KR20060065814A - Agent for preventing skin aging containing oligonucleotide - Google Patents
Agent for preventing skin aging containing oligonucleotide Download PDFInfo
- Publication number
- KR20060065814A KR20060065814A KR1020040104236A KR20040104236A KR20060065814A KR 20060065814 A KR20060065814 A KR 20060065814A KR 1020040104236 A KR1020040104236 A KR 1020040104236A KR 20040104236 A KR20040104236 A KR 20040104236A KR 20060065814 A KR20060065814 A KR 20060065814A
- Authority
- KR
- South Korea
- Prior art keywords
- mrna
- gene
- skin
- antisense
- aging agent
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/60—Sugars; Derivatives thereof
- A61K8/606—Nucleosides; Nucleotides; Nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/74—Biological properties of particular ingredients
- A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
- A61K2800/782—Enzyme inhibitors; Enzyme antagonists
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Dermatology (AREA)
- Cosmetics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 올리고뉴클레오타이드를 포함하는 피부 노화 방지제에 관한 것이다. 특히 본 발명은 사이클로옥시게네이즈-2 및 세포간 접합 분자-1의 발현을 저해함으로써 염증 발생으로 인한 피부 노화를 방지할 수 있는, 사이클로옥시게네이즈-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 및 세포간 접합 분자-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 포함하는 피부 노화 방지제를 제공한다. The present invention relates to skin anti-aging agents comprising oligonucleotides. In particular, the present invention provides antisense oligonucleotides and cells for mRNA of the cyclooxygenase-2 gene, which can prevent skin aging due to inflammation by inhibiting the expression of cyclooxygenase-2 and intercellular junction molecule-1. Provided is an anti-aging agent for skin comprising an antisense oligonucleotide for mRNA of a liver conjugated molecule-1 gene.
올리고뉴클레오타이드, 항염, 피부 노화 Oligonucleotides, Anti-Inflammation, Skin Aging
Description
[발명이 속하는 기술분야] [TECHNICAL FIELD OF THE INVENTION]
본 발명은 올리고뉴클레오타이드를 포함하는 피부 노화 방지제에 관한 것으로, 보다 상세하게는 사이클로옥시게네이즈2(cyclooxygenase-2, 이하 "COX-2"라 함) 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 및 세포간 접합 분자-1(intercellular adhesion molecule-1, 이하 "ICAM"이라 함) 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 포함하며, 염증 발생에 관여하는 단백질의 발현을 저해함으로써 염증으로 인한 피부 노화를 방지할 수 있는 피부 노화 방지제에 관한 것이다.The present invention relates to a skin anti-aging agent comprising oligonucleotide, and more particularly, antisense oligonucleotide and intercellular conjugation to mRNA of cyclooxygenase-2 (hereinafter referred to as "COX-2") gene. It contains antisense oligonucleotides to mRNA of the molecule-1 (intercellular adhesion molecule-1, hereinafter referred to as "ICAM") gene, and can prevent skin aging due to inflammation by inhibiting the expression of proteins involved in inflammation. It relates to a skin anti-aging agent.
[종래기술] [Private Technology]
피부의 노화는 피부 내에서 지속적으로 발생하는 미세염증에 의하여 촉진된다. 이러한 미세염증은 세포내의 COX-2가 발현되어 염증매개물질을 생산하고, 생산된 염증매개물질은 혈관내 순환하는 염증세포를 피부조직 속으로 불러들여 염증세포들에 의한 피부 진피조직이 파괴되는 일련의 과정이 발생된다. 상기한 과정은 피부 노화의 원인 중 하나로 판단되고 있다.Aging of the skin is facilitated by micro-inflammatory which occurs continuously in the skin. This micro-inflammation is produced by the expression of COX-2 in cells to produce inflammatory mediators, and the produced inflammatory mediators bring circulating inflammatory cells into the skin tissue and destroy the dermal dermal tissue by the inflammatory cells. The process of occurs. The above process is considered to be one of the causes of skin aging.
피부 노화에서 가장 중요한 요소는 염증매개물질을 생산하는 효소인 COX-2와, 염증세포가 피부조직으로 침투해 들어오게 하는데 중요한 역할을 하는 ICAM-1이다.The most important factors in skin aging are COX-2, an enzyme that produces inflammatory mediators, and ICAM-1, which plays an important role in infiltrating inflammatory cells into skin tissue.
염증발생으로 유도되는 피부 노화를 예방하기 위한 방안으로, COX-2의 활성을 저해할 수 있는 천연추출물을 개발하는 연구들이 진행되고 있다. 그러나, 항염증 효과를 갖는 천연추출물은 연고나 화장료에 배합하여 사용하는 경우 피부에 자극성을 유발하거나 제품 안정성이 좋지 못하여 사용이 제한되거나, 또는 항염 효과가 미비한 문제점이 있는 실정이다.In order to prevent skin aging induced by inflammation, studies are being conducted to develop natural extracts that can inhibit COX-2 activity. However, natural extracts having an anti-inflammatory effect may cause irritation to the skin or poor product stability when used in combination with ointments or cosmetics, or may be limited in use, or have insufficient anti-inflammatory effects.
