WO2005054514A1

WO2005054514A1 - Immuno-amplification rna assay

Info

Publication number: WO2005054514A1
Application number: PCT/SG2004/000394
Authority: WO
Inventors: Chung-Pui Paul Cheng; Hon-Chiu Eastwood Leung; Wing Kin Sung; Wah Heng Charlie Lee
Original assignee: Agency For Science, Technology And Research
Priority date: 2003-12-02
Filing date: 2004-12-02
Publication date: 2005-06-16

Abstract

The present invention provides a method for quantifying the level of at least two types of selected proteins by immuno-amplification RNA comprising: (a) Immobilizing at least 2 species of capture molecules onto an insoluble support, wherein each species of capture molecule is specific for a species of a target protein; (b) Contacting the support with the at least 2 species of target proteins so that the target proteins bind to the immobilised capture molecules; (c) Contacting the support wherein the target proteins are immobilised with at least two species of RNA promoter driven DNA sequences each being different from the other and being conjugated to a detection molecule specific to each species of the target proteins so that each detection molecule binds to the specific protein on the support, wherein the promoter-driven DNA sequence comprises a template comprising a 1st region which is a RNA polymerase promoter and a 2nd region comprising a probe, the probe having a nucleic acid sequence specific for each target protein; (d) Obtaining amplified copies of at least two species of RNAs each representing one species of target protein; (e) Quantifying the level of the target species of proteins by detecting the species of RNAs. This method is of particular use in the determinations where the target proteins are cytokines and the detection and capture molecules are antibodies.

Description

Immuno-amplification RNA assay

Field of the invention

The present invention relates to an immuno-amplification RNA method for detecting target proteins. In particular, the method is for quantifying the level of at least two species of proteins.

Background of the invention

One of the major challenges of proteomics is the detection of proteins at or below-zepto-mole (10^~21 mole) level. Traditional methodologies for protein detection and quantification include two-dimensional gel electrophoresis, mass spectrometry, and antibody-based immunoassays. Each methodology has been used to quantify protein levels from relatively large amounts of sample consumption, yet each method suffers from a lack of sensitivity. In this regard, the future direction of development of protemoics-oriented technology would ideally have single-cell resolution and still be quantitative.

A variety of technologies have been used to improve the sensitivity of detection in immunoassays. For example, the PCR technology has been combined with traditional immuno-detection methods (Sano et al., Science, 1992; Adler et al., Biochem Biophys Res Comm, 2003(a)). This technology, termed immuno-PCR, enhances detection limited for 1000 to 10⁵ times when compared with conventional Enzyme Linked Immunosorbant Assay (ELISA). This method has been employed to study a wide variety of proteins (Liang et al., J. Immunol Methods, 2003; Adler et al., Biochem Biophys Res Comm, 2003(b); McKie et al., J Immunol Methods, 2002(a); McKie et al., J Immunol Methods, 2002(b); Cao Y, Methods Mol Biol, 2002; Monteiro et al., J Clin Microbiol, 2001 ). While these immuno-PCR techniques have provided advantages over traditional methods of protein detection such as an increase in sensitivity, there still exist several notable limitations to their use. One of the major limitations of immuno-PCR lies in the non-linear amplification ability of PCR reaction. There is no direct correlation between the amount of signal and the amount of protein present. Thus, this technique is limited as a quantitative detection method.

The problem of validation has been approached with a relatively isothermal rolling circle DNA amplification technology (RCA)(Schweitzer et al., PNAS, 2000; Demidov VV, Expert Rev Mol Diagn, 2002; Kingsmore and Patel, Curr Opin Biotechnol, 2003). Although multiplexing capability was demonstrated, the sensitivity could not surpass subattomole range.

A more facile and powerful method, termed immuno-detection amplified by T7 RNA polymerase (IDAT), has been developed to overcome the limitations of immuno-PCR technology (Zhang et al., PNAS, 2001 ; Zhang et al., Mol Diagn, 2001 ; Zhang et al., Gene 2001 ; US Patent 5,922,553; US Patent 6,255,060). Multiple T7 RNA polymerase enzyme molecules bind in a consecutive and progressive manner. U.S. Pat. No. 5,922,553 discloses a method for quantifying levels of the tau protein via a technique referred to as immuno- amplification-RNA (immuno-aRNA). In this method, a first antibody targeted to the tau protein is immobilized to a solid support. The support is then contacted with blood so that the tau protein is immobilized to the first antibody. The solid support is then contacted with a RNA promoter-driven cDNA sequence covalently coupled to a second antibody targeted to the tau protein so that the second antibody binds to the bound tau protein. ³²P-labeled ribonucleotides are introduced during the RNA amplification step. The amount of the tau protein is determined by direct quantifying levels of the radio-labelled band, and this amount corresponds to the amount of promoter driven cDNA sequence covalently coupled to the bound second antibody, via electrophoresis through an RNA denaturing gel. The IDAT method eliminates the necessity of changing temperatures as in immuno-PCR, making this method more straightforward to use. This method, however, has the disadvantage of requiring a direct quantitative method based on radio-labelled gel electrophoresis. This quantitation method suffers from several disadvantages. First, the sensitivity of detection relies on radioactivity incorporated in the amplified RNA product. The sensitivity of methods based on radioactivity is known to be limited to a detection of 10⁵ molecules. Accordingly, this method is not suitable for detecting amounts of molecules lower than 10⁵ molecules. Secondly, it is not possible to validate if the amplified RNA molecules observed on the electrophoresis contain the specific target sequences. Finally, the method described in the prior art is limited to the detection of one single species of target protein and cannot perform multiplex analysis.

There is therefore a need in this field of technology for improved, more sensitive and efficient immuno-detection methods.

