KR20050085855A - Methods for predicting therapeutic response to agents acting on the growth hormone receptor - Google Patents

Abstract

Methods of producing a subject's response to an agent capable of binding to a growth hormone receptor (GHR) protein comprise determining in the subject the presence or absence of an allele of the (GHR) gene, wherein the allele is coordinated with the likelihood of having an increased or decreased positive response to the agent, thereby identifying the subject as having an increased or decreased likelihood of responding to treatment with the agent.

Description

METHODS FOR PREDICTING THERAPEUTIC RESPONSE TO AGENTS ACTING ON THE GROWTH HORMONE RECEPTOR}

The present invention relates to a method for predicting the intensity of a patient's therapeutic response to a drug acting on a growth hormone receptor. Preferred aspects of the present invention include methods of increasing kidneys in short-lived human patients and methods of treating obesity and terminal hypertrophy.

Most children who are severely short have no growth hormone deficiency (GHD), which is usually defined by the growth hormone (GH) response to inducible stimuli. Once the known cause of short stature is excluded, these patients are classified into various symptoms such as familial short stature, constitutional delay in growth, and "idiopathic" short stature (ISS). Children born smaller than parents of normal kidneys are called "intra uterine growth retardation" (IUGR). Children born smaller than their age are called "small for gestational age" (SGA). Although large, long-term studies have not been reported, some, perhaps many, of these children will not be able to reach genetic potential kidneys. Because there are so many factors affecting normal growth and development, patients with ISS, IUGR, and SGA symptoms, as defined, appear heterogeneous with respect to their short stature. Most children with ISS symptoms, even if not classified as GH deficiency, respond to treatment with GH, even if not fully equivalent enough.

Many researchers have studied the impairment of spontaneous GH secretion in this class of patients. One hypothesis suggests that some of these patients may lack internal GH under physiological conditions, but may show an increase in GH in response to drug stimulation, as in conventional GH stimulation tests. This disorder is called "GH neurosecretory abnormalities" and the diagnosis is based on the demonstration of abnormal circulating GH patterns on sustained serum sampling. Many researchers have reported these findings and found that these abnormalities appear only occasionally. Other researchers claim that these patients have "biologically inactive GH," but have not yet been conclusively proven.

Upon cloning of the GH receptor (GHR), the major GH binding activity in the blood was found to originate from the same genes as GHR and from proteins corresponding to the extracellular domain of full length GHR. Almost all patients with growth hormone insensitivity (or Laron) syndrome (GHIS) lack growth hormone receptor binding activity and are very low, without the activity of GH binding protein (GHBP) in the blood. These patients have an average kidney standard deviation score (SDS) of about -5 to -6, are resistant to GH treatment, and have increased serum GH concentrations and low serum insulin like growth factor (IGF-I) concentrations. They respond to treatment with IGF-I. In patients with defects in the extracellular domain of GHR, a lack of functional GHBP in the circulation can serve as a marker for GH insensitivity.

ISS patients treated with exogenous GH showed different degrees of response to treatment. In particular, many children respond somewhat to GH treatment but do not respond completely. These patients have an increase in growth rate of only about half of children who respond completely. Thus, the increased total height after the course of treatment of these children decreases as compared to the height of the fully responding children, depending on the duration of treatment. One way to improve the treatment of patients who do not respond completely is to increase the GH dose resulting in some improvement in growth rate and total height. However, increasing the GH dose is undesirable for all patients because of potential side effects. Increasing the GH dose also entails an increase in cost. Unfortunately, before long treatment and observation periods, there is currently no way to identify patients who appear to be less responsive.

Thus, there is a need in the art for methods that can be used to identify subpopulations of patients that exhibit reduced response rates to treatment with GH. There is also a need for a method that allows the development of improved drugs for the treatment of patients with reduced reactivity to exogenous GH. In addition, in the art, methods that can be used to identify subpopulations of patients with increased response rates to GH and to enable the development of improved drugs to treat patients with increased reactivity to GH Method is required.

Such patients include, for example, individuals who are short, or obese, infected or diabetic; Symptomatic or terminal hypertrophy, which may be associated with milk secretion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with sodium and water retention; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and individuals with high blood pressure.

Summary of the Invention

The present invention relates to the treatment of a human patient with a growth hormone receptor (GHR) allele (GHRd3) with an exon 3 deletion using a medicament that acts through the GHR pathway, compared to a patient without the GHRd3 allele. It is based on the finding that it shows a greater positive response. In particular, patients with the GHRd3 allele showed a greater positive response to treatment with recombinant growth hormone (GH) compared to patients without the GHRd3 allele. Through the course of treatment with recombinant GH, patients with ISS, IUGR or SGA symptoms and GHRd3 showed about a 2-fold increase in growth rate compared to ISS patients homozygous for the GHRfl allele. Their total height change increases in proportion to this effect.

GH activity is mediated by the GH receptor (GHR), as described above. Two molecules of GHR have been shown to interact with one molecule of GH [Cunningham et al. (1991) Science 254: 821-825; de Vos et al., (1992) Science 255: 306-312; Sundstrom et al., (1996) J. Biol. Chem. 271: 32197-32203; And Clackson et al., (1998) J. Mol. Biol. 277: 1111-1128. Binding occurs at a common binding pocket on the extracellular domains of the two receptors and at two unique GHR binding sites on GH. Site 1 on the GH molecule has a higher affinity than site 2, and receptor dimerization is thought to occur when one receptor binds to site 1 on GH and then a second receptor binds to site 2. Cunningham et al. (1991, supra) suggested that receptor dimerization is an important step leading to signal activation and dimerization is induced by GH binding [Ross et al., J. Clin. Endocrinol. & Metabolism (2001) 86 (4): 1716-171723]. Upon binding of the ligand, GHRs are rapidly internalized (Maamra et al., (1999) J. Biol. Chem 274: 14791-14798; and Harding et al., (1996) J. Biol. Chem. 271: 6708-6712), Some are recycled to the cell surface (Roupas et al., (1987) Endocrinol. 121: 15211530).

More recently, it has been discovered that a GHR isoform called GHRd3 has a deletion of exon 3 (Urbanek M et al., Mol Endocrinol 1992 Feb; 6 (2): 279-87; Godowski et al (1989) PNAS USA 86: 8083-8087). This deletion is believed to be the result of alternating splicing resulting in retention or exclusion of exon 3, corresponding to the full length GHRf1 isotype or exon 3 deletion GHRd3 isotype. Several contradictory results were obtained by the identification of the GHRd3 isoform. Some studies have reported that the GHRd3 isotype undergoes tissue specific splicing, the expression pattern is developmentally regulated, and other studies have reported that the GHRd3 isotype is specific to an individual. Another study suggested that splicing is due to genetic polymorphisms that are delivered as qualities of Mendel and alter splicing (Stallings-Mann et al. (1996) P. N. A. S U. S. A. 94: 12394-12399). Finally, Pantel et al. ((2000), J. Biol. Chem. 275 (25): 18664-18669), during analysis of the GHR position, demonstrated that in humans the GHRd3 isotype is a transcribed form of the GHR allele with 2.7 kb genomic deletion over exon 3. Pantel also identified two adjacent retrorlements in genomic DNA samples from individuals expressing only GHRfl, whereas only one adverse element was identified in DNA of individuals expressing GHRd3, indicating that GHRfl has the same exon 3 deletion. It is a result of homologous recombination between two inverse elements located on the allele.

The hGHRd3 protein differs from full-length hGHR (GHRfl) in that 22 amino acids in the extracellular domain of the receptor are deleted. The GHRd3 isotype encodes a stable and functional GHR protein [Urbanek et al. (1993) J. Biol. Chem. 268 (25): 19025-19032. Urbanek et al. (1993) reported that GHRd3 isotypes are stably integrated into cell membranes, bind and internalize ligands as efficiently as hGHR, and no functional differences with GHRfl isotypes have been identified.

The present invention relates to the identification of GHR alleles and isotypes as important factors influencing differences in positive responses to exogenous GH. Accordingly, the present invention provides a method for predicting the extent of a positive response to treatment with a compound that acts through the GHR pathway, or preferably a compound that binds to GHR, such as a GH composition. This method makes it possible to classify patients deductively, for example, into high or low response groups. By enabling treatment tailored to a particular patient (e.g., by the use of an appropriate amount of a GH composition or by the use of a compound in which the patient does not exhibit a reduced GHR response), the consequences of economic benefit and / or reduced side effects Get

The invention also demonstrates that patients who are heterozygous for the GHRd3 and GHRfl alleles have greater growth rates and renal changes in response to treatment with GH compared to patients that are homozygous for the GHRfl alleles. do. Accordingly, the present invention provides a method for detecting and diagnosing a decrease in GHR response or GHR activity in a subject homozygous for the GHRfl allele. The decrease in GHR activity may be the result of, for example, reduced GHR concentration, expression or protein activity. The present invention also provides a method for detecting and diagnosing an increase in GHR response or GHR activity in an individual that is homozygous or heterozygous for the GHRd3 allele. Detection of an increase or decrease in GHR activity is expected to be useful for the treatment of various disorders treatable using therapeutic agents that act through the GHR pathway. Examples include short stature (eg, preferably ISS, IUGR or SGA), obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and hypertension. Preferred examples include agents that bind GHR proteins, such as recombinant GH compositions that act as GHR agonists or antagonists.

Accordingly, the present invention provides methods for measuring or predicting GHR mediated activity, including methods of predicting GHR response to treatment, and diagnosing or identifying patients at risk for symptoms associated with reduced GHR activity. Etc. are included. Preferably, the present invention provides a method for predicting a patient's response to a medicament capable of interacting with (eg, binding to) a GHR polypeptide.

Thus, in one aspect, the present invention describes a method for predicting a patient's response to an agent capable of binding to a GHR protein, wherein the method measures the presence or absence of an allele of the GHR gene in the patient. And correlating the allele with the likelihood that the positive response to the medicament will increase or decrease, thereby identifying a patient with an increased or decreased likelihood of response to treatment with the medicament.

In addition, the present invention provides for short stature (eg, preferably ISS, IUGR or SGA), obesity, infection or diabetes; Giant authentication, or acromegaly, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Predict a patient's response to an agent for treatment of a condition selected from the group consisting of mood disorders and sleep disorders, cancer, heart disease and hypertension, and correlating the allele with the likelihood of an increase or decrease in a positive response to the agent In a related manner, a method is provided for identifying a patient with an increased or decreased likelihood of response to treatment with the medicament. In a preferred aspect, the present invention provides a method for predicting a patient's response to a medicament for increasing the patient's height, said method measuring the presence or absence of an allele of a GHR gene in a patient, said allele Correlating the probability of an increase or decrease in a positive response to the agent, thereby identifying a patient with an increased or decreased likelihood of response to treatment with the agent.

Preferably, the methods of the present invention comprise measuring the presence or absence of the GHR allele, wherein one or more nucleic acids in exon 3 are deleted, inserted or substituted, or most preferably, substantially the entire exon 3 is deleted. do.

The present invention also provides a method of identifying a patient with increased or decreased therapeutic potential for a disease or condition using a medicament capable of binding a GHR protein, the method comprising: a) the presence of an allele of the GHR gene Correlated with the patient's response to an agent capable of binding the GHR protein, and b) detecting the allele of step a) in the patient, thereby increasing or decreasing the likelihood of response to treatment with the agent. Identifying.

In another aspect, the invention includes a method of identifying alleles of a GHR gene associated with an increase or decrease in the treatability of a disease or condition using a medicament capable of binding a GHR protein, the method comprising: a) Measuring the presence of the allele of the GHR gene in the patient and b) correlating the presence of the allele of step a) with an increase or decrease in the treatability of a disease or condition using a medicament capable of binding the GHR protein. And identifying alleles associated with increased or decreased likelihood of response to treatment with the medicament.

The disease or condition may be short stature (eg, preferably ISS, IUGR or SGA), obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and hypertension.

Most preferably, the methods of the present invention comprise measuring a patient's genotype at exon 3 of the GHR gene, wherein the presence of exon 3 indicates that the patient is suffering from or is suffering from symptoms associated with a decrease in the GHR response. Indicates an increased risk for or deletion in exon 3 indicates that the patient has a reduced risk for symptoms associated with a decrease in the GHR response.

The method of the invention can be used particularly advantageously in the method of treatment. Preferably, the genotype is to show a therapeutic benefit or efficacy of the therapy. In one example, the methods of the present invention are used to determine the amount of drug to be administered to a patient. In another example, the method is used to evaluate a patient's treatment response in a clinical trial or to select a patient for inclusion in a clinical trial. For example, the methods of the present invention may include measuring a patient's genotype at exon 3 of the GHR gene, by which the patient is classified into a subgroup of clinical trials or a subgroup for inclusion in a clinical trial.

The present invention also provides a method of treating a patient, the method comprising (a) measuring the presence or absence of an allele of a GHR gene in a patient, wherein the allele acts through the GHR pathway or is directed to a GHR protein. Correlating the likelihood of an increase or decrease in response to an agent with which it can bind, and (b) selecting or determining an effective amount of the agent to be administered to the patient.

In any one of the methods of the invention, the agent capable of acting via the GHR pathway or binding to the GHR protein is preferably an agent effective for the treatment of a condition selected from the group consisting of: short stature (eg, preferably, ISS, IUGR or SGA), obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure.

In particular, the present invention provides a method of treating a patient comprising the following steps:

(a) measuring the presence or absence of an allele of a GHR gene in a patient, wherein the likelihood of an increase or decrease in a positive response to a medicament capable of treating the allele with a condition selected from the group consisting of: Correlated with: short stature (eg, preferably ISS, IUGR or SGA), obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure,

(b) selecting or determining an effective amount of the medicament to be administered to the patient.

In a particularly preferred embodiment, the present invention provides a method of increasing the growth of a patient, the method comprising: (a) measuring the presence or absence of alleles of the GHR gene in the patient, wherein the allele is grown in the patient Correlating the likelihood of an increase or decrease in a positive response to a medicament that is capable of increasing iodine, and (b) selecting or determining an effective amount of the medicament to be administered to the patient.

In a preferred aspect, the present invention provides a method of increasing the growth rate of a human patient, wherein the method comprises: (a) the patient is less than normal height of the corresponding age and gender, and the standard deviation is at least 1, more preferably Determining whether the standard deviation is at least 2, (b) determining whether the patient's DNA encodes a GHRd3 polypeptide, and (c) administering to the patient an effective amount of GH that increases the patient's growth rate. . Preferably the patient is not a patient with Laron's syndrome.

Preferably, the method of treating a human patient comprises administering to the patient an effective amount of a drug in a patient homozygous for the GHRfl allele, wherein the effective amount is administered to the same patient in which the DNA encodes a GHRd3 protein. It is more than the effective amount.

In a preferred aspect, the medicament is a GH molecule. The effective amount of GH to be administered to a patient is preferably from about 0.001 mg / kglday to about 0.2 mg / kg / day, and more preferably, the effective amount of GH is about 0.01 mglkg / day to about 0.1 mg / kg / day.

In another aspect, the effective amount of GH to be administered to the patient is at least about 0.2 mg / kg / week. In another aspect, the effective amount of GH is at least about 0.25 mg / kg / week. In another aspect, the effective amount of GH is at least about 0.3 mg / kg / week. Preferably, GH is administered once a day. It is preferred to inject GH subcutaneously. Most preferably, the growth hormone is formulated at a pH of about 7.4 to 7.8.

Another aspect of the invention relates to a method of using a drug comprising the steps of: obtaining a DNA sample from a patient, the DNA sample comprising an allele of the GHR gene associated with an increase in a positive response to the drug Whether and / or whether the DNA sample contains an allele of a GHR gene associated with a decrease in a positive response to the drug, and wherein the DNA sample contains an allele of a GHR gene associated with an increase in a positive response to a drug Administering an effective amount of the drug to the patient if it contains a gene and / or if the DNA sample lacks an allele of the GHR gene associated with a decrease in positive response to the drug.

In another aspect, the present invention includes the treatment of a patient suffering from reduced response to exogenous GH. In this aspect, the present invention provides a method of using a drug comprising the steps of: obtaining a DNA sample from a patient, the DNA sample comprising an allele of the GHR gene associated with an increase in a positive response to the drug Whether and / or whether the DNA sample contains an allele of a GHR gene associated with a decrease in a positive response to the drug, and wherein the DNA sample contains an allele of a GHR gene associated with a decrease in a positive response to the drug Administering an effective amount of the drug to the patient if it contains a gene and / or if the DNA sample lacks an allele of the GHR gene associated with an increase in a positive response to the drug.

As noted above, the method comprises measuring the presence or absence in the patient of the GHR allele in which one or more nucleic acids in exon 3 is deleted, inserted or substituted, or, most preferably, substantially the entire exon 3 is deleted. . The allele of the GHR gene associated with an increase in a positive response to the drug is a GHR allele lacking exon 3, preferably the GHRd3 allele. Preferably, the allele of the GHR gene associated with a decrease in the positive response to the drug is a GHR allele (GHRfl) comprising exon 3 (if the patient is homozygous for the surrogate).

The invention also relates to a method for clinical testing of a drug comprising the following steps:

Administering the drug to the population.

-From said population, identifying a first subpopulation of individuals whose DNA encodes a GHRd3 polypeptide isotype and a second subpopulation of individuals whose DNA does not encode a GHRd3 polypeptide isotype.

The method may further comprise the following steps: (a) evaluating the response to the drug in the first subpopulation; And / or (b) assessing the response to the drug in the second subpopulation. Preferably, the response to the drug is evaluated in both the first subpopulation and the second subpopulation. Preferably, the response is evaluated separately in the first and second subpopulations. Evaluation of the response to the drug preferably includes measuring a change in the kidney of the patient.

The present invention also relates to a method for clinical testing of a drug comprising the following steps:

Identifying a first population of individuals whose DNA encodes a GHRd3 polypeptide and a second population of individuals whose DNA does not encode a GHRd3 polypeptide,

-Administering the drug to an individual of said first and / or said second population. In one embodiment, the drug is administered to the individual of the first population and not to the individual of the second population. In one embodiment, the drug is administered to a subject of a second population and not to a subject of the first population. In another embodiment, the drug is administered to an individual in both the first and second populations.

In the aforementioned method, the drug is preferably a drug for treating the following symptoms: short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure.

A preferred aspect of the present invention relates to a method for clinical testing of a drug, wherein the drug is preferably a drug that can increase the growth rate of a human patient. The method includes the following steps:

Administering to the population a drug, preferably a drug that can increase the growth rate of a human patient,

-From said population, identifying a first subpopulation of individuals in which the DNA encodes a GHRd3 polypeptide isotype and a second subpopulation of individuals in which the DNA does not encode a GHRd3 polypeptide isotype.

Another preferred aspect relates to a method of clinical testing of a drug, wherein the drug is preferably a drug that can increase the growth rate of a human patient or can improve ISS, IUGR or SGA. The method includes the following steps:

Identifying a first population of individuals whose DNA encodes a GHRd3 polypeptide and a second population of individuals whose DNA does not encode a GHRd3 polypeptide,

Administering a drug, preferably a drug that can increase the growth rate of a human patient or that can improve ISS, IUGR or SGA, to the individual of the first and / or second population. In one embodiment, the drug is administered to an individual of said first population and not to an individual of said second population. In one embodiment, the drug is administered to the individual of the second population and not to the individual of the first population. In another embodiment, the drug is administered to both the first and second populations.

Assessment of response to a drug that can increase the growth rate of a human patient or can improve ISS, IUGR or SGA includes assessing changes in the subject's kidneys. Increasing the growth rate of a human patient includes not only the situation in which the patient reaches the same final height as a GH deficient patient (ie, a patient diagnosed with GHD) treated with at least GH, Refers to a situation in which the kidney is reached at the same growth rate as the GH-deficient patient treated, or the final kidney meets the genetic potential as determined by the adult kidney within the target kidney range, ie the middle parent target kidney. .

In any of the aspects of the methods of the invention, determining whether the patient's DNA encodes a particular GHR polypeptide isotype can be performed using a nucleic acid molecule that specifically binds to the GHR nucleic acid molecule. In another aspect, determining whether the patient's DNA encodes a GHR polypeptide isotype is performed using a nucleic acid molecule that specifically binds to the GHR nucleic acid molecule. The method of the invention preferably comprises determining whether the subject's DNA encodes a GHRd3 protein or polypeptide. Thus, this may include determining whether the genomic DNA of the individual comprises a GHRd3 allele, whether the mRNA obtained from the individual encodes a GHRd3 polypeptide, or whether the patient expresses a GHRd3 polypeptide.

