KR20050090237A - Genetic marker of single nucleotide polymorphism for supernodulating mutants - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphic genetic marker for a root nodule phenotype, a method for identifying a root nodule forming variant using the same, and a kit for implementing the same. According to the present invention, it is possible to rapidly screen superroot nodule forming variants in the early growth stages of plants without phenotypic determination and inoculation of root nodule formation requiring complex data collection. The markers of the present invention make it possible to provide faster, more reproducible and inexpensive genotyping methods than other genotyping methods.

Description

Genetic Marker of Single Nucleotide Polymorphism for Supernodulating Mutants

The present invention relates to a single nucleotide polymorphic genetic marker for a root nodule phenotype, a method for identifying a root nodule forming variant using the same, and a kit for implementing the same.

Root nodulation in soybeans is a major source of nitrogen supply in underground ecosystems. Nodules formation at the roots is Rhizobium It is triggered by the invasion of bacteria and controlled by the internal or external factors of the host. Certain mechanisms in a continuous process, collectively referred to as self-regulation, are known to systemically control the degree of root nodules formation (Carroll et al., 1985; Pierce & Bauer, 1983).

To date, in order to elucidate the genetic regulation of root nodule formation, chemical mutagenesis using ethylmethane sulfonate (EMS) (Carroll et al., 1985a; Carroll et al, 1985b; Akao & Kouchi, 1992) and fast neutron variations Through production (Men et al., 2002), several variants with poor self-regulation in soybeans have been identified. Lee et al. (1997) isolated a supernodulating variant SS2-2 from the M ₂ family of Mutaldalkong 2 mutant-induced Singpaldalkong 2 using 30 mM EMS. Root nodule formation was not inhibited (Lee et al., 1997; Lee et al., 1998). Hybridization between SS2-2 and nitrate-resistant symbiotic ( nts ) variants (Carroll et al., 1985a; Carroll et al, 1985b) and the genetic mapping in cluster separation for chondrocyte formation is in SS2-2 It has been shown that the hypernodulation characteristics are regulated by the same locus that regulates the formation of hyperroot nodules in nts variants (Ha and Lee, 2001).

The locus formation locus is 18.9 cM away from Satt353 in LG H (Ha and Lee, 2001) and is near the RFLP marker pUTG-132, which is closely linked to the nts gene (Landau-Ellis et al., 1991, Kolchinsky et. al., 1997). Recently, UQC-IS1 at the side markers pUTG-132 and LG H has been used to isolate genes associated with ultra- / daspock formation in nts variants (Searle et al., 2003). Point mutations in the nodule autoregulation receptor-like protein kinase precursor ( NARK ) genes in the nts1116 and nts382 variants have been shown to result in ultra- / daroot homing phenotypes (Searle et al. , 2003). Thus, it was suggested that chondroitin formation in SS2-2 would be regulated by the same NARK locus of soybeans (Ha and Lee, 2001).

Single nucleotide polymorphisms (SNPs) have recently been actively developed as markers. SNPs are the most mutant of the human genome, and are believed to exist at one SNP ratio per 1.9 kb (Sachidanandam et al., 2001). SNPs are very stable genetic markers, sometimes directly affecting the phenotype, and are well suited for automated genotyping systems (Landegren et al., 1998; Isaksson et al., 2000). However, in plants, studies have been conducted on SNPs in several species, such as Arabidopsis , barley, corn and potatoes (Cho et al., 1999; Kanazin et al., 2002; Rickert et al., 2002; Tenaillon et al., 2001), there is no active study of SNPs. Recently, a total of 280 SNPs have been found in 76 kb sequences from 25 different soybean genotypes (Zhu et al., 2003).

Throughout this specification, numerous papers and patent documents are referenced and their citations are indicated in parentheses. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

The present inventors have made intensive research to develop a method for detecting genes at the earliest stages of development in the early stages of development. As a result, we have found that there is a single nucleotide polymorphism (SNP) for the genes of the superroots. In the case of using this SNP, the present invention was completed by confirming that the super-root root hog formation variant can be easily identified.

Accordingly, it is an object of the present invention to provide an SNP for ultra-root root formation.

Another object of the present invention is to provide a method for identifying a superfamily root forming variant using SNPs for superfamily root forming.

It is another object of the present invention to provide a kit for identifying a supernatant-forming variant.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to an aspect of the present invention, the present invention comprises 10-100 consecutive nucleotide residues including the 959th nucleotide in SEQ ID NO. And in the supernodulating variant, the w of the 959th nucleotide is T. to provide.

The present inventors conducted an in-depth study to develop a method for easily identifying a superroot root hog forming variant at the gene level, and as a result, the gene for transducing the super root root hog forming variant in the GmNARK (Glycine max nodule autoregulation receptor-like protein kinase) gene A single nucleotide polymorphism (SNP) phenomenon was identified that distinguishes it at the level.

SNPs of the present invention are applied to root-knot forming plants, most preferably to soybean ( Glycine max ).

According to the SNP of the present invention, the plant having the normal root-knot forming property is "A" in the GmNARK nucleotide sequence of the SEQ ID NO: 1 sequence is "A", and in the ultra- root root- knocking variant is "T". These SNPs change the lysine (AAG) coding sequence to a stop codon (TAG), resulting in premature termination of the translation.

As used herein, the term "plants having normal root nodule formation characteristics" refers to soybeans having a root nodule formation degree of soybeans that are generally grown. It means a variant forming the root knots above.