Summary of the invention

The present invention addresses the problems above, and in particular provides an improved immuno-amplification RNA method for the quantification of proteins. In particular, the present invention provides a multiplex immuno- amplification RNA method for the quantification of proteins. More in particular, the present invention provides a method for the simultaneous quantification of level of at least two species of target proteins by immuno-amplification RNA comprising:

(a) immobilising at least two species of capture molecules (for example, capture peptides or antibodies) to an insoluble support, wherein each species of capture molecule is specific for a species of a target protein; (b) contacting the support with the at least two species of target proteins so that the target proteins bind to the immobilised capture molecules; (c) contacting the support with at least two species of RNA promoter- driven DNA sequences, each DNA sequence being different from the other(s) and being conjugated to a detection molecule (for example, a peptide or antibody) specific to each species of the target proteins, so that each detection molecule binds to the specific target protein on the support; (d) obtaining amplified copies of at least two species of RNAs, each representing one species of the target protein; (e) quantifying the level of the target species of proteins, by detecting the species of RNAs.

The capture and detection molecules may be any molecule capable of recognising and binding the target protein(s). The capture and detection molecule may be, for example, an antibody or a peptide specific for a target protein.

The detection of amplified RNAs may be carried out according to any standard technique. In particular, in step (e), the amplified RNAs may be applied on a microarray comprising oligonucleotides (probes) fixed onto it, so that the RNAs which hybridize with the oligonucleotides (probes) are detected.

Two important characteristics of the present invention are that the RNA promoter-driven DNA sequences used to probe the different species are designed in order to two have unique nucleotide sequences so as 1 ) not to hybridize with each other, and 2) to avoid secondary structure formation on the probe or the amplified RNA. The RNA promoter-driven DNA sequences used in the invention comprise a double strand (ds) portion comprising the RNA promoter and a single strand oligonucleotide (the probe) of 10-100 nucleotides. In particular, the RNA promoter-driven DNA can be prepared by hybridising a single strand template (comprising the RNA polymerase promoter and the probe) to an oligonucletide complementary to the portion of the template including the promoter. The probe is specific (unique) for each species. The RNA promoter may be any RNA promoter recognised by a RNA polymerase. For example, the RNA promoter may be T7, T3, K11 and/or SP6-RNA-driven DNAs, and the amplification is carried out by T7, T3, K11 and/or SP6 RNA polymerase(s).

The single strand probe is specific for each species of target protein and two probes of two different species are preferably selected such that they do not hybridise with each other. The probe may be 10-100 nucleotides (mer), 20-80 nucleotides, 30-60 nucleotides, 40-60 nucleotides. For example, the probes chosen may be 60 nucleotides. More in particular, the probe may have the sequence of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and/or SEQ ID NO:7. The probes can also be used to capture the amplified RNAs, for example by applying them on a microarray. In particular, the template may have a sequence selected from SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 , and SEQ ID NO:12. The oligonucleotide complementary to the portion of the template comprising the RNA polymerase promoter may be, for example, the sequence SEQ ID NO: 13. Accordingly, the present invention also provides new probes and templates having the sequences of: SEQ ID NOS:1 to 12.

The RNA amplification is obtained by adding RNA polymerase, for example, T3, T7, K11 or SP6-RNA polymerase, and ribose-ATP, ribose-CTP, ribose- GTP, and at least one of ribose-UTP. Cy5-uridine and/or Cy3-uridine may be used instead of ribose-UTP.

According to another aspect, in step (c), the detection molecule (for example, a detection antibody) is added first, followed by streptavidin, and further, promoter-driven DNA sequence 5'-conjugated with biotin is added. An alternative way is to covalently conjugate the detection molecule with promoter-driven DNA sequence via disulphide linkage.

According to one aspect, in the method of the invention, a sample, for example a biological sample comprising the at least two target species of proteins, is applied on an insoluble support having capture molecules immobilised on it. According to another aspect, each species of the target protein is comprised in a sample. Accordingly, at least two samples are applied on the support, each sample comprising one species of target protein. The biological sample may be, but not limited to: blood, body fluid, and/or urine. The method can also be used to detect and quantify a suspension of air filtrate.

The at least two species of target proteins detected and quantified by the method of the present invention may be any protein. For example, the target proteins may be cytokines. For example, IL-1 β, IL-1α, IL-4, IL-8, TNF-α, and the like. Accordingly, at least two of the about eighty known cytokines may be detected and quantified simultaneously.

According to a further aspect, a first amplification is carried out for a first species of target protein having the RNA promoter-driven DNA sequence labelled with Cy5-uridine and a second amplification is carried out for a second species of target protein having the RNA promoter-driven DNA sequence labelled with Cy3-uridine. Further, the respective amplified RNAs are detected by simultaneous hybridisation on the same microarray.

According to another aspect, the invention provides at least an oligonucleotide having the sequence of SEQ ID NOS:1-12.

According to another aspect, the invention provides a kit, for example a diagnostic kit, comprising at least two probes selected from SEQ ID NOS: 1-7 and at least two templates selected from SEQ ID NO:8-12. Further, it comprises an oligonucleotide complementary to the part of any of SEQ ID NO:8-12 comprising the RNA polymerase promoter. For example, the oligonucleotide SEQ ID NO:13. The kit may optionally comprise: - at least two different capture molecules and at least two detection molecules. Each capture and detection molecule being specific for a species of target protein. The capture and detection molecules may be capture and detection antibodies or any other molecule, for example a peptide, capable of recognizing and binding to the target proteins; - an insoluble support, onto which the capture molecules may be applied; - at least one RNA polymerises (for example, T3, T7, K11 or SP6-RNA polymerase) and the substrates (for example, ribose-ATP, ribose-CTP, ribose-GTP, and at least one of ribose-UTP. Cy5-uridine and/or Cy3- uridine); - a microarray onto which at least two of the probes SEQ ID NOS:1-7 are applied.