상기 종래기술의 문제점을 해결하기 위하여 안출된 것으로서, 본 발명은 염증발생에 관여하는 단백질의 발현을 저해함으로써 염증으로 인한 피부 노화를 방지할 수 있는 피부 노화 방지제를 제공하는 것을 목적으로 한다.In order to solve the problems of the prior art, an object of the present invention is to provide a skin anti-aging agent that can prevent skin aging due to inflammation by inhibiting the expression of proteins involved in inflammation.
또한 본 발명은 피부에 자극적이지 않으며 제품 안정성이 우수한 피부 노화 방지제를 제공하는 것을 목적으로 한다. It is another object of the present invention to provide a skin anti-aging agent that is not irritating to the skin and has excellent product stability.
상기 목적을 달성하기 위하여 본 발명은 사이클로옥시게네이즈2(cyclooxygenase-2, COX-2) 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 및 세포간 접합 분자-1(intercellular adhesion molecule-1, ICAM-1) 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드로 이루어진 군으로부터 선택된 1종이 상의 안티센스 올리고뉴클레오타이드를 유효성분으로 포함하는 피부 노화 방지제를 제공한다.In order to achieve the above object, the present invention provides an antisense oligonucleotide and intercellular adhesion molecule-1 (ICAM-1) gene for mRNA of a cyclooxygenase-2 (COX-2) gene. It provides a skin anti-aging agent comprising at least one antisense oligonucleotide selected from the group consisting of antisense oligonucleotides for mRNA as an active ingredient.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 피부 노화를 유발하는 인자들 중, 염증 발생으로 인한 피부 노화 기작에 관여하는 단백질들의 발현을 저해하여 피부미세결을 개선시킬 수 있는 올리고뉴클레오타이드 및 이의 피부 노화 방지제로의 용도에 관한 것이다. The present invention relates to oligonucleotides and their use as skin anti-aging agents, which can improve skin fineness by inhibiting the expression of proteins involved in skin aging mechanisms due to inflammation, among factors causing skin aging.
본 발명의 올리고뉴클레오타이드는 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 및/또는 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 유효성분으로 포함한다.The oligonucleotide of the present invention includes an antisense oligonucleotide for mRNA of the COX-2 gene and / or an antisense oligonucleotide for mRNA of the ICAM-1 gene as an active ingredient.
COX-2 유전자 및 ICAM-1 유전자는 사람을 비롯한 동물에서 유래된 것일 수 있으며, 바람직하기로는 사람에서 유래된 공지의 유전자일 수 있다.The COX-2 gene and the ICAM-1 gene may be derived from animals, including humans, and may be known genes derived from humans.
상기 안티센스 올리고뉴클레오타이드는, mRNA에 상보적인 염기서열을 포함하는 올리고뉴클레오타이드며, 이의 길이는 15내지 25 bp일 수 있으나 이에 한정되는 것은 아니다. 안티센스 올리고뉴클레오타이드의 길이가 15 bp 미만인 경우 mRNA의 번역을 효과적으로 저해하지 않을 수 있으며, 25 bp 초과하는 경우 세포내 침투가 어려울 수 있다.The antisense oligonucleotide is an oligonucleotide comprising a nucleotide sequence complementary to mRNA, the length thereof may be 15 to 25 bp, but is not limited thereto. If the length of the antisense oligonucleotide is less than 15 bp may not effectively inhibit the translation of the mRNA, if it exceeds 25 bp intracellular penetration may be difficult.
일예로, COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드는 GeneBank accession no. M90100에 기재된 서열에 대한 mRNA에 상보적인 15 내지 25 bp의 폴리뉴클레오타이드일 수 있으며, 바람직하기로는 서열번호 1 내지 9로 기재한 염기서열로 이루어진 군으로부터 1종이상 선택된 것일 수 있다. ICAM-1 유전자 의 mRNA에 대한 안티센스 올리고뉴클레오타이드는 GeneBank accession no. J03132에 기재된 서열에 대한 mRNA에 상보적인 15내지 25bp의 폴리뉴클레오타이드일 수 있으며, 바람직하기로는 서열번호 10 내지 18로 기재한 염기서열로 이루어진 군으로부터 선택된 것일 수 있다.In one embodiment, the antisense oligonucleotide for mRNA of the COX-2 gene is GeneBank accession no. It may be a polynucleotide of 15 to 25 bp complementary to the mRNA for the sequence described in M90100, preferably at least one selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1-9. Antisense oligonucleotides for mRNA of the ICAM-1 gene are described in GeneBank accession no. It may be a polynucleotide of 15 to 25bp complementary to the mRNA for the sequence described in J03132, preferably may be selected from the group consisting of the nucleotide sequence set forth in SEQ ID NO: 10 to 18.
본 발명의 안티센스 올리고뉴클레오타이드는 화학적으로 합성된 것 일수 있으며, 생체내 안정성을 더욱 증강시키기 위하여 포스포로티오에이트 형태로 합성된 것 일 수 있다.The antisense oligonucleotides of the present invention may be chemically synthesized, or may be synthesized in the form of phosphorothioate to further enhance stability in vivo.