For example, in any of the above embodiments, determining whether the subject's DNA encodes a GHRd3 polypeptide comprises the following steps:

a) preparing a biological sample,

b) contacting the biological sample with ii) a polynucleotide that hybridizes with GHR nucleic acid, preferably GHRd3 nucleic acid under stringent conditions, or iii) a detectable polypeptide that selectively binds to a GHR polypeptide, preferably GHRd3 polypeptide, and ,

c) determining the presence of hybridization between the polynucleotide and the RNA species in the sample or the binding of the detectable polypeptide to the polypeptide in the sample.

Preferably, the biological sample is contacted with a polynucleotide that hybridizes with GHRd3 nucleic acid or with a detectable polypeptide that selectively binds to a GHRd3 polypeptide under stringent conditions, wherein the hybridization or detection of the binding is such that the GHRd3 is in the sample. It is expressed in.

Preferably, the polynucleotide is a primer and the hybridization is detected by detecting the presence of an amplification product comprising the primer sequence. Preferably, the detectable polypeptide is an antibody. Detection of GHRd3 and GHRfl polypeptides or nucleic acids can be performed by any suitable method. For example, serum concentrations of extracellular domains of GHRd3 or GHRfl can be assessed (eg, high affinity GH binding proteins can be assessed). Oligonucleotide probes or primers that specifically hybridize to the GHRd3 genome or cDNA sequence and methods of DNA amplification and detection using the primers and probes are also part of the present invention.

The invention also relates to a method for identifying candidate modulators of a GHRd3 polypeptide. Such methods can be embodied as methods of identifying GHR agonists or inhibitors that are effective, for example, in individuals that are homozygous or heterozygous for the GHRd3 allele. The method can be used to identify compounds that are most effective for treatment, for example by identifying compounds from known GH compositions such as GENOTROPIN ^™ , PROTROPIN ^™ , NUTROPIN ^™ , SOMAVERT ^™ (pegvisomant) and the like. Thus, the method can increase the growth rate of human patients and can be used for obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; It may be useful for identifying drugs that can improve mood disorders and sleep disorders, cancer, heart disease and high blood pressure.

In one aspect, the invention relates to a method for identifying candidate modulators of a GHRd3 polypeptide, the method comprising:

a) preparing a GHRd3 polypeptide,

b) contacting the mixture with a test compound,

b) determining whether said compound selectively binds to said GHRd3 polypeptide,

At this time, when the compound is selectively detected to bind the polypeptide, it indicates that the compound is a candidate regulator of the GHRd3 polypeptide. The test compound is preferably a GH polypeptide or portion or variant thereof. The compound may be an agent or inhibitor of a GHRd3 polypeptide. In a preferred embodiment, the GHRd3 polypeptide is integrated into the membrane.

The invention also provides a method of identifying candidate modulators of a GHRd3 polypeptide, the method comprising:

a) preparing a GHRd3 polypeptide,

b) contacting the mixture with a test compound

c) determining whether said compound selectively modulates GHR activity,

At this time, when the compound is detected to selectively modulate GHR activity, it indicates that the compound is a candidate regulator of GHRd3 polypeptide activity. Preferably the test compound is a GH polypeptide or portion or variant thereof. The compound may be an agent or inhibitor of a GHRd3 polypeptide. If the test compound is detected to promote GHR activity, the test compound is a candidate agent. If the test compound inhibits GHR activity, the test compound is a candidate inhibitor. In a preferred embodiment, the GHRd3 polypeptide is integrated into the membrane.

The invention also provides a method of identifying candidate modulators of a GHRd3 polypeptide, the method comprising:

a) preparing a cell comprising a GHRd3 polypeptide,

b) contacting said cells with a test compound,

c) determining whether said compound selectively modulates GHR activity,

At this time, if the compound is detected to selectively modulate GHR activity, the compound is a candidate modulator of GHRd3 polypeptide activity. Preferably said test compound is a GH polypeptide or portion or variant thereof. The compound may be an agent or inhibitor of a GHRd3 polypeptide. If the test compound is detected to promote GHR activity, the test compound is a candidate agent. If the test compound is detected to inhibit GHR activity, the test compound is a candidate inhibitor. Preferably the cell is a human 293 cell. In another aspect of the method, the cell is an oocyte of Xenopus laevis and step a) comprises introducing a GHRd3 cRNA into the cell.

The present invention also suggests that GHR can exist as GHRd3 and GHRfl heterodimeric polypeptides. Thus, in another aspect, the invention also relates to a method for identifying candidate modulators of GHR heterodimer (GHRd3 / fl) polypeptides. Such methods can be embodied, for example, as methods for identifying GHR agonists or inhibitors. Such methods may also increase the growth rate of human patients, and may include obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; It can be embodied as a method of identifying drugs that can improve mood disorders and sleep disorders, cancer, heart disease and hypertension.

In one aspect, the invention relates to a method for identifying candidate modulators of a GHR heterodimer polypeptide, the method comprising:

c) mixing GHRfl polypeptide and GHRd3 polypeptides,

d) contacting the mixture with a test compound,

b) determining whether said compound selectively binds to a GHRfl or GHRd3 polypeptide,

At this time, if the compound is detected to selectively bind to the polypeptide, the compound is a candidate modulator of the GHR heterodimer polypeptide. Preferably said test compound is a GH polypeptide or portion or variant thereof. The compound may be an agent or inhibitor of a GHR heterodimer. In a preferred embodiment, the GHRfl and GHRd3 polypeptides are integrated into the membrane.

The invention also provides a method of identifying candidate modulators of a GHR heterodimer polypeptide, the method comprising:

c) mixing the GHRfl polypeptide and the GHRd3 polypeptide,

d) contacting the mixture with a test compound,

c) determining whether said compound selectively modulates GHR activity,

At this time, if the compound is detected to selectively regulate GHR activity, the compound is a candidate modulator of GHR heterodimer activity. The test compound is preferably a GH polypeptide or a portion or variant thereof. The compound may be an agent or inhibitor of a GHR heterodimer. If the test compound is detected to promote GHR activity, the tetracycline test compound is a candidate agent. If a test compound is detected to inhibit GHR activity, the test compound is a candidate inhibitor. In a preferred embodiment, the GHRfl and GHRd3 polypeptides are integrated into the membrane.

The invention also provides a method of identifying candidate modulators of a GHR heterodimer polypeptide, the method comprising:

c) preparing a cell comprising a GHRfl polypeptide and a GHRd3 polypeptide,

d) contacting said cells with a test compound,

c) determining whether said compound selectively modulates GHR activity,

If the compound is detected to selectively modulate GHR activity, the compound is a candidate modulator of GHR heterodimer activity. Preferably the test compound is a GH polypeptide or portion or variant thereof. The compound may be an agent or inhibitor of a GHR heterodimer. If a test compound is detected to promote GHR activity, the test compound is a candidate agent. If a test compound is detected to inhibit GHR activity, the test compound is a candidate inhibitor. Preferably the cell is a human 293 cell. In another aspect of the method, the cell is a Xenopus laevis oocyte and step a) comprises introducing a GHRd3 cRNA into the cell.

The cell is preferably a cell expressing a GHRfl polypeptide and a GHRd3 polypeptide. In a preferred aspect, step a) comprises introducing a nucleic acid comprising a GHRd3 nucleotide sequence and a nucleic acid comprising a GHRfl nucleotide sequence into said cell. In another aspect, step a) comprises introducing a nucleic acid comprising a GHRd3 nucleotide sequence into a cell expressing a GHRfl nucleic acid. In another aspect, step a) comprises introducing a nucleic acid comprising a GHRfl nucleotide sequence into a cell expressing a GHRd3 nucleic acid.

The present invention also provides a recombinant vector comprising a GHRd3 polynucleotide and a polynucleotide encoding a GHRfl polypeptide. Host cells comprising the recombinant vector according to the invention are also included in the invention. The invention also provides two or more sets of recombinant vectors comprising a first recombinant vector comprising a GHRd3 polynucleotide and a second recombinant vector comprising a GHRfl polynucleotide. The present invention also provides a host cell comprising the first recombinant vector and the second recombinant vector, which includes a non-human host animal or mammal comprising the recombinant vectors.

The present invention also provides a mammalian host cell comprising a GHR gene that is broken by homologous recombination by a knockout vector comprising a GHRd3 polynucleotide. The present invention also provides a non-human host mammal comprising a GHR gene that is broken by homologous recombination by a knockout vector comprising a GHFd3 polynucleotide.

As described above, methods of performing the assay, methods of identifying modulators of GHR heterodimers, recombinant vectors, host cells, and non-human host mammals may use or instead replace all GHRd3 alleles that are substantially free of total exon 3 It will be appreciated that any suitable isotype encoded by the GHR nucleic acid in which one or more nucleic acids in the appropriate GHR allele or exon 3 is deleted, inserted or substituted may be used.

Detailed description of the invention

For 97 children with idiopathic short stature (ISS) included in the treatment trial using recombinant GH, the association of common GHR exon 3 variants and the response of growth rate to treatment with GH were investigated. GHRd3 alleles were present in 47 patients, 3 of them as GHRd3 / d3 homozygotes and 44 as GHRd3 / fl heterozygotes. After adjusting for age, sex and rGH dosage, children with GHRd3 variants have been shown to grow at an excellent rate when treated with rGH. The growth rate was 9.0 +/- 0.3 cm / yr in the first year of treatment and 7.8 +/- 0.2 cm / yr in the second year for children with the GHRd3 / fl or GHRd3 / d3 genotype, and the GHRfl / fl genotype Compared with the growth rates of 7.4 +/- 0.2 cm / yr and 6.5 +/- 0.2 cm / yr in the first and second years of children, respectively (P <0.0001). Genotype groups were compared for other medical and therapeutic characteristics. Thus, genomic variants of the GHR sequence are associated with significant differences in rGH effects.

As noted above, the present invention falls within the field of prophylactic medicine and pharmaceuticals that treat subjects using diagnostic analysis, prognostic analysis, and monitoring clinical trials for prognostic (predictive) purposes. Thus, one aspect of the present invention relates to an exogenous GH composition, in particular for determining the nature of a GHR response in an individual by measuring GHR protein and / or nucleic acid expression in a biological sample (eg, blood, serum, cells, tissue). Used to treat diagnostic analysis. It may also be useful to determine whether an individual suffers from a disease or disorder associated with a reduced GHR response or activity. Diseases or symptoms involving GHR activity include short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and hypertension. The invention also provides prognostic judgment (prediction) assays to determine whether an individual has a risk of developing a disease associated with GHR protein activity. For example, GHRd3 isoforms and GHRfl isoforms can be analyzed in biological samples. This analysis prevents an individual prior to the onset of a disease characterized by or associated with a reduced GHR response, such as by administering an effective amount of GH to allow the patient to reach a final kidney that matches his or her genetic potential. Can be used for prognostic judgment or for predictive purposes. In another aspect, the invention provides a method of detecting a medicament that modulates GHRd3 / GHRfl heterodimer activity. Such agents may be useful for the treatment of the above symptoms or diseases involving GHR activity.

Justice

As used herein, the term "pharmaceutical" refers to a chemical compound, a mixture of chemical compounds, a biological macromolecule, preferably a peptide or protein, or a biological material such as a bacterial, plant, fungal or animal (especially mammalian) cell or tissue. Means an extract obtained from.

In the context of the present invention, "positive response" or "positive therapeutic response" to a drug or medicament may be defined to include a reduction in a disease or condition associated with the condition. For example, the positive response may be an increase in the elongation or growth rate upon administration of the medicament. In the context of the present invention, “negative response” to a drug includes the lack of a positive response to the drug, or the induction of side effects observed after administration of the drug.

"Polypeptide" means a polymer of amino acids regardless of the length of the polymer, and peptides, oligopeptides and proteins are included within the definition of a polypeptide. In addition, the term does not limit or exclude modifications after expression of the polypeptide, for example, a polypeptide comprising covalent attachment of a glycosyl group, an acetyl group, a phosphate group, a lipid group or the like is expressly included in the polypeptide. . Polypeptides, including one or more amino acid analogs (eg, non-natural amino acids, naturally occurring amino acids in unrelated biological systems, amino acids modified from mammals, etc.), substitutional bonds, and other modifications known in the art Polypeptides, both natural and unnatural, have also been included within the definition.

A "isolated" or "purified" protein or biologically active portion thereof is substantially free of intracellular material or other impurity proteins of the cell or tissue origin from which the protein is derived or, if chemically synthesized, a chemical precursor or other It means no chemicals. The expression “substantially free of intracellular material” includes GH or GHR protein preparations in which the GH or GHR protein is separated from the cellular components of the cell from which it is isolated or recombinantly produced. In one embodiment, the expression “substantially free of intracellular material” has a non-GH protein or non-GHR protein content of about 30% or less (based on dry weight), preferably about 20% or less, more preferably Up to about 10%, most preferably up to 5%, GH or GHR protein preparations. If the GH or GHR protein or its biologically active portion is produced recombinantly, it is also preferably substantially free of culture medium, ie the culture medium is no more than about 20%, more preferably about 10% of the volume of the protein preparation. Or less, most preferably about 5% or less.

The expression “substantially free of chemical precursors or other chemicals” is inclusive of GH or GHR protein preparations in which the GH or GHR protein is separated from the chemical precursors or other chemicals involved in its synthesis. In one embodiment, the expression “substantially free of chemical precursors or other chemicals” means that the content of the chemical precursors or non-GH chemicals or non-GHR chemicals is about 30% or less (based on dry weight), preferably And up to about 20%, more preferably about 10% or less, most preferably about 5% or less.

As used herein, a "recombinant polypeptide" means a polypeptide comprising two or more polypeptide sequences that are artificially designed and do not appear as contiguous polypeptide sequences in their initial natural environment, or are expressed from recombinant polynucleotides. It means a polypeptide.

Nucleic acids are said to be "operably linked" when positioned so as to be functionally related to other nucleic acid sequences. For example, a promoter or enhancer is said to be operably linked to the coding sequence when it affects the transcription of the coding sequence. With respect to the transcriptional regulatory sequence, “operably linked” is when the bound DNA sequence is contiguous and it is necessary to concatenate two protein coding regions, adjacently located within the translation frame.

"Primer" means a particular oligonucleotide sequence that is complementary to a target nucleotide sequence and used for hybridization with the target nucleotide sequence. The primer serves as an initiation point for nucleotide polymerization catalyzed by DNA polymerase, RNA polymerase or reverse transcriptase.

"Probe" means a defined nucleic acid fragment (or nucleotide analogue fragment, such as a polynucleotide as defined herein) that can be used to identify a specific polynucleotide sequence present in a sample, wherein the nucleic acid fragment is identified It is to include a nucleotide sequence that is complementary to a specific polynucleotide sequence.

As used herein, “test sample” means a biological sample obtained from the patient. For example, the test sample can be a bodily fluid (eg, serum), a cell sample or tissue.

“Trait” and “phenotype” are used interchangeably herein and include all clinically distinguishable, detectable or other measurable organisms, such as, for example, symptoms of disease or sensitivity to disease. It means characteristic. In general, the term “trait” or “phenotype” is used herein to mean the response of an individual to an agent acting on GHR.

As used herein, "genotype" refers to the identity of alleles present in an individual or sample. In the context of the present invention, genotype preferably refers to the description of an allele present in an individual or sample. "Genotyping" a sample or individual to an allele involves determining the specific allele possessed by the individual.

As used herein, "allele" means a variant of the nucleotide sequence. For example, alleles of the GHR nucleotide sequence include GHRd3 and GHRfl.

As used herein, “isoform” and “GHR isotype” refer to polypeptides encoded by one or more exons of the GHR gene. Examples of GHR isotypes are the GHRd3 and GHRfl polypeptides.

As used herein, "polymorphism" refers to the generation of two or more alternative genomic sequences or alleles between different genomes or individuals. "Polymorphic" means a state in which two or more variants of a particular genomic sequence are found in a population. "Polymorphic site" means the position where the mutation occurs. Polymorphism includes substitution, deletion or insertion of one or more nucleotides. Single nucleotide polymorphism refers to the change of a single base pair.

As used herein, "exon" refers to all fragments of an interrupted gene present in mature RNA products.

As used herein, "intron" refers to a fragment of an interrupted gene that is not present in a mature RNA product. Introns are part of primary nuclear transcription but are not removed by splicing to produce mRNA to be transported into the cytoplasm.

As used herein, "growth hormone" or "GH" refers to growth hormone in its native sequence or variant form, which can be obtained from any source and can be natural, synthetic or recombinant. Examples include human growth hormone (hGH) (eg GENOTROPIN ^™ , somatotropin or somatotropin), which is a natural or recombinant GH with human native sequence, and somatrem, somatotropin, smart Recombinant growth hormone (rGH), which means all GH or GH variants produced by recombinant DNA technology, including, but not limited to, ropin and pegvisomant. The GH molecule may be an agonist or antagonist in GHR.

As used herein, "growth hormone receptor" or "GHR" refers to growth hormone receptor in its native sequence or variant form and can be obtained from any source and may be natural, synthetic or recombinant. "GHR" includes both GHRfl isoforms and GHRd3 isotypes. Examples include human growth hormone receptor (hGHR), which is a natural or recombinant GHR with human native sequence. As used herein, "GHRd3" refers to the exon 3 deletion isoform of GHR. "GHRfl" refers to an exon 3 containing isotype. GHRd3 includes, but is not limited to, the polypeptides described in “Mol Endocrinol 1992 Feb; 6 (2): 279-87” by Urbanek M et al., Incorporated herein by reference. GHRfl includes, but is not limited to, the polypeptides described in "Nature, 330: 537-543 (1987)" by Leung et al., Which is incorporated herein by reference.

As used herein, "GHR gene" includes genomic sequences, mRNA sequences, and cDNA sequences that encode all GHR proteins, including the untranslated regulatory regions of genomic DNA. "GHR gene" also includes alleles of the GHR gene, such as the GHRd3 allele and the GHRfl allele.

Human GHR Genes and Proteins

The human GHR gene is a single copy gene spanning 90 kb of the 5p13-12 chromosome region. It contains nine coding exons (numbers 2 to 10) and several untranslated exons, exons 2 encode signal peptides, exons 3 to 7 encode extracellular domains, and exon 8 to transmembrane domains. And exons 9 and 10 encode the cytoplasmic domain. As mentioned above, the hGHRd3 protein differs from hepatic hGHR in that 22 amino acids in the extracellular domain of the receptor are deleted (Godowski et al. (1989)). The description of Genbank accession number: AF155912, the sequence of which is incorporated herein by reference, provides the nucleotide sequence of the genomic DNA region around exon 3 of the GHR gene (ie, GHRfl allele). This 6.8 bp fragment, including exon 3 and introns 2 and 3 parts, also contains two 251 bp repeat elements. These repeat elements are flanked by exon 3 and have 5 ′ and 3 ′ repeat elements located 577 bp upstream and 1821 bp downstream of exon. These elements consist of 171 bp long terminal repeat (LTR) fragments derived from retroviruses in humans belonging to the HERV-P strain [Boeke, JD, and Stoye, JP (1997) in Retroviruses (Coffin, JM, Hughes, SH, and Varmus, HE, eds), pp. 343-435, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 80 bp from the medium repetition frequency MER4 type sequence is located after the LTR [Smit, AF (1996) Curr. Opin.Genet. Dev. 6, 743-748. Two 251 bp long copy sequences, referred to as 5 'and 3' repeat sequences, are 99% homologous and differ only in the three nucleotides at positions 14, 245 and 146 of the repeat sequence. In particular, as reported in Pantel et al. (2000), elements located upstream at exon 3 have cytosine at position 14 and thymine at positions 245 and 246, whereas elements located downstream of exon 3 have Guanine, cytosine and adenine. In addition, other sequences of viral origin are observed adjacent to exon 3.

GHRd3 alleles include deletion of exons 3 and peripheral portions of introns 2 and 3. Unlike the GHRfl allele, the GHRd3 allele contains a single 251 bp LTR identical in sequence to the 3 'copy of the LTR identified on the GHRfl allele. The genomic DNA sequence of the 3 GHRd3 allele of the deleted exon region is shown in Genbank accession number: AF210633, the description of which sequence is incorporated herein by reference. Based on the GHRd3 and GHRfl sequences, known methods of detecting GHR nucleic acids or polypeptides can be used to determine whether an individual has a GHRd3 allele.

