287C (en) | A cascade nucleic acid amplification reaction | |
| EP2449104B1 (en) | Chimeric primers with hairpin conformations and methods of using same | |
| JP3313358B2 (en) | Nucleic acid synthesis method | |
| JP5945271B2 (en) | Helicase-dependent isothermal amplification using nicking enzymes | |
| US9738928B2 (en) | Method of DNA sequencing by polymerisation | |
| CN107446919B (en) | Method and kit for synthesizing nucleic acid under constant temperature condition | |
| CN106636071B (en) | Method for synthesizing nucleic acid under constant temperature condition | |
| JP2008544756A (en) | Methods and kits for analyzing target nucleic acid sequences | |
| KR101400995B1 (en) | APtamer-based Isothermal Nucleic acid Amplification (APINA) method and its use for ultra-high sensitive detection of biomolecules | |
| EP3292217B1 (en) | Formation of hairpins in situ using force-induced strand invasion | |
| EP3476938B1 (en) | Method and kit for synthesizing nucleic acid under constant temperature conditions | |
| US20220042075A1 (en) | Methods, compositions, and devices for solid-state syntehsis of expandable polymers fo ruse in single molecule sequencings | |
| KR20060073815A (en) | Amplification method of nucleic acid sequence using modified rca and second primer | |
| KR101785687B1 (en) | Method for detection of target nucleic acid sequence by multiple amplification nested signal amplification | |
| WO2002048401A2 (en) | Nested oligonucleotides containing hairpin for nucleic acid amplification | |
| WO2006028162A1 (en) | Method of forming signal probe polymer | |
| KR20190092883A (en) | Method for Detecting Target Nucleic Acid using Three-way Junction Structure-induced Isothermal Amplification〔ThIsAmp〕 | |
| CN107109478B (en) | Method for obtaining paired-end sequencing information | |
| KR102531590B1 (en) | Method for detecting target nucleic acid and composition for detecting nucleic acid by mirroring binding of nicking enzyme recognition site | |
| WO2012009464A2 (en) | Detection of nucleic acids by agglutination | |
| WO1996017087A1 (en) | Detection of nucleic acid sequences | |
| JP7191115B2 (en) | Method for amplification of nucleic acids by endonuclease-mediated migration equilibrium (EM-SEq) | |
| JP4395363B2 (en) | Nucleic acid detection method | |
| JP2023524129A (en) | Removal of Excess Oligonucleotides from Reaction Mixtures | |
| WO2005054514A1 (en) | Immuno-amplification rna assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WITN | Withdrawal due to no request for examination |