As used herein, the term “nucleotide” is a deoxyribonucleotide or ribonucleotide that exists in single- or double-stranded form and includes analogs of natural nucleotides unless otherwise specified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990).

On the other hand, the present invention, as described above, relates to an allele for a super-rooted hog forming variant in which the 959th nucleotide of the GmNARK nucleotide sequence of SEQ ID NO: 1 sequence is "T", but such allele nucleotide is a double-stranded gDNA ( genomic DNA), is also interpreted to include nucleotide sequences complementary to the nucleotide sequences described above. That is, "T", which is an SNP representing a superroot nodule forming variant in the complementary nucleotide sequence, becomes "A".

In this aspect, all sequences herein are based on sequences in the sense strand in gDNA, unless otherwise noted.

According to another aspect of the invention, the present invention comprises the steps of (a) separating the nucleic acid molecule from the root-knot forming plant; And (b) identifying in the isolated nucleic acid molecule the presence or absence of a superroot root formation-related single nucleotide polymorphism (SNP) base "T" corresponding to the 959th nucleotide in SEQ ID NO: 1, wherein the SNP When the position is "T", it provides a method for identifying a superficial root-knot forming variant in a root-knot forming plant, characterized in that it is determined as a superroot root-knot forming variant.

As used herein, the term “nucleic acid molecule” is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides, which are the basic structural units in nucleic acid molecules, modify not only natural nucleotides, but also sugar or base sites. Analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990)).

In the method of the invention, the nucleic acid molecule can be obtained from various organs of the plant, for example from leaves, roots, stems and seeds, most preferably from leaves. Plants as sources of nucleic acid molecules can be used as sources for whatever is in any stage of development. On the other hand, the method of the present invention can obtain a nucleic acid molecule from a plant in the early development stage, and can initially determine whether the plant has a superficial root-forming trait.

If the starting material in the process of the invention is gDNA, isolation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)).

If the starting material is mRNA, total RNA is isolated and carried out by conventional methods known in the art. See Sambrook, J. et al., Molecular Cloning. A Laboratory Manual , 3rd ed. Cold Spring Harbor Press ( 2001); Tesniere, C. et al., Plant Mol. Biol. Rep. , 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology , John Willey & Sons (1987); and Chomczynski, P. et al., Anal.Biochem. 162: 156 (1987)). The isolated total RNA is synthesized into cDNA using reverse transcriptase. Since the total RNA is isolated from plant cells, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using oligo dT primer and reverse transcriptase using this sequence characteristic (see PNAS). USA , 85: 8998 (1988); Libert F, et al., Science , 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning.A Laboratory Manual , 3rd ed.Cold Spring Harbor Press (2001) )).

In the method of the present invention, step (b) may be carried out by applying various methods known in the art used to identify specific sequences. For example, techniques applicable to the present invention include fluorescence phosphorylation hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single-strand conformation analysis (SSCA, Orita et al., PNAS, USA 86: 2776 (1989)), RNase protection assay (Finkelstein et al., Genomics , 7: 167 (1990)), dot blot analysis, denaturation gradient gel electrophoresis (DGGE, Wartell et al., Nucl. Acids Res. 18: 2699 (1990)), methods using proteins that recognize nucleotide mismatches (e.g., mutS proteins of E. coli ) (Modrich, Ann. Rev. Genet. , 25: 229-253 (1991)), and Allele-specific PCR, including but not limited to.

Sequence changes result in differences in base bonds within single-stranded molecules, resulting in different bands of mobility, which SSCA detects. DGGE analysis uses denaturation gradient gels to detect sequences that exhibit mobility different from wild-type sequences.

Other techniques generally employ probes or primers that are complementary to sequences comprising the SNPs of the invention.

For example, in RNase protection assays riboprobes complementary to the sequences comprising the SNPs of the invention are used. DNA or mRNA isolated from the riboprobe and the plant are hybridized and then cleaved with an RNase A enzyme capable of detecting mismatches. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In assays using hybridization signals, probes complementary to the sequences comprising the SNPs of the invention are used. In this technique, hybridization signals of probes and target sequences are detected to directly determine whether or not a superroot root formation variant is present.

As used herein, the term “probe” refers to a linear oligomer having naturally occurring or modified monomers or bonds, including deoxyribonucleotides and ribonucleotides that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably deoxyribonucleotide.

As the probe used in the present invention, a sequence perfectly complementary to the sequence including the SNP may be used, but a sequence complementarily complementary to a range that does not prevent specific hybridization may be used. It may be. Preferably, the probe used in the present invention comprises a sequence capable of hybridizing to a sequence comprising 10-30 contiguous nucleotide residues comprising the 959th nucleotide in the sequence 1st sequence. More preferably, the 3'-end or 5'-end of the probe has a base complementary to the SNP base. In general, since the stability of duplexes formed by hybridization tends to be determined by the consensus of the sequences of the ends, the ends in probes having bases complementary to the SNP base at the 3'- or 5'-ends If the parts are not hybridized, these duplexes can be dismantled under stringent conditions.

Conditions suitable for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach , Decisions may be made with reference to those disclosed in IRL Press, Washington, DC (1985). Stringent conditions used for hybridization can be determined by adjusting the temperature, ionic strength (buffer concentration), the presence of compounds such as organic solvents, and the like. Such stringent conditions can be determined differently depending on the sequence being hybridized.