본 발명에 따른 피부 노화 방지제는 유효성분으로 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드, ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 및 이들의 혼합물로 이루어진 군으로부터 선택된 안티센스 올리고뉴클레오타이드를 포함할 수 있으며, 바람직하기로는 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드와 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드의 혼합물을 유효성분으로 포함할 수 있다.The anti-aging agent according to the present invention may include an antisense oligonucleotide selected from the group consisting of antisense oligonucleotides for mRNA of COX-2 gene, antisense oligonucleotides for mRNA of ICAM-1 gene, and mixtures thereof as an active ingredient. Preferably, a mixture of antisense oligonucleotides for mRNA of COX-2 gene and antisense oligonucleotides for mRNA of ICAM-1 gene may be included as an active ingredient.
상기 유효성분의 함량은 건조중량으로 0.00001 내지 10.0중량%일 수 있으나, 이에 한정되는 것은 아니다. 다만 유효성분의 함량이 0.00001 중량% 미만인 경우 피부 노화 방지 및 항염증 효과가 미비할 수 있으며, 10.0 중량% 초과하는 경우 사용량 대비 효과가 미비할 수 있다. 바람직하기로는 유효성분의 함량이 0.001 내지 1.0 중량% 일수 있다.The content of the active ingredient may be 0.00001 to 10.0% by weight of dry weight, but is not limited thereto. However, if the content of the active ingredient is less than 0.00001% by weight may be insufficient skin anti-aging and anti-inflammatory effects, if the amount exceeds 10.0% by weight may be ineffective compared to the amount used. Preferably the content of the active ingredient may be 0.001 to 1.0% by weight.
상기 유효성분으로 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드와 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 함께 사용 하는 경우, 이의 혼합비율은 1: 0.1 내지 10중량비일 수 있다. When the antisense oligonucleotide for the mRNA of the COX-2 gene and the antisense oligonucleotide for the mRNA of the ICAM-1 gene are used as the active ingredient, the mixing ratio thereof may be 1: 0.1 to 10 weight ratio.
본 발명의 피부 노화 방지제는 콜라겐을 분해하는 단백질 즉, COX-2의 발현을 억제하는 것으로, COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드는 COX-2 mRNA가 단백질로 번역되는 것을 저해하며, ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드는 ICAM-1 mRNA의 단백질로의 번역을 저해하는 것이다. 따라서, COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드와 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 유효성분으로 포함하는 경우, COX-2 및 ICAM-1 양 단백질의 발현을 동시에 저해함으로, 현저한 피부미세결 개선 효과가 있다. 또한 본 발명의 피부 노화 방지제는 피부에 자극을 유발하지 않는 안전한 시료이다.The skin anti-aging agent of the present invention inhibits the expression of a protein that breaks down collagen, that is, COX-2. The antisense oligonucleotide to the mRNA of the COX-2 gene inhibits the translation of COX-2 mRNA into the protein, Antisense oligonucleotides to mRNA of the -1 gene inhibit the translation of ICAM-1 mRNA into protein. Therefore, when the antisense oligonucleotide for the mRNA of the COX-2 gene and the antisense oligonucleotide for the mRNA of the ICAM-1 gene as an active ingredient, by inhibiting the expression of both COX-2 and ICAM-1 both proteins, It has the effect of improving skin fineness. In addition, the skin anti-aging agent of the present invention is a safe sample that does not cause irritation to the skin.
또한 상기 본 발명에 따른 피부 노화 방지제는 항염증제일 수 있다.In addition, the skin anti-aging agent according to the present invention may be an anti-inflammatory agent.
본 발명은 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 또는/및 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 유효성분으로 포함하는 피부 노화 방지용 약제를 제공한다. 상기 피부 노화 방지용 약제는 상기 유효성분만을 단독으로 포함할 수도 있으나, 제형 및 사용방법에 따라 약리학적으로 허용가능한 부형제를 더욱 포함할 수 있다. 상기 피부 노화 방지용 약제는 유효성분을 건조중량으로 0.00001 내지 10.0중량%으로 포함할 수 있으나 이에 한정되는 것은 아니다. 다만 유효성분의 함량이 0.00001 중량% 미만인 경우 피부 노화 방지 효과가 미비할 수 있으며, 10.0 중량% 초과하는 경우 사용량 대비 효과가 미비할 수 있다. 바람직하기로는 유효성분의 함량이 0.001 내지 1.0 중량% 일수 있 다. 상기 유효성분으로 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드와 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 함께 사용할 수 있으며, 이의 혼합비율은 1: 0.1 내지 10 중량비일 수 있다. The present invention provides an anti-aging drug for skin aging comprising an antisense oligonucleotide for mRNA of COX-2 gene and / or an antisense oligonucleotide for mRNA of ICAM-1 gene as an active ingredient. The anti-aging agent may include only the active ingredient alone, but may further include a pharmacologically acceptable excipient according to the formulation and the method of use. The anti-aging agent may include 0.00001 to 10.0% by weight of the active ingredient as a dry weight, but is not limited thereto. However, if the content of the active ingredient is less than 0.00001% by weight may be insufficient skin anti-aging effect, if it exceeds 10.0% by weight may be ineffective compared to the amount used. Preferably the content of the active ingredient may be 0.001 to 1.0% by weight. As the active ingredient, an antisense oligonucleotide for the mRNA of the COX-2 gene and an antisense oligonucleotide for the mRNA of the ICAM-1 gene may be used together, and a mixing ratio thereof may be 1: 0.1 to 10 weight ratio.