Brief description of the figures

Figure 1 : Multiplex immuno-aRNA method according to the present invention. Figure 2: Sensitivity test: Serial dilution of proteins. Single immuno-T7 assay using IL-1 β as antigen.

Figure 3: Microarray intensity fluorescence spots of the amplified RNAs of the assay of Figure 2. Antigen interleukin-1 (IL-1) was present at different concentrations: (A):10pg, 3x10⁸ molecules; (B): 1 pg, 3x10⁷ molecules; (C): 100fg, 3x10⁶ molecules; (D): 10fg, 3x10⁵ molecules; (E): 1fg, 3x10⁴ molecules; (F) 0.1fg, 3x10³ molecules; (G): 0.01fg, 3x10² molecules; (H): Blank.

Figure 4: Duplex immuno-T7 reaction. A: 10 pg of IL-1 β, 0 pg of IL-4. B: 1 pg of IL-1β, 0.01 fg of IL-4; C, 0.1 pg of IL-1β, 0.1 fg of IL-4; D, 10 fg of IL-1β, 1 f g of IL-4; E, 1fg of IL-1β, 10 fg of IL-4; F, 0.1 fg of IL-1 β, 0.1 pg of IL-4; G, 0.01 fg of IL-1 β, 1 pg of IL-4; H, 0 pg of IL-1β, 10 pg of IL-4.

Figure 5: Specificity test of RNA:DNA hybridisation. Concept of test of cross hybridization and effect of sequences on complementary sequences hybridization.

Figure 6: Hybridization of amplified 60D RNA and 30A RNA onto a glass slide which was arrayed with probe 60D, 50A, 40E, and 30A. A: 30 ng of template, B: 3 ng of template, C: 0.3 ng of template.

Detailed description of the invention

Bibliographic references mentioned in the present specification are listed in the form of a list of references for convenience at the end of the examples below. The whole content of such bibliographic references is herein incorporated by reference. A technique known as amplified RNA (aRNA) synthesis has been developed and utilized in the past few years for a variety of purposes including in vitro RNA synthesis from plasmids containing the appropriate promoter site for use as probes (Melton et al., 1984 Nucl. Acid Res., 12:7035-7056), for in vitro translation studies (Krieg and Melton, 1984 Nucl. Acid Res., 12:7057-7070), for producing synthetic oligonucleotides (Milligan et al., 1987 Nucl. Acid Res., 15:8783-8798), and for detection of low abundance messages.

The technique of amplification RNA (herein after indicated as "aRNA") synthesis has been utilized by those of skilled in the art perhaps most effectively for the detection of rare messages. In general, the first step in this method involves synthesizing an oligo(dT) primer that is extended at the 5' end with an RNA polymerase promoter such as the T7 or SP6 promoter. This oligonucleotide can be used to prime poly (A+) mRNA populations for cDNA synthesis. After the first strand cDNA is synthesized, the second strand cDNA is made, followed by RNA nuclease treatment to degrade the RNA and treatment with T4 DNA polymerase to generate a blunt-ended molecule. This double-stranded cDNA can then be used for amplification by utilizing the incorporated RNA polymerase promoter to direct the synthesis of RNA. The aRNA synthesized using this type of technique is quantitatively representative of the original message present in the population (van Gelder et al., 1990,

Proc. Natl. Acad. Sci., 87:1663-1667).

This method was further refined to assay the expression profile of a particular mRNA at the single cell level (Eberwine et al., 1992 Proc. Natl Acad. Sci., 89:3010-3014). Using a variation of this technique, the mRNA from a defined single cell was characterized by microinjecting primer, nucleotides and reverse transcriptase using a patch pipette into acutely dissociated cells from a defined region of the rat brain. A modified aRNA technique has been developed for use in the identification of proteins (US 6,255,060, the whole content of which is herein incorporated by reference). This method, termed immuno-aRNA, was indicated to correlate the connection between co-ordinated mRNA level changes and the presence of protein. In general terms, in this method, a first antibody targeted to a first epitope of a protein of interest, i.e., the selected protein, is immobilized to a solid support by incubation at 4°C. Any unattached first antibody is removed from the solid support by washing with buffer. This solid support containing the immobilized first antibody is then contacted with the selected protein so that the selected protein binds to the immobilized first antibody. The solid support is then contacted with a second antibody which recognizes a second epitope of the selected protein of interest and which is covalently coupled to a RNA promoter-driven cDNA sequence so that the second antibody binds to the bound selected protein on the solid support. The promoter-driven cDNA sequence coupled to the second antibody is then used in an aRNA amplification procedure to detect the presence of the bound selected protein. aRNA synthesis is a technique known to those of skill in the art. This method is limited in the use and presents several disadvantages. First, the method has the disadvantage of requiring a direct quantitative method based on radio- labelled gel electrophoresis. The sensitivity of detection relies on radioactivity incorporated in the amplified RNA product. The sensitivity of methods based on radioactivity is known to be limited to a detection of 10⁵ molecules. Accordingly, this method is not suitable for detecting amounts of molecules lower than 10⁵ molecules. Secondly, it is not possible to validate if the amplified RNA molecules observed on the electrophoresis contain the specific target sequences. Finally, the method described in the prior art is limited to the detection of one single species of target protein and cannot perform multiplex analysis. The method according to the present invention has solved the above disadvantages and provides an improved immuno-aRNA method for detecting target proteins. In particular, the method is a multiplex method for the simultaneous quantification of the level of at least two species of proteins.