Most preferably, step (b) of the method of the invention is carried out by an allele-specific gene amplification method. As such, when the SNP of the present invention is applied to a gene amplification method, it is particularly referred to as single nucleotide amplified polymophism (SNAP).

This gene amplification basically uses primer pairs designed to amplify polynucleotides comprising the 959th nucleotide of SEQ ID NO: 1. Amplification techniques that can be used in the methods of the invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reactions (LCR, Wu, DY) et al., Genomics 4: 560 (1989)), polymerase ligase chain reaction (Barany, PCR Methods and Applic. , 1: 5-16 (1991)), Gap-LCR (WO 90/01069), repair chain Reactions (EP 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably according to the PCR amplification step.

If amplification techniques are applied, the design of the primer is important. Preferably, the forward primers among the primer pairs comprise a nucleotide sequence capable of annealing with a sequence adjacent to a superroot root formation-related mononucleotide polymorphism (SNP) base corresponding to the 959th nucleotide in SEQ ID NO: 1; The 3′-end of the aromatic primer has a base complementary to the SNP base. More preferably, the 3'-terminus of the forward primer has a base complementary to the SNP base, and the immediately adjacent sequence has a non-complementary base that does not match the target sequence. Referring to Table 2 showing an embodiment of the primers of the present invention, the 3'-terminus of the T allele-specific omnidirectional primer has the sequence "TT", where the T at the most terminal portion is the "T" SNP. Matches, but the "T" next to it is a mismatch to the target sequence. This primer design strategy inserts another mismatched nucleotide because one nucleotide alone makes allele specific genotyping PCR difficult.

According to the method of the present invention, a primer used for screening superroot root formation variants and having a "T" at the 3'-end is called a T-allelic (or specific) primer, and screens for plants having normal root nodal properties. Primers having an "A" at the 3'-end are referred to as A-allele (or specific) primers. However, based on the antisense strands, primers with "A" at the 3'-end are used to screen for supernatant-forming variants, while primers with "T" at the 3'-end have normal root-knock characteristics. It is used to screen plants.

The method of the present invention can be roughly classified into a case of amplifying a sequence located downstream and an amplification of a sequence located upstream based on the 959th nucleotide of the first sequence listing the SNP.

First, when amplifying a sequence located downstream of the 959th nucleotide of the sequence listing first sequence, preferably, the forward primer used has a "T" base at the 3'-end, and the rest of the sequence listing And a sequence substantially corresponding to the sequence located upstream of the 959th nucleotide in the first sequence.

As used herein, the term "substantially corresponding sequence" as used in connection with a primer sequence is intended to partially match the sequence to be compared, as well as the sequence of an exact match, as well as within the scope of annealing to a specific sequence to serve as a primer. Mismatched sequences are also included.

Such omnidirectional primers are represented by the following general formula (I):

X _p -dT (I)

Wherein X is a sequence substantially corresponding to a contiguous nucleotide sequence adjacent upstream of the 959th nucleotide of SEQ ID NO: 1, and p is an integer from 8-30.

According to a more preferred embodiment of the present invention, the omnidirectional primer used in the present invention is represented by the following general formula II:

X _p -Y _q -dT (Ⅱ)

Wherein X is a sequence substantially corresponding to a contiguous nucleotide sequence adjacent upstream of the 959th nucleotide of SEQ ID NO: 1, and Y is directly adjacent to the 5'-direction of the 959th nucleotide of SEQ ID NO: 1 A sequence different from nucleotides, p is an integer from 8-30, q is an integer from 1-2.

In the general formula, p is preferably 15-25, and q is preferably 1.

In this case, the reverse primer is paired with the above-described forward primer to amplify about 50-1000 bp, preferably 50-500 bp, more preferably 80-400 bp, most preferably about 200-400 bp A primer capable of hybridizing to the complementary sequence of SEQ ID NO: 1 sequence to form an amplification of.

Table 2 of the following examples describes specific examples of primer sequences that can be used in the present invention. The first primer pair of the T-specific primer pairs in Table 2 is used to amplify a sequence located downstream of the 959th nucleotide of the first sequence of SEQ ID NO.

Secondly, when amplifying a sequence located upstream of the 959th nucleotide of SEQ ID NO: 1, the reverse primer used preferably has an "A" base at the 3'-end, and the rest of the sequence is Have a sequence substantially complementary to a sequence located downstream of the 959th nucleotide in the first sequence.

As used herein, the term "substantially complementary sequence" as used in connection with a primer sequence is not only a completely complementary sequence, but also a part of the sequence to be compared, within a range that can serve as a primer by annealing to a specific sequence. It is meant to include sequences that are not complementary.

This reverse primer is represented by the following general formula I ':

X ' _p -dT (I ')

Wherein X 'is a sequence that is substantially complementary to consecutive nucleotide sequences adjacent to downstream of the 959th nucleotide of SEQ ID NO: 1, and p is an integer from 8-30.

According to a more preferred embodiment of the present invention, the reverse primer used in the present invention is represented by the following general formula II ':

X ' _p -Y' _q -dT (II ')

Wherein X is a sequence that is substantially complementary to a contiguous nucleotide sequence adjacent to the downstream of the 959th nucleotide of SEQ ID NO: 1, and Y 'is to the 3'-direction of the 959th nucleotide of the SEQ ID NO. A sequence different from the complementary sequence of the immediately adjacent nucleotide, p is an integer from 8-30, q is an integer from 1-2.