상기 피부 노화 방지용 약제에 혼합가능한 부형제는 통상의 약제 조성물, 예컨대 글리세린, 전분, 유당, 물, 알코올, 프로필렌글리콜, 살리실산, 다히아드로초산 및 생리식염수를 포함할 수 있으나 이에 한정되는 것은 아니다.Excipients that can be mixed with the anti-aging agent may include, but are not limited to, conventional pharmaceutical compositions such as glycerin, starch, lactose, water, alcohol, propylene glycol, salicylic acid, dahyroacetic acid and saline.
피부 노화 방지용 약제는 경구 또는 비경구로 사용될 수 있으며, 바람직하기로는 경피 투여이다. 피부 노화 방지용 약제의 제형은 사용방법에 따라 적절히 조절할 수 있으며, 그 예로는 경고제(PLASTERS), 과립제(GRANULES), 로션제(LOTIONS), 산제(POWDERS), 시럽제(SYRUPS), 액제(LIQUIDS AND SOLUTIONS), 에어로솔제(AEROSOLS), 연고제(OINTMENTS), 유동엑스제(FLUIDEXTRACTS), 유제(EMULSIONS), 현탁제(SUSPESIONS), 침제(INFUSIONS), 정제(TABLETS), 주사제(INJECTIONS), 캅셀제(CAPSULES) 및 환제(PILLS) 등이 있으나, 이에 한정되는 것은 아니다. Skin anti-aging agents can be used orally or parenterally, preferably transdermal. The formulation of the anti-aging agent can be appropriately adjusted according to the method of use, such as PLASTERS, GRANULES, LOTIONS, POWDERS, SYRUPS, and LIQUIDS AND. SOLUTIONS), AEROSOLS, OINTMENTS, FLUIDEXTRACTS, EMULSIONS, SUSPENSIONS, INFUSIONS, TABLETS, INJECTIONS, CAPSULES ) And pills (PILLS), but is not limited thereto.
피부 노화 방지용 약제의 투여량은 사용목적, 부위, 방법, 환자의 연령, 성별, 상태, 체내에서 활성 성분의 흡수도, 불활성율 및 병용되는 약물을 고려하여 결정하는 것이 좋으며, 예컨대 1일 유효성분을 기준으로 하였을 때 0.0001 ㎎/㎏(체중) 내지 500 ㎎/㎏(체중)으로 투여할 수 있다. The dosage of the anti-aging agent should be determined in consideration of the purpose of use, site, method, patient's age, sex, condition, absorption of the active ingredient in the body, inactivation rate, and the drug used in combination. It can be administered from 0.0001 mg / kg (body weight) to 500 mg / kg (body weight), based on.
또한 본 발명은 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드 및/또는 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 유효성분 으로 포함하는 피부 노화 방지용 화장료 조성물을 제공한다.The present invention also provides a cosmetic composition for preventing skin aging comprising an antisense oligonucleotide for the mRNA of the COX-2 gene and / or an antisense oligonucleotide for the mRNA of the ICAM-1 gene as an active ingredient.
상기 화장료 조성물은 1종이상의 유효성분을 건조중량으로 0.00001 내지 10.0중량%일 수 있으나, 이에 한정되는 것은 아니다. 다만 유효성분의 함량이 0.00001 중량% 미만인 경우 피부 노화 방지 효과가 미비할 수 있으며, 10.0 중량% 초과하는 경우 사용량 대비 효과가 미비할 수 있다. 바람직하기로는 유효성분의 함량이 0.001 내지 1.0 중량% 일수 있다. 상기 유효성분으로 COX-2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드와 ICAM-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드를 함께 사용하는 경우, 이의 혼합비율은 1: 0.1 내지 10 중량비일 수 있다. The cosmetic composition may be 0.00001 to 10.0% by weight of one or more active ingredients as a dry weight, but is not limited thereto. However, if the content of the active ingredient is less than 0.00001% by weight may be insufficient skin anti-aging effect, if it exceeds 10.0% by weight may be ineffective compared to the amount used. Preferably the content of the active ingredient may be 0.001 to 1.0% by weight. When the antisense oligonucleotide for the mRNA of the COX-2 gene and the antisense oligonucleotide for the mRNA of the ICAM-1 gene are used as the active ingredient, the mixing ratio thereof may be 1: 0.1 to 10 weight ratio.
본 발명의 화장료 조성물은, 상기 유효성분 이외에, 통상의 화장품에 사용가능한 모든 종류의 성분, 예컨대 부형제, 희석제 등을 포함할 수 있다. The cosmetic composition of the present invention may include, in addition to the active ingredient, all kinds of ingredients usable for ordinary cosmetics, such as excipients, diluents, and the like.