According to a first aspect, the present invention provides a method for the simultaneous quantification of level of at least two species of target proteins by immuno-amplification RNA comprising:

(a) immobilising at least two species of capture molecules (for example, capture peptides or antibodies) to an insoluble support, wherein each species of capture molecule is specific for a species of a target protein;

(b) contacting the support with the at least two species of target proteins so that the target proteins bind to the immobilised capture molecules; (c) contacting the support with at least two species of RNA promoter- driven DNA sequences, each DNA sequence being different from the other(s) and being conjugated to a detection molecule (for example, a peptide or antibody) specific to each species of the target proteins, so that each detection molecule binds to the specific target protein on the support; (d) obtaining amplified copies of at least two species of RNAs, each representing one species of the target protein; (e) quantifying the level of the target species of proteins, by detecting the species of RNAs.

The capture and detection molecules may be any molecule capable of recognising and binding the target protein(s). The capture and detection molecule may be, for example, an antibody or a peptide specific for a target protein. It will be evident to a skilled person in the art how to choose and prepare capture and detection molecules, for example, antibodies and/or peptides suitable for the purpose of the present invention.

More in particular, the present invention provides a method for the simultaneous quantification of level of at least two species of target proteins by immuno-amplification RNA comprising:

(a) immobilising at least two species of capture antibodies to an insoluble support, wherein each species of antibody is specific for a species of a target protein; (b) contacting the support with the at least two species of target proteins so that the target proteins bind to the immobilised capture antibodies; (c) contacting the support with at least two species of RNA promoter- driven DNA sequences, each DNA sequence being different from the other(s) and being conjugated to a detection antibody specific to each species of the target proteins, so that each detection antibody binds to the specific target protein on the support; (d) obtaining amplified copies of at least two species of RNAs, each representing one species of the target protein; (e) quantifying the level of the target species of proteins, by detecting the species of RNAs.

At least two capture antibodies, each of them specific for a species of target protein, are immobilised or adsorbed on a support (see Figure 1 and Figure 2). A variety of solid supports well known to those skilled in the art can be used in this method. The support is preferably an insoluble support, for example a solid support. Examples include, but are not limited to, siliconized patch pipettes, microtiter plates and beads. The capture antibodies may be immobilised on the support, for instance on the microtiter plate, according to any standard methodology. For example, the species of target proteins (for example different cytokines at serial concentrations) are immobilized onto microtiter well surface through hydrogel-based silane linker. More in particular, the antibodies may be immobilised on protein G coated 96-well microtiter plates. The capture antibodies specific for the species of target proteins may be prepared according to any standard technique known in the art. The antibodies may be monoclonal antibodies.

At least two species of proteins are applied on the support on which the capture antibodies have been immobilised. The species of proteins may be comprised in one or more samples. For example, a sample comprising the at least two species of target proteins is loaded on the support loaded with the capture antibodies. Alternatively, at least two samples, each comprising one species of target protein, are loaded on the support. The sample may be any biological sample. For example, blood or body fluid. Body fluid is a general term which refers to body fluids such as tears, sweat, urine, gastric and intestinal fluids, as well as saliva, various mucous discharges, sinovial fluids, and the like. However, the biological sample which can be treated with the method of the invention is not limited to blood and body fluids. For example, a suspension of air filtrate may also be treated. If the capture antibodies are immobilised on a microtiter well, the target proteins will be captured in the well. Non-specific proteins which have not bound to the detector antibodies are washed away.

At least two detector antibodies, each of them specific for a species of the target proteins, are conjugated to RNA promoter-driven DNA sequences (also indicated as RNA promoter-driven double strand (ds) DNA sequences). The RNA promoter-driven DNA may be prepared by hybridising a single strand template (comprising a first portion comprising the RNA polymerase promoter and a second portion which the probe) to an oligonucletide complementary to the portion of the template including the promoter. The probe is specific (unique) for each species. RNA promoter-driven DNA sequences are added to the support (see Figure 1 , Figure 2 and Figure 5). The RNA promoter- driven DNA sequences used in the invention comprise a RNA promoter and a probe of 10-100 nucleotides, the probe being specific for each species. The RNA promoter may be any RNA promoter recognised by a RNA polymerase. For example, the RNA promoter may be T7, T3, K11 and/or SP6-RNA-driven double strand (ds) DNAs, and the amplification is carried out by T7, T3, K11 and/or SP6 RNA polymerase(s). The probe is specific for each species of target protein and two probes of two different species are preferably selected such that they do not hybridize with each other. The probe may be 10-100 nucleotides (mer), 20-80, 30-60 nucleotides, 40-60 nucleotides. For example, the probes chosen may be of 60 nucleotides. More in particular, the probe may have the sequence of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and/or SEQ ID NO:7. It is an important characteristic of the present invention that the RNA promoter-driven DNA sequences used to probe the different species do not hydridise with each other. Accordingly, the probes conjugated to the detector antibodies are specifically designed so as to limit or avoid cross-hydridization with each other. As an example, probes SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and/or SEQ ID NO:7 have been designed to avoid cross-hybridisation. For example, at least two detector antibodies-dsT7-unique 60mer may be added to the wells. According to an embodiment, detection antibodies are added, followed by the addition of strepavidin or avidin [herein commonly indicated as strepto(avidin)]. Templates comprising the RNA promoter and the probe 5' conjugated with biotin are then added (see Figure 1 , Figure 2 and Figure 5). These templates may be of any size. The size can be that of the probe with an additional region comprising the promoter. The template may be, for example, 10-150 nucleotides (mer), 10-100, 20-80, 30-60, 40-60. In particular, the template may be selected from SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and/or SEQ ID NO:12. The template hydridizes to an oligonucleotide complementary to the region of the template comprising the RNA polymerase promoter in order to form the double strand (ds) DNA stretch (see Figure 2 and Figure 5). For example, the oligonucleotide having the sequence SEQ ID NO:13 is used to hybridise to any one of the template SEQ ID NOS:8 to 12. After that, non-specific detection antibodies-oligo will be washed off with binding buffer.

