KR101400995B1 - APtamer-based Isothermal Nucleic acid Amplification (APINA) method and its use for ultra-high sensitive detection of biomolecules - Google Patents

Abstract

The present invention relates to a method for amplifying an isothermal nucleic acid using a structural change characteristic of an aptamer that specifically binds to a target substance, and a method for detecting an ultra high sensitivity biomaterial using the same, and more particularly, (APINA) using a structural change characteristic of a tympanic membrane, and a method for detecting DNA, protein, or physiologically active substance with high sensitivity using the APINA-based Isothermal Nucleic Acid Amplification (APINA).
According to the present invention, by solving the problem of requiring the temperature change of the existing nucleic acid amplification method (PCR), which is the biggest obstacle to realizing the current nucleic acid test by the field diagnosis technology, it becomes competitive in the in vitro diagnostic market, (APINA) is also applied to the immunoassay, which is useful for detecting the target substance (DNA, protein and physiologically active substance) with very high sensitivity.

Description

TECHNICAL FIELD The present invention relates to an isothermal nucleic acid amplification method and an ultra-high sensitive biomolecule detection method using the same, and more particularly, to an isothermal nucleic acid amplification method and an ultra-high sensitive biomolecule detection method using the same,

The present invention relates to a method for amplifying an isothermal nucleic acid using a structural change characteristic of an aptamer that specifically binds to a target substance, and a method for detecting an ultra high sensitivity biomaterial using the same, and more particularly, (APINA) based on the structural change characteristic of the tympanic membrane, and a method for detecting DNA, protein or physiologically active substance with high sensitivity using the same.

Molecular diagnostic testing or nucleic acid testing (NAT) is the fastest growing market for in vitro diagnostic testing, with annual growth rates of around 20% in the global market. In the next five to ten years, it is expected to grow very fast, thanks to the accelerated development of automated nucleic acid testing equipment and the development of various disease-related nucleic acid markers. Currently, the market share of 10-15% of total in vitro diagnostic testing market is growing, but the ratio is increasing. The current nucleic acid diagnostic test is divided into two broad categories: nucleic acid derived from pathogenic organisms infected with the human body and nucleic acid derived directly from the human body. The former is a test for the diagnosis of infection, accounting for more than 80% of the market for molecular diagnostics. The latter is a genetic test that analyzes nucleic acids involved in disease induction and therapy, and has a market share of less than 20%, but potential value and marketability are expected to be very high. Molecular diagnostics is currently the largest market in North America (43%), Western Europe (31%) and Japan (11%). However, China and India each have a rapid growth rate of 16% (2005)). Recently, related companies have been showing continuous growth trend with differentiated usefulness and specificity of products through mergers and acquisitions (Jeonju Hong, Research Trend of Nucleic Acid Diagnosis Technology, Trend of Health Industry Technology, (2005)).

In particular, Roche acquired patent rights for PCR, a nucleic acid amplification technology, from Chiron in 1991, and has developed a variety of analytical platform technologies based on this technology, accounting for more than 40% of the market for molecular diagnostic tests And technology research trends, health industry trends, (2006)). Therefore, Western advanced diagnostic companies have developed new DNA amplification methods to avoid this patent. Currently, more than 50 companies have their own DNA amplification technology. DNA amplification methods include target amplification that directly amplifies DNA itself, probe amplification that amplifies a probe used for nucleic acid detection, and signal amplification that amplifies a detection signal. (Zhang Hong, Molecular Diagnostic Test Development and Technology Research Trends, Health Industry Trends, (2006)). In addition to Roche's PCR, target amplification methods include Becton Dickinson's SDA (strand displacement amplification), rolling circle amplification (RCA), transcription-mediated amplification (TMA) of gen-probe and nucleic acid sequence-based amplification . Probe amplification methods include Abbott Laboratories' LCR (ligase chain reaction), CPT (cycling probe technology) and Invader assay.

There are advantages for each amplification method, but conventional PCR is still the most effective for universal use. However, conventional PCR methods are based on temperature changes and therefore require a thermocycler. Therefore, the lab-on-a-chip (LOC), which integrates microfluidics technology for the purpose of point-of-care testing (POCT) -chip) or a micro total analysis system (μTAS). In addition, since it is a reaction accompanied by high fever, there is a restriction that available enzymes are limited, and it also takes a long time to amplify. Isothermal nucleic acid amplification technology is the technology that can overcome these problems and apply them to the diagnostic system.