GHRd3 protein with exon 3 deletion differs from full-length hGHR (GHRfl) in that 22 amino acids in the extracellular domain of the receptor are deleted. Thus, all known methods can be used to determine the presence of GHRd3 or GHRfl protein. GHRd3 and GHRfl are also non-cleaved as “high affinity growth hormone binding protein”, “high affinity GHBP” or “GHBP”, which refers to the extracellular domain of GHR that acts as GHBP and circulates in the blood in some species. Can be detected in morphology or cleavage form [Ymer and Herington, (1985) Mol. Cell. Endocrinol. 41: 153; Smith and Talamantes, (1988) Endocrinology, 123: 1489-1494; Emtner and Roos, Acta Endocrinologica (Copenh.), 122: 296-302 (1990), including mar. Baumann et al., J. Clin. Endocrinol. Metab., 62: 134-141 (1986); EP 366,710; Herington et al., J. Crin. Invest., 77: 1817-1823 (1986); Leung et al., Nature, 330: 537-543 (1987). There are a variety of methods for measuring functional GHBP in serum, and the preferred and preferred methods are the ligand-mediated immunofunctional assays (LIFAs) described in US Pat. No. 5,210,017 and herein.

GHRd3 in Diagnosis, Treatment, and Pharmacological Genetics

In a preferred embodiment, the invention involves determining whether a patient expresses a GHR allele associated with an increase or decrease in response to treatment, or an increase or decrease in GHR activity. Determination of whether a patient expresses a GHR allele can be performed by detecting a GHR protein or nucleic acid.

Methods of treating, diagnosing or evaluating a patient include assessing or measuring whether the patient expresses the GHRd3 allele and / or the GHRfl allele, eg, the patient is homozygous for the GHRfl allele (GHRfl / fl), GHRd3 It is preferred to include determining whether the allele is homozygous (GHRd3 / d3) or heterozygous (GHRd3 / fl). Accordingly, the present invention preferably involves measuring whether GHRd3 is expressed in a biological sample, including the following steps: a) a polynucleotide or ii hybridizing the biological sample with GHRd3 nucleic acid under stringent conditions; A) contacting with a detectable polypeptide that selectively binds a GHRd3 polypeptide, and b) hybridizing the polynucleotide to an RNA species in the sample or whether there is a binding of the detectable polypeptide to a polypeptide in the sample. Detecting. Detection of the hybridization or the binding indicates that the GHRd3 allele or isotype is expressed in the sample. Preferably, the polynucleotide is a primer and the hybridization is determined by measuring the presence of an amplification product comprising the primer sequence, or the detectable polypeptide is an antibody.

In addition, a method is designed to determine whether a mammal, preferably a human, exhibits increased or decreased levels of GHRd3 expression, the method comprising: a) preparing a biological sample from the mammal, and b) in the biological sample. Comparing the amount of GHRd3 RNA species or GHRd3 polypeptide encoding the GHRd3 polypeptide to the level expected or measured from the control sample. An increase in the GHRd3 RNA species or the GHRd3 polypeptide in the biological sample as compared to the expected or detected level in the control sample indicates an increase in the GHRd3 expression level in the mammal, compared to the level expected or detected in the control sample. The reduced amount of the GHRd3 RNA species or the GHRd3 polypeptide in the biological sample when compared indicates that the mammalian GHRd3 expression level was reduced.

A method for determining the presence of a GHRd3 protein or nucleic acid in a biological sample is obtained by obtaining a biological sample from a test patient, wherein the biological sample is capable of detecting a GHRd3 protein or a nucleic acid (eg, mRNA, genomic DNA) encoding a GHRd3 protein. Or contacting the compound to allow the presence or absence of a GHRd3 protein or nucleic acid in the biological sample. The agent for detecting GHRd3 mRNA or genomic DNA is preferably a labeled nucleic acid probe capable of hybridizing to GHRd3 mRNA or genomic DNA. Nucleic acid probes are, for example, human nucleic acids or portions thereof, such as oligonucleotides that are at least 15, 30, 50, 100, 250 or 500 nucleotides in length and are sufficient to specifically hybridize with GHRd3 mRNA or genomic DNA under stringent conditions. Can be. Other suitable probes for use in the diagnostic assays of the present invention are described herein.

The agent for detecting the GHRd3 protein is preferably an antibody capable of binding to the GHRd3 protein, and more preferably a detectably labeled antibody. The antibody may be a polyclonal antibody, or more preferably a monoclonal antibody. Intact (intact) antibodies or fragments thereof (eg, Fat or F (ab ') ₂ ) can be used. The term "labeled" in connection with a probe or antibody refers to the reactivity of other reagents directly labeled as well as directly labeling the probe or antibody by binding (eg, physically binding) a detectable substance to the probe or antibody. By indirectly labeling the probe or antibody. Examples of indirect labels include detection of primary antibodies using fluorescently labeled secondary antibodies and terminal labeling of DNA probes using biotin to detect fluorescently labeled streptavidin.

The term "biological sample" is intended to include tissues, cells and body fluids separated from the patient, as well as tissues, cells and body fluids present in the patient. That is, the detection method of the present invention can be used to detect candidate mRNA, protein or genomic DNA in biological samples in vitro and in vivo. For example, in vitro techniques for detecting candidate mRNAs include Northern hybridization and in situ hybridization. In vitro techniques for detecting candidate proteins include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitation and immunofluorescence. In vitro techniques for detecting candidate genomic DNA include Southern hybridization. In vivo techniques for detecting GHRd3 protein also include introducing labeled anti-antibodies into the patient. For example, antibodies can be labeled with radioactive markers whose presence and location in a patient can be detected by standard imaging techniques.

In one embodiment, the biological sample is one comprising a protein molecule derived from a test subject. Alternatively, the biological sample may comprise mRNA molecules derived from the test subject or genomic DNA molecules derived from the test subject. Preferred biological samples are serum samples isolated from conventional patients by conventional means.

In another embodiment, the method comprises obtaining a control biological sample from a control patient and contacting the control sample with an agent or compound capable of detecting a GHRd3 protein, mRNA or genomic DNA, such that the GHRd3 protein, mRNA or Determining the presence of genomic DNA and further entailing comparing the presence of GHRd3 protein, mRNA or genomic DNA in a control sample with the presence of GHRd3 protein, mRNA or genomic DNA in a test sample.

The invention also includes a kit for detecting the presence of GHRd3 protein, mRNA or genomic DNA in a biological sample. For example, the kit may comprise a labeled compound or agent capable of detecting a GHRd3 protein or mRNA in a biological sample; Means for detecting the amount of GHRd3 protein or mRNA in the sample; And means for comparing the amount of GHRd3 protein, mRNA or genomic DNA in the sample with a standard sample. The compound or medicament may be packaged in a suitable container. The kit may further comprise instructions for using the kit for detecting a GHRd3 protein or nucleic acid.

Most preferably, the assays described herein, such as the diagnostic assays described above or the assays described below, may be used to identify patients with reduced GHR responses or patients at risk of developing a reduced GHR response. In particular, patients with GHRfl homozygous have been found to have a reduced GHR response or a risk of decreased GHR response. In another aspect, the diagnostic methods described herein can be used to identify patients who have or are at risk for abnormal symptoms, particularly diseases, disorders or traits associated with reduced GHR levels, expression or activity. For example, the assays described herein, such as the diagnostic assays described above or the assays described below, can be used to identify patients who have or are at risk of developing a trait associated with a decrease in GHR levels, expression or activity. In another example, the assays described herein can be used to identify patients having or at risk of developing a trait associated with a decrease in GHR levels, expression or activity. As discussed, GHRfl heterozygotes are expected to have increased GHR response or GHR activity compared to GHRfl / fl homozygotes.

The prognostic assays described herein can be used to determine whether to administer to a patient a medicament that works through the GHR route to treat a disease or disorder and / or to which dosage regimen to follow. Thus, the present invention provides a method for determining whether a patient can be effectively treated by a medicament acting through the GHR pathway, which method comprises obtaining a test sample and detecting GHRd3 protein or nucleic acid expression or activity. . As discussed, patients with detected GHRd3 protein or nucleic acid are expected to show an increased positive response to the agent compared to patients without detected GHRd3 protein or nucleic acid.

In most cases, measurement of sensitivity to reduced GHR activity in a subject is very important because administration of agents acting through the GHR mediated pathway can be applied to patients with high or low responsiveness to the agent. The agent does not necessarily need to act directly on the GHR protein, but may act upstream of the GHR protein, for example on other molecules that ultimately interact with the GHR protein. In a preferred embodiment, the medicament is a medicament that acts directly on the GHR protein. More preferably, the agent is a drug that acts as an agonist or antagonist and binds to the GHR protein. Most preferably, the agent is a GH protein capable of activating the GHR protein. In another embodiment, the agent is a GH protein that binds but does not activate GHR protein.

Diseases involving GHR include, for example, short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and hypertension. Thus, the methods of the present invention can be used to predict a patient's response to treatment with a medicament for either of these diseases.

As discussed, the present invention discloses a method of treating a patient suffering from a condition selected from the group consisting of: short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure,

The method,

(a) measuring the presence or absence of an allele of a GHR gene in a patient, correlating the allele with the likelihood of an increase or decrease in a positive response to an agent capable of ameliorating the symptoms,

(b) selecting or determining an effective amount of said medicament to be administered to said patient.

The present invention therefore also relates to a method of treating a mammal, preferably a human, wherein said method is

Optionally, determine whether the subject's DNA encodes a GHRd3 protein,

-Screening subjects whose DNA does not encode GHRd3 protein,

-Track the pattern of symptoms (and optionally progress) associated with the reduced GHR response of said individual;

Administering to the subject an effective amount of therapeutic agent that acts on the reduced GHR response or symptoms thereof, as appropriate.

Another embodiment of the invention comprises a method of treating a mammal, preferably a human, wherein the method comprises

Optionally, determine whether the subject's DNA encodes a GHRd3 protein,

-Screening subjects whose DNA does not encode GHRd3 protein,

-Performing a loan prophylactic treatment on said GHR response to said individual.

In another embodiment, the present invention relates to a method of treating a mammal, preferably a human, wherein the method comprises

Optionally, determine whether the subject's DNA encodes a GHRd3 protein,

-Screening subjects whose DNA does not encode GHRd3 protein,

Administering prophylactic treatment to the subject for a reduced GHR response,

-Track the pattern and course of symptoms associated with a reduced GHR response of said individual,

Optionally at a suitable stage, subjecting said subject to a treatment acting on a reduced GHR response or symptoms thereof.

For use in determining the treatment direction of an individual, the present invention also relates to a method of treatment comprising the following steps:

Selecting individuals encoding proteins associated with a reduced GHR response, activity or expression of DNA or symptoms associated therewith,

-Administering to the subject an effective treatment for a reduced GHR response or symptoms thereof. In a preferred embodiment, said protein associated with a reduced GHR response or symptoms thereof is a GHR protein, more preferably a GHRfl protein. Most preferably, the subject will be homozygous for the GHRfl / fl isotype.

The subject according to the method of the invention may be a subject sensitive to or suffering from a symptom selected from the group consisting of: short stature (eg preferably ISS), obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure.

The reduced GHR response is preferably a decrease in response to treatment with a medicament capable of acting through the GHR pathway, more preferably binding to a GHR protein. Examples of preferred agents include agents for the treatment of the following symptoms: short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure.

Treatment effective for a reduced GHR response or symptoms thereof may differ from the treatment performed in a subject who has not had a reduced GHR response in all appropriate respects. In one aspect, the treatment differs in the amount of agent to be administered. In another aspect, the treatment is different in formulation. In another aspect, the duration of the method of administering the composition is different. In another aspect, agents commonly used for treatment that are effective in reducing GHR responses or symptoms thereof are different in structure from agents used to treat underlying symptoms (eg, short stature, obesity). In a preferred aspect, a composition containing a GH protein, variant or fragment thereof is administered to an individual that is homozygous for GHRfl in an amount greater than the amount of DNA administered to the individual encoding the GHRd3 protein.

Preferably, the medicament is a GH polypeptide or fragment thereof, more preferably a recombinant GH polypeptide or fragment thereof, examples of which are further discussed herein. The recombinant GH polypeptide may be a GHR agonist (eg, for increasing growth or treating obesity) or a GHR antagonist (eg, for treating terminal hypertrophy or giant authentication). As will be further discussed, the response may include changes in kidney or growth rate, obesity (eg, body mass index (BMI)), improvement of symptoms of infection or diabetes, improvement of symptoms of terminal hypertrophy or hyperauthentication, sodium and water Symptoms associated with congestion, metabolic syndrome, mood disorders and sleep disorders, cancer, heart disease and hypertension symptoms, and the like.

In one aspect, the individual may already be suffering from or susceptible to the disease, and may be already being treated, being on therapy, or be a candidate for further treatment. Most preferably, the individual may be suffering from or sensitive to symptoms selected from the group consisting of: short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure. Thus, in a preferred aspect, the present invention provides a method for treating a subject having one or more of the above diseases. Accordingly, the present invention may be aimed at treating patients with a reduced GHR response as defined above according to certain treatment methods.

DNA samples are taken from the individual to be tested to determine whether the DNA encodes a GHRd3 protein. DNA samples are analyzed to determine whether they contain the GHRd3 sequence or if the individual is homozygous for the GHRfl isotype. The DNA encoding the GHRd3 protein is associated with a large positive response to treatment with the drug and the lack of DNA encoding the GHRd3 allele is associated with a reduced positive response compared to GHRd3 individuals.

The methods of the invention can also be used to evaluate and conduct clinical trials of drugs. Thus, the method identifies a first population of individuals that respond positively to the drug and a second population of individuals that respond negatively to the drug or have a reduced positive response to the drug compared to the first population. It includes. In one embodiment, the DNA sample comprises alleles of one or more alleles associated with a positive response to treatment with the drug and / or the negative or reduced positive response to the treatment with the drug. If the allele of one or more alleles involved in the response is included, the drug can be administered to the patient during the clinical trial. In another aspect, the DNA sample comprises one or more alleles of the allele associated with a negative or reduced positive response to treatment with the drug and / or the DNA sample is positive for treatment with the drug Or if the allele of one or more alleles associated with increased positive response is lacking, the drug can be administered to the patient during the clinical trial.

Thus, the methods of the present invention can be used to assess drug efficacy taking into account differences in GHR responses between drug test subjects. If desired, drug efficacy assessment tests may be performed in a population that includes individuals that are likely to respond substantially to the drug, or in a population that includes individuals that are likely to respond to the drug substantially less than other populations. have. For example, GH protein containing compositions can be evaluated in a population of GHRd3 individuals or in a population of GHRfl / fl individuals. In another aspect, it is advantageous to evaluate a drug intended in a population of GHRfl / fl individuals to treat an individual suffering from a decrease in GH response.

Detection of GHRd3 and GHRfl

It is intended to detect nucleotide modifications in particular nucleic acids and, according to the present invention, to identify other variations of the GHR gene (US Pat. No. 4,988,617, incorporated herein by reference). In this regard, a variety of different assays are contemplated, the assays comprising fluorescent in situ hybridization (FISH; US Pat. No. 5,633,365 and US Pat. No. 5,665,549, each incorporated herein by reference), direct DNA Sequencing, PFGE assay, Southern or Northern blotting, single-stranded conformation analysis (SSCA), RNAse protection assay, allele specific oligonucleotides (ASO such as US Pat. No. 5,639,611), dot blast Analytical denaturation gradient gel electrophoresis (eg, US Pat. No. 5,190,856, incorporated herein by reference). RFLP (eg, US Pat. No. 5,324,631, incorporated herein by reference) and PCR-SSCP. Detection and quantification of gene sequences, such as in bodily fluids, is described in US Pat. No. 5,496,699, which is incorporated herein by reference.

Primers and Probes

As defined above, primers are intended to include all nucleic acids capable of priming template-dependent process synthesis of neonatal nucleic acids. Typically, primers are oligonucleotides of 10 to 20 base pairs in length, and longer sequences can be used. The primer may be provided in double stranded or single stranded form, with single stranded form being preferred. Probes may act as primers, but are defined differently. Probes are probably primed, designed to bind to target DNA or RNA, and do not need to be used in the amplification process.

3 and 4 show genomic DNA sequences around exon 3 or the exon 3 deletion site in the GHR gene, respectively. The GHRfl cDNA sequence is shown in SEQ ID NO: 1. In order to detect and distinguish a particular GHR allele in an individual, all differences in the nucleotide sequence between the GHRd3 allele and the GHRfl allele can be used in the methods of the invention. To identify GHRfl genomic DNA or cDNA molecules, primers can be designed to hybridize to exon 3 nucleic acids. To identify GHRd3 genomic DNA, primers or probes are designed to span the junctions of the introns 2 and 3 of the GHR gene as found in the genomic DNA sequence of the GHRd3 allele, resulting in a GHRfl allele comprising exon 3 and exon 3 It may be possible to distinguish between GHRd3 alleles that do not contain. In another example, a GHRd3 cDNA molecule can be identified by designing a primer or probe across the exon 2 and 4 junctions to allow for discrimination between GHTRfl cDNA molecules comprising exon 3 and GHRd3 cDNA molecules without exon 3 have. Other examples of suitable primers for GHRd3 detection are listed in Pantel et al. (Above) and Example 1 described below.

The present invention includes polynucleotides for use as primers and probes in the methods of the present invention. These polynucleotides may consist of, consist essentially of, or consist of sequences (complements) complementary to, as well as contiguous spans of nucleotides of sequences derived from all sequences presented herein. have. An "adjacent range" can be at least 25, 35, 40, 50, 70, 80, 100, 250, 500, or 1000 nucleotides in length, such that adjacent ranges of these lengths match the length of a particular sequence ID. It should be noted that the polynucleotides of the present invention are not limited to having the exact flanking sequence around the target sequence listed in the sequence listing. Rather, it is recognized that contiguous sequences around any one or polymorph of the primer or probe of the invention further away from the marker may be extended or shortened to a degree consistent with their intended use, and the present invention is directed to Specifically predict. It will be appreciated that the polynucleotides cited herein may have any length that matches their intended use. In addition, contiguous sites outside the contiguous range need not necessarily be homologous to native contiguous sequences present in humans. Specifically intended is the addition of all nucleotide sequences that correspond to the intended use of the nucleotide. Preferred polynucleotides consist of, consist essentially of or comprise the contiguous range of nucleotides of the SEQ ID NO: 1, 4 or 6 sequence as well as complementary sequences thereto. The "adjacent range" may be at least 8, 10, 12, 15, 50, 70, 80, 100, 250, 500, or 1000 nucleotides in length.

Probes of the invention can be designed from the sequences described for all methods known in the art, particularly for those that allow for the presence of specific sequences or markers described herein. Preferred probe sets are any means known in the art, for use in the hybridization assays of the present invention, where they selectively bind to one allele of a polymorph and bind to another under any particular set of assay conditions. It can be designed not to.

All polynucleotides of the invention can be labeled by binding a label, if desired, by detectable means by spectroscopic analysis means, photochemical means, biochemical means, immunochemical means or chemical means. For example, useful labels include radioactive materials, fluorescent dyes or biotin. Preferably, the 3 'and 5' ends of the polynucleotides are labeled. Labels can also be used to capture primers to facilitate the fixation of primers or primer extension products, such as amplified DNA, on a solid support. The capture label may be a specific binding agent (eg, biotin and streptavidin) attached to a primer or probe and forming a binding pair with the specific binding agent of the solid phase reagent. Thus, depending on the type of label carried by the polynucleotide or probe, it can be used to capture or detect the target DNA. In addition, it is to be understood that the polynucleotides, primers or probes presented herein can act as capture labels by themselves. For example, where the binding agent of the solid phase reagent is a nucleic acid sequence, it may be selected to bind to the complementary portion of the primer or probe to immobilize the primer or probe on the solid phase. If the polynucleotide probe acts on its own as a binding agent, one of ordinary skill in the art will recognize that the probe will contain sequences or "tails" that are not complementary to the target. . If the polynucleotide itself acts as a capture label, at least a portion of the primer will freely hybridize with the nucleotide on the solid phase. DNA labeling techniques are well known to the skilled artisan.