Further, the aRNA is carried out. A RNA polymerase, for example T7 RNA polymerase, ribose-ATP, CTP, GTP and ribose-UTP are added to allow polymerization from the different templates (see Figure 1 and Figure 2). Alternatively, ribose-Cy3-uridine or ribose-Cy5-uridine is added instead of ribose-UTP. The RNA polymerase is chosen according to the RNA promoter of the RNA promoter-driven DNA sequences. Therefore, if the RNA promoter used is T7 RNA promoter, the amplification is carried out by using T7 RNA polymerase. Alternatively, a T3, K11 or SP6 RNA polymerase may also be used.

The detection and quantification of the level of the species of target proteins is carried out by detecting the species of amplified RNAs. This can be carried out according to standard technologies. For example, by detecting and sequencing the species of amplified RNAs, by standard sequencing technique (Sanger) or by TOF-Mass spectrometry to detect different RNA products with different molecular weight. Other physical or chemical properties of the amplified products can also be exploited for detection and quantitation. Any other method known to the skilled person may also be used. The detection of the presence of the promoter-driven cDNA (by detecting the amplified RNA), is indicative of the presence of the target protein. According to an embodiment, the quantification analysis starts from loading amplified ribose nucleic acids onto microarray slides on which sequences of the probes have been loaded, fixed or printed. The probes to be fixed on to the microarray are the same probes used to make the RNA promoter-driven DNA sequences. Accordingly, at least two probes selected from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 are applied, fixed or printed on a microarray. Amplified RNAs are allowed to bind onto probes on microarray slides. In particular, in step (e) of the method of the invention, the amplified RNAs may be applied on a microarray comprising the probes fixed on it, and the RNAs which hybridize with the probes are detected. The output of fluorescent intensity and position of fluorescent spot reflect the amount and identity of amplified products. These amplified RNAs in turn reflect amount of antigens binding to the secondary antibodies. This embodiment is illustrated in Figure 1 , Figure 2 and Figure 5.

In the method of the invention, the detection and sequencing carried out in the method of the present invention allows the recognition of different species of RNAs. These RNAs do not hybridize with each other. Further, the identification through fluorescent intensity allows an efficient quantification. Accordingly, the multiplex method according to the present invention allows a sensitive and efficient method. On the contrary, the method described in the prior art (for example, in US 6,255,060 and US 5,922,553) suffers for being limited to the detection of only one target protein (the tau protein). In fact, the method described in the prior art, is not suitable for the simultaneous detection and quantification of more than one species of protein and is limited to radio-labelled direct detection via gel electrophoresis. The quantification of the target protein also suffers from the limitation of accuracy of the gel electrophoresis. A further extension of the application is that multiple serum samples can be processed by adding different fluorophore-uridine in different samples. For example, in sample number 1 , Cy3-uridine is used. In sample number 2, Cy-5 uridine is used. After amplification processes are done separately, amplified RNA samples can be co-hybridized onto same microarrays. Therefore, analyses of two samples for multiple cytokines can be done simultaneously, thus doubling the through-put rate.

Any species of target protein may be used in the quantification method of the present invention. For example, the detection of any species of the known eighty different cytokines is possible. For example, IL-1 β, IL-1α, IL-4, IL-8, TNF-α, and the like. The detected and quantified target proteins may be correlated to a disease. Accordingly, the method of the invention will be a diagnostic method for the determination of a disease or presumption of a disease indicated by the presence of one or more specific target proteins. Accordingly, the present invention also relates to a diagnostic kit for carrying out the diagnostic method according to any embodiment of the invention.

According to another aspect, the invention provides a kit, for example a diagnostic kit for detecting and quantifying target proteins correlated to a physiological condition, comprising at least two probes selected from SEQ ID NOS: 1-7 and at least two templates selected from SEQ ID NO:8-12. Further, it comprises an oligonucleotide complementary to the part of any of SEQ ID NO:8-12 comprising the RNA polymerase promoter. For example, the oligonucleotide of SEQ ID NO:13. The kit may optionally comprise: - at least two different capture molecules and at least two detection molecules. Each capture and detection molecule being specific for a species of target protein. The capture and detection molecules may be capture and detection antibodies or any other molecule, for example a peptide, capable of recognizing and binding to the target proteins; - an insoluble support, onto which the capture molecules may be applied; - at least one RNA polymerase (for example, T3, 17, K11 or SP6-RNA polymerase) and the substrates (for example, ribose-ATP, ribose-CTP, ribose-GTP, and at least one of ribose-UTP. Cy5-uridine and/or Cy3- uridine); - a microarray onto which at least two of the probes SEQ ID NOS:1-7 are applied.

Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.

EXAMPLES

Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001 ).

Example 1

Antibodies A panel of four monoclonal antibodies against cytokines are provided for the first step of calibration of the system in terms of reproducibility, sensitivity, and specificity. These monoclonal antibodies recognise the four cytokines IL-1α, IL-4, IL-8, and TNF- (see Figure 1 ).

ds-DNA ds-oligos of the following structures: One or more templates (SEQ ID No. 8 to 12) with 3' end tagged with biotin was added together with another oligonucleotide

(5'biotinGAGAGAGGATCCAAGTACTAATACGACTCACTATAGGG)- 3' (SEQ ID NO: 13). The unique 30, 40 and/or 60mer sequences were the unique sequences that were generated artificially by computer algorithm to get maximum hybridization efficiency and minimal cross hybridization probability. The unique mer used was found only in that particular cytokine.