본 발명의 화장료 조성물은, 기초화장품, 메이크업 화장품, 바디 화장품, 두발용 화장품, 두피용 화장품, 면도용 화장품 또는 구강용 화장품의 용도로 제공될 수 있다. 상기 기초화장품의 예로는 크림, 화장수, 팩, 마사지 크림, 유액 등이 있으며, 상기 메이크업 화장품으로는 파운데이션, 메이크업 베이스, 립스틱, 아이새도, 아이라이너, 마스카라, 아이브로우 펜슬 등이 있으며, 바디 화장품으로는, 비누, 액체 세정제, 입욕제, 선스크린 크림, 선 오일 등이 있으며, 두발용 화장품으로는 샴푸, 린스, 헤어 트리트먼트, 헤어 무쓰, 헤어 리퀴드, 포마드, 헤어 칼라제, 헤어 블릿치제, 칼라 린스가 있으며, 두피용 화장품으로는 헤어 토닉, 스칼프 트리트먼트가 있으며, 면도용 화장품으로는 애프터셰이브로션, 셰이빙 크림 등이 있으며, 구강용 화장품으로는 치약, 마우스 워셔 등이 있다. The cosmetic composition of the present invention may be provided for the use of basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics. Examples of the basic cosmetics include creams, lotions, packs, massage creams, emulsions, etc. The makeup cosmetics include foundation, makeup base, lipstick, eyeshadow, eyeliner, mascara, eyebrow pencil, and the like. Examples include soaps, liquid cleansers, baths, sunscreen creams and sun oils. Hair care products include shampoos, rinses, hair treatments, hair mousses, hair liquids, pomades, hair colorants, hair bleaches, and colorants. There are rinses, hair tonics and scalp treatments as scalp cosmetics, aftershave and shaving creams as shaving cosmetics, and toothpaste and mouth washes as oral cosmetics.
이하 본 발명의 실시예를 기재한다. 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명이 하기 실시예에 한정되는 것은 아니다. Hereinafter, examples of the present invention will be described. The following examples are only for illustrating the present invention and the present invention is not limited to the following examples.
실시예 1-18: 피부 노화 방지 효과를 갖는 올리고뉴클레오타이드 합성Example 1-18: Oligonucleotide Synthesis Having an Anti-aging Effect
서열번호 1 내지 18의 총 18개의 올리고뉴클레오타이드를 각각 주식회사 바이오니아에 의뢰하여 합성하였으며, 생체내 안정성을 높이기 위하여 포스포로티오에이트(phosphorothioate) DNA로 합성하였다. 제조된 각각의 올리고뉴클레오타이드를 실시예 1 내지 18로 하였다. 서열번호 1 내지 8은 사이클로옥시게네이즈2 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드고, 서열번호 9 내지 18은 세포간 접합 분자-1 유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드다.A total of 18 oligonucleotides of SEQ ID NOS: 1 to 18 were synthesized by BIONIA Co., Ltd., respectively, and synthesized with phosphorothioate DNA to increase stability in vivo. Each oligonucleotide prepared was as Examples 1-18. SEQ ID NOs: 1-8 are antisense oligonucleotides for mRNA of the cyclooxygenase2 gene, and SEQ ID NOs: 9-18 are antisense oligonucleotides for mRNA of the intercellular junction molecule-1 gene.
서열번호 1: gagaaggcttcccagcttttSEQ ID NO: gagaaggcttcccagctttt
서열번호 2: aactgatgcgtgaagtgctgSEQ ID NO: aactgatgcgtgaagtgctg
서열번호 3: ggggatcagggatgaactttSEQ ID NO: ggggatcagggatgaacttt
서열번호 4: gccctcgcttatgatctgtcSEQ ID NO: gccctcgcttatgatctgtc
서열번호 5: gtgcactgtgtttggagtggSEQ ID NO: gtgcactgtgtttggagtgg
서열번호 6: cagcaaaccgtagatgctcaSEQ ID NO: 6 cagcaaaccgtagatgctca
서열번호 7: gccctcgcttatgatctgtcSEQ ID NO: gccctcgcttatgatctgtc
서열번호 8: tcagccagattgtggcatac SEQ ID NO: tcagccagattgtggcatac
서열번호 9: tgcttgtctggaacaactgc SEQ ID NO: tgcttgtctggaacaactgc
서열번호 10: taggcaacggggtctctatg SEQ ID NO: 10 taggcaacggggtctctatg
서열번호 11: gatgacttttgagggggaca SEQ ID NO: gatgacttttgagggggaca
서열번호 12: tggagtccagtacacggtga SEQ ID NO: 12 tggagtccagtacacggtga
서열번호 13: tttaggcaacggggtctcta SEQ ID NO: 13: tttaggcaacggggtctcta
서열번호 14: gggtaaggttcttgcccact SEQ ID NO: 14 gggtaaggttcttgcccact
서열번호 15: actgtggggttcaacctctg SEQ ID NO: 15 actgtggggttcaacctctg
서열번호 16: ctgacaagttgtgggggagt SEQ ID NO 16: ctgacaagttgtgggggagt
서열번호 17: tcacactgactgaggccttg SEQ ID NO: 17 tcacactgactgaggccttg
서열번호 18: aggagtcgttgccataggtgSEQ ID NO: 18 aggagtcgttgccataggtg
실험예 1: 항염증 효과 Experimental Example 1: anti-inflammatory effect
실시예 1 내지 18의 올리고뉴클레오타이드 각각을 0.01 (w/v) %(용매는 에탄올 : PG(프로필렌 글리콜) = 4 : 1)로 사용하여 아라키돈산에 의해 유발되는 염증에 대한 항염 효과를 확인하였다.Each of the oligonucleotides of Examples 1 to 18 was used as 0.01 (w / v)% (solvent is ethanol: PG (propylene glycol) = 4: 1) to confirm an anti-inflammatory effect on inflammation caused by arachidonic acid.