All polynucleotides, primers and probes of the present invention can be conveniently immobilized on a solid support. Solid supports are well known in the art to which this invention pertains and include microparticles, sheep (or other animal) red blood cells, such as walls of the wells of reaction trays, test tubes, polystyrene beads, magnetic beads, nitrocellulose stripes, membranes, latex particles, etc. , Duracyte, and the like. Solid supports are not critical and may be chosen by one of ordinary skill in the art. Thus, latex particles, fine particles, magnetic or nonmagnetic beads, membranes, plastic tubes, walls of microtiter wells, glass or silicon chips, sheep (or other suitable animal) red blood cells and durasites are all suitable examples. Suitable methods of immobilizing nucleic acids on solid phases include ionic interactions, minority interactions, covalent interactions, and the like. As used herein, solid support means any material that is insoluble or can be made insoluble by subsequent reactions. The solid support can be chosen to be capable of attracting and immobilizing capture reagents in its inherent capacity. Alternatively, the solid phase may be one with additional receptors that have the ability to attract and immobilize the capture reagents. The additional receptor may comprise a charged material conjugated to the capture reagent or a charged material that is oppositely charged relative to the capture reagent itself. As another alternative, the receptor molecule can be any specific binding material that is immobilized or attached on a solid support and that has the ability to immobilize the capture reagents through a specific binding action. The receptor molecule may indirectly bind the capture reagent to the solid support material prior to or during the assay. Thus, the solid phase may be a plastic, derivatized plastic, magnetic or nonmagnetic metal, glass or silicon surface of a test tube, microtiter wells, sheets, beads, fine particles, chips, sheep (or other suitable animal) red blood cells, Durasite and other shapes known to those skilled in the art to which this invention pertains. The polynucleotides of the present invention are attached or immobilized individually on one solid support, or one solid support in a group of 2, 5, 8, 10, 12, 15, 20 or 25 different polynucleotides of the present invention. It can be attached or fixed on the phase. In addition, polynucleotides other than the polynucleotides of the present invention may be attached to the same solid support as one or more of the polynucleotides of the present invention.

All polynucleotides set forth herein may be attached at overlapping regions or at any position on the solid support. Alternatively, the polynucleotides of the present invention may be attached to an alignment array in which each polynucleotide is attached to a separate region that does not overlap with the attachment site of another polynucleotide on the solid support. Desirably, such polynucleotide alignment arrays can be designed to be “addressable” in which distinct distinct positions can be recorded and accessed as part of the analysis process. The addressable polynucleotide array typically includes a number of different oligonucleotide probes that bind to the surface of the substrate at different sites known in the art. The exact location information of each polynucleotide makes these "addressable" arrays particularly useful for hybridization analysis. All addressable array techniques known in the art can be used with the polynucleotides of the present invention. One embodiment of these polynucleotide arrays is known as Genechips and has been generally disclosed in US Pat. Nos. 5,143,854, PCT Publication Nos. 90/15070 and 92/10092. These arrays can generally be produced using mechanical synthesis or light directed synthesis, which can include a combination of photolithography and solid state oligonucleotide synthesis (Fodor et al., Science, 251: 767-777, 1991). Oligonucleotide array immobilization on a solid support is usually accomplished by the development of a technique defined as "Very Large Scale Immobilized Polymer Synthesis" (VLSIPS), which typically immobilizes the probe to a high density array on the solid surface of the chip. It became possible. Examples of VLSIPS techniques are described in US Pat. Nos. 5,143,854, 5,412,087 and PCT Publications WO 90/15070, WO 92/10092 and WO 95/11995, which form oligonucleotide arrays through techniques such as light directed synthesis. A method of doing this is disclosed. In planning the strategy for providing nucleotide arrays immobilized on a solid support, additional presentation strategies have been developed for aligning and displaying nucleotide arrays on a chip with the intention of maximizing hybridization pattern and sequence information. Such presentation strategies are described in PCT publications WO 94/12305, WO 94/11530, WO 97/29212 and WO 97/31256.

Template Dependent Amplification Methods

Many template dependent methods can be used to amplify marker sequences present in a given template sample. One well known amplification method is polymerase chain reaction (PCR), which is described in US Pat. Nos. 4,683,195, 4,683,202, 4,800,159, and "Innis et al., PCR Protocols, Academic Press, Inc. San Diego Calif. , 1990. " Etc., each of which is incorporated herein by reference in its entirety.

Briefly, in PCR, two primer sequences are prepared that are complementary to regions on the complementary strand opposite the marker sequence. For example, an excess of deoxynucleoside triphosphate is added to the reaction mixture with a DNA polymerase such as Taq polymerase. If a marker sequence is present in the sample, the primers will bind to the marker and the polymerase will extend the primer along the marker sequence by adding nucleotides. By raising and lowering the temperature of the reaction mixture, the extended primer is separated from the marker to form the reaction product, the excess primer binds to the marker and the reaction product, and the reaction process will be repeated.

Reverse transcriptase PCR amplification may be performed to quantify the amount of mRNA amplified. Methods for reverse transcription of RNA into cDNA are well known and are described in Sambrook et al., "In: Molecular Cloning. A Laboratory Manual. 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989". Another reverse transcription method is the use of thermostable RNA dependent DNA polymerase. This method is described in WO 90/07641. Polymerase chain reaction methods are well known in the art.

Another amplification method is a ligase chain reaction (LCR), US Pat. Nos. 5,494,810, 5,484,699, EP 320 308, each incorporated herein by reference). For LCR, two complementary probe pairs are prepared, where the target sequences are present, each pair will bind to and contact each other the complementary strands opposite the target sequence. If ligase is present, the two probe pairs will be joined to form a single unit.

The temperature is circulated to separate the linked linking units from the target, as in PCR, and then used as the "target sequence" for linking extra probe pairs. US Pat. No. 4,883,750 describes a method similar to LCR for binding probe pairs to target sequences.

Qbeta Replicase, an RNA derived RNA polymerase, can be used as another amplification method of the present invention. In this method, a replicative RNA sequence having a site complementary to a target site is added to the sample in the presence of an RNA polymerase. The polymerase will replicate the replicative sequence, which will be detectable. Similar methods are also described in US Pat. No. 4,786,600, which is incorporated herein by reference, which relates to recombinant RNA molecules that can serve as templates for the synthesis of complementary single stranded molecules by RNA induced RNA polymerase. The product molecule thus formed may also serve as a template for further copy synthesis of the original recombinant RNA molecule.

Isothermal amplification methods using restriction endonucleases and ligase to amplify target molecules comprising nucleotide 5 '-[alpha-thio] -triphosphate in one strand of a restriction enzyme recognition site Can be used for nucleic acid amplification of the invention (Walker et al., (1992), Proc. Nat'l Acad Sci. USA, 89: 392-396; US Pat. No. 5,270,184, which is incorporated herein by reference). U.S. Patent 5,747,255, incorporated herein by reference, describes isothermal amplification using cleavable oligonucleotides for polynucleotide deletion. In the methods described herein, a separate oligonucleotide population comprising one or more cleavable linkages comprising complementary sequences of each other and cleaved each time a perfectly matched double strand is formed including linkages Presented. When the target polynucleotide contacts the first oligonucleotide, cleavage occurs and produces a first fragment capable of hybridizing with the second oligonucleotide. Upon such hybridization, the second oligonucleotide is cleaved to release a second fragment, which can in turn hybridize with the first oligonucleotide in a manner similar to the target polynucleotide.

Strand Displacement Amplification (SDA) is another method of performing isothermal amplification of nucleic acids involving multiple strand substitutions and synthesis, such as nick translation, for example (US Pat. 5,744,311; 5,733,752; 5,733,733; 5,712,124). A similar method called Repair Chain Reaction (RCR) involves a recovery reaction in which only two of the four bases are present after annealing several probes through the targeted region for amplification. The other two bases can be added as biotinylated derivatives to facilitate deletion. Similar approaches are used for SDA. Target specific sequences can also be detected using a cyclic probe reaction (CPR). For CPR, probes with 3 'and 5' sequences of nonspecific DNA and intermediate sequences of specific DNA hybridize with DNA present in the sample. During hybridization, the reaction is treated with RNaseH and a probe product defined as the unique product released after degradation. The original template is annealed with another circulating probe and the reaction is repeated.

In the present invention, other amplification methods described in British Application No. 2 202 328 and PCT Application No. PCT / US89 / 01025, which are hereby incorporated by reference in their entirety, can be used. In the former application, "modified" primers are used for PCR like, template dependent and enzyme dependent synthesis. Primers can be modified by labels using capture moieties (eg biotin) and / or detector moieties (eg enzymes). In the latter application, excess labeled probe is added to the sample. In the presence of the target sequence, the probes bind and catalytically cleave. After cleavage, the target sequence is released as is and bound by extra probes. Cleavage of the labeled probe is a signal of the presence of the target sequence.

Other nucleic acid amplification processes include nucleic acid sequence based amplification (NASBA) and 3SR (Kwok et al., (1989) Proc. Nat'l Acad. Sci. USA, 86: 1173; and WO 88/10315, fully incorporated herein). And a transcriptional basic amplification system (TAS) comprising a. For NASBA, nucleic acids can be prepared for standard phenol / chloroform extraction, thermal denaturation of clinical samples, lysis buffer treatment, and amplification by minispin columns for separation of guanidium chloride of DNA and RNA or RNA. These amplification techniques involve annealing primers with target specific sequences. After polymerization, DNA / RNA hybrids are treated with RNaseH and double stranded DNA molecules are again thermally denatured. In both cases, a second target specific primer is added to make the single stranded DNA completely double stranded and then polymerized. The double stranded DNA molecule is then multiplexed by an RNA polymerase such as T7 or SP6. In an isothermal circulation reaction, RNA is reverse transcribed into single stranded DNA, converted to double stranded, and then transcribed once again with an RNA polymerase such as T7 or SP6. Whether in truncated or complete form, the resulting product exhibits a target specific sequence.

European Patent No. 329 822 to Davey et al., Incorporated herein by reference in its entirety, involves cyclically synthesizing single stranded RNA (ssRNA), ssDNA and double stranded DNA (dsDNA), which can be used in the present invention. Nucleic acid amplification methods are disclosed. ssRNA is a template for the first primer oligonucleotide, which is extended by reverse transcriptase (RNA dependent DNA polymerase). RNA is then removed from the DNA: RNA double strand obtained by ribonuclease H (a DNARNase specific for a double strand with either RNase H, DNA or RNA). The resulting ssDNA is the template for the second primer, which also includes an RNA polymerase promoter (exemplified by T7 RNA polymerase) 5 'sequence for homology to the template. This primer is then extended by DNA polymerase (exemplified by the large "Klenow" fragment of DNA polymerase I of E. coli), with the same sequence as the original RNA between the primers and at one end of the promoter sequence To generate double stranded DNA (dsDNA) molecules. This promoter sequence can be used to make many RNA copies of DNA by appropriate RNA polymerase. Then, these copies can be re-entered into the circulation, leading to very rapid amplification. By selecting the appropriate enzyme, the amplification can be performed isothermally without adding an enzyme to each cycle. Because of the cyclical nature of the method, the starting sequence can be selected in the form of either DNA or RNA.

The PCT application WO 89/06700 (incorporated herein by reference in its entirety) discloses amplification of nucleic acid sequences based on hybridization of a promoter / primer sequence with a target single stranded DNA (ssDNA), followed by a plurality of RNA copies of the sequence. Start the transfer. This scheme is acyclic, ie no new template is produced from the RNA transcript product. Other amplification methods include "RACE" and "one-sided PCR" (Frohman "In: PCR Protocols. A Guide To Methods And Applications, Academic Press, NY, 1990; and O'hara et al., (1989) Proc. Nat'l Acad. Sci. USA, 86: 5673-5677; each of which is incorporated by reference in its entirety).

Methods based on linking two (or more) oligonucleotides in the presence of a nucleic acid having the sequence of "dioligonucleotides" obtained to amplify said dioligonucleotides may also be used in the amplification step of the present invention (Wu et al. , (1989) Genomics, 4: 560, incorporated herein by reference).

Southern / Northern Blotting

Blarting techniques are well known to those of ordinary skill in the art. Southern blotting uses DNA as a target, while northern blotting uses RNA as a target. cDNA blotting is similar in many respects to blotting or RNA species, but each provides a different type of information.

In short, probes are used to target DNA or RNA species immobilized on appropriate matrices, sometimes nitrocellulose filters. Different species must be spatially separated for ease of analysis. This can often be accomplished by gel electrophoresis of nucleic acid species followed by "blotting" onto a filter.

The blasted target is then incubated with the (generally labeled) probe under conditions that promote denaturation and rehybridization. Since the probe is designed with base pairs with the target, the probe will bind to a portion of the target sequence under denaturing conditions. The unbound probe is then removed and the detection is completed as described above.

Separation

In a single step or other steps, it is generally desirable to separate the amplification products from excess primers to determine whether template and specific amplification has occurred. In one embodiment, the promoted product is separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods. See Sambrook et al., 1989.

Alternatively, it can be separated using chromatography techniques. There are many kinds of chromatography that can be used in the present invention: including absorption chromatography, partition chromatography, ion exchange chromatography and molecular sieve chromatography, and column chromatography, paper chromatography, thin layer chromatography and gas chromatography. Many special techniques for using them (Freifelder. Physical Biochemistry Applications to Biochemistry and Molecular Biology, 2nd ed. Wm. Freeman and Co., New York, NY, 1982).

Detection method

The product can be visualized to confirm amplification of the marker sequence. One typical visualization method involves dyeing the gel using ethidium bromide and visualizing it under UV light. Alternatively, if the amplification product is internally labeled with radiolabeled or fluorescently labeled nucleotides, the amplification product may be exposed or visualized on the x-ray film under an appropriate stimulus spectrum after separation.

In one embodiment, it may be indirectly visualized. After isolation of the amplification product, the labeled nucleic acid probe is contacted with the amplified marker sequence. It is preferred to conjugate the probe with a chromophore, but can also be radiolabelled. In another embodiment, the probe is conjugated with a binding partner such as an antibody or biotin, and other members of the binding pair have a detectable moiety.

In one embodiment, detection is performed using labeled probes. The techniques used are well known to those of ordinary skill in the art and can be found in many standard books on molecular protocols. See Sambrook et al., 1989. For example, chromophores or radiolabeled probes or primers identify targets during or after amplification.

One example of such is described in US Pat. No. 5,279,721, incorporated herein by reference, which discloses an apparatus and method for automated electrophoresis and nucleic acid delivery. The device enables electrophoresis and blotting without external manipulation of the gel and is ideally suited for carrying out the method of the invention.

In addition, various types of mutations can be identified by sequencing the amplification products described above using standard sequencing methods. Within certain methods, complete analysis of genes is performed by sequence analysis using primer sets designed for optimal sequencing (Pignon et al. (1994) Hum. Mutat., 3: 126-132, 1994). The present invention provides methods in which any or all of these types of assays can be used. Using the sequences described herein, oligonucleotide primers can be designed to allow for amplification of sequences through the GHR gene, which can then be analyzed by direct sequencing.

All the diversified sequencing reactions known in the art can be used to directly sequence the GHR gene by comparing the sample sequence to the corresponding wild type (control) sequence. Examples of sequencing reactions are those based on techniques developed by Maxam and Gilbert (1977, Proc. Natl. Acad. Sci. USA 74: 560) or Sanger (1977, Proc. Natl. Acad. Sci. USA 74: 5463). Include. It is also anticipated that all of the various automatic sequencing methods can be used in performing diagnostic analysis.

Kit components

All essential materials and reagents required for detecting and sequencing GHR and its variants can be aggregated in one kit. This will generally include preselected primers and probes. In order to provide the reaction mixture required for amplification, enzymes, deoxynucleotides and buffers suitable for nucleic acid amplification such as various polymerases (RT, Taq, Sequence, etc.) may also be included. Such kits will also generally include, in appropriate manner, separate containers for each individual reagent and enzyme and for each primer or probe.

Design and Theoretical Considerations for Relative Quantitative RT-PCR ^TM .

RNA can be reverse transcribed (RT) into cDNA and then subjected to relative quantitative PCR (RT-PCR) to determine the relative concentration of specific mRNA species isolated from the patient. By measuring varying concentrations of specific mRNA species, it has been shown that genes encoding specific mRNAs are expressed differently. Quantitative PCR can include, for example, patients to be treated with agents acting through the GHR pathway, suspected of having reduced GHR activity, or preferably short stature, obesity, infection or diabetes; Giant or terminal hypertrophy, which may be associated with milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium and water; Metabolic syndrome; It can be used to investigate the relative concentrations of GHRd3 and GHRfl mRNAs in patients suffering from mood and sleep disorders, cancer, heart disease or hypertension.

For PCR, the number of target DNA molecules amplified increases about two times in each cycle of the reaction until some reagent is depleted. The amplification rate then decreases until there is no increase in the amplified target between cycles. When plotting the graph so that the X axis is the number of cycles and the Y axis is the logarithm of the amplified target DNA concentration, the plotted points form a characteristic curve. Starting with the first cycle, the slope of the line is positive and constant. This means the linear part of the curve. After the reagent runs out, the slope of the line decreases and eventually goes to zero. At this point, the concentration of amplified target DNA approaches some fixed value. This means the flat part of the curve.

The concentration of target DNA in the linear portion of the PCR amplification is directly proportional to the initial target concentration before the start of the reaction. By measuring the concentration of the amplification product of the target DNA in a PCR reaction where the same number of cycles have been completed and in the linear range, it is possible to determine the relative concentration of a particular target sequence in the original DNA mixture. If the DNA mixture is cDNA synthesized from RNA isolated from different tissues or cells, the relative abundance of the particular mRNA from which the target sequence is derived can be measured for each tissue or cell. The direct proportion between these PCR product concentrations and relative mRNA excess is true only in the linear range of the PCR reaction.

The final concentration of target DNA in the flat portion of the curve is determined by the solubility of the reagents in the reaction mixture and depends on the original concentration of the target DNA. Thus, the first condition that must be met before the relative excess of mRNA species, which can be determined by RT-PCR for the collection of RNA populations, is that the concentration of the amplified PCR product should be sampled when the PCR reaction is in the linear portion of the curve. will be.

The second condition that must be met in the RT-PCR experiment to successfully measure the relative excess of a particular mRNA species is that the relative concentration of amplified cDNA must be standardized on several independent criteria. The purpose of the RT-PCR experiment is to determine the excess of a particular mRNA species with respect to the average overvalue of all mRNA species in the sample. In the experiments described below, mRNAs for GHRfl can be used as a standard to compare the relative excess of GHRd3 mRNA.

Most protocols for competitive PCR use internal PCR standards that are roughly the same as the target. These schemes are effective when PCR amplification products are sampled during the linear phase. If the product was sampled when the reaction reached the knitting machine, there would be a relatively excess of less excess product. As in the case of investigating the unusual expression of RNA samples, the comparison of relative excesses performed on many different RNA samples is skewed such that differences in the relative excesses of RNAs appear less than they actually are. If the internal standard is much larger than the target, this is not a big problem. If there are more internal standards than the target, direct linear comparisons between RNA samples can be performed.

The discussion above describes the theoretical considerations for RT-PCR analysis of clinically derived materials. Problems inherent in clinical samples are that their amounts vary (causing standardization problems) and their quality varies (preferably co-amplification of a reliable internal control that is larger than the target). RT-PCR is a relative quantitative RT- using an internal standard wherein the internal standard is an amplifiable cDNA fragment with a larger size than the target cDNA fragment, and the excess of the mRNA encoding the internal standard is about 5 to 100 times greater than the mRNA encoding the target. When performed as a PCR, all these problems are solved. This analysis measures the relative excess of each mRNA species, not the absolute excess.

Other studies can be conducted using more typical relative quantitative RT-PCR assays using external standard protocols. This analysis samples the PCR product in the linear portion of the amplification curve. The number of PCR optimized for sampling should be determined experimentally for each target cDNA fragment. In addition, the reverse transcriptase products of each RNA population isolated from various tissue samples should be carefully normalized for equivalent concentrations of amplifiable cDNA. This concentration is very important because the assay measures absolute mRNA excess. Absolute mRNA excess is used as a measure of specific gene expression only in normalized samples. While the experimental determination of the linear range of normalization and amplification curves of cDNA preparations is a delayed and time consuming process, the RT-PCR analysis obtained is superior to that obtained from relative quantitative RT-PCR using internal standards.