In the general formula, p is preferably 15-25, and q is preferably 1.

In this case, the forward primer is paired with the reverse primer described above to amplify about 50-1000 bp, preferably 50-500 bp, more preferably 80-400 bp, most preferably about 200-400 bp A primer capable of hybridizing to the complementary sequence of SEQ ID NO: 1 sequence to form an amplification of.

Table 2 of the following examples describes specific examples of primer sequences that can be used in the present invention. The second primer pair of the T-specific primer pairs in Table 2 is used to amplify a sequence located upstream of the 959th nucleotide of the first sequence of SEQ ID NO.

The conditions of the PCR method and the reagents and enzymes used may be those commonly known in the art. On the other hand, according to a preferred embodiment of the present invention, the annealing step in the PCR step is preferably performed at a temperature higher than the general temperature, preferably 55-68 ℃, more preferably 60-654 ℃, most preferably Annealed at about 62-65 ° C. to perform allele-specific PCR.

On the other hand, products amplified by allele-specific PCR are identified by conventional electrophoretic methods such as agarose-gel electrophoresis. In other words, the PCR amplification reaction is loaded on the agarose-gel, and the presence of a band is observed to determine whether it is a superroot or a variant.

When carrying out the method of the invention according to alleles-particularly PCR, the method of the invention preferably comprises the following steps;

(Iii) isolating nucleic acid molecules from root gall forming plants;

(Ii) performing PCR using the forward primer represented by Formula I or II or the reverse primer represented by Formula I 'or II'; And

(Iii) electrophoresis of the PCR reaction product.

According to another aspect of the present invention, the present invention is capable of annealing polynucleotides of SEQ ID NO: 1 sequence, and a primer pair designed to amplify a polynucleotide comprising the 959th nucleotide of SEQ ID NO: 1 sequence Kit for identifying a supernatant-forming variant comprising.

Preferably, the forward primer among the primer pairs includes a nucleotide sequence capable of annealing with a sequence adjacent to a superroot root formation-related mononucleotide polymorphism (SNP) base corresponding to the 959th nucleotide in the sequence listing first sequence, The 3′-end of the omni primer has a base complementary to the SNP base.

Since the kit of the present invention is an essential component of the above-described primer, the detailed description of the primer also applies to the primer used in the kit of the present invention. Therefore, the description is omitted to avoid excessive complexity of the present specification in accordance with the repeated description.

When the kit of the present invention is subjected to a PCR amplification process, the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as buffers, DNA polymerases (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus ). filiformis , Thermis flavus , Thermococcus literalis or thermally stable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. Kits of the invention can be prepared in a number of separate packaging or compartments containing the reagent components described above.

According to the present invention, it is possible to rapidly screen superficial root formation variants in the early growth stages of plants without the phenotyping and inoculation process of root gall formation requiring complex data collection. The markers of the present invention make it possible to provide faster, more reproducible and inexpensive genotyping methods than other genotyping methods.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Experimental Materials and Methods

Plant material

Two different soybean genotypes, Shinpaldang No. 2, with its normal root nodule formation properties and its superroot nodule variant variant SS2-2, were used to identify SNPs in the Glycine max nodule autoregulation receptor-like protein kinase ( GmNARK ) gene. For the development and assessment of SNAP marker for GmNARK, by hybridization with sinpal dalkong No.2 SS2-2 to obtain the F ₂ progeny of 40 seeds. In addition, six normally-rooted gall-forming cultivars and two ultra- / daproot-formed variants were used (Table 1).

Root-knot Formation Phenotype in Soybean Cultivated in Experiments type Root Nox Formation Characteristics Cultivated species Wild type normal New soybeans 2, protein beans, Taekwang beans, green beans, genuine beans 2, PI 96188, long bean Variant Root formation SS2-2, nts382 Root formation nts1116

Sequencing and SNP Discovery and Identification

Genome DNA was isolated from healthy leaves according to the method disclosed in Rogers & Bendich (1994). DNA concentration was measured using a fluorescence spectrophotometer according to the pest die-based protocol (Model F-4500, Hitachi Ltd., Ibaragi, Japan). DNA solution was diluted to experimental concentration with Tris-EDTA buffer (pH 8.0) and stored at -20 ° C until use.

In order to obtain the corresponding PCR product of the gene GmNARK, NCBI (National Center for Biotechnology Information ) database (http:. //Www.ncbi.nlm nih.gov/) GmNARK gene sequences available from (GenBank Acc No. AY166655. Primers were prepared based on Primer sequences were analyzed and selected using Gene Runner V. 3.05 (Hastings software Inc., Hastings on Hudson, NY, USA). The amplification conditions were optimized to get a single amplicon of the expected length as possible. Amplification reactions were 50 ng of genome DNA, 3.2 pmol each of forward and reverse primers, 200 μM of each dNTP, 1.5 mM MgCl ₂ , 1 × reaction buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl) and AmpliTaq Gold DNA polymerization Enzyme (Applied Biosystems, Foster City, Calif., USA) 1 U, total 50 μl. The reaction mixture was denatured at 94 ° C. for 4 minutes and then amplified a total of 30 cycles at 94 ° C. 30 seconds, 50-65 ° C. 30 seconds annealing and 72 ° C. 1 minute. PCR products were electrophoresed on 1.0% ethinium bromide-stained agarose gel.