암컷의 Balb/C 마우스 좌측귀를 대조부위, 우측귀를 시험부위로 하고, 에탄올로 귀를 깨끗하게 세척하였다. 우측귀에 실시예 1내지 18의 올리고뉴클레오타이드 0.01 w/v%를 1일1회로 4일간 지속적으로 도포하고, 마지막 도포1시간후에 좌측귀에 에탄올을 우측귀에는 아라키돈산(Arachidonic acid)을2㎎/ear을 도포하였다. 1시간 후 귀의 부종(ear edema)정도를 마이크로미터로 3회씩 반복 측정하였다. 항염증 효과는 아라키돈산 처리군을 기준으로 부종억제 정도로 판정하였다. 항염증 효과는 계산식 1로 계산하였고, 그 결과는 표1에 나타내었다.The left ear of the female Balb / C mouse was the control site, the right ear was the test site, and the ears were washed clean with ethanol. 0.01 w / v% of the oligonucleotides of Examples 1 to 18 were continuously applied to the right ear once a day for 4 days, ethanol was added to the left ear 1 hour after the last application, and 2 mg / ear of Arachidonic acid to the right ear. Was applied. After 1 hour, the degree of ear edema was repeated three times with a micrometer. The anti-inflammatory effect was determined as the degree of edema inhibition based on the arachidonic acid treatment group. Anti-inflammatory effect was calculated by the formula 1, the results are shown in Table 1.
(계산식 1) (Calculation 1)
억제율(%) = (A―B) / A x 100% Inhibition = (A-B) / A x 100
A: 대조군 귀의 평균두께(아라키돈산 처리 귀의 두께-비처리 귀의 두께)A: Average thickness of control ears (thickness of arachidonic acid-treated ears-thickness of untreated ears)
B: 시료 도포군 귀의두께(시료처리 귀의 두께-비처리 귀의 두께)B: Thickness of sample-coated group ears (thickness of sample-treated ears-thickness of untreated ears)
(표 1) Table 1
표 1에 나타낸 바와 같이, 실시예 1 내지 18의 올리고뉴클레오타이드는 0.01 % 농도에서 21 내지 35 %의 항염 효과를 나타내었으며, 각 실시예에 따라 큰 효과 차이는 없는 것으로 확인되었다. As shown in Table 1, the oligonucleotides of Examples 1 to 18 exhibited an anti-inflammatory effect of 21 to 35% at a concentration of 0.01%, and it was confirmed that there was no significant difference between the examples.
실험예 2: 올리고뉴클레오타이드간의 혼합 사용시 항염증 효과 검증 Experimental Example 2: Validation of anti-inflammatory effect when using mixed oligonucleotides
실시예 1 내지 9의 올리고뉴클레오타이드와, 실시예 10 내지 18의 올리고뉴클레오타이드를 각각 동일 농도비로 혼합하여 실험예 1과 동일한 방법으로 실험을 실시하였다. 그 결과는 하기 표 2에 나타낸다.The oligonucleotides of Examples 1 to 9 and the oligonucleotides of Examples 10 to 18 were mixed at the same concentration ratios, and the experiment was conducted in the same manner as in Experimental Example 1. The results are shown in Table 2 below.
(표 2)Table 2
표 2에서, 실시예 1 내지 9와 실시예 10 내지 18를 혼합 사용하는 경우, 항염증 효과가 현저히 증가함을 확인할 수 있다. In Table 2, it can be seen that when using a mixture of Examples 1 to 9 and Examples 10 to 18, the anti-inflammatory effect is significantly increased.
실시예 19: 피부 외용 연고 제조Example 19 Preparation of Skin Ointment
하기 표 3의 조성(단위: 중량%)로 피부 외용 연고를 제조하였다.To the skin ointment was prepared in the composition of Table 3 (unit: wt%).
(표 3)Table 3
실시예 20: 화장료(크림) 제조Example 20 Preparation of Cosmetics (Cream)
하기 표 4의 조성(단위: 중량%)으로 크림을 제조하였다.To prepare a cream in the composition of Table 4 (unit: wt%).
(표 4)Table 4
실시예 21: 화장료(유연화장수) 제조Example 21 Preparation of Cosmetic (Flexible Cosmetic)
하기 표 5의 조성(단위: 중량%)로 유연화장수를 제조하였다.To the flexible composition was prepared in the composition of Table 5 (unit: wt%).