Preparation and characterization ofAb-DNA conjugates

In this example antibodies with biotin at the Fc fragment were used. Upon binding onto the captured antigen, biotin tagged detection antibodies were added. Streptavidin was added sequentially followed by the addition of biotin

3' labelled oligonucleotide (SEQ ID NO: 8 to 12). An addition of oligonucleotide SEQ ID NO: 13 completed the Ab-DNA conjugate formation.

Alternative procedures followed those described in Schweitzer et al., 2000.

Desalted Ab (41 nmoles) were treated with a 10-fold molar excess of sulfo-

GMBS (Pierce) under nitrogen in the dark for 30 min at 37°C, followed by 30 min at room temperature. Unreacted sulfo-GMBS was removed by chromatography over a PD-10 column equilibrated with sodium phosphate

(pH 7.5)/150 mM NaCl. The Ab was then concentrated in a Centricon YM-30 at 4°C. The number of maleimides per Ab was determined by utilizing

Ellman's reagent (Pierce) to measure sulfhydryls followed by titration of β- mercaptoethanol by the activated Ab. An amount equal to 28.1 nmol of sulfo- GMBS-activated Ab and 142 nmol of 5' thiol oligonucleotide was conjugated in a volume of 825 ml for 2 h at room temperature, followed by overnight at 4°C. Ab conjugated to oligonucleotide was purified by anion exchange chromatography on Q-Sepharose (Amersham Pharmacia) using a salt gradient. Fractions containing conjugate were pooled and subjected to a size exclusion chromatography on Superdex-200 (Pharmacia) at 4°C to remove free oligonucleotide. The overall efficiency of the conjugation procedure was determined by analysis of percentage of recovery of the starting Ab.

Immunobinding and T7 amplification

The T7 amplification assays can be done in two ways. Firstly, different cytokines at serial concentrations may be immobilized onto microtiter well surface through hydrogel-based silane linker. A panel of antibodies-dsT7- unique 60mer will be added to the wells. Non-specific binding antibodies-oligo will be washed off with binding buffer. T7 RNA polymerase, ribose-A,C,G , and Cy3-uridine will be added to allow polymerization from different templates. Alternatively, primary antibodies will be immobilized onto proteinG coated 96-well microtiter plates. This will ensure right side up orientation of primary antibodies. Upon binding with antigens, secondary monoclonal antibodies-ds DNA conjugates will be added into the wells. Again, T7 RNA polymerase, ribose-A,C,G, and Cy3-uridine will be added to allow polymerization from different templates. The second section of analysis starts from loading amplified ribose nucleic acids onto microarray slides on which sequences of specific probes have been printed. Amplified ribonucleic acids are allowed to bind onto probes on microarray slides. The output of fluorescent intensity and position of fluorescent spot reflect the amount and identity of amplified products respectively. These amplified RNAs in turn reflect the amount of antigens binding to the secondary antibodies. Example 2

If not indicated otherwise, the example or any step thereof was carried out according to that described in Example 1.

Material and methods

Antigens (the cytokines IL-1 beta and IL-4) and antibodies against IL-1 beta and IL-4 were obtained from Bender Medsystem (Vienna, Austria). T7 RNA polymerase was obtained from Epicenter (Madison, Wl). Reverse transcriptase and polymerase chain reaction kit were from Roche Applied Science (Indianapolis, IN). Gold Seal microscopic slides spotted with complementay oligonucleotides were scanned using Genepix scanner. Cy3 fluorescence dye was from NEN (Boston, MA). Artificially generated oligonucleotide sequences contained 40% GC-content, 0 to -0.3 unit of secondary structure, and at least 19 units of Hamming distance. Oligos were made from Proligo Inc. (Singapore).

The oligonuleotides sequences of the probes were as follows.

Probes:

60A: tccttttcctttagcatttgtatccagctctgtatcgtaccactaatcttcccctttttg (SEQ ID NO:1 ); 60B: tgtatataaatccgcgttatgttgtcgtcctactttgtcccttcgtattccttctctagt (SEQ ID NO:2) 60C: tagtcgtttactaatttccctttgtgcctgccttactgtttgttaacttactctcacccc (SEQ ID NO:3) 60D: atcgttcagtctccgtgtattcttatcctatgcctctttccattcctctatctgttatag (SEQ ID NO:4); 50A: gtgttcgttttcttcgtttccattattcactatctcaacaaccatgtcgg (SEQ ID NO:5); 40E: taattgcagttagttcatcgcttcatccctatacgagttc (SEQ ID NO:6); 30A: agaacttagctcacacatagtaccttttgc (SEQ ID NO:7). Table 1 - Oligo (probe) sequences

Name 60A 60B 60C 60D 50A 40E 30A

The templates were as follows: 60A: 5' tccttttcctttagcatttgtatccagctctgtatcgtaccactaatcttcccctttttgC CCT ATA GTG AGT CGT ATT AGT ACT TGG ATC CTC TCT C 3' (SEQ ID NO:8); 60D: 5" atcgttcagtctccgtgtattcttatcctatgcctctttccattcctctatctgttatagC CCT ATA GTG AGT CGT ATT AGT ACT TGG ATC CTC TCT C 3' (SEQ ID NO:9); 50A: 5' gtgttcgttttcttcgtttccattattcactatctcaacaaccatgtcggC CCT ATA GTG AGT CGT ATT AGT ACT TGG ATC CTC TCT C 3' (SEQ ID NO:10); 40E: 5' taattgcagttagttcatcgcttcatccctatacgagttcC CCT ATA GTG AGT CGT ATT AGT ACT TGG ATC CTC TCT C 3' (SEQ ID NO:11 ); 30A: 5' agaacttagctcacacatagtaccttttgcC CCT ATA GTG AGT CGT ATT AGT ACT TGG ATC CTC TCT C 3" (SEQ ID NO: 12).