PCR products amplified into single fragments were used as templates in sequencing. Purify the PCR reaction with NucleoSpin Extract kit (MACHEREY-NAGEL Inc., Easton City, PA, USA), perform sequencing reaction with BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and then ABI PRISM The sequence was finally determined by 3700 DNA sequencer. In order to identify SNPs in the GmNARK gene between Sinpallude No. 2 and SS2-2, the sequences were aligned using Seqscape software V. 1.1 (Applied Biosystems, Foster City, CA, USA).

Primer design and SNAP-PCR

To obtain primers specific for the identified SNPs, a portion of the GmNARK sequence containing the SNP positions was entered into the web-accessed SNAPER program (http://ausubellab.m.harvard.edu/). A total of five primer pairs for SNPs were tested using standard PCR amplification (see Table 2). PCR was performed using 100-100 ng of template DNA, 5 μM each of forward and reverse primers, 100 μM of each dNTP, 1.5 mM MgCl ₂ , 1 × reaction buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl) and Taq DNA polymerization. A total of 20 μl of reaction containing 1 U of enzyme (AmpliTaq Gold polymerase, Applied Biosystems, Foster City, Calif., USA) was used. Template DNA was first denatured at 94 ° C. for 5 minutes using a programmable heat controller (DNA Engine Tetrad, MJ Research, Watertown, MA, USA), followed by 28 or 38 cycles of PCR amplification under the following conditions: 94 30 ° C. denaturation, 64 ° C. 1 min annealing and denaturation, then 72 ° C. 10 min final extension reaction. Amplification products were separated on 1.5% agarose gels and analyzed for each allele at the SNP position with or without bands.

Experiment result

GmNARK SNP Identification at

Several primer pairs designed from the GmNARK gene sequence were used to identify SNPs between Singal Pall No. 2 and SS2-2. Of these primer pairs, only one primer pair produced an amplicon with sequence variation. The sequence of primer pairs forming the amplicon is as follows: Forward primer: GACATGAGAAGCTGTGTGTGCTAC, Reverse primer: TCCAAGCTCTTAAACTCCGAG. An A / T SNP was found at position 959 of the GmNARK gene sequence (see SEQ ID NO: 1). The single base change from A to T in the exon region was classified as a transversion of purine to pyrimidine among the four SNP types. Sequence variation in SS2-2 causes lysine (AAG) to change to stop codons (TAG), resulting in termination of the translation of the gene.

Development of SNAP Marker for Superficial Root Formation

For the A / T SNP of the present invention, the five primer pairs designed by the SNAPER program consist of three pairs for the A allele and two pairs for the T allele (see Table 2). One primer pair for the A allele was selected and the PCR specificity for each allele according to DNA concentration and amplification cycle was investigated. Higher template DNA concentrations and more cycles resulted in false positive results (see FIG. 2A). When 30 ng or less template DNA and 28 PCR cycles were used under 100 μM dNTP concentration, an amplification product was generated for the A allele and no amplification product was generated for the T allele. Of the five primer pairs, three primer pairs except the two primer pairs for the A allele showed reliable specificity for each allele (see; FIG. 2B and Table 2).

Sequences of primer pairs specific for A / T SNPs of the GmNARK gene used for SNAP-PCR and phenotypes of PCR products formed by each primer pair Allele Primer sequence PCR product size (bp) Phenotype A-specific F: CAACCTCACCGGCGTACTTCCGAR: CCTCAGCGTCTTCAACTTCGACAAACTC 343 Polymorphic F: AACAACCTCACCGGCGTACTTCCAAR: CCTCAGCGTCTTCAACTTCGACAAACTC 345 monotype F: AATCAGAGAGACATGAGAAGCTGTGTGTGCTAR: GTGAGGGCGGCGAGCTCCCT 374 monotype T-specific F: GAACAACCTCACCGGCGTACTTCCTTR: CCTCAGCGTCTTCAACTTCGACAAACTC 346 Polymorphic F: AATCAGAGAGACATGAGAAGCTGTGTGTGCTAR: GTGAGGGCGGCGAGCTCCAA 374 Polymorphic

SNAP Marker for Chopping Root Formation

To assess the usefulness of SNAP in marker-assisted selection (MAS) for chordal root formation, the phenotypic data of root nodule formation in the 40 F ₂ offspring of SS2-2 x Newcomal Pallets 2 were compared (see FIG. 3). ). In this colony, 28 and 12 offspring, respectively, were found to be normal and chondrocyte-forming offspring. Of 28 normal individuals, eight showed only a band specific for the A allele, indicating that the individual is homozygous. The remaining individuals with normal phenotypes were identified as heterozygotes for A / T SNPs because of the specific bands on both sides.

Twelve ultra-root root-forming individuals showed bands specific for the T allele. This allelic separation ratio of GmNARK is consistent with the 1: 2: 1 expected ratio of single recessive genes in the F ₂ community. Thus, the selective nucleotides at the SNAP markers and SNP positions of the present invention, co-separated from the GmNARK gene, identify the normal phenotype and the supersporidae formation phenotype, respectively.