(표 5) Table 5
실시예 22: 화장료(에센스) 제조Example 22 Preparation of Cosmetic (Essence)
하기 표 6의 조성(단위: 중량%)으로 에센스를 제조하였다. To the essence was prepared in the composition (unit: wt%) of Table 6.
(표 6)Table 6
실시예 23: 화장료(팩) 제조Example 23 Preparation of Cosmetics (Packs)
하기 표 7의 조성(단위: 중량%)으로 팩을 제조하였다.To prepare a pack in the composition of Table 7 (unit: wt%).
(표 7)Table 7
실시예 24: 화장료(영양화장수) 제조Example 24 Preparation of Cosmetics (Nutrition Makeover)
하기 표 8의 조성(단위: 중량%)으로 영양화장수를 제조하였다.To nutrient cosmetics was prepared in the composition of Table 8 (unit: wt%).
(표 8)Table 8
비교예 1 내지 6Comparative Examples 1 to 6
하기 표 9 내지 14의 조성(단위: 중량%)으로 피부 외용 연고, 크림, 유연화장수, 에센스, 팩, 영양화장수를 각각 제조하였다.To the composition (unit: wt%) of the following Tables 9 to 14 skin ointments, creams, soft cosmetics, essences, packs, nutrient cosmetics, respectively.
(표 9)Table 9
(표 10) Table 10
(표 11) Table 11
(표 12)Table 12
(표 13)Table 13
(표 14) Table 14
실험예 3: 피부 노화 방지 효과 검증 Experimental Example 3: verification of skin anti-aging effect
실시예 22, 실시예 24, 비교예 22 및 비교예 24에 대한 피부 노화 방지 효과를 피부미세결 개선효과로 확인하였다. The skin anti-aging effect of Example 22, Example 24, Comparative Example 22 and Comparative Example 24 was confirmed as an improvement in skin fineness.
35세에서 50세의 건강한 남녀 20명을 피시험자로 하였다. 피시험자의 하박부에 가로, 세로 2센티미터의 구역 4개를 정하여 각각의 비교예와 실시예를 4주간 매일 하루 2회씩 바른 피부미세결의 변화를 평가하였다. 피부미세결 평가는 비교예의 경우와 비교하여 개선없음, 약간의 개선, 상당한 개선의 3단계로 평가하였으며, 하기 표 15에 나타내었다.Twenty healthy men and women aged 35 to 50 years were enrolled. Four sections of 2 centimeters in length and 2 inches were defined in the lower part of the subject, and the changes of skin fineness applied to each Comparative Example and Example twice a day for 4 weeks were evaluated. The skin fineness evaluation was evaluated in three stages of no improvement, slight improvement, and significant improvement as compared with that of the comparative example, and is shown in Table 15 below.
(표 15) Table 15
표 15에 나타낸 바와 같이, 육안평가시 본 발명의 실시예 22 및 24는 비교예 4 및 6에 비하여 피시험자 20명중 최소 16명 이상에 대하여 피부 미세결 개선효과를 나타내었다. 또한 상기 임상 실험시 피부에서 어떠한 부작용도 나타나지 않 아, 본 발명의 올리고뉴클레오타이드가 매우 안전함을 알 수 있었다.As shown in Table 15, in the visual evaluation, Examples 22 and 24 of the present invention showed an effect of improving skin micrograins in at least 16 or more of 20 subjects compared to Comparative Examples 4 and 6. In addition, the clinical trial did not show any side effects in the skin, it was found that the oligonucleotide of the present invention is very safe.
이상 살펴본 바와 같이, 본 발명의 COX-2 유전자의 mRNA와 ICAM-1유전자의 mRNA에 대한 안티센스 올리고뉴클레오타이드는 염증 발생을 저해하여 염증으로 인한 피부 노화를 억제하고, 피부미세결을 개선시키는 효과를 제공한다.As described above, the antisense oligonucleotides for the mRNA of the COX-2 gene and the mRNA of the ICAM-1 gene of the present invention inhibit inflammation and inhibit skin aging due to inflammation, and provide an effect of improving skin fineness. do.