One reason for this advantage is that, without internal standards / competitors, all reagents can be converted to a single PCR product in the linear range of the amplification curve, thus increasing the sensitivity of the assay. Another reason is that the display of the product in an electrophoretic gel or other display method using only one PCR product is less complex, has less background and is easier to understand.

Chip technology

Chip based DNA techniques such as those described in Hacia et al. (1996, Nature Genetics, 14: 441-447) and Shoemaker et al. (1996, Nature Genetics 14: 450-456) are particularly contemplated techniques in the present invention. In short, these techniques involve quantitative methods for analyzing large quantities of genes quickly and accurately. By labeling genes with oligonucleotides or using immobilized probe arrays, chip techniques can be used to isolate target molecules as high density arrays and screen these molecules based on hybridization. Pease et al. (1994, Proc. Nat'l Acad Sci. USA, 915022-5026); See Fodor et al. (1991, Science, 251: 767-773).

How to detect GHRd3 or GHRfl protein

Through techniques such as ELISA and Western blotting, antibodies can be used to characterize GHRd3 and / or GHRfl content in healthy and diseased tissues. Methods of obtaining GHRd3 and GHRfl polypeptides are described in detail herein and can be performed using known methods. Likewise, methods of preparing antibodies capable of selectively binding to GHRd3 and GHRfl isoforms are also described in detail.

In one embodiment, it is contemplated to use GHR antibodies, including GHRd3, GHRfl and GHR antibodies that do not identify GHRd3 and GHRfl, for ELISA measurements. For example, anti-GHR antibodies are immobilized on selected surfaces, preferably on surfaces that exhibit protein affinity, such as polystyrene microtiter plate wells. After washing to remove incompletely adsorbed material, it is recommended to bind or coat this measurement plate with a nonspecific protein known to be antigenically neutral with respect to the test antiserum, such as bovine serum albumin (BSA), casein or milk powder solution. desirable. This can block nonspecific adsorption sites on the immobilized surface and thus reduce the background due to nonspecific binding of the antigen to that surface.

The antibody is bound to the wells, coated with non-reactive material to reduce background and washed to remove unbound material, and then the fixed surface is contacted with the sample to be tested to form an immune complex (antigen / antibody).

After specific immunocomplex formation and subsequent washing between the test sample and the binding antibody, whether and even even the amount of immunocomplex formation can be determined by treating it with a second antibody specific for GHR, unlike the first antibody. have. Suitable conditions preferably include diluting the sample with diluents such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS) / Tween. These added agents also tend to reduce the nonspecific background. The antiserum forming the layer is then incubated for about 2 to about 4 hours, preferably at about 25 to 27 ° C. After incubation, the surface contacted with the antiserum is cleaned to remove non-immune complex material. Preferred cleaning processes include cleaning with a solution such as PBS / Tween or borate buffer.

In order to provide a detection means, it is preferred that the second antibody has a binding enzyme that exhibits a color reaction when incubated with a suitable color substrate. Thus, for example, it may be desirable to contact and incubate the second antibody binding surface with an anti-human IgG conjugated with urease or peroxidase for conditions and duration suitable for immunocomplex formation (eg, such as PBS / Tween). Incubate for 2 hours at room temperature in PBS containing solution).

After incubation with an antibody designated as the second enzyme and washed to remove unbound material, urea and bromocresol purple or 2,2'-azido-di- (3-ethyl-benzthiazoline) -6 Label amount is quantified by incubation with a chromogenic substrate such as sulfonhan (ABTS) and H ₂ O ₂ (when peroxidase is used as the enzyme label). Subsequently, quantitation is performed by measuring the color development, for example using a spectral spectrophotometer which is visually inspectable.

The above-described format may be modified by first coupling the sample with the measurement plate. In this case, the primary antibody is incubated with the measurement plate and the bound primary antibody is measured using a labeled secondary antibody having specificity for the primary antibody.

Many other useful immunodetection processes are described in scientific literature, such as Nakamura et al., In: Handbook of Experimental Immunology (4th edition), Weir. E., Herzenberg, L. A. Blackwell, C., Herzenberg, L. (edit). Vol. Chapter 27, Blackwell Scientific Publ. , Oxford, 1987, all of which are incorporated herein by reference. Immunoassays are binding assays in the simplest and most straightforward sense. Some preferred immunoassays are radioimmunoassay (RIA) and immunobead capture assay. Immunohistochemical screening using tissue-sections is also particularly useful. However, it will be readily appreciated that such a search method is not limited to this technique, and that Western blotting, dot blotting, FACS measurement, and the like can also be used in connection with the present invention.

In a preferred embodiment, GHRd3-specific antibodies can be used to measure GHRd3 concentrations using the methods described above. In another method, the total amount of GHR is measured and the amount of GHRfl is measured without distinguishing between GHRd3 and GHRfl. The difference in the amount of undifferentiated GHR and GHRfl is the amount of GHRd3 present.

Preferably, this method detects the amount of GHBP (eg extracellular portion of GHRd3 or GHRfl) in circulation. Preferred examples of this process enable the retrieval of undifferentiated GHR (such as to deduce GHRd3 from undifferentiated total GHR over GHRfl), the retrieval of GHRd3 and / or the retrieval of GHRfl. Such processes include ELISA measurements, ligand mediated immune function measurements (LIFA) and radioimmunoassay (RIA).

Pflaum et al. ((1993) Exp. Clin. Endocrinol. 101 (Suppl. 1): 44) and Kratzsch et al. ((2001) Clin. Endocrinol. 54 to detect undifferentiated GHR (eg GHRd3 or GHRfl). LIFA can be performed according to the method of (61-68). Briefly, in one example, undifferentiated GHR is detected using monoclonal antirGHBP antibodies to coat microtiter plates. Serum samples or glycosylated rGHBP standards are incubated with 10 ng / well hGH and monoclonal antibodies directed against hGH as biotinylation tracers. This signal is amplified by the Europium labeled streptavidin system and measured using a fluorometer. In another example, to search for undifferentiated GHBP as described in Kratsch et al. ((1995) Eur. J. Endocrinol. 132: 306-312), ¹²⁵ I-rhGHBP, antirhGHBP antibody as a labeled antigen, and Competitive radioimmunoassay (RIA) is performed using the rhGHBP standard.

In another example described in Kratsch et al. ((2001) Clin. Endocrinol. 54: 61-68), binding to GHBP outside the hGH binding site (Rowlinson et al. (1999)) in 50 mmol / l sodium phosphate buffer, pH 9.6. Undifferentiated GHBP is detected by coating the microtiter plate with 100 μl of monoclonal antibody 10B8, followed by 75 μl of measurement buffer (50 mM Tris- (hydroxymethyl) -aminomethane, 150 mM NaCl, 0.05 % NaN ₃ , 0.01% Tween 40, 0.5% BSA 0.05% bovine gamma globulin, 20 μmol / l diethylenetriaminepenta acetic acid) 25 μl sample or standard and 50 ng biotin-labeled anti-GHGBP mAb 5C6 (gGH Incubation overnight is added by addition of a binding site (which binds GHBP in Rowlinson et al. (1999).) The amount of GHRfl is then determined using an antibody specific for exon 3-containing fl type of GHBP. As in the case of the microtiter plate Fix mAb 10B8 in. After the washing step, add 25 μl of sample or 75 μl of rabbit polyclonal antibody to GHRd3 peptide as described in Standard and Kratsch et al. (2001) and incubate overnight. Biotinylated rat anti-rabbit IgG is added, incubated for 2 hours and then rinsed repeatedly, amplified by the europium-labeled streptavidin system and measured using a fluorometer. Recombinant aglycosylated hGHBP is used as a standard.

Antibodies specific for GHRd3 to be used in the present invention can be obtained by known methods. The isolated GHRd3 protein, or part or fragment thereof, is used as an immunogen to make antibodies that bind to GHRd3 using standard techniques for the production of polyclonal and monoclonal antibodies. GHRd3 protein may be used, or the present invention provides an antigenic peptide fragment of GHRd3 for use as an immunogen.

GHRd3 polypeptides can be purified from known means, such as biological samples obtained from an individual, or more preferably from recombinant polypeptides. The GHRfl amino acid sequences are shown in SEQ ID NOS: 2 and 3, with GHRd3 being the difference in that the 22 amino acids encoded by exon 3 are deleted. The antigenic peptide of GHRd3 preferably comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NOS: 2 and 3, wherein at least one amino acid is outside of said exon 3-coded amino acid residue. The antigenic peptide encompasses an epitope of GHRd3 and the antibodies raised against this peptide form a specific immune complex with GHRd3. Preferably, the antibody binds selectively or preferentially to GHRd3 and does not actually bind to GHRfl. Preferably, the antigenic peptides comprise at least 10 amino acid residues, more preferably at least 15 amino acid residues, more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.

Preferred epitopes encompassed by antigenic peptides are GHRd3 bands located on the surface of the protein: for example, hydrophilic bands.

GHRd3 immunogens are generally used to prepare antibodies by immunizing a suitable subject (such as a rabbit, goat, mouse or other mammal) with an immunogen. Suitable immunogenic agents are, for example, recombinantly expressed GHRd3 proteins or chemically synthesized GHRd3 polypeptides. This formulation further comprises an adjuvant, Freund's complete or incomplete adjuvant or immunostimulant. Immunizing an appropriate subject with an immunogenic GHRd3 agent induces a polyclonal anti-GHRd3 antibody response.

Thus, another aspect of the invention relates to anti-GHRd3 antibodies. The term "antibody" as used herein refers to a molecule containing an immunoglobulin molecule and an immunologically chemical moiety of an immunoglobulin molecule, ie, an antigen binding site that specifically binds (immunizes) an antigen, such as GHRd3. The immunologically active portion of the immunoglobulin molecule includes F (ab) and F (ab ') ₂ fragments that can be produced by treating the antibody with an enzyme such as pepsin. The present invention provides polyclonal and monoclonal antibodies that bind GHRd3. As used herein, the term "monoclonal antibody" or "monoclonal antibody composition" refers to a population of antibody molecules containing only one antigen binding site capable of immunoreacting with a particular epitope of GHRd3. Thus monoclonal antibody compositions generally exhibit a single binding affinity for a particular GHRd3 protein that immunoreacts with it.

The present invention relates to a sequence of at least 6, preferably at least 8 to 10 amino acids, more preferably at least 12, 15, 20, 25, 30, 45, 50, or 100 amino acids of SEQ ID NO: 2 or 3 A polyclonal or monoclonal antibody composition that can selectively bind or selectively bind to an epitope containing polypeptide comprising a span, wherein the continuous span is preferably encoded by exon 3 of the GHR gene. And at least one amino acid outside of the 22 amino acid span.

Polyclonal anti-GHRd3 antibodies can be prepared by immunizing an appropriate subject with a GHRd3 immunogen, as described above. Anti-GHRd3 antibody titers of immunized subjects can be monitored over time by standard techniques such as enzyme-linked immunosorbent assay (ELISA) using immobilized GHRd3. If desired, antibody molecules directed against GHRd3 are isolated from mammals (such as from blood) and further purified by known techniques such as Protein A chromatography to obtain IgG fractions. After immunization, when the appropriate time, eg, anti-GHRd3 antibody titer, peaks, antibody producing cells are obtained from the subject, such as the hybridoma technique first described by Kohler and Milstein (1975) Nature 256: 495-497). Standard techniques (eg Brown et al. (1981) J. Immunol. 127: 539-46; Brown et al. (1980) J. Biol. Chem. 255: 4980-83; Yeh et al. (1976) PNAS 76: 2927-31; and Yeh (1982) Int. J. Cancer 29: 269-75), more recent human B cell hybridoma technology (Kozbor et al. (1983) Immunol Today 4:72), EBV-hybridoma technology (Cole et al. (1985)) , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques can be used to prepare monoclonal antibodies. Techniques for producing monoclonal antibody hybridomas are well known (generally in RH Kenneth, Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, NY (1980); EA Lemer (1981) Yale J. Biol. Med., 54: 387-402; see ML Gefter et al. (1977) Somatic Cell Genet. 3: 231-36). Briefly, lymphocytes (generally splenocytes) and immortal cell lines (generally myeloma) from mammals immunized with a GHRd3 immunogen as described above are fused, and the culture supernatants of the resulting hybridoma cells are screened to bind to GHRd3. To identify hybridomas producing monoclonal antibodies.

For the purposes of anti-GHRd3 monoclonal antibody production, many known protocols used for fusion of lymphocytes and immortalized cell lines can be applied (eg, G. Galfre et al. (1977) Nature 266: 55052; Somatic Cell Genet., Gefter et al., Lerner, Yale J Biol.Med, supra; Kenneth, Monoclonal Antibodies, supra. In addition, those skilled in the art will understand that many other variations may be useful. In general, immortalized cell lines (such as myeloma cell lines) are derived from the same mammalian species as lymphocytes. For example, lymphocytes from mice immunized with the immunogen agent of the present invention can be fused with immortalized mouse cell lines to create mouse hybridomas. Preferred immortalized cell lines are mouse myeloma cells susceptible to culture medium (“HAT medium”) containing hypoxanthine, aminopterin and thymidine. Any number of myeloma cells, such as, for example, P3-NSI / 1-Ag4-1, P3-x63-Ag8.653 or Sp2 / O-Agl4 myeloma cells, can be used as a fusion partner according to this standard technique. These myeloma cell lines are available from ATCC. Generally, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (“PEG”). Hybridoma cells resulting from this fusion are selected using HAT medium, which kills unfused or non-productive fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing monoclonal antibodies of the invention are detected by screening hybridoma culture supernatants for antibodies that bind GHRd3 (eg, standard ELISA assays).

As an alternative to the preparation of hybridomas that secrete monoclonal antibodies, binding to GHRd3 is achieved by identifying monoclonal anti-GHRd3 antibodies and screening and separating GHRd3 and recombinant complex immunoglobulin libraries (such as antibody phage display libraries). Immunoglobulin library members are isolated. Kits for preparing and screening phage display libraries are commercially available (eg, Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and Stratagene SurfZAP.TM. Phage Display Kit, Catalog No. 240612). In addition, examples of methods and reagents that are particularly suitable for use in preparing and screening antibody display libraries are described, for example, in US Pat. 5,223, 409; Kang et al. PCT international publication No. WO 92/18619; PCT International Publication No. WO 91/17271; Winter et al. PCT International Publication No. WO 92/20791; PCT International Publication No. WO 92/15679; Breitling et al. PCT International Publication WO 93/01288; PCT International Publication No. McCafferty et al. WO 92/01047; PCT International Publication No. WO 92/09690; Ladner et al. PCT International Publication No. WO 90/02809; Fuchs et al. (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffiths et al. (1993) EMBO J 12: 725-734; Hawkins et al. (1992) J. Mol. Biol. 226: 889-896; Clarkson et al. (1991) Nature 352: 624-628; Gram et al. (1992) PNAS 89: 3576-3580; Garrad et al. (1991) Bio / Technology 9: 1373-1377; Hoogenboom et al. (1991) Nuc. Acid Res. 19: 4133-4137; Barbas et al. (1991) PNAS 88: 7978-7982; And cCafferty et al. Nature (1990) 348: 552-554.

Anti-GHRd3 antibodies (such as monoclonal antibodies) can be used to separate GHRd3 by standard techniques such as affinity chromatography or immunoprecipitation. Anti-GHRd3 antibodies facilitate the purification of native GHRd3 from cells and the purification of recombinantly produced GHRd3 expressed in host cells. In addition, anti-GHRd3 antibodies can be used to detect GHRd3 protein (eg, in cell lysates or cell supernatants) to assess the expression pattern and abundance of GHRd3 protein. For example, anti-GHRd3 antibodies can be used diagnostically to monitor protein concentrations in tissues as part of a clinical test process, to measure efficacy of a given treatment regimen. Searching can be facilitated by coupling (ie, physically binding) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, galactosidase or acetylcholinesterase; Examples of suitable prosthetic complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, monochloro chloride or phycoerythrin; Examples of luminescent materials include luminol; Examples of bioluminescent materials include luciferase, luciferin and equarin, and examples of suitable radioactive materials include ¹²⁵ I, ¹³¹ I, ³⁵ S or ³ H.

In a preferred embodiment, substantially pure GHRd3 protein or polypeptide is obtained. Protein concentration in the final formulation is adjusted by concentrating to levels of several micrograms per ml, for example using an Amicon filter device. Monoclonal or polyclonal antibodies to proteins can be prepared as follows: Monoclonal antibody production by hybridoma fusion monoclonal antibodies to epitopes in GHRd3 or portions thereof is a classic method of Kohler and Milstein. (Nature, 256: 495, 1975) or induction modifications thereof (Harlow and Lane, Antibodies A Laboratory Manual, Cold Spring Harbor Laboratory, pp. 53-242,1988).

Briefly, mice are inoculated repeatedly with several micrograms of GHRd3 or portions thereof over several weeks. Mice are then sacrificed and antibody-producing cells in the spleen are isolated. These splenocytes are fused with mouse myeloma cells using polyethylene glycol and the unfused excess cells are destroyed by culturing in a selection medium (HAT medium) system containing aminopterin. Dilute the successfully fused cells and continue the incubation by diluting aliquots into the wells of the microtiter plate. Engvall, E., Meth. Enzymol. As first described in 70: 419 (1980), antibody producing clones are identified by antibody detection in supernatants of wells by immunoassay processes such as ELISA. Selected positive clones are amplified and their monoclonal antibody products are harvested. Detailed procedures for preparing monoclonal antibodies are described in Davis, L. et al. Basic Methods in Molecular Biology Elsevier, New York. It is described in Section 21-2.

The antibody compositions of the invention are particularly useful for immunoblot or western blot assays. This antibody may be useful as a high affinity primary reagent for the identification of proteins immobilized on solid support matrices such as nitrocellulose, nylon or combinations thereof. In immunoprecipitation and subsequent gel electrophoresis, they can be used as a single process reagent used to search for antigen, causing a secondary background to it, resulting in poor background used in antigen search. In this regard, immunologically based screening methods, used in conjunction with western blotting, are particularly contemplated using enzymatically, radiolabeled or fluorescently tagged secondary antibodies for the toxin moiety. Literature related to such labels is described in US Pat. 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241, each of which is incorporated herein by reference in its entirety. Of course, as is known in the art, additional advantages may be obtained when using secondary binding ligands such as second antibodies or biotin / avidin ligand binding arrangements.

The GH to be used according to the invention may be of natural sequence or in variant form, or may be made by natural, synthetic or recombinant. Examples include human growth hormone (hGH), which is a native sequence or recombinant GH (GENOTROPIN ^™ , somatotropin or somatropin) with human sequences, and somatrem, somatotropin and somatropin. And recombinant growth hormone (rGH), which refers to all GH or GH variants produced by recombinant DNA technology means. Preferred for use with humans is a recombinant human native sequence, mature GH, with or without methionine at its N-terminus. Most preferred is GENOTROPIN ^™ (Pharmacia, USA), a recombinant human GH polypeptide. Also preferred are methionyl human growth hormone (met-hGH) produced in E. coli, for example according to the process described in US Pat. No. 4,775,465 to July 5, 1988 and Nature, 282: 544 (1979) to Goeddel et al. Met-hGH sold by PROTROPIN ^™ (Genentech, Inc. USA) is identical to the native polypeptide, except that an N-terminal methionine residue is present. Another example is recombinant hGH sold as NUTROPIN ^™ (Genentech, Inc., USA). This latter hGH lacks this methionine residue and has the same amino acid sequence as the natural hormone. Gray et al., Biotechnology 2: 161 (1984). Another example of GH is the hGH variant, a placental form with pure chainability with no lactogenic activity as described in US Pat. No. 4,670,393. Also included are GH variants such as those described, for example, in WO90 / 04788 and WO92 / 09690.

Other examples include GH compositions that act as GHR antagonists such as pegbisorment (SOMAVERT ^™ , Pharmacia, USA) that can be used to treat terminal hypertrophy.

GH can be delivered directly to a subject using any suitable technique, such as parenteral, nasal, pulmonary, oral, or absorption through the skin. They can be administered locally or systemically. Examples of oral administration include subcutaneous, intramuscular, intravenous, intraarterial and intraperitoneal administration. Preferably they are administered by subcutaneous injection daily.