SNAP markers for GmNARK were evaluated for eight soybean phenotypes (see Table 1), consisting of six normal, one ultraroot root formation, and one multiroot formation genotype. All genotypes showed the same band pattern as Sinpaldal No. 2 (see FIG. 4). The superroot root forming variant nts382 is known to have SNPs at other positions of the GmNARK gene. The results indicate that the SNAP markers of the present invention, unlike random PCR markers, do not have specificity for specific hybridization populations, and that individuals with superficial root formation properties can be selected without phenotypic analysis of roots.

As noted above, the present invention provides SNPs for ultraroot root formation. In addition, the present invention provides a method for identifying a superroot root formation variant using SNP for the super root root formation. On the other hand, the present invention provides a kit for identification of ultra-root root hog forming variants. According to the present invention, it is possible to rapidly screen superroot nodule forming variants in the early growth stages of plants without phenotypic determination and inoculation of root nodule formation requiring complex data collection. The markers of the present invention make it possible to provide faster, more reproducible and inexpensive genotyping methods than other genotyping methods.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Reference

A. Kolchinsky, D. Landau-Ellis, PM Gresshoff, 1997. Map order and linkage distances of molecular markers close to the supernodulation ( nts-1 ) locus of soybean. Mol. Gen. Genet. 254: 29-36.

S. Akao and H. Kouchi. 1992. A superndulating mutant isolated from soybean cultivar Enrei. Soil Sci. Plant Nutr. 38: 183-187.

BJ Carroll, DL McNeil and PM Gresshoff 1985a. Isolation and properties of soybean [ Glycine max (L) Merr.] Mutants that nodulate in the presence of high nitrate concentrations. Proc. Natl. Acad. Sci. USA 94: 773-781.

BJ Carroll, DL McNeil and PM Gresshoff. 1985b. A supernodulation and nitrate-tolerant symbiotic ( nts ) soybean mutant. Plant Physiol. 78: 34-40.

D. Landau-Ellis, S. Angermuller, R. Shoemaker, 1991.The genetic locus controlling supernodulation in soybean ( Glycine max L.) co-segregates tightly with a cloned molecular marker. Mol. Gen. Genet. 228: 221-226.

H.S. Lee, Y.A. Chae, E. H. Park, Y.W. Kim, K.I. Yun, S.H. Lee, Introduction, development, and characterization of supernodulating soybean mutant. I. Mutagenesis of soybean and selection of supernodulating mutant, Korean J. Crop. 42 (1997) 247-253.

H.S. Lee, Y.W. Kim, E. H. Park, Introduction, development, and characterization of supernodulating soybean mutant: Shoot factor regulation of nodule development in supernodulating soybean mutant, Korean J. Crop Sci. 43 (1998) 28-31.

I.R. Searle, A.E. Men, T.S. Laniya, D.M. Buzas, I. Iturbe-Ormaetxe, B.J. Carroll, P.E. Gresshoff. 2003. Long-distance signaling in nodulation directed by a CLAVATA1-like receptor kinase. Science 299: 109-112

Men AE, Laniya TS, Iturbe-Dramaetxe I., Gresshoff I., Jiang Q., Carroll BJ and Gresshoff PM 2002.Fast neutron mutagenesis of soybean ( Glycine soja L.) produces a supernodulating mutant containing a large deletion in linkage group H Genome Lett. 3: 147-155.

Pierce M. and Bauer W.D. 1983. A rapid regulatory response governing nodulation in soybean. Plant Physiol. 73: 286-290.

FIG. 1 is a sequence alignment of each PCR amplified fragment derived from Glycine max nodule autoregulation receptor-like protein kinase ( GmNARK ) genes of Sinpallon No. 2 and SS2-2. Primer sequences are described in italics and the SNP positions are shown in capital letters.

Figure 2a is a photograph showing the specificity of the SNAP primer pair of the present invention according to the template DNA concentration and the number of amplification cycles. Primer pairs specific for the A allele of GmNARK were used.

2B is a photograph showing the specificity of five primer pairs for each allele of GmNARK . Numerals 1 to 5 represent five primer pairs, SP denotes New Paldal Bean No. 2 and SS denotes SS2-2, respectively.

FIG. 3 is a photograph showing genotyping of SNAP markers for chondrocyte formation in the F ₂ progeny of SS2-2 × Singer Falcon No. _2. FIG. 40 lines were amplified using allele-specific primers for GmNARK , and the pattern of the bands was assessed as normal (N) and choda root hog (S). In each line, the left lane represents the amplification product obtained with the A-allele specific SNAP primer and the right lane represents the amplification product obtained with the T-allele specific SNAP primer. The lines representing the two bands for each allele show that they are heterozygotes.

Figure 4 is a photograph showing the amplification pattern of the SNAP marker for chodaroot in eight soybean genotypes. For each genotype, the left lane represents the amplification product obtained with the A-allele specific SNAP primer and the right lane represents the amplification product obtained with the T-allele specific SNAP primer. 1, protein beans; 2, Tae Kwang Bean; 3, green beans; 4, genuine beans; 5, PI 96188; 6, long beans; 7, nts382; 8, nts 1116.