Isothermal amplification (LAMP) is a detection method designed by Notomi et al. In 2000 and is similar to the conventional PCR method. However, DNA denaturation and primer annealing are performed during PCR or real-time PCR, , Amplification reaction can be performed at a temperature of 60 ° C without the need for temperature changes necessary for extension of the polymerase. The most important feature of LAMP is the amplification of the gene in isothermal, and isothermal conditions have several advantages over PCR which requires a temperature gradient. First, the reaction time is relatively short because no temperature control is required. Thus enabling gene amplification in a shorter time. It has already been reported in previous papers that gene amplification is possible within one hour except for electrophoresis time if LAMP is used. Moreover, the amplification efficiency is very high because there is no DNA loss or damage due to temperature change. Amplification under isothermal conditions is the basis for LAMP to be field-workable, unlike other detection methods. Because it only needs to maintain constant temperature, it can react with only simple equipment such as constant temperature water tank without expensive equipment. Therefore, using LAMP makes it possible to detect a specific gene in the field even if it is not in the laboratory environment. However, current FDA-approved isothermal amplification methods include strand displacement amplification (SDA) of BD Microbiology Systems for analysis of C. trachomatis and N. gonorrhoeae , nucleic acid sequence based amplification (NASBA) of bioMerieux for CMV and HIV diagnosis , Transcription mediated amplification (TMA) of Gen-Probe, and branched chain DNA signal amplification (BDNA) of Bayer Healthcare, and no related studies have been reported in Korea (JK Hong, Research trend, health industry trend, (2005)).

As a result of intensive efforts to solve the problems of the above-described conventional techniques and to develop a novel isothermal nucleic acid amplification technology, the present inventors have found that when introducing a structural change due to the binding of a target substance and aptamer into a DNA amplification process, It is possible to amplify the target nucleic acid in the target nucleic acid, and it is possible to detect biomaterials and chemical substances, which are target substances of the platamer, with very high sensitivity. Thus, the present invention has been completed.

It is an object of the present invention to provide an isothermal nucleic acid amplification composition and an isothermal nucleic acid amplification method for causing denaturation of a double stranded DNA by causing a structural change of a primer containing a DNA strand base sequence to specifically bind to a target substance.

It is another object of the present invention to provide a simple and rapid detection and quantification method of a target substance using the isothermal nucleic acid amplification method.

In order to accomplish the above object, the present invention provides a nucleic acid comprising (i) a template nucleic acid; (ii) an abatumer-specific target material; (iii) an inner primer comprising a base sequence of the squamometer and specifically binding to the template nucleic acid; (iv) nucleic acid polymerase; (v) an outer primer designed closer to the 5 'end of the template nucleic acid than the internal primer; And (vi) a booster primer designed as a base sequence of the platemaker. The present invention also provides a composition for APT (APT) -based isothermal nuclear nucleic acid amplification (APINA).

The present invention also provides a method for isothermal amplification of nucleic acids, characterized in that the composition is isothermally amplified.

The present invention also provides a detection target sample suspected of containing an enteral-specific target substance and (i) a template nucleic acid; (ii) an inner primer comprising a base sequence of an abtamer binding to the target substance and specifically binding to the template nucleic acid; (iii) nucleic acid polymerase; (iv) an outer primer designed closer to the 5 ' end of the template nucleic acid than the internal primer; And (v) a composition for nucleic acid isothermal polymerization reaction comprising a booster primer designed as a base sequence of platamer is subjected to polymerization reaction at isothermal temperature to confirm the amplified product. ≪ / RTI >

The present invention also provides a detection target sample suspected of containing an enteral-specific target substance and (i) a template nucleic acid; (ii) an inner primer comprising a base sequence of an abtamer binding to the target substance and specifically binding to the template nucleic acid; (iii) nucleic acid polymerase; (iv) an outer primer designed closer to the 5 ' end of the template nucleic acid than the internal primer; And (v) a composition for nucleic acid isothermal polymerization comprising a booster primer designed as a base sequence of platamer is subjected to polymerization reaction at isothermal temperature to quantify the amplified product. ≪ / RTI >

According to the present invention, by solving the problems of the existing nucleic acid amplification method (PCR) which is the biggest obstacle to realizing the present nucleic acid test by the field diagnosis technology, it is expected to create enormous economic and industrial value by having competitiveness in the in vitro diagnostic market And is also useful for detecting target substances (DNA, proteins and physiologically active substances) with ultra-high sensitivity by applying the developed platemaker-based isothermal nucleic acid amplification technology (APINA) to immunoassays.