Probes 60A, 60B, 60C, and 60D in 0.2 μL in volume were spotted on each microscopic slide. These four probes processed the concentration of 2 μM. Hybridization was done in 3x SSC buffer. Sensitivity test of single antigen detection Antigen interleukin-1 (IL-1) at different concentrations were added to a microtiter well which had been immobilized with specific capture antibody. Detection antibody was added followed by the addition of streptavidine. Template 60D (SEQ ID NO:9) with 3'-biotin was added followed by the addition of T7 RNA polymerase, ribose-ATP, ribose-CTP, ribose-GTP, and ribose-UTP. T7 amplified product was allowed to undergo RT-PCR using primer sequences at the 5' and 3' end of the 60 mer sequence. Negative control was identical with the test conditions except that antigen IL-1 beta was not included. Figure 3 shows that the specific signal from 60D was lighted up at the top left corner of each well. These PCR amplified products did not hybridize to 60A, 60B, or 60C sequence. No signal was detected in the absence of antigen (Figure 3H). The positive signal was observed as low as 300 molecules of antigen (Figure 3G).

Example 3

If not otherwise indicated the example and any step thereof was carried out according to Example 2.

Duplex immuno-T7 reaction

Similar to the above single antigen detection, two antigens were used. Serial dilution of IL-1 β and IL-4 were added to the well sequentially followed by the addition of target detection antibodies. In Figure 4, the top left corner denoted IL-1 β whereas the lower right corner denoted IL-4. IL-1 β signal decreased to non-detectable when the antigen concentration went down to 1fg or below. IL- 4 signal was present throughout the whole slide.

The values for the concentrations indicated in Figure 4 are as follows: A: 10 pg of IL-1β, 0 pg of IL-4. B: 1 pg of IL-1β, 0.01 fg of IL-4; C, 0.1 pg of IL-1 β, 0.1 fg of IL-4; D, 10 fg of IL-1 β, 1 fg of IL-4; E, 1fg of IL-1 β, 10 fg of IL-4; F, 0.1 fg of IL-1 β, 0.1 pg of IL-4; G, 0.01 fg of IL-1β, 1 pg of IL-4; H, 0 pg of IL-1 β, 10 pg of IL-4.

Maximum complementary hybridization and absence of non-specific cross hybridization. Figure 5 shows the concept of using two double stranded templates (60D and 30A) during the T7 amplification steps. A serial dilution of 60D and 30A ds templates were used. Amplified RNA molecules were allowed to hybridize to glass slides arrayed with probes 60D, 50A, 40E, and 30A. Figure 6 shows that 30A and 60D hybridized specificially to the corresponding probe positions. The signal intensities were identical in both probes in three dilutions. These two RNA species contained identical number of uridine in the molecules. The similar signal intensities implied that the two sets of RNA molecules processed similar hybridization efficiency. These two sequences were screened so that no intramolecular secondary structure was formed. Therefore, one could conclude that these two sequences had maximum hybridization efficiency. No cross-hybridization was observed as the amplified RNA species did not hybridize to 50A and 40E at all. Therefore, one could conclude that no cross hybridization was observed since the Hamming distance was greater than 19.

REFERENCES

- Adler M, Wacker R, Niemeyer CM: A real-time immuno-PCR assay for routine ultrasensitive quantification of proteins. Biochem Biophys Res Commun 2003(a), 308:240-250.

- Adler M.Langer M, Witthohn K, Eck J, Blohm D, Niemeyer CM:Detection of rViscumin in plasma samples by immuno-PCR. Biochem Biophys Res Commun 2003(b), 300:757-763.

- Cao Y: In situ immuno-PCR. A newly developed method for highly sensitive antigen detection in situ. Methods Mol Biol 2002, 193:191-196.

- Demidov VV: Rolling-circle amplification in DNA diagnostics: the power of simplicity. Expert Rev Mol Diagn 2002, 2:542-548.

- Eberwine et al., 1992 Proc. Natl Acad. Sci., 89:3010-3014.

- Kingsmore SF, Patel DD: Multiplexed protein profiling on antibody-based microarrays by rolling circle amplification. Curr Opin Biotechnol 2003, 14:74-81.

- Krieg and Melton, 1984 Nucl. Acid Res., 12:7057-7070.

- Liang H, Cordova SE, Kieft TL, Rogelj S: A highly sensitive immuno-PCR assay for detecting Group A Streptococcus. J Immunol Methods 2003, 279:101-110.

- Melton et al., 1984 Nucl. Acid Res., 12:7035-7056.

- McKie A, Samuel D, Cohen B, Saunders NA: Development of a quantitative immuno-PCR assay and its use to detect mumps-specific IgG in serum. J Immunol

Methods 2002(a), 261 :167-175. - McKie A, Samuel D, Cohen B, Saunders NA: A quantitative immuno-PCR assay for the detection of mumps-specific IgG. J Immunol Methods 2002(b), 270:135-141.

- Milligan et al., 1987 Nucl. Acid Res., 15:8783-8798

- Monteiro L, Gras N, Megraud F: Magnetic immuno-PCR assay with inhibitor removal for direct detection of Helicobacter pylori in human feces. J Clin Microbiol 2001 , 39:3778-3780.

- Sano T, Smith CL, Cantor CR: Immuno-PCR: very sensitive antigen detection by means of specific antibody-DNA conjugates. Science 1992, 258:120-122.