<110> Seoul National University Industry Foundation Pulmuone.Co.Ltd <120> Genetic Marker of Single Nucleotide Polymorphism for Supernodulating Mutants <160> 1 <170> KopatentIn 1.71 <210> 1 <211> 4289 <212> DNA <213> Glycine max <220> <221> allele <222> (959) <400> 1 ttcatcatca aaccatttta gtaaagtgca tggacccaaa tttctacgat acatatttat 60 ttattaaaaa tgtaagaata tttcagtcat atttaaaaat atatatatca agaataatta 120 actttgtaca cacgcactga ataaaagatt tgtgacagac aaggcttgca taaaaatttc 180 tcctctaaac taattgcttg taggacctct cccaccacta tagaatcaat ataattaatc 240 cgcattagaa agttatattg tatacaattt tcttgaaaca taattatact tcatgtttca 300 cagacttata gtggatcttg tgtggctagc tactgacgaa tattgttttt tttttttttt 360 cctaagcatc cactttgaac aacttttccc atttcataca aacagaatta attagtattg 420 cgtgccacca tatggtacag tgttgtacat gcatataagc tatttaattt aataatatac 480 aaacataacg gtgtatataa atagaggcag catgtggtgt gtggtgtaaa aataaggacg 540 caggcaaatg tatgcatttg gcataagtat ataagagaga gggagtagta ctactgcaaa 600 gcaaaatcag agagacatga gaagctgtgt gtgctacacg ctattattgt ttattttctt 660 catatggctg cgcgtggcaa cgtgctcttc gttcactgac atggaatcgc ttctgaagct 720 gaaggactcc atgaaaggag ataaagccaa agacgacgct ctccatgact ggaagttttt 780 cccctcgctt tctgcacact gtttcttttc aggcgtaaaa tgcgaccgag aacttcgagt 840 cgttgctatc aacgtctcgt ttgttcctct cttcggtcac cttccgccgg agatcggaca 900 attggacaaa ctcgagaacc tcaccgtctc gcagaacaac ctcaccggcg tacttcccwa 960 ggagctcgcc gccctcactt ccctcaagca cctcaacatc tctcacaacg tcttctccgg 1020 ccatttcccc ggccaaatta tccttccgat gacgaaactg gaggtcctcg acgtctacga 1080 caacaacttc accggaccgc ttcccgtaga gttggtgaaa ctggagaaat taaaatacct 1140 gaagctcgac ggaaactatt tctccggcag cataccggag agttactcgg agtttaagag 1200 cttggagttt ttaagcttaa gcaccaatag cttatcgggg aagattccca agagtttgtc 1260 gaagttgaag acgctgaggt acctaaaact cggatacaac aacgcttacg aaggtggaat 1320 tccaccggag tttggcagca tgaaatctct gagatacctt gacctctcta gctgcaacct 1380 cagcggcgag attccaccga gccttgcaaa tctgacaaac cttgacacgt tgttcctgca 1440 aattaacaac ctcaccggaa ccattccgtc ggagctctcc gctatggtga gcctcatgtc 1500 acttgatctc tccatcaacg acctcaccgg tgagataccg atgagcttct cacagcttag 1560 aaacctcact ctcatgaact tcttccaaaa caatcttcgc ggctcagttc cgtccttcgt 1620 cggcgagctt ccgaatctgg aaacgctgca gctctgggat aacaacttct ccttcgtgct 1680 acctccgaac cttgggcaaa acggcaagtt aaagttcttc gacgtcatca agaatcactt 1740 caccgggttg atccctcgag atttgtgtaa aagtgggagg ttacaaacga tcatgatcac 1800 agataacttc ttccgcggtc caatccctaa cgagattggt aactgcaagt ctctcaccaa 1860 gatccgagcc tccaataact accttaacgg cgtggttccg tcagggattt tcaaactacc 1920 ttctgtcacg ataatcgagc tggccaataa ccgttttaac ggcgaactgc ctcctgagat 1980 ttccggcgaa tccctgggga ttctcactct ttccaacaac ttattcagtg ggaaaattcc 2040 cccagcgttg aagaacttga gggcactgca gactctctca cttgacgcaa acgagttcgt 2100 tggagaaata ccgggagagg tttttgacct accgatgctg actgtggtca acataagcgg 2160 caacaatcta accggaccaa tcccaacgac gttgactcgc tgcgtttcac tcaccgccgt 2220 ggacctcagc cggaacatgc ttgaagggaa gattccgaag ggaatcaaaa acctcacgga 2280 cttgagcatt ttcaatgtgt cgataaacca aatttcaggg ccagtccctg aggagattcg 2340 cttcatgttg agtctcacca cattggatct atccaacaac aatttcatcg gcaaggtccc 2400 aaccgggggt cagttcgcgg tcttcagcga gaaatccttt gcagggaacc ccaacctctg 2460 tacctcccac tcttgcccga attcctcgtt gtaccctgac gacgccttga agaagaggcg 2520 cggcccttgg agtttgaaat ccacgagggt gatagtcatc gtgattgcac tgggcacagc 2580 cgcgctgctg gtggcggtga cggtgtacat gatgaggagg aggaagatga accttgcgaa 2640 gacgtggaag ctgacggcgt tccagcggct gaacttcaaa gccgaggacg tggtggagtg 2700 tctgaaggag gagaacataa taggaaaagg aggggcaggg atcgtgtacc gcgggtccat 2760 gccaaacgga acagacgtgg cgataaagcg gttggttggg gcggggagtg gaaggaacga 2820 ttacggattc aaagcggaga tagaaacgct ggggaagata aggcacagga acataatgag 2880 gcttttaggt tacgtgtcga acaaggagac gaacttgctg ctgtatgagt acatgccaaa 2940 tgggagctta ggggaatggc tgcatggtgc caaaggaggg cacttgaagt gggaaatgag 3000 gtacaagatt gcggtggaag ctgctaaggg actgtgctat ttgcaccatg attgttcccc 3060 tcttatcatt cacagggatg tcaagtctaa taatatattg ctggatgggg acttggaggc 3120 ccatgttgct gattttggcc ttgccaagtt cttgtacgac cctggcgcct ctcagtccat 3180 gtcctccatt gctggctcct acggctacat tgctccaggt tccattcatt attattttct 3240 cttttccttc ttcataatat tcatatacca tgcagataac gtacaacatg catacttata 3300 catataattt tatcctttca acatataatc aaatatttca tatctaataa taccaacttc 3360 atattataaa catcacctaa tatagtcaat atgacttgat aaataagaca tataagttca 3420 atatttaaac tcgtgtctga aaaaacatta attggaaaag tcactcttaa aaatatttga 3480 taatatatca atatgaccat atgattccaa ttacgatcac aaactctgtt aaaaattctt 3540 gctgaagata ttagtccttg aatactaata taagaatatc ttgggttaga aaagttacta 3600 ttttactgtt aattcccgtt tactttagat gggttggaag ttgaaaagtt tagtgattta 3660 atttgtttct ggtggttgcg cagagtatgc atacactttg aaagtggacg agaaaagtga 3720 tgtgtacagc tttggcgttg tgctgctgga gctgataata gggaggaagc cagtgggaga 3780 gtttggagac ggggtggaca tcgttggatg ggtcaacaaa acgagattgg agctcgctca 3840 gccgtcggat gcagcgttgg tgttggcagt ggtggaccca aggttgagtg ggtatccatt 3900 gacaagtgtc atttacatgt tcaacatagc tatgatgtgt gttaaagaaa tggggcccgc 3960 taggcctacc atgagggaag tcgttcatat gctctcagag cctcctcact ctgctactca 4020 cactcacaac ctaattaatc tctagttaat taagttattt gctcatcgat ccagattcac 4080 ttcttttcaa aataaattaa cacagacgaa aactgtagga ataactttca tctgttgttt 4140 gtccgaagtg aaacaacgaa tcaaatgtga actatgtatc aaatgtaaga taggttttaa 4200 ttaattttgt aatattggtg tcaactgtca actgtcaagt aattcgaagg attttcccca 4260 atcgaattcc ccggccgcca tggcggccg 4289