<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> WRINKLE DECLINE AGENT CONTAINING OLIGONUCLEOTIDE <130> dpp20044844 <160> 18 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 1 tgcttgaccc tcagagacct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 2 ctgcttgacc ctcagagacc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 3 ttttcaactt gcctcccatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 4 caccttcagg gtttcagcat 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 5 cagggtttca gcatctggtt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 6 ctggttgaaa agcatgagca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 7 gagcatcccc tccaatacct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 8 ccgcaacacg atgtaagttg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 9 ggtacatcaa agccccgata 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 10 cgtttccatc tttgcagtca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 11 cagggtcatg ctctgtttca 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 12 gagggcatcg tcatagaagg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 13 tgaggaggtc cgagttcttg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 14 gggcatcgtc atagaaggtc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 15 cactgtctga ggctcctcct 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 16 gtgttctggc tgtgcagttc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 17 tgggttgaag ttgctgaggt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 18 cctgctcatc tgtcacgttc 20 <110> LG HOUSEHOLD & HEALTH CARE LTD. <120> WRINKLE DECLINE AGENT CONTAINING OLIGONUCLEOTIDE <130> dpp20044844 <160> 18 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 1 tgcttgaccc tcagagacct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 2 ctgcttgacc ctcagagacc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 3 ttttcaactt gcctcccatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 4 caccttcagg gtttcagcat 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 5 cagggtttca gcatctggtt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 6 ctggttgaaa agcatgagca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 7 gagcatcccc tccaatacct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 8 ccgcaacacg atgtaagttg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 9 ggtacatcaa agccccgata 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 10 cgtttccatc tttgcagtca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 11 cagggtcatg ctctgtttca 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 12 gagggcatcg tcatagaagg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 13 tgaggaggtc cgagttcttg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 14 gggcatcgtc atagaaggtc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 15 cactgtctga ggctcctcct 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 16 gtgttctggc tgtgcagttc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 17 tgggttgaag ttgctgaggt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense oilgonucleotide <400> 18 cctgctcatc tgtcacgttc 20
Claims (8)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020040104236A KR100789344B1 (en) | 2004-12-10 | 2004-12-10 | Agent for preventing skin aging containing oligonucleotide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020040104236A KR100789344B1 (en) | 2004-12-10 | 2004-12-10 | Agent for preventing skin aging containing oligonucleotide |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20060065814A true KR20060065814A (en) | 2006-06-14 |
KR100789344B1 KR100789344B1 (en) | 2007-12-28 |
Family
ID=37160836
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020040104236A KR100789344B1 (en) | 2004-12-10 | 2004-12-10 | Agent for preventing skin aging containing oligonucleotide |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100789344B1 (en) |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5912307A (en) * | 1996-05-03 | 1999-06-15 | Bp Amoco Corporation | Polyester compositions |
DE10214257A1 (en) | 2002-03-28 | 2003-10-16 | Merck Patent Gmbh | Use of compatible solutes to inhibit the release of ceramides |
-
2004
- 2004-12-10 KR KR1020040104236A patent/KR100789344B1/en active IP Right Grant
Also Published As
Publication number | Publication date |
---|---|
KR100789344B1 (en) | 2007-12-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP4603192B2 (en) | Hair scalp composition | |
US20060013845A1 (en) | Oxygenated personal care products | |
JP2006514657A (en) | Compositions and delivery methods for the treatment of wrinkles, fine lines and hyperhidrosis | |
TWI682782B (en) | Methods and compositions for topical delivery for skin care | |
US20140106009A1 (en) | Methods and compositions for maintaining and improving the health of skin | |
AU2010248292B2 (en) | Composition for preventing hair loss or for stimulating hair growth | |
US20080161229A1 (en) | Compounding ingredients for basic cosmetics and basic cosmetics | |
KR101229927B1 (en) | Skin Whitening Composition Using a Litter Extract or a Silk Worm Extract | |
KR20160131387A (en) | Composition for skin care | |
KR20090130584A (en) | Cosmetic composition comprising an extract of mixed herbs having skin whitening and wrinkle improving activity | |
JP2010006844A (en) | Secretagogue for insulin-like growth factor-1 | |
KR20170001649A (en) | Composition comprising herbal extract for improving skin wrinkle and moisturizing | |
KR20070000675A (en) | Composition containing mung bean extract, bletillae tuber extract and black cohosh extract and use thereof | |
JP2009114170A (en) | Hair restorer | |
JPH03112912A (en) | Cosmetic composition | |
KR100789344B1 (en) | Agent for preventing skin aging containing oligonucleotide | |
CN115867321A (en) | Deoxycholic acid-peptide conjugates with anti-obesity activity and uses thereof | |
KR100753473B1 (en) | Wrinkle decline agent containing oligonucleotide | |
KR102014102B1 (en) | Composition for Improving Skin Beauty Comprising Mesquite Honey | |
CN110547975B (en) | Cosmetic material composition containing epipinoresinol | |
KR101661694B1 (en) | Low irritating composition for skin whitening comprising hydroquinone | |
KR102670049B1 (en) | Cosmetic composition for exfoliating and pad having the same | |
KR102233916B1 (en) | Composition for Skin Moisturizing, Improving Skin Wrinkle and Elasticity comprising PQ1 Succinic Acid | |
US20230270640A1 (en) | Brightening cosmetic composition comprising sodium pyruvate as active ingredient | |
JP3526806B2 (en) | Cosmetics |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20120914 Year of fee payment: 6 |
|
FPAY | Annual fee payment |
Payment date: 20130913 Year of fee payment: 7 |
|
FPAY | Annual fee payment |
Payment date: 20140917 Year of fee payment: 8 |
|
FPAY | Annual fee payment |
Payment date: 20150917 Year of fee payment: 9 |
|
FPAY | Annual fee payment |
Payment date: 20160919 Year of fee payment: 10 |
|
FPAY | Annual fee payment |
Payment date: 20170928 Year of fee payment: 11 |
|
FPAY | Annual fee payment |
Payment date: 20180927 Year of fee payment: 12 |
|
FPAY | Annual fee payment |
Payment date: 20191014 Year of fee payment: 13 |