Figure 1 schematically illustrates an aptamer-based isothermal nucleic acid amplification method according to the present invention.
FIG. 2 shows melting curve analysis results for the determination of the melting temperature (Tm) of aptamer that specifically binds to the target substance ATP and causes a structural change.
Figure 3 shows the result of confirming that the target substance ATP-DNA platemater complex can be extended by polymerization reaction with DNA polymerase.
Figure 4 shows the results of experiments on the effect of target material ATP and optimization of the booster primer.
FIG. 5 shows the results of an experiment for confirming the optimal temperature of the amplified isothermal nucleic acid amplification (APINA).
FIG. 6 shows the results of experiments confirming the optimal target substance ATP concentration for amplification of isothermal nucleic acid based on platemaker.
FIG. 7 shows the results of the experiment confirming the sensitivity of the isothermal nucleic acid amplification technique based on platamer.

In one aspect, the present invention provides a nucleic acid construct comprising (i) a template nucleic acid; (ii) an abatumer-specific target material; (iii) an inner primer comprising a base sequence of the squamometer and specifically binding to the template nucleic acid; (iv) nucleic acid polymerase; (v) an outer primer designed closer to the 5 'end of the template nucleic acid than the internal primer; And (vi) a booster primer designed as a base sequence of the platamer. The present invention also relates to a composition for APT (APT) -based isothermal nuclear acid amplification (APINA).

In another aspect, the present invention relates to a method for isothermal amplification of nucleic acids characterized by amplifying the composition at isothermal temperature.

An aptamer that can bind to proteins, physiologically active substances, etc., usually has a high affinity for the target substance because it is accompanied by a structural change while folding upon binding with the target substance. By substituting the denaturation of the double-stranded DNA by temperature change of the existing polymerase chain reaction (PCR) using the structural change caused by the binding of the tympanic membrane to the target molecule, it is possible to amplify the nucleic acid at the isothermal temperature Technology will be developed. In addition, this isothermal nucleic acid amplification technique can be utilized for ultra-high sensitivity analysis of target substances (proteins and physiologically active substances) by designing amplification reaction of nucleic acid only when the target substance is present.

As shown in FIG. 1, the extramammary-based isothermal nucleic acid amplification method according to the present invention can be performed by the following process.

Three types of DNA primers (Inner, Outer, and Booster primers) are used for isothermal amplification of the target nucleic acid. Outer primer is a primer used for displacement of inner primer at the beginning of nucleic acid amplification cycle. It is designed to hybridize with target nucleic acid above the position where internal primer hybridizes with target nucleic acid. . Through this, the nucleic acid strand extended from the inner primer at the beginning of the nucleic acid amplification cycle is replaced by the outer primer, and the sequential amplification cycle proceeds. The internal primer contains the nucleotide sequence of the DNA plasmid which specifically binds to the target substance and causes a structural change in the 5th part. This causes denaturation of the double strand DNA in the amplification process of the isothermal nucleic acid, The primer (Booster primer) binds to the amplification process. The booster primer is a primer that is part of the DNA typing sequence and binds to the denaturation part of the double stranded DNA induced by the binding of the target substance and the tympanic membrane, thus facilitating the isothermal amplification of the nucleic acid.

The aptamer used in the present invention may be an ATP-specific aptamer identified through SELEX process in 1995. In the double-stranded form, the ATP-aptamer complex can be formed by reacting with ATP ( Biochemistry , 1995, Vol. 34, p656, David E. et al.) have been reported. Although the ATP-specific aptamer is used as a part of the internal primer for nucleic acid isothermal amplification, any of the platamers that react with the target substance to form a three-dimensional structure can be used without limitation.