Claims (11)

In plants having 10-100 nucleotide residues comprising the 959th nucleotide in SEQ ID NO. Wherein the w of the first nucleotide is T, the genetic marker or its complementary nucleotide sequence used to identify supernodulating variants in root-knot forming plants. The genetic marker of claim 1, wherein the root-knot forming plant is a soybean. (a) isolating nucleic acid molecules from root-knot forming plants; And (b) identifying in the isolated nucleic acid molecule the presence or absence of a superroot root formation-related single nucleotide polymorphism (SNP) base "T" corresponding to the 959th nucleotide in SEQ ID NO: 1, wherein the SNP If the position is "T", the method for identifying the supernatant forming plants in root-knot forming plants, characterized in that it is determined as a superroot root-knot forming variants: 4. The method of claim 3, wherein step (b) is performed by amplifying the isolated nucleic acid molecule using a primer pair designed to amplify a polynucleotide comprising the 959th nucleotide of SEQ ID NO: 1 sequence. Method for identifying the superficial root formation variant made with. The nucleotide of claim 4, wherein the forward or reverse primer of the pair of primers is capable of annealing with a sequence adjacent to a superroot root formation-related single nucleotide polymorphism (SNP) base corresponding to the 959th nucleotide in SEQ ID NO: 1. And a 3'-terminus of said forward or reverse primer has a base that matches said SNP base. 6. The method of claim 5, wherein the forward primer has a "T" base at the 3 '-terminal, and the remaining portion has a sequence substantially corresponding to the sequence located upstream of the 959th nucleotide in the sequence 1 st sequence A method for identifying a super-root root-hog variant. 6. The reverse primer of claim 5, wherein the reverse primer has a "A" base at the 3'-end, with the remainder having a sequence substantially complementary to a sequence located downstream of the 959th nucleotide in SEQ ID NO: 1 A method for identifying a super-root root-hog variant. Kit for the identification of ultra-root root hog forming variants comprising a primer pair designed to amplify a polynucleotide comprising the 959th nucleotide of SEQ ID NO: 1 sequence. 7. The nucleotide according to claim 6, wherein a forward or reverse primer in the pair of primers is capable of annealing with a sequence adjacent to a superroot root formation-related single nucleotide polymorphism (SNP) base corresponding to the 959th nucleotide in SEQ ID NO: 1. A kit comprising the sequence, wherein the 3'-terminus of the forward or reverse primer has a base that matches the SNP base. 10. The method of claim 9, wherein the forward primer has a "T" base at the 3 '-terminal, the remaining portion having a sequence substantially corresponding to the sequence located upstream of the 959th nucleotide in the sequence 1 st sequence Kit for identification of ultra-root root-knock forming variants, characterized in that. 10. The method of claim 9, wherein the reverse primer has a "A" base at the 3 '-terminal, the remaining portion having a sequence substantially complementary to the sequence located downstream of the 959th nucleotide in SEQ ID NO: 1 sequence Kit for identification of ultra-root root-knock forming variants, characterized in that.