- Schweitzer B, Wiltshire S, Lambert J, O'Malley S, Kukanskis K, Zhu Z, Kingsmore SF, Lizardi PM, Ward DC: Inaugural article:immunoassays with rolling circle DNA amplification: a versatile platform for ultrasensitive antigen detection. Proc Natl Acad Sci U S A 2000, 97:10113-10119.

- van Gelder et al., 1990, Proc. Natl. Acad. Sci., 87:1663-1667.

- Zhang HT, Kacharmina JE, Miyashiro K, Greene Ml, Eberwine J:Protein quantification from complex protein mixtures using a proteomics methodology with single-cell resolution. Proc Natl Acad Sci U S A 2001 , 98:5497-5502.

- Zhang DY, Brandwein M, Hsuih T, Li HB: Ramification amplification: a novel isothermal DNA amplification method. Mol Diagn 2001 , 6:141-150.

- Zhang DY, Zhang W, Li X, Konomi Y: Detection of rare DNA targets by isothermal ramification amplification. Gene 2001 , 274:209-216.

Claims

1. A method for the simultaneous quantification of level of at least two species of target proteins by immuno-amplification RNA comprising:

(a) immobilizing at least two species of capture molecules to an insoluble support, wherein each species of capture molecule is specific for a species of a target protein;

(b) contacting the support with the at least two species of target proteins so that the target proteins bind to the immobilised capture molecules;

(c) contacting the support with at least two species of RNA promoter- driven DNA sequences, each DNA sequence being different from the other(s) and being conjugated to a detection molecule specific to each species of the target proteins, so that each detection molecule binds to the specific target protein on the support;

(d) obtaining amplified copies of at least two species of RNAs, each representing one species of the target protein; (e) quantifying the level of the target species of proteins, by detecting the species of RNAs.

2. The method of claim 1 , wherein the capture and/or detection molecules are capture and/or detection antibodies or peptides.

3. The method of claims 1-2, wherein each RNA promoter-driven DNA sequence comprises a template comprising a first region comprising a RNA polymerase promoter and a second region comprising a probe, the probe having a nucleotide sequence specific for each target protein.

4. The method of claim 3, wherein in step (e), the amplified RNAs are applied on a microarray comprising at least two of the probes fixed on it, and the RNAs which hybridise with the probes are detected.

5. The method of claims 1-4, wherein the RNA promoter-driven DNA sequences do not hybridize with each other.

6. The method of claims 1-5, wherein the RNA promoter-driven DNA sequences are T7, T3, K11 and/or SP6 RNA-driven DNAs, and the amplification is carried out by T7, T3, K11 and/or SP6 RNA polymerase(s).

7. The method of claims 1-6, wherein the at least two target species of proteins are comprised in a sample.

8. The method of claims 1-7, wherein each species of the target protein is comprised in a sample.

9. The method of claims 7-8, wherein the sample(s) is a biological sample or suspension of air filtrate.

10. The method of claim 9, wherein the biological sample is blood, body fluid, and/or urine.

11. The method of claims 1-10, wherein a first species of RNA promoter- driven DNA sequence labelled with Cy5-uridine and a second species of RNA promoter-driven DNA sequence labelled with Cy3-uridine are obtained, and the detection of the respective amplified RNAs is carried out simultaneously.

12. The method of claim 11 , wherein the two species of amplified RNAs are detected simultaneously by hybridization on the same microarray.

13. The method of claims 1-12, wherein in step (c), the detection molecules are added first, followed by streptavidin, and further promoter-driven DNA sequence 5'-conjugated with biotin are added.

14. The method of claims 1-13, wherein the target proteins are cytokines.

15. The method of claim 14, wherein the cytokines are IL-1 β and IL-4.

16. The method of claims 1-15, wherein the RNA promoter-driven DNA sequences comprise a template comprising the RNA polymerase promoter and a probe of 20-100 nucleotides, the probe being specific for each species.

17. The method of claim 16, wherein the probe is 30-60 mer.

18. The method of claim 16, wherein the probe is 60 mer.

19. The method of claims 3-18, wherein the at least two templates are selected from SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12.

20. The method of claim 19, wherein an oligonucleotide having the sequence of SEQ ID NO:13 hybridises to the template to make the at least two RNA promoter-driven DNA sequence.

21. The method of claims 3-20, wherein the probe is selected from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and/or SEQ ID NO:7.

22. An isolated oligonucleotide molecule having a sequence selected from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12 .

23. A microarray comprising at least one of a probe having a nucleotide sequence selected from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7.

24. A kit comprising at least two probes selected from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, at least two templates selected from SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12, and an oligonucleotide of sequence SEQ ID NO:13.

25. The kit of claim 24, further comprising at least one of the following: - at least two different capture molecules and at least two detection molecules, each capture and detection molecule being specific for a species of target protein; - an insoluble support, onto which the capture molecules are applied; - at least one RNA polymerase, and the RNA polymerase substrates; - a microarray onto which at least two of the probes selected from having the sequences selected from SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, are applied.

26. The kit of claim 25, wherein the capture and detection molecules are capture and detection antibodies, each antibody being specific for a target protein.

27. The kit of claim 25, wherein the RNA polymerase promoter is selected from T3, T7, K11 and/or SP6-RNA polymerase and the RNA polymerase is selected from T3, T7, K11 and/or SP6-RNA polymerase.

28. The kit of claims 25-27, wherein the RNA polymerase substrates comprises ribose-ATP, ribose-CTP, ribose-GTP, and at least one of ribose-UTP. Cy5-uridine and/or Cy3-uridine.

29. The kit of claims 25-28, wherein the kit is a diagnostic kit, and wherein the at least two target proteins are correlated to one ore more physiological condition.