The target substance of the plaster used in the present invention is DNA, protein and physiologically active substance, and it is particularly preferable that it is ATP.

The template nucleic acid used in the present invention is characterized in that it is double-stranded. If it is a double-stranded nucleic acid, it can be used without limitation to its origin or function, and the use of appropriate primers according to the selected template nucleic acid can be used in the art I will.

The nucleic acid polymerase used in the polymerization reaction is an enzyme capable of expanding the nucleic acid primer according to the DNA template. It does not have exonuclease function and should have DNA substitution function. Examples of enzymes that can be used in the present invention include Vent (exo-) DNA polymerase, Bst polymerase, Klenow fragment, and Bsu DNA polymerase.

Aptamer-based isothermal nucleic acid amplification (APINA) is largely accomplished through two pathways (CASE A and B). CASE A is an amplification reaction initiated from a double stranded DNA formed by polymerization reaction with an external primer, and the amplification reaction which binds a target substance (for example, ATP) to only one side of double stranded DNA I have. On the other hand, CASE B is a DNA that is formed through polymerization reaction by an internal primer, and has an Aptamer base sequence (Red line) which binds to both terminals at its ends.

In another aspect, the present invention provides a detection target sample, which is presumed to contain an enteral-specific target substance, and (i) a template nucleic acid; (ii) an inner primer comprising a base sequence of an abtamer binding to the target substance and specifically binding to the template nucleic acid; (iii) nucleic acid polymerase; (iv) an outer primer designed closer to the 5 ' end of the template nucleic acid than the internal primer; And (v) a composition for nucleic acid isothermal polymerization reaction comprising a booster primer designed as a base sequence of platamer is subjected to polymerization reaction at isothermal temperature to confirm the amplified product. ≪ / RTI >

The platemaker-specific target material of the present invention may be a DNA, a protein, or a physiologically active substance contained in a sample such as blood, urine, and biotissue. When a target substance specifically binding to the platemer is present in the sample So that the target substance can be detected by confirming the amplification product obtained through the nucleic acid isothermal polymerization reaction.

Existing enzyme immunoassay can not diagnose the infection in the window period in which the antigen or antibody present in the blood does not reach more than a certain amount, whereas the nucleic acid amplification detection method shortens the incubation period and diagnoses the infection early It can contribute to the enhancement of the safety of blood and the improvement of the health of the public.

It is possible to perform high sensitivity detection based on FRET (Fluorescence Resonance Energy Transfer) generated between fluorescent molecules (FAM) and quencher (Dabcyl) that bind to the target substance through the isothermal nucleic acid amplification method according to the present invention.

In another aspect, the present invention provides a detection target sample, which is presumed to contain an enteral-specific target substance, and (i) a template nucleic acid; (ii) an inner primer comprising a base sequence of an abtamer binding to the target substance and specifically binding to the template nucleic acid; (iii) nucleic acid polymerase; (iv) an outer primer designed closer to the 5 ' end of the template nucleic acid than the internal primer; And (v) a composition for nucleic acid isothermal polymerization comprising a booster primer designed as a base sequence of platamer is subjected to polymerization reaction at isothermal temperature to quantify the amplified product. ≪ / RTI >

The platemaker-specific target material of the present invention may be a DNA, a protein, or a physiologically active substance contained in a sample such as blood, urine, and biotissue. When a target substance specifically binding to the platemer is present in the sample The amplification product obtained through the nucleic acid isothermal polymerization reaction according to the present invention is compared with the control group whose concentration is known, and the concentration range of the target substance can be determined by relative quantification.

In the present invention, as the template nucleic acid of the detection method and the quantification method of the tympanic-specific target substance, Chlamydia Although only the gene expressing the toxic protein of trachmatis has been exemplified, any double-stranded nucleic acid capable of promoting isothermal amplification of the nucleic acid can be used without limitation.

[ Example ]

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

In the following examples, only the platemer of SEQ ID NO: 1 is exemplified, but it will be apparent to those skilled in the art that other platameric nucleotide sequences can be substituted for the same.