Considering the clinical symptoms of the subject (especially side effects of GH alone treatment), the site of administration of the GH composition (s), the method of administration, the dosing schedule, and other variables known to the practitioner, the GH to be used in the therapy should be considered for good medical care. Dosing in the following manner. For the purposes of the present invention the "effective amount" of each component is therefore determined based on these considerations and is an amount that increases the growth rate of the subject.

For GH, preferably more than about 0.2 mg / kg / week, more preferably more than about 0.25 mg / kg / week, more preferably about 0.3 mg / kg / week Is administered. In one embodiment, the dosage of GH is about 0.3-1.0 mg / kg / week and in another embodiment 0.35-1.0 mg / kg / week.

Preferably, GH is administered subcutaneously once a day. In a preferred aspect, the dosage of GH is about 0.001 to 0.2 mg / kg / day. More preferably, the dosage of GH is about 0.010 to 0.10 mg / kg / day.

As noted above, subjects homozygous or heterozygous for the GHRd3 allele are expected to have a higher positive response to GH treatment than subjects homozygous for the GHRfl allele. In a preferred aspect, the dosage for a subject heterozygous for the GHRfl allele is preferably higher than for a subject homozygous or heterozygous for the GHRd3 allele.

GH is appropriately administered continuously or discontinuously in a specific dosage form (eg, once daily), with an increase in plasma GH concentration at the time of injection and a decrease in plasma GH concentration at the next injection. . Another discontinuous administration method is to perform discontinuous administration by using PLGA microspheres and PLGA microspheres with various implantation devices that release the active component discontinuously, such as by releasing the active ingredient after a period of time after initial release. You may. See US Patent 4,767,628.

GH may also be administered to be present continuously in the blood, in a manner that is maintained throughout the administration period of GH. This is most preferably achieved by continuously injecting via a minipump such as an osmotic minipump. Alternatively, it is also suitable to perform by frequently injecting GH (ie more than once a day, such as twice a day, or three times a day).

In another embodiment, GH can also be administered using a sustained GH composition that delays GH clearance from the blood or slowly releases GH, eg, from the site of injection. Sustainable formulations that delay plasma clearance of GH are macromolecules whose binding proteins (WO92 / 08985) or water soluble polymers are selected from PEG and polypropylene glycol homopolymers and polyoxyethylene polyols, ie, macromolecules soluble in water at room temperature. It may be in the form of GH complexed with a molecule or covalently conjugated to such a macromolecule (by reversible or irreversible binding). Alternatively, GH can bind to or complex with the polymer to increase its circulating half-life. Examples of polyethylene polyols and polyoxyethylene polyols useful for this purpose include polyethylene glycerol, polyethylene glycol, polyoxyethylene sorbitol, polyoxyethylene glucose and the like. The glycerol backbone of polyoxyethylene glycerol is the same backbone as occurs in mono, di and triglycerides, for example in animals and humans.

The polymer does not have to have a specific molecular weight, but is preferably in the range of about 3500 to 100,000, more preferably 5000 to 40,000. Preferably, the PEG homopolymer is preferably unsubstituted, but one end thereof may be substituted with an alkyl group. Preferably, the alkyl group is preferably a C1-C4 alkyl group and most preferably a methyl group. Most preferably, the polymer is an unsubstituted homopolymer of PEG, a monomethyl substituted homopolymer of PEG (mPEG), or polyoxyethylene glycerol (POG) and a molecular weight of about 5000 to 40,000.

GH covalently binds to terminal reactive groups on a polymer via one or more amino acid residues of GH, primarily depending on reaction conditions, molecular weight of the polymer, and the like. Polymers having reactive group (s) are referred to herein as activated polymers. Reactive groups selectively react on free amino acids or other reactive groups on GH. However, the type and amount of reactive groups selected for optimal results and the type of polymer used will depend on the specific GH used to avoid reacting the reactive group with too many particularly active groups on the GH. However, since it may not be possible to avoid this completely, it is generally recommended to use about 0.1 to 1000 moles, preferably 2 to 200 moles, of activated polymer per mole of protein, depending on the protein concentration used. The final amount of activated polymer per mole of protein is a balance to maintain optimal activity while simultaneously optimizing the circulating half-life of the protein if possible.

The residue may be any reactive amino acid on the protein, for example one or two cysteine or N-terminal amino acid groups, but preferably the reactive amino acid is linked to the reactive group of the activated polymer via its free epsilon-amino group, Or glutamic acid or aspartic acid linked to the polymer via an amide bond.

The covalent modification reaction is preferably carried out at about pH 5-9, more preferably at pH 7-9 by any suitable method generally used to react biologically active substances with inert polymers if the reactive group on GH is a lysine group. Happens. In general, this process produces an activating polymer (having at least one terminal hydroxyl group), preparing an active substrate from the polymer, and then reacting the GH with the active substrate to produce a GH suitable for formulation. Including the process. The modification reaction may be carried out by various methods which may include one or more processes. Examples of modifiers that can be used to prepare the activated polymer in a one-step process reaction include cyanuric acid chloride (2,4,6-trichloro-S-triazine) and cyanuric acid fluoride.

In one embodiment, this modification reaction first reacts the polymer with an acid anhydride such as succinic anhydride or glutaric anhydride to form a carboxylic acid, which then reacts with a compound capable of reacting with the carboxylic acid to Gh. This occurs in a two step process of forming a homopolymerized polymer having a reactive ester group capable of reacting with. Examples of such compounds include N-hydroxysuccinimide, 4-hydroxy-3-nitrobenzene sulfonic acid, and the like, and N-hydroxysuccinimide or 4-hydroxy-3-nitrobenzene sulfonic acid is used. It is desirable to. For example, monomethyl substituted PEG can be reacted with glutaric anhydride for 4 hours at high temperature, preferably about 100-110 ° C. The monomethyl PEG-glutaric acid thus obtained is reacted with N-hydroxysuccinimide in the presence of a carbodiimide reagent such as dicyclohexyl or isopropyl carbodiimide to produce an activated polymer, methoxypolyethylene glycolyl-N-succinate. Imidyl glutarate can be obtained and reacted with GH. This method is described by Abuchowski et al., Cancer Biochem. Biophys., 7: 175-186 (1984). In another example, monomethyl substituted PEG is reacted with glutaric anhydride followed by 4-hydroxy-3-nitrobenzene sulfonic acid (HNSA) in the presence of dicyclohexyl carbodiimide to obtain an activated polymer. HNSA is described in Bhatnagar et al., Peptides: Synthesis-Structure-Function, Proceedings of the Seventh American Peptide Symposium, Rich et al.- (eds.) (Pierce Chemical Co., Rockford, Ill., 1981), p. 97-100, and Nitecki et al., High-Technology Route to Virus Vaccines (American Society for Microbiology: 1986) title: "Novel Agent for Coupling Synthetic

Peptides to Carriers and Its Applications. "

Particular methods of preparing GH conjugated to PEG include US Pat. No. 4,179,337 for PEG-GH and US Pat. No. 4,935,465 describing PEG reversibly, but covalently, bound to GH. .

GH can also be suitably administered as a sustained release system. Examples of sustained release compositions useful in the present invention include semipermeable polymer matrices in the form of shaped articles such as films or microcapsules. Sustained release matrices include polylactide (US Pat. No. 3,773,919, EP 58,481), L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al., Biopolymers, 22, 547-556 (1983), poly (2- Hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981); Langer, CHem. Tech., 12: 98-105 (1982), ethylene vinyl acetate (Langer And the like) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988) or PLGA microspheres.

Sustained release GH compositions also include GH captured in liposomes. Liposomes containing GH are known methods: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Patent Application 83-118008; US Patent Nos. 4,485,045 and 4,544,545; And the methods described in EP 102,324. Usually, liposomes are small (about 200-800 angstroms) unilamellae with a lipid content of greater than about 30 mole percent, the selection ratio of which is modified to suit the optimal therapy. In addition, biologically active sustained release formulations can be made from additives of GH covalently bound to the active polysaccharides described in US Pat. No. 4,857,505. US Pat. No. 4,837,381 also describes microsphere compositions for slow release of GH with fat or beeswax or mixtures thereof.

In another embodiment, the identified individuals are also treated with an effective amount of IGF-I. In general, the total pharmaceutical effective amount of IGF-I administered parenterally per dose is about 50 to 240 μg / kg / 1 day, preferably 100 to 200 μg / kg / 1, relative to the subject's body weight. As will be the case, as noted above, this may vary greatly at therapeutic discretion. In addition, preferably, IGF-I is administered once or twice daily by subcutaneous injection. In another embodiment, both IGF-I and GH can be administered to a subject in each effective amount, or in a suboptimal amount each, but in an amount that produces a desired effect when combined. Preferably, GH is administered in an amount of about 0.001 to 0.2 mg / kg1 day or more preferably about 0.01 to 0.1 mg / kg / day. Preferably, both IGF-I and GH are injected, for example by using intravenous or subcutaneous injection means. More preferably, both subcutaneous injections of IGF-I and GH are preferred, most preferably daily.

Operators considering administering both IGH-I and GH should consider known side effects when treating these hormones. For GH, side effects include sodium retention and extracellular volume expansion (Ikkos et al., Acta Endocrinol. (Copenhagen), 32: 341-361 (1959); Biglieri et al., J. Clin. Endocrinol. Metab., 21: 361-370 (1961)), and hyperinsulinemia and hyperglycemia. The main significant side effect of IGF-I is hypoglycemia. Guler et al., Proc. Natl. Acad. Sci. USA, 86: 2868-2872 (1989). Indeed, the combination of IGF-I and GH may reduce unwanted side effects of both drugs (eg hypoglycemia of IGF-I and hyperinsulinemia of GH), and blood levels of GH whose secretion is suppressed by IGF-I You can also restore the concentration.

In one embodiment, for parenteral administration, generally, the desired purity of GH in unit dosage form (solution, suspension, or emulsion) is pharmaceutically acceptable carrier, i.e., the dosage and concentration used. GH is formulated by mixing with a carrier that is toxic to the subject and is compatible with the other ingredients of the formulation. For example, the formulation preferably contains no components or oxidants known to be harmful to the polypeptide. In general, this formulation is prepared by contacting GH with a liquid carrier or a finely divided solid phase carrier or both. This product is then shaped into the desired formulation, if necessary. Preferably, the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the donor. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Immobilized oils and non-aqueous vehicles such as ethyl oleate and liposomes are also useful in the present invention.

The carrier suitably contains small amounts of additives such as materials that enhance isotonicity and chemical stability. Such materials are harmless to the recipient at the dosages and concentrations employed and include, for example, buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or salts thereof; Antioxidants such as ascorbic acid; Low molecular weight (less than about 10 residues) polypeptides such as polyarginine or tripeptides; Proteins such as serum albumin, gelatin or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamic acid, aspartic acid, or arginine; Monosaccharides, disaccharides, and other celluloses or derivatives thereof, carbohydrates such as glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Counter ions such as sodium; And / or nonionic surfactants such as polysorbate, poloxamer or PEG.

GH is generally formulated at a pH of about 4.5 to 8, individually at such concentrations in such vehicles, at a concentration of about 0.1 mg / mL to 100 mg / mL, preferably 1-10 mg / mL. The pH of GH is preferably 7.4 to 7.8. It will be understood that certain excipients, carriers or stabilizers described above may be used to form the GH salt.

GH can be formulated in any manner as long as it is suitable, but the preferred formulation of GH is as follows: Preferred hGH (GENOTROPIN ^™ ), recombinant somatotropin 0.2 mg, 0.4 mg, 0.6 mg, 0.8 mg, 1.0 Single dose syringes containing mg, 1.2 mg, 1.4 mg, 1.6 mg, 1.8 mg or 2.0 mg. The aforementioned GENOTROPIN ^™ syringe also contains 0.21 mg glycine, 12.5 mg mannitol, 0.045 mg monoatrium phosphate, 0.025 mg disodium phosphate and 0.25 ml water.

For met-GH (PROTROPIN ^™ ), the pre-freeze-dried bulk solution is met-GH 2.0 mg / mL, mannitol 16.0 mg / mL, sodium phosphate 0.14 mg / mL and pH 7.4 sodium phosphate 1.6 mg / mL (day Base monohydrate). A 5 mg vial of met-GH contains 5 mg met-GH, 40 mg of mannitol, and 1.7 mg total sodium phosphate (dry weight) (dibasic anhydride) at pH 7.8. The 10 mg vial contains 10 mg met-GH, 80 mg mannitol, and 3.4 mg total sodium phosphate (dry) (dibasic anhydride) at pH 7.8.

For metless-GH (NUTROPIN ^™ ), the pre-lyophilized bulk solution is GH 2.0 mg / mL, mannitol 18.0 mg / mL, glycine 0.68 mg / mL, sodium phosphate 0.45 mg / mL and pH 7.4 Sodium phosphate at 1.3 mg / mL (monobasic monohydrate). The 5 mg vial of GH contains 5 mg GH, 45 mg mannitol, 1.7 mg glycine, and 1.7 mg total sodium phosphate (dry weight) (dibasic anhydride) at pH 7.4. The 10 mg vial contains 10 mg GH, 90 mg mannitol, 3.4 mg glycine and 3.4 mg total sodium phosphate (dry weight) (dibasic anhydride).

Alternatively, liquid formulations for NUTROPIN ^™ hGH may be used. Such as: 5.0 ± 0.5 mg / mL rhGH; 8.8 ± 0.9 mg / mL sodium chloride; 2.0 ± 0.2 mg / mL polysorbate 20; 2.5 ± 0.3 mg / mL phenol; 2.68 ± 0.3 mg / mL sodium citrate dihydrate; And 0.17 ± 0.02 mg / mL citric anhydride (total sodium anhydrous citrate / citric acid is 2.5 mg / mL, or 10 mM); pH 6.0 ± 0.3. Place this formulation in a 10-mg vial as appropriate. This is a 2.0-mL fill of the aforementioned composition in a 3-cc glass vial. Alternatively, a 10-mg (2.0 mL) cartridge containing the formulation described above may be placed in an injection pen for injecting liquid GH into the subject.

The GH composition to be used for therapeutic administration is preferably sterile. Sterilization treatments can be readily performed by filtration through sterile filtration membranes (eg, 0.2 micron membranes). The therapeutic GH composition is generally placed in a container with a sterile outlet port, such as a vial or intravenous solution bag equipped with a perforated stopper with a hypodermic needle.

The GH will generally be stored as an aqueous solution, or as a lyophilized formulation for recomposition in unit or multi-dose containers such as sealed ampoules or vials. As an example of the lyophilized formulation, the vial is filled with sterile filtered it (w / v) aqueous Gh solution and the resulting mixture is lyophilized. Lyophilized GH is reconstituted with bactericidal water for injection to prepare an infusion solution.

Drug Screening Assay

From the discovery that individuals with the GHRd3 allele show an increased positive response to treatment with drugs acting through the GHR pathway compared to individuals homozygous for the GHRfl allele, the assessment of therapeutic agents acting through the GHR pathway Assays that can be used have been developed. For example, screening assays based on measuring GHR activity or binding to GHRd3 can be used to identify agents that will be most effective in treating individuals expressing the GHRd3 allele. As will be described in more detail below, the medicament that can be tested is GH comprising somatotropin or somatropin, preferably GENOTROPIN ^™ , or PROTROPIN ^™ , NUTROPIN ^™ or pepsiomant, preferably SOMAVERT ^™ . Drugs known to be useful for treating a disease, such as compositions, or drugs for which the utility of the disease is unknown.

In one aspect, the invention provides a cell-based assay for contacting a cell expressing a GHRd3 protein, or a biologically active portion thereof, with the test compound to determine the ability of the test compound to modulate GHR activity. Measurement of the ability of this test compound to modulate (eg, stimulate or inhibit) GHR activity can be performed by monitoring the activity of the GHR polypeptide. Determination of GHR activity includes determining appropriate detectable activity, including, for example, cell proliferation, GHR internalization and / or signal transduction induced by the test compound, as detailed below.

In a preferred embodiment, the invention provides a method of identifying candidate GHR modulators (such as agonists or antagonists), the method comprising: a) providing a cell comprising a GHRd3 polypeptide; b) contacting said cells with a test compound; c) determining whether said compound selectively stimulates or inhibits GHR activity. In one embodiment, the method comprises a) providing a human cell (preferably 293 cells); b) introducing into said cell a vector containing a nucleic acid sequence encoding a GHRd3 polypeptide; And c) contacting said cell with a test compound; And d) detecting GHR activity. If the compound is found to inhibit GHR activity, then the compound is a candidate for a GHRd3 inhibitor. If the compound is found to stimulate GHR activity, the compound is a candidate for a GHRd3 agonist. In another example, the method comprises the steps of providing oocytes of Xenopus laevis (African frog); b) introducing a GHRd3 cRNA into the oocytes of Xenopus; c) contacting the oocytes of Xenopus with a test compound; And d) detecting GHR activity in the oocytes of Xenopus. Here too, if the compound is detected to stimulate GHR activity, the compound is a candidate for a GHRd3 agonist. If the compound is detected to inhibit GHR activity, the compound is a candidate for GHRd3 antagonist. Additional details on screening assays are detailed in the following section regarding GHRd3 / fl heterodimers.

GHRd3 / GHRfl Heterodimer

Method for measuring GHRd3 / fl heterodimer activity

As mentioned above, the present invention suggested that the GHRd3 polypeptide may naturally exist as a heterodimer with the GHRfl polypeptide. Accordingly, the present invention provides a method for measuring the activity of a GHRd3 polypeptide. In a preferred aspect, the present invention comprises measuring the activity of a polypeptide complex comprising a GHRd3 polypeptide and a GHRfl polypeptide. The present invention therefore provides a method for measuring activity of a GHR polypeptide complex comprising a GHRd3 polypeptide. Preferably, the complex is a complex comprising a GHRd3 polypeptide, a GHRfl polypeptide and a GH polypeptide.

The invention also includes a method of measuring or obtaining the activity of a functional variant of a functional variant GHRd3 nucleotide sequence, comprising the step of providing a modified GHRd3 nucleic acid or variant and evaluating whether the polypeptide encoded thereby exhibits GHR activity. To provide. Thus, (a) providing a GHRd3 polypeptide and a GHRfl polypeptide; And (b) evaluating GHR activity, the functional evaluation method of GHRd3 polypeptide is also included in the present invention. All suitable formats are available, including cell-free (eg, membrane-based) formats, cell-based and in vivo formats. For example, the assay can include expressing GHRd3 and GHRfl nucleic acids in a host cell and observing GHR activity in the cell. In another example, GHRd3 and GHRfl polypeptides are introduced into cells and observed for GHR activity. In another example, GHRd3 polypeptide is introduced into cells expressing GHRfl polypeptide to observe GHR activity.

In a preferred embodiment, the method of measuring GHR activity may comprise measuring whether the GHR protein can further regulate the activity of downstream effectors (eg, GHR mediated signal transduction pathway components). For example, the activity of an effector molecule on an appropriate target can be measured or the binding of the appropriate target with the effector can be measured as described above. Preferably, it is good to evaluate Jak-2 / Stat-5 signaling. In another preferred embodiment, the method of measuring GHR activity comprises measuring any suitable detectable activity including cell proliferation induced by GHR ligand, binding of GHR to GHR ligand, GHR and / or ligand internalization. Can be. Most preferably, the GHR ligand is a GH polypeptide. These methods can be used to test the activity of GHR heterodimers, including GHRd3 and GHRfl polypeptides.

Methods of assessing GHRd3 activity may be useful for characterizing modified GHRd3 polypeptides. For example, GHRd3 polypeptides with altered essential or non-essential amino acid residues may be characterized. Nucleotide substitutions can be performed that result in amino acid substitutions at “non-essential” amino acid residues of the GHRd3 sequence. “Non-essential” amino acid residues are those residues that can be altered without altering their biological activity from the wild-type sequence of the GHR polypeptide, whereas “essential” amino acid residues involve altering biological activity. For example, amino acid residues that are conserved in the GHRd3 protein of the invention are expected to be less easy to alter. In addition, additional conserved amino acid residues may be amino acids conserved between the GHRd3 proteins of the invention. In another example, for naturally occurring allelic variants of GHRd3 sequences that may be present in a population, alterations may be introduced by mutations in the nucleotide sequence of the GHRd3 nucleic acid, thereby involving or altering the functional capacity of the GHRd3 protein. Without entailment, changes in the amino acid sequence of the encoded GHRd3 protein can be made.