In the following Examples, Chlamydia Although it illustrated only genes that express toxic proteins trachmatis, even using the other nucleic acid, that may implement the isothermal nucleic acid amplification method of the present invention and the target material detection and quantification methods will be apparent to those skilled in the art.

Example  One: Abtamer's melting curve  analysis

Melting curve analysis was performed using the ATP tampamer labeled with fluorescence (FAM) and Quencher (Dabcyl) to determine the melting temperature (Tm) of the tympanic membrane that specifically binds to the target substance ATP 2). This analysis was carried out by using aptamer labeled with fluorescent molecules (FAM) and quencher (Dabcyl) at the 5 'and 3' positions of the plumbers of SEQ ID NO: 1, respectively, and only when the ATP- Fluorescence molecule (FAM) and quencher (Dabcyl) were brought closer to each other and fluorescence resonance energy transfer (FRET) occurred. As a result, as shown in FIG. 2, it was found that the Tm of the ATP-abatumer was 60 ° C. These results indicate that the binding of the target substance ATP to the tympanic membrane is maintained at a high temperature of 60 ° C, which means that the amplified isothermal nucleic acid amplification method (APINA) can be performed at a high temperature of about 60 ° C .

Example  2: DNA 중합체 By polymerization of ATP - DNA Abtamer  Elongation of complex

An experiment was conducted to confirm whether the ATP-DNA platemer complex formed by the combination of the target substance ATP and the DNA plasmid (SEQ ID NO: 1) could be elongated by polymerase reaction of DNA polymerase (Fig. 3) . The template nucleic acid (SEQ ID NO: 2) used in the above experiment was designed based on the nucleotide sequence of the gene expressing the toxic protein of Chlamydia trachmatis, one of clinically useful genitourinary infectious diseases. The base sequences of internal primers (SEQ ID NOS: 3 and 4) and external primers (SEQ ID NOS: 5 and 6) were primer-3 (http://biotools.umassmed.edu/bioapps) to minimize the formation of primer-dimer and hairpin structures /primer3_www.cgi) program. SEQ ID NOS: 1 to 4 were prepared so as to include an alkaline protease sequence (ACCTGGGGGAGTATTGCGGAGGAAGGT) that binds to the target substance ATP.

SEQ ID NO: 1: 5 '- ACCTGGGGGAGTATTGCGGAGGAAGGT -3'

SEQ ID NO: 2:

5'- ACCTGGGGGAGTATTGCGGAGGAAGGT AGCTGCCTCAGAATATACTCAGTAGAGTATCTTGCATGCGATTTTCTA-3 '

SEQ ID NO: 3: 5 '- ACCTGGGGGAGTATTGCGGAGGAAGGT TAGAAAATCGCATGCAAGATA - 3 '

SEQ ID NO: 4: 5 '- ACCTGGGGGAGTATTGCGGAGGAAGGT AGCTGCCTCAGAATATACTCA-3'

SEQ ID NO: 5: 5 '- TAAACATGAAAACTCGTTCCG-3'

SEQ ID NO: 6: 5'-AGTCTACAGTTATAGGTAATCC-3 '

This process is indispensable for the amplified isothermal nucleic acid amplification (APINA). In order for the amplified DNA sequence to undergo a structural change through binding with the target substance ATP, the DNA polymerase To the double-stranded form. As shown in FIG. 3, when oligonucleotides were used to simulate CASE A and B, the presence of DNA polymerase (1,3 lane) 4 lane), and it was confirmed that extension product of double strand was formed. This confirms that the ATP-DNA platelet complex can induce APINA amplification without interfering with the DNA polymerase pathway. In addition, this result implies that an internal primer having a longer length, including the ATP abstamase sequence, can work well for extension reaction by DNA polymerase.

Example  3: Abtamer  Based isothermal nucleic acid amplification method ( APINA ) ≪ / RTI > ATP Impact and Booster primer Optimization

Optimization of booster primers (Booster primer, 15mer, 18mer, 21mer, 24mer, 27mer, SEQ ID NOs: 7 to 11) according to the influence of the target substance ATP and the number of oligomers was performed using oligonucleotides simulating the initial state of the CASE A amplification reaction (Fig. 4). SEQ ID NO: 11 was prepared so as to include an abtamer nucleotide sequence ( ACCTGGGGGAGTATTGCGGAGGAAGGT ) that binds to the target substance ATP.