Drug Screening Assay

The present invention relates to GHR agonists and antagonists, ie candidate compounds or test compounds or agents acting through the GHR pathway (e.g., preferably polypeptides, in addition to peptides, peptidomimetics, small molecules or other drugs). Provides a method for identifying and / or evaluating Preferably, the GHR agonist and antagonist bind to the GHRd3 and GHRfl proteins, preferably forming a complex comprising the GHRd3 polypeptide, the GHRfl polypeptide and the compound. The assay may be cell based or non-cell based. Preferred splenocyte based assays are membrane based assays. This measurement is also referred to herein as a "screening measurement". Screening assays can be binding assays or other functional assays based on known appropriate GHR activity assays.

In one aspect, there are also cell-based assays that measure the ability of a test compound to contact a cell that expresses a GHRd3 protein and a GHRfl protein or a biologically active portion thereof with the test compound and modulate GHR activity. Determining the ability of test compounds to modulate (eg, stimulate or inhibit) GHR activity can be accomplished by monitoring the activity of GHR polypeptides (eg, GHR polypeptide complexes including GHRd3 and GHRfl proteins). Determination of GHR activity may include assessing appropriate detectable activity, including, for example, cell proliferation, GHR internalization and / or signal transduction induced by the test compound.

In a preferred embodiment, the invention provides a method of identifying candidate GHR modulators (such as agonists or antagonists), the method comprising: a) providing a cell comprising a GHRd3 polypeptide; b) contacting said cells with a test compound; c) determining whether said compound selectively stimulates or inhibits GHR activity. In one embodiment, the method comprises a) providing a human cell (preferably 293 cells); b) introducing into said cell a vector containing a nucleic acid sequence encoding a GHRd3 polypeptide and optionally introducing into said cell a vector containing a nucleic acid sequence encoding a GHRfl polypeptide; And c) contacting said cell with a test compound; And d) detecting GHR activity. If the compound is found to inhibit GHR activity, then the compound is a candidate for GHRd / GHRfl heterodimer inhibitors. If the compound is found to stimulate GHR activity, the compound is a candidate for GHRd3 / GHRfl heterodimer agonists. In another example, the method comprises the steps of providing oocytes of Xenopus laevis; b) introducing GHRd3 and optionally GHRfl cRNA into the oocytes of Xenopus; c) contacting the oocytes of Xenopus with a test compound; And d) detecting GHR activity in the oocytes of Xenopus. Here too, if the compound is detected to stimulate GHR activity, the compound is a candidate for GHRd3 / GHRfl heterodimer agonists. If the compound is detected to inhibit GHR activity, the compound is a candidate for GHRd3 / GHRfl heterodimer antagonists.

Detection of activity of GHR is performed by appropriate detectable activity assessment, including cell proliferation, binding of GHR to GHR ligands (e.g. Gh polypeptides), internalization of GHR and / or GHR ligands, and / or transduction of GHR-mediated signals. It is possible.

Maamra et al. (1999) J. Biol. Chem. 274: 14791-14798 describes an example of GHR function analysis in 293 cells for GHR-mediated Jak2-Stat 5 signaling, which is incorporated herein by reference. Analysis of GHR function in Xenopus laevis oocytes is described by Urbanek et al. (1993) J. Biol. Chem. 268 (25): 19025-19032, the disclosures of which are incorporated herein by reference. Methods for preparing cDNA templates, ex vivo transcription and translation, oocyte infusion, mRNA stability assays, binding of GH to GHR and receptor internalization assays can be basically performed as described by Urbanek et al. (1993).

Another preferred aspect is a cell based binding assay that measures the ability of a test compound to contact cells expressing GHRd3 protein and GHRfl protein or a biologically active moiety thereof and bind the GHR polypeptide. In another aspect, non-cell based binding assays are provided that contact a membrane comprising a GHRd3 protein and a GHRfl protein or a biologically active portion thereof with a test compound and measure the force of the test compound that binds to the GHR polypeptide. Measurement of the ability of a test compound to bind a GHR (eg GHRd3 or GHRfl) polypeptide can be performed according to known methods.

Binding assays include, for example: a) providing a cell comprising a GHRd3 and GHRf1 polypeptide; b) contacting said cells with a test compound; And c) determining whether the compound selectively binds to the GHR polypeptide. In one embodiment, the method comprises a) providing a human cell (preferably 293 cells); b) introducing into said cell a vector containing a nucleic acid sequence encoding a GHRd3 polypeptide and optionally introducing into said cell a vector containing a nucleic acid sequence encoding a GHRfl polypeptide; And c) contacting said cell with a test compound; And d) searching for whether the compound selectively binds to the GHR polypeptide. If the compound is found to bind to the GHR polypeptide, the compound is a candidate for the GHRd / GHRfl heterodimer modulator. In another example, the method comprises the steps of: a) providing oocytes of Xenopus laevis; b) introducing GHRd3 and optionally GHRfl cRNA into the oocytes of Xenopus; c) contacting the oocytes of Xenopus with a test compound; And d) searching for whether the compound selectively binds to the GHR polypeptide. Here too, if the compound is found to bind to the GHR polypeptide, the compound is a candidate for the GHRd3 / GHRfl heterodimer modulator.

Examples of GHR binding assays based on 293 cells are described in Ross et al. (2001) J. Clin. Endocrinol. Metabol. 86 (4) 1716-1723, the disclosure content of which is incorporated herein by reference.

The cells used for this measurement are preferably 293 cells expressing the GHRfl polypeptide. 293 cells expressing GHR are described in Maamra et al. (1999) J. Biol. Chem. 274: 14791-14798, which is incorporated herein by reference.

Such assays can be particularly useful for testing GH polypeptides or fragments or variants thereof. Especially preferred are GH polypeptides which have been modified to have a longer blood circulation time, for example by binding of polyethylene glycol molecules. In other embodiments, the GH polypeptide may be a GHR antagonist, such as a GH polypeptide, which binds to a GHR protein (eg, forms a complex comprising preferably the GHRd3 and GHRfl proteins) but does not stimulate GHR activity. .

Another embodiment is a assay comprising contacting a cell expressing a GHRd3 protein and a GHRfl protein or a biologically active portion thereof with a GHR ligand to form a assay mixture, and contacting the assay mixture with a test compound to determine GHR activity . Preferably, this method measures the ability of a test compound to stimulate or inhibit the activity of GHR proteins (eg, GHR dimers comprising GHRd3 and GHRfl proteins or biologically active moieties thereof), wherein Determination of the ability of the test compound to inhibit is to measure the ability of the test compound to inhibit the biological activity of GHR- and GHRfl-expressing cells (eg, the ability of the test compound to inhibit signal transduction or protein: protein interactions). Measure).

The ability of a GHR protein to bind or interact with a GHR ligand can be measured by the aforementioned methods of measuring direct binding. In another embodiment, the ability of the GHRd3 protein or complex containing the GHRd3 protein to bind or interact with the GHR ligand molecule is such that the cellular second messenger of the target (ie intracellular Ca2 +, diacylglycerol, IP _3, etc.) Detect induction to detect catalytic / enzymatic activity against an appropriate substrate, detect induction of reporter genes (including reactive regulatory elements operably linked to a nucleic acid encoding a detectable marker such as luciferase) and Or by detecting GHR-regulated cellular responses such as, for example, signal transduction or protein: protein interactions.

In another embodiment, the assays of the present invention provide a GHRd3 protein and a GHrfl protein or a biologically active portion thereof to the membrane, contact the GHR protein or membrane with a test compound, and then GHR protein (such as GHRd3 and / or GHRfl protein) or It is a cell free assay, which measures the ability of a test compound to bind its biologically active moiety. The binding of the test compound to the GHRd3 protein can be measured directly or indirectly as described above. In another embodiment, this assay contacts a known compound, such as a GH polypeptide, which binds a GHR protein (such as a GHR heterodimer) or a biologically active moiety thereof to make a measurement mixture, and contacting the measurement mixture with a test compound. And measuring the ability of the test compound to interact with the GHR protein, wherein the test compound's ability to interact with the GHR heterodimer protein is determined by comparing the test compound with the known compound, This is done by measuring the ability to preferentially bind with its biologically active moiety.

Another embodiment provides a GHrd3 protein and a GHRfl protein or a biologically active portion thereof to a membrane, contacting a polypeptide or membrane with a test compound and then the test compound modulates the activity of the GHR protein or its biologically active portion (eg, stimulates or Cell-free assay, comprising measuring the ability to inhibit). The ability of test compounds to modulate GHR activity is appropriate, including, for example, cell proliferation, binding of GHR to GHR ligands (such as GH polypeptides), GHR and / or GHR ligand internalization, and / or GHR mediated signal transduction. It can be measured by evaluating GHR detectable activity.

Determination of the test compound's ability to inhibit GHR activity can also be accomplished by coupling a test compound, such as, for example, a GH molecular protein or a portion or derivative thereof, with a radioisotope or enzyme label to label the Gh protein or its biological activity in a complex. By detecting the moiety, the binding of the GH molecule to the GH heterodimer can be performed. For example, compounds (eg, GH proteins or biologically active portions thereof) can be labeled directly or indirectly with ¹²⁵ I, ³⁵ S, ¹⁴ C, or ³ H to directly measure radioactivity or by radioactive isotope by scintillation counting. Can be detected. Alternatively, compounds may be searched by enzymatic labeling, such as horseradish peroxidase, alkaline phosphatase or luciferase, to determine the conversion of such enzyme labels to the product of the appropriate substrate.

It is also within the scope of the present invention to measure the ability of a compound (such as a GH protein or part or fragment thereof) to interact with a GHR polypeptide (such as GHRd3 / GHRfl heterodimer) without labeling it as an interacting substance. . For example, a microphysiometer can be used to detect the interaction of a compound with its cognitive target molecule without labeling the compound or receptor. McConnell, H.M. Et al. (1992) Science 257: 1906-1912. Microphysiometers, such as cytosensors, are analyzers that measure the rate at which cells acidify their surroundings using a phototransmitter potential sensor (LAPS). This change in acidification rate can be used as a measure of the interaction between the compound and the receptor.

The ability of GHR proteins to bind to GHR ligands or test compounds can be measured using techniques such as real-time Biomolecular Interaction Analysis (BIA). Sjolander, S. and Urbaniczky, C. (1991) Anal. CHem. 63: 2338-2345 and Szabo et al (1995) Curr. Opin. Struct. Biol. 5: 699-705. As used herein, "BIA" is a technique for studying biospecific interactions in real time without labeling the interacting material (such as the BIA core). Changes in optical phenomena of surface plasmon resonance (SPR) may be used as a measure of real time reactions between biological molecules.

Test compound

A "candidate" or "test" compound or "drug" (such as a test GHR agonist and antagonist) can be in various suitable forms including polypeptides, peptides, peptidomimetics, small molecules and other drugs. The compounds or medicaments include those known to be useful for the treatment of disease and agents that are not yet known to be useful for treating the disease.

In a preferred embodiment, the test compound is a GH polypeptide. Preferred GH may be in native sequence or variant form and may be natural, synthetic or recombinant. Examples include natural human growth hormone (hGH) or recombinant GH with human natural sequences, and recombinant growth hormone (rGH), which refers to any GH or GH variant produced by recombinant DNA technology means. In one aspect, GH is capable of stimulating the GHR receptor, including somatotropin or somatropin, preferably GENOTROPIN ^™ or PROTROPIN ^™ , NUTROPIN ^™ .

In another aspect, the GH polypeptide is a GH variant that can act as a GHR antagonist. GHR antagonists are groups of drugs intended to bind GHR polypeptides but block GHR function. One example of a GHR antagonist is described in Ross et al. (2001) J. Clin. Endocrinol. Mebabol. 86 (4) 1716-1723. This GHR antagonist, named B2036-PEG in Ross et al., Is a PEGylated GH variant polypeptide with site 1 mutation to promote GHR binding and site 2 mutation to block receptor dimerization. Preferred GHR antagonists or inhibitors are pegbismanants, preferably SOMAVERT ^™ . GHR antagonists are useful for treating terminal hypertrophy, a condition commonly caused by GH oversecreted from pituitary adenoma.

Test compounds of the present invention may include biological libraries, spatially deliverable parallel solid phase or solid phase libraries; Synthetic library methods requiring deconvolution; "One-bead one-compound" library method; And combinatorial library methods well known in the art, including synthetic library methods using affinity chromatography screening. This biological library approach is used with peptide libraries, while the other four approaches are accessible to small molecular libraries of peptides, nonpeptide oligomers or compounds (Lam, K.S. (1997) Anticancer Drug Des. 12: 145).

Examples of methods for synthesizing molecular libraries are well known in the art and described, for example, in DeWitt et al. (1993) Proc. Natl. Acad. Sci. U. S. A. 90: 6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422; Zuckermann et al. (1994). J. Med. Chem. 37: 2678; Cho et al. (1993) Science 261: 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061; and in Gallop et al. (1994) J. Med. Chem. 37: 1233.

Libraries of compounds may be in solution (eg, Houghten (1992) Biotechniques 13: 412-421), or on beads (Lam (1991) Nature 354: 82-84), on chips (Fodor (1993) Nature 364: 555 -556), on bacterial phases (Ladner US Pat. No. 5,223, 409), on spores (Ladner US Pat. No. '409), on plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89: 1865-1869) or On phage (Scott and Smith (1990) Science 249: 386-390); (Devin (1990) Science 249: 404-406) may be provided; (Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87: 6378-6382); Felici (1991) J. Mol. Biol. 222: 301-310; (Ladner supra).

The present invention also relates to novel drugs identified by the screening method described above and to methods of making such drugs by using these measurements. Thus, in one embodiment, the present invention includes a compound or medicament obtainable by a method comprising any one of the aforementioned screening methods (eg, cell-based or cell-free assays). Preferably, the compound or medicament comprises a GH polypeptide or part or variant thereof.

Thus, use of a medicament identified as described above in a suitable animal model is also within the scope of the present invention. For example, agents identified as described herein (eg, GH modulators such as GH polypeptides or portions or variants thereof, antisense GHRd3 nucleic acid molecules, GHRd3-specific antibodies or GHRd3-binding partners) may be used in animal models. The efficacy, toxicity or side effects of such agents can be measured. Alternatively, the agents identified as described above can be used in animal models to measure the mechanism of action of such agents. The invention also relates to the use of the novel medicaments identified by the aforementioned screening assays for treatment as described.

The present invention also relates to the use of the novel formulations identified by the aforementioned screening measurements for diagnosis, prediction, and treatment as described. Thus, it is within the scope of the present invention to use such agents for the design, composition, synthesis, manufacture and / or production of drugs or pharmaceutical compositions for diagnosis, prediction, or treatment as described herein. For example, in one embodiment, the present invention includes a method for synthesizing or producing a drug or pharmaceutical composition with reference to the structure and / or properties of a compound obtainable by the aforementioned screening assay. For example, cells expressing GHRd3 and GHRfl polypeptides are contacted with a test compound and the test compound measures the ability to bind or modulate the activity of the GHR polypeptide (preferably a complex comprising the GHRd3 and GHRfl polypeptides). Drugs or pharmaceutical compositions can be synthesized based on the structure and / or properties of the compound obtained by the method. In another embodiment, the present invention is directed to contacting a GHRd3 protein or a biologically active portion thereof with a test compound and modifying the activity of the GHR dimer or biologically active portion thereof comprising the GHR protein, preferably GHRd3 and GHRfl proteins. A method of synthesizing or producing a drug or pharmaceutical composition based on the structure and / or properties of a lake product obtainable by methods of measuring (eg, stimulating or inhibiting) or binding to them.

GHRd3 Nucleic Acids and Proteins

As noted above, the present invention relates to the use of GHRd3 nucleic acids and polypeptides.

In a preferred embodiment, the GHRd3 protein is at least 6 amino acids, preferably at least 8 to 10 amino acids, more preferably at least 12, 15, 20, 25, 30, 40, 50, 100, 200, 300, 400, 500 Or 600 amino acids consecutively extended. In another preferred embodiment such continuous stretch of amino acids comprises mutation or functional variation sites, including deletion, addition, exchange or cleavage of amino acids in the GHRd3 protein sequence. Thus, in the context of the present invention, the biological activity of a GHRd3 protein comprising an amino acid sequence derived from or sufficiently homologous to the amino acid sequence of a GHRd3 protein, comprising less amino acids than the full-length GHRd3 protein, and exhibiting at least one activity of the GHRd protein. Part is also useful. In another embodiment, the GHRd3 protein is substantially homologous to the native GHRd3 sequence and maintains the functional activity of the native GHRd3 protein, while differing in amino acid sequence due to natural allelic variation or mutation. Thus, in another embodiment, the GHRd3 protein is a protein each comprising the functional activity of the GHRd3 protein, including amino acids having at least about 60% homology with the amino acid sequence described in Urganek et al. (1992). Preferably, the protein is at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97% of the protein of Urbanek et al. (1992), It is preferred to have 98%, 99% or 99.8% homology.

In order to determine the percent homology of two amino acid sequences or two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., of the first amino acid or nucleic acid sequence for optimal alignment with the second amino acid or nucleic acid sequence). Gaps may be introduced in the sequence, and nonhomologous sequences may be ignored for comparison purposes). In a preferred embodiment, the length of the reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, and more Preferably at least 70%, 80%, 90% or 95% (eg, when aligning the second sequence with the GHRd3 amino acid sequence, at least 100, preferably at least 200 amino acid residues). The amino acid residues or nucleotides are then compared at the corresponding amino acid position or nucleotide position. When the position of the first sequence is occupied by the same amino acid residue or nucleotide as at the corresponding position of the second sequence, these molecules are homologous at that position (ie, amino acid or nucleic acid “identity” herein is amino acid or Equivalent to nucleic acid "homology"). The percent homology between two sequences is a function of the number of identical positions shared by those sequences (ie,% homology = total # * 100 of number / position of identical positions).

Sequence comparison and determination of percent homology between two sequences can be performed using a mathematical algorithm. Preferred and non-limiting examples of mathematical algorithms used for sequence comparison are Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87: 2264-68, as variations of Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-77. Such algorithms are described in Altschul et al. (1990) J. Mol. Biol. It is integrated into the NBLAST and XBLAST programs (version 2.0) of 215: 403-10. To obtain nucleic acid sequences homologous to the GHRd3 nucleic acid molecule of the invention, BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12. BLAST protein searches can be performed with the XBLAST program, score = 50, word length = 3 to obtain amino acid sequences homologous to the GHRd3 protein molecule of the present invention. For comparison purposes, to obtain alignments with gaps, Gapped Blast can be used as described in Altschul et al. (1997) Nucleic Acid Research 25 (17): 3389-3402. When using the BLAST and Gapped BLAST programs, the default variables of the respective programs (eg XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.gov. An example of another preferred, non-limiting mathematical algorithm used for sequence comparison is the algorithm of Myers and Miller, CABIOS (199). This algorithm is integrated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When using the ALIGN program for amino acid sequence comparison, the PAM120 weight residue table, gap length penalty 12 and gap penalty 4 can be used.

Recombinant Expression Vectors and Host Cells

A vector, preferably an expression vector, containing a nucleic acid encoding a GHRd3 protein (or a portion thereof) can be prepared by any suitable method. Likewise, in a preferred aspect, expression vectors comprising nucleic acids encoding GHRfl protein (or portions thereof) can also be prepared. If desired, the expression vector will contain a nucleic acid encoding a GHrD3 protein and a nucleic acid encoding a GHRfl protein. As used herein, the term "vector" refers to a nucleic acid molecule capable of delivering other nucleic acids bound thereto. One type of vector is a "plasmid," which is a circular double helix DNA loop into which additional DNA segments can be conjugated. Another type of vector is a viral vector, where additional DNA segments can be conjugated into the viral genome. Some vectors are capable of autonomous replication in host cells into which they are introduced (eg, bacterial vectors with bacterial origins of replication and episomal mammalian vectors). Other vectors (eg, non-episomal mammalian vectors), when incorporated into homework cells, integrate into the genome of the host cell, thereby replicating with the host genome. In addition, some vectors may direct gene expression to which they are operatively bound. Such vectors are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In this specification, "plasmid" and "vector" are used interchangeably with each other because the most common vector type is plasmid. However, the present invention also encompasses other types of expression vectors, such as viral vectors (such as replication deficient retroviruses, adenoviruses and adeno-associated viruses) that play an equivalent role.