SEQ ID NO: 7: 5 '- ACCTGGGGGAGTATT-3'

SEQ ID NO: 8: 5 '- ACCTGGGGGGAGTATTGCG-3'

SEQ ID NO: 9: 5 '- ACCTGGGGGAGTATTGCGGAG-3'

SEQ ID NO: 10: 5 '- ACCTGGGGGAGTATTGCGGAGGAA-3'

SEQ ID NO: 11: 5 '- ACCTGGGGGAGTATTGCGGAGGAAGGT -3'

As a result of the isothermal nucleic acid polymerization reaction, when the target substance ATP of the DNA strand was not present, the amplification products formed by the DNA polymerase were not confirmed except for the oligonucleotide inserted at the early stage. When the target substance ATP is present, it is confirmed that there is a DNA product formed through the isothermal amplification process in addition to the oligonucleotides added in the early stage. It was confirmed that the process of causing the structural change due to the presence of ATP, which is a target substance of DNA compactor, has an important influence on DNA amplification. In order to determine the optimum booster primer length for effective isothermal amplification, the booster primers of 15, 18, 21, 24, and 27 mer were constructed and amplified. As a result, DNA amplification using 18mer- And the most effective.

Example  4: Abtamer  Based isothermal nucleic acid amplification method ( APINA ) Optimization of temperature

In order to investigate the optimal temperature of the isothermal nucleic acid amplification reaction (APINA) based on the Aptamer, it was confirmed that the ATP aptamer in addition to the target substance ATP at 60 ° C was most likely to bind to the target substance ATP using the same experimental conditions as the oligonucleotides used in Example 3 Isothermal nucleic acid amplification was also performed at 37 ° C. As a result, it was confirmed that, at 37 ° C, DNA amplification products were not formed despite the presence of the target substance ATP, unlike the case where the experiment was performed at 60 ° C (FIG. 5). This means that the hybridization of double stranded DNA is too strong at low temperatures, so that DNA aptamers at the end of the double stranded DNA do not bind to the target ATP and thus the end portions of the double stranded DNA are not denaturated. As a result, the booster primer interferes with the hybridization of the double-stranded DNA ends and the isothermal nucleic acid amplification process is not performed. In addition, at low temperatures (37 ° C), the probability of formation of self-dimer and hairpin structures of DNA increases, which makes it difficult to effectively amplify the target nucleic acid.

Example  5: Abtamer  Based isothermal nucleic acid amplification method ( APINA ) Ultra-high sensitivity detection capability

(APINA) can be applied to the ultra-high sensitivity detection of the target substance using optimized conditions (reaction temperature: 60 ° C and Booster primer 2) through the procedures of Example 3 and Example 4 The experiment was conducted to confirm whether or not there was any. As a result, it was confirmed that the amplification pattern of the nucleic acid was changed according to the concentration change of the target substance ATP of the squid polymer (Fig. 6). This is a result that indicates that the amplification method based on an isothermal nucleic acid amplification method can be applied to the detection of target substances (bio and chemical substances). In addition, the optimal target ATP concentration for isothermal nucleic acid amplification (APINA) was 1 mM. In addition, experiments were conducted to confirm the possibility of developing amplification patterns of aminotransferase-based isothermal nucleic acid amplification technology (APINA) according to the concentration of template nucleic acid (APINA template) (20fM to 20nM) Respectively. As a result, as shown in FIG. 7, the APINA amplification process was performed even at a low template nucleic acid concentration of 20 fM, and it was confirmed that the target substance with high sensitivity can be detected.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Attach an electronic file to a sequence list

Claims (29)

(i) a template nucleic acid; (ii) an abatumer-specific target material; (iii) an inner primer including a base sequence of the squamometer and specifically binding to the template nucleic acid; (iv) nucleic acid polymerase; (v) an outer primer designed closer to the 5 'end of the template nucleic acid than the internal primer; And (vi) a booster primer designed as a nucleotide sequence of the platemaker.
The composition of claim 1, wherein the target material is DNA or protein.
2. The composition of claim 1, wherein the target material is ATP.
2. The composition of claim 1, wherein the template nucleic acid is double stranded.
The composition according to claim 1, wherein the nucleic acid polymerase has no exonuclease function and has a DNA substitution function.
6. The composition according to claim 5, wherein the nucleic acid polymerase is any one selected from the group consisting of Vent (exo-) DNA polymerase, Bst polymerase, Klenow fragment and Bsu DNA polymerase.
The composition according to claim 1, wherein the isothermal polymerization reaction temperature is 55 to 65 占 폚.
A method for isothermal amplification of nucleic acids, characterized in that the composition of any one of claims 1 to 7 is amplified at isothermal temperature.
9. The method according to claim 8, which comprises the following steps:
(a) annealing an inner primer comprising a nucleotide sequence of (i) a template nucleic acid and (ii) an abtamer bound to a target substance and specifically binding to the template nucleic acid, (iii) ) Modifying the internal primer by binding the squamous-specific target material to the squamous cell, and (iv) elongating the nucleic acid polymerase;
(b) an outer primer designed to be closer to the 5 'end of the template nucleic acid than the internal primer is coupled to 5' of the template nucleic acid to displace the nucleic acid extended by the internal primer, step;
(c) repeating the steps (a) and (b) to sequentially perform isothermal amplification; And
(d) a step of (vi) annealing a booster primer to a single strand separated portion of the target nucleic acid amplified in the step (c) by the target substance-plamma conjugate.
10. The method of claim 9, wherein the target material is DNA or protein.
10. The method of claim 9, wherein the target material is ATP.
10. The method of claim 9, wherein the template nucleic acid is double stranded.
10. The method according to claim 9, wherein the nucleic acid polymerase has no exonuclease function and has a DNA substitution function.
14. The method according to claim 13, wherein the nucleic acid polymerase is any one selected from the group consisting of Vent (exo-) DNA polymerase, Bst polymerase, Klenow fragment and Bsu DNA polymerase.
The method according to claim 9, wherein the isothermal polymerization reaction temperature is 55 to 65 ° C
(I) a template nucleic acid; (ii) an inner primer comprising a base sequence of an abtamer binding to the target substance and specifically binding to the template nucleic acid; (iii) nucleic acid polymerase; (iv) an outer primer designed closer to the 5 ' end of the template nucleic acid than the internal primer; And (v) a composition for nucleic acid isothermal polymerization reaction comprising a booster primer designed as a base sequence of platamer is subjected to polymerization reaction at isothermal temperature to confirm the amplified product. Way.
17. The method of claim 16, wherein the target material of the squamometer is DNA or protein.
17. The method of claim 16, wherein the target material of the compressor is ATP.
17. The method according to claim 16, wherein the sample to be detected is a double-stranded nucleic acid. 17. The method of claim 16, wherein the nucleic acid polymerase has no exonuclease function and has a DNA substitution function.
The method according to claim 20, wherein the nucleic acid polymerase is any one selected from the group consisting of Vent (exo-) DNA polymerase, Bst polymerase, Klenow fragment and Bsu DNA polymerase.
The method according to claim 16, wherein the polymerization reaction temperature is 55 to 65 占 폚.
(I) a template nucleic acid; (ii) an inner primer comprising a base sequence of an abtamer binding to the target substance and specifically binding to the template nucleic acid; (iii) nucleic acid polymerase; (iv) an outer primer designed closer to the 5 ' end of the template nucleic acid than the internal primer; And (v) a composition for nucleic acid isothermal polymerization comprising a booster primer designed as a base sequence of platamer is subjected to polymerization reaction at isothermal temperature to quantify the amplified product. Way.
24. The method of claim 23, wherein the target material of the squamometer is DNA or protein.
24. The method of claim 23, wherein the target material of the compressor is ATP.
24. The method according to claim 23, wherein the sample to be detected is a double-stranded nucleic acid.
24. The method according to claim 23, wherein the nucleic acid polymerase has no exonuclease function and has a DNA substitution function.
28. The method according to claim 27, wherein the nucleic acid polymerase is any one selected from the group consisting of Vent (exo-) DNA polymerase, Bst polymerase, Klenow fragment and Bsu DNA polymerase.
24. The method according to claim 23, wherein the polymerization reaction temperature is 55 to 65 占 폚.

Images