Recombinant expression vectors of the invention include GHRd3 and / or GHRfl nucleic acids in a form suitable for expressing nucleic acids in a host cell, which host cell to be used for expression, wherein the recombinant expression vector is operably linked to the nucleic acid sequence to be expressed. It is meant to include one or more regulatory sequences selected based on. In a recombinant expression vector, "operably linked" is meant to mean that the desired nucleotide sequence is bound to the regulatory sequence (s) in a manner that enables the nucleotide sequence to be expressed (eg, in vivo). Exogenous transcription / translation system or in host cells when the vector is introduced into a host cell). By "regulatory sequence" is meant to include promoters, enhancers and other expression control elements (such as polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif (1990). Regulatory sequences include those that direct sequential expression of nucleotide sequences in various types of host cells and those that direct expression of nucleotide sequences only in specific host cells (eg, tissue specific regulatory sequences). Those skilled in the art will appreciate that the design of the expression vector will depend on several factors, such as the choice of host cell to be transformed, the level of expression of the desired protein, and the like. Proteins or peptides are produced by introducing an expression vector into a host cell.

Recombinant expression vectors of the invention can be designed to express GHRd3 protein in prokaryotic or eukaryotic cells. For example, the GHRd3 protein can be expressed in bacteria such as E. coli, insect cells (using baculovirus vesicle vectors), yeast cells or mammalian cells. Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif (1990) describe appropriate host cells. Alternatively, this recombinant expression vector can be transcribed and translated ex vivo using, for example, a T7 promoter regulatory sequence and a T7 polymerase.

Protein expression in prokaryotes is most often performed in E. coli using vectors containing continuous or flowable promoters that direct the expression of fusion or non-fusion proteins. Fusion vectors add the number of amino acids to the protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors usually function for three purposes: 1) increased expression of recombinant protein; 2) increased solubility of the recombinant protein; And 3) assisting in the purification of recombinant proteins by acting as ligands in affinity purification. Often, in a fusion expression vector, proteolytic cleavage sites are introduced at the junction of the fusion moiety and the recombinant protein, in order to be able to separate the recombinant protein from the fusion moiety following purification of the fusion protein. Such enzymes and their recognizer recognition sequences include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, DB and Johnson, KS (1988) Gene 67) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A to the target recombinant protein, respectively. : 31-40), pMAL (New England Biolabs, Beverly, Mass) and pRIT5 (Pharmacia, Piscataway, NJ).

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., (1988) Gene 69: 301-315) and pET11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89). Expression of the target gene from the pTrc vector is dependent on host RNA polymerase transcription from the hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector relies on transcription from the T7 gn10-lac fusion promoter mediated by coexpressed viral RNA polymerase (T7 gn 1). This viral polymerase is supplied by either host strain Bl21 (DE3) or HMS174 (DE3) from a retention phage that produces the T7 gn1 gene under the transcriptional control of the lacUV5 promoter.

One strategy for maximizing recombinant protein expression in E. coli is to express the protein in host bacteria with reduced ability to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Another strategy is to modify the nucleic acid sequence of the nucleic acid to be inserted into the expression vector so that an individual codon for each amino acid is preferably available in E. col (Wada et al., (1992) Nucleic Acids Res. 20: 2111-2118). Such nucleic acid alterations of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the GHRd3 expression vector is a yeast expression vector. Examples of expression vectors of yeast S. cerevisiae include pYepSec 1 (Baldari, et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 (Schultz Et al. (1987) Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), And picZ (InVitrogen Corp, San Diego, Calif.).

Alternatively, the GHRd3 protein can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors capable of expressing proteins in cultured insect cells (eg Sf 9 cells) include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers ( 1989) Virology 170: 31-39. In a particularly preferred embodiment, the GHRd3 protein is selected from Karniski et al., Am. J. Physiol. (1998) 275: F79-87.

In another embodiment, a nucleic acid of the invention is expressed from a mammalian cell using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6: 187-195). When used in mammalian cells, the regulatory function of this expression vector is often provided by the regulatory elements of the virus. For example, commonly used promoters are polyoma, adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells, see Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989.

Another aspect of the invention is a host cell into which the recombinant expression vector of the invention has been introduced. "Host cells" and "recombinant host cells" are used interchangeably in the present invention. It is understood that these terms are used not only for specific cells but also for the progeny or potential progeny of such cells. Because certain modifications may occur in subsequent generations due to mutations or environmental effects, these progeny may or may not actually be identical to parent (parent) cells, but as used herein It shall be included in a range.

The host cell may be any prokaryotic or eukaryotic cell. For example, GHRd3 protein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (preferably 293 cells of humans). Other suitable host cells are well known to those of skill in the art, including Xenopus laevis oocytes.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to various techniques well known in the art, such as calcium phosphate or calcium chloride coprecipitation, DEAE, for introducing foreign nucleic acids (such as DNA) into host cells. Dextran shall refer to mediated transfection, lipofection or electrophoresis. Suitable methods for transforming or transfecting host cells are described in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and others. You can find it in the experiment manual.

For stable transfection of mammalian cells, depending on the expression vector and transfection technique used, only a small fraction of cells can integrate foreign DNA into its genome. To identify and select such integrants, genes encoding selectable markers (eg, antibiotic resistance markers) are introduced into the host cell along with the desired genes. Preferred selectable markers are those that confer resistance to drugs such as G418, hygromycin and methotrexate. The nucleic acid encoding the appropriate marker may be introduced into the host cell using the same vector encoding the GHRd3 protein, or may be introduced using a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (eg, cells incorporating selectable marker genes will survive and cells that do not will die).

Host cells of the invention, such as prokaryotic or eukaryotic cells in culture, can be used to produce (ie, express) GHRd3 protein. Accordingly, the present invention further provides a method of producing GHRd3 protein using the host cell of the present invention. In one embodiment, the method comprises culturing the host cell of the invention (the host into which the recombinant expression vector encoding the GHRd3 protein is introduced) in an appropriate medium to produce the GHRd3 protein.

Host cells of the invention are also available for making nonhuman transgenic animals homozygous or heterozygous for the GHRd3 allele. For example, in one embodiment, the host cells of the invention are fertilized oocytes or embryonic stem cells into which a GHRd3-coding sequence has been introduced. Such host cells can be used to make nonhuman transgenic animals in which exogenous GHRd3 sequences have been introduced into their genome, or homologous recombinant animals with altered endogenous GHRfl sequences. Such animals are useful for studying the fusion and / or activity of GHRd3 and for identifying and / or evaluating modulators of GHRd3 activity. As used herein, the term "transgenic animal" refers to a non-human animal, preferably a rodent, such as a mammal, more preferably a rat or mouse, in which one or more cells of the animal contain a transgene. Other examples of transgenic animals include nonhuman primates, sheep, dogs, cattle, goats, chickens, amphibians, and the like. A transgene is exogenous DNA integrated into the genome of a cell, whereby a transgenic animal develops from that cell and remains in the genome of the mature animal, so that the expression of the encoded gene product is one or more cell types or tissues of the transgenic animal. Will be indicated. As used herein, "homologous recombinant animal" refers to homologous recombination between an endogenous gene and an exogenous DNA molecule in which an endogenous GHR gene (such as a GHRfl allele) is introduced into an animal's cells, such as the embryonic cell of that animal, prior to its development. Non-human animals, preferably mammals, more preferably mice modified by.

Transgenic animals of the present invention introduce a nucleic acid encoding GHRd3 into the male pronuclei of fertilized oocytes, for example by means of microinjection, retroviral infection means, and introduce the oocytes into a false pregnant female surrogate animal. Can be made by development. GHRd3 cDNA sequences can be introduced as transgenes into the genome of non-human animals. Intron sequences and polyadenylation signals can also be included in the transgene to increase the expression efficiency of the transgene. Tissue specific regulatory sequence (s) can be operatively linked to the GHRd3 transgene to direct expression of the GHRd3 protein to specific cells. Through embryo manipulation and microinjection, methods of making transgenic animals, in particular transgenic animals such as mice, have become common in the art, for example, US Pat. Nos. 4,736,866 and 4,870,009 to Ledar et al., US Pat. 4,873,191 and Hogan, B., Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). Similar methods are used to produce similar other transgenic animals. A transgenic founder animal can be identified based on the presence of a GHRd3 transgene in its genome and / or the expression of GHRd3 mRNA in tissue or cells of the animal. Transgenic founder animals can then be used to breed additional animals carrying the transgene. In addition, transgenic animals encoding the GHRd3 protein can be further bred to other transgenic animals with different transgenes.

To make homologous recombinant animals, vectors containing at least a portion of the GHRd3 nucleic acid are prepared to alter the endogenous GHR (GHRfl) gene. This GHRd3 gene may be a human gene or a non-human homologue of the human GHR gene (eg, in stringent hybridization with a nucleotide sequence derived from SEQ ID NO: 1, 4 or 6). CDNA). Preferably, non-human homologs are prepared by modifying the non-human GHR sequence to delete exon 3 nucleic acids. Since GHRd3 alleles are not observed in mice, mouse GHRd3 nucleic acids can be produced using known methods. Thus, in some aspects, synthetic mouse GHRd3 genes can be used in homologous recombinant vectors suitable for altering the endogenous GHR gene of the mouse genome. In a preferred embodiment, the vector is replaced by homologous recombination to replace the endogenous GHR gene with a GHRd3 gene encoding a functional GHRd3 protein (e.g., the expression of the endogenous GHRd3 protein is altered due to a change in the regulatory zone upstream). Devise it. In homologous recombination vectors, the 5 'and 3' ends of the GHRd3 gene are adjacent to the additional nucleic acid sequence of the GHR gene, resulting in homologous recombination between the exogenous GHRd3 gene carried by the vector and the endogenous GHR gene in embryonic stem cells. The additional contiguous GHR nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene. In general, this vector contains several kilobases of contiguous DNA (both 5 'and 3' ends) (for descriptions of homologous recombination vectors, see, eg, Thomas, KR and Capecchi, MR (1987) Cell 51: 503). The vector is introduced into an embryonic stem cell line (eg by electrophoresis) and the cells in which the introduced GHRd3 gene is homologously recombined with the endogenous GHR gene are selected (see, eg, Li, E. et al. (1992) Cell 69: 915). Selected cells are then injected into the cysts of the animal (eg mouse) to obtain aggregation chimeras (eg Bradley, A. in Teratocarcinomas and Embryonic Stem Cells.A Practical Approach, EJ Robertson, Edit (IRL) , Oxford, 1987) pp. 113-152). The chimeric embryo is transplanted into an appropriate false gestational surrogate animal to commence gestation. Descendants that produce homologously recombined DNA in the embryonic cells can be used to breed animals containing all of the cells of the animal containing homologously recombined DNA by embryo transfer of the transgene. Methods of making homologous recombinant vectors and homologous recombinant animals are described in Bradley, A. (1991) Current Opinion in Biotechnology 2: 823-829 and PCT International Publication No. WO 90/11354 (Le Mouellec et al.); WO 91/01140 (Smithies et al.); WO 92/0968 (Zijlstra et al.); And WO 93/04169 (Berns et al.).

In another embodiment, transgenic non-human animals can be prepared that contain selected systems that allow for controlled expression of the transgene. One example of such a system is the cre / loxP recombinant enzyme system of bacteriophage Pl. A description of the cre / loxP recombinant enzyme system can be found, for example, in Lakso et al. (1992) PNAS 89: 6232-6236. An example of another recombinant enzyme system is the FLP recombination system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251: 1351-1355). When using the cre / loxP recombinase system to control expression of transgenes, animals that contain Cre recombinase and transgenes encoding both selected proteins are required. Such animals can be provided through the construction of a "double" transgene animal, for example, by crossing an animal containing a transgene encoding a selected protein with another animal containing a transgene encoding a recombinant enzyme. have.

The present invention will be better understood with reference to the following examples. However, the scope of the present invention is not limited by these Examples. All literature and patent citations are incorporated herein by reference.

Example 1

PCR RFLP Genotypes of GHRd3 and GHRfl

PCR RFLP

For each well, reaction containing 200 ng DNA, 1.5 mM MgCl ₂ , 5 μl 10 × of reaction buffer (Perkin Elmer), dNTP at 0.2 mM, each primer at 0.2 μM and 1.25 U of Taq polymerase (Perkin Elmer) PCR amplification was performed in 96-well microtiter plates (Perkin Elmer) containing 50 μl of the mixture.

35 PCR cycles were performed using a 9700 Perkin Elmer thermocycler. PRC products were detected on agarose gels.

Primer (5'-3 ') Annealing temperature PCR products Detection method G1: TGTGCTGGTCTGTTGGTCTGG2: AGTCGTTCCTGGGACAGAGAGG3: CCTGGATTAACACTTTGCAGACTC    60 ℃ fl / fl: 935 bpfl / d3: 935 and 532 bpd3 / d3: 532 bp 1% agarose gel in 0.5 X TBE

Example 2

Detection of GHRd3 Allele Associated with GH Response

Association of GHR exon 3 variants common to 97 children with idiopathic short stature (ISS) who have been registered with treatment with recombinant GH and growth rate response to treatment with GH Inspected. As shown in Table 1, the GHRd3 allele was present in 47 patients, 3 of which were GHRd3 / d3 homozygotes and 44 were GHRd3 / fl heterozygotes.

GHR Genotype Distribution in Caucasus Race Individuals fl / fl 50 210 d3 / fl 44 181 d3 / d3 3 12

General short-term patients were also included. Those excluded were: patients who were “actually” deficient in growth hormone (GHD), patients with CNS tumors, patients with mutated GHR genes, patients with other hormone deficiencies, patients with Turner syndrome, PHP, cartilage dysplasia or Patients with other bone dysplasia, Lalon's disease or other diseases. Finally, the included patients did not develop puberty syndrome (breast, testes) at the end of GH treatment two years later.

Genotyping groups were comparable with respect to other medical and therapeutic features. Patient characteristics were considered, including parental height and postnatal size, age, sex, and rGH dose (Tables 2, 3, and 4).

 Clinical and Biological Phenotypes at the Beginning of the Trial GHR Genotype fl / fl fl / d3 or d3 / d3 N 50 47 Age (age) 7.63 ± 0.32 7.80 ± 0.30 gender 29M / 21F 32M / 15F GH Peak (ng / ml) OAIGBX Other 8.8 ± 0.9 (31) 8.2 ± 1.3 (23) 10.8 ± 2.0 (28) 8.7 ± 1.9 (18) 9.2 ± 1.5 (28) 8.1 ± 1.2 (17) 10.0 ± 1.5 (30) 6.9 ± 1.1 (17)

GH Dominology in Two Genotyping Groups fl / fl fl / d3, d3 / d3 rGH Dose Year 1 (U.kg.w.) 0.714 ± 0.055 0.727 ± 0.066 rGH Dose Year 2 (U.kg.w.) 0.712 ± 0.056 0.727 ± 0.060

Birth size and parental height GHR Genotype fl / fl dl / fl or d3 / d3 n 50 47 Postnatal height (cm) 47.2 ± 0.4 47.6 ± 0.4 Postnatal weight (g) 2885 ± 90 2929 ± 85 Father height (cm) 170 ± 1.2 169.2 ± 0.8 Mother height (cm) 157.2 ± 0.9 157.3 ± 0.9

The growth rate was followed for two years during treatment with rhGH. After age, sex, and dose adjustment of rGH, children with GHRd3 variants grew much faster when treated with rGH. Growth rate was 9.0 +/- 0.3 cm / 1 year in the first year of treatment, followed by children with GHRd3 / fl or GHRd3 / d3 genotype, while GHRfl / fl was 7.8 +/- 0.2 cm / 1 year In children with genotype, 7.4 +/- 0.2 cm / 1 year and 6.5 +/- 0.2 cm / 1 year, respectively (P <0.0001). Genomic variations of the GHR sequence are therefore associated with significant differences in rGH efficacy.

Growth Rate in Two Genotyping Groups fl / fl fl / d3 or d3 / d3 P 50 47 Growth rate at start of treatment (cm / 1 year) First year Second year 4.83 ± 0.117.39 ± 0.206.48 ± 0.19 4.30 ± 0.159.01 ± 0.307.77 ± 0.24 <0.0001 <0.0001 Calibrated Y1-0 (cm / 1 year) 2.55 ± 0.24 4.72 ± 0.38 <0.0001 Calibrated Y2-0 (cm / 1 year) 1.65 ± 0.21 3.47 ± 0.32 <0.0001

For multivariate analysis of growth rate, a mixed linear model was used to model the correlation between the measurements of the individual itself (Table 6). Covariates referred to include age, sex, growth rate (VC0) (equestrian effect) before treatment with recombinant GH, kidney at the start of treatment, GH dose, GHR genotype and subject (intercept).

As a result, the growth rate of patients with GHR (GHRd3) lacking exon 3 was found to be higher than patients homozygous for full-length GHR isotype (GHRfl) after covariate adjustment. The correlation matrix shows that this effect is independent of the amount of other drills.

Linear regression model for various variables Multiple regression t value p value age -5.308 <0.0001 GV0 -3.017 0.0033 gender 3.495 0.0007 rGH dosage 3.389 0.001 GHR Genotype 4.520 <0.0001

<110> PFIZER HEALTTH AB <120> Methods for Predicting Therapeutic Response to Agents Acting on the Growth Hormone Receptor <130> KP-CH-056284 <150> 60 / 434,861 <151> 2002-12-19 <160> 6 <170> PatentIn version 3.2 <210> 1 <211> 4414 <212> DNA <213> Homo sapiens <220> <221> CDS (222) (44) .. (1957) <220> <221> misc_feature (222) (488) .. (742) FNS; Region: Fibronectin type 3 domain <220> <221> misc_feature (524) (524) .. (775) FNS; Region: Fibronectin type III domain <220> <221> variation <222> (579) Allele = A; allele = G <220> <221> variation <222> (601) Allele = A; allele = G A is G in GHR.262 and GHR.501 <220> <221> variation <222> (729) Allele = A; allele = G <220> <221> variation <222> (1167) <223> G is U in GHR.501 <220> <221> variation <222> (1362) Allele = G; Allele = T <220> <221> variation <222> (1516) Allele = C; Allele = T <220> <221> variation <222> (1526) Allele = A; Allele = C <220> <221> variation <222> (1673) Allele = A; Allele = C <220> <221> variation <222> (1778) Allele = A; Allele = C <220> <221> variation <222> (2260) Complement-Allele = C; Allele = T <220> <221> variation <222> (2479) <223> C is U in GHR.110 <220> <221> variation <222> (3751) Allele = A; Allele = G <220> <221> polyA_signal <222> (3751) <220> <221> polyA_site <222> (4414) <400> 1 ccgcgctctc tgatcagagg cgaagctcgg aggtcctaca ggt atg gat ctc 52 Met asp leu One tgg cag ctg ctg ttg acc ttg gca ctg gca gga tca agt gat gct ttt 100 Trp Gln Leu Leu Leu Thr Leu Ala Leu Ala Gly Ser Ser Asp Ala Phe 5 10 15 tct gga agt gag gcc aca gca gct atc ctt agc aga gca ccc tgg agt 148 Ser Gly Ser Glu Ala Thr Ala Ala Ile Leu Ser Arg Ala Pro Trp Ser 20 25 30 35 ctg caa agt gtt aat cca ggc cta aag aca aat tct tct aag gag cct 196 Leu Gln Ser Val Asn Pro Gly Leu Lys Thr Asn Ser Ser Lys Glu Pro 40 45 50 aaa ttc acc aag tgc cgt tca cct gag cga gag act ttt tca tgc cac 244 Lys Phe Thr Lys Cys Arg Ser Pro Glu Arg Glu Thr Phe Ser Cys His 55 60 65 tgg aca gat gag gtt cat cat ggt aca aag aac cta gga ccc ata cag 292 Trp Thr Asp Glu Val His His Gly Thr Lys Asn Leu Gly Pro Ile Gln 70 75 80 ctg ttc tat acc aga agg aac act caa gaa tgg act caa gaa tgg aaa 340 Leu Phe Tyr Thr Arg Arg Asn Thr Gln Glu Trp Thr Gln Glu Trp Lys 85 90 95 gaa tgc cct gat tat gtt tct gct ggg gaa aac agc tgt tac ttt aat 388 Glu Cys Pro Asp Tyr Val Ser Ala Gly Glu Asn Ser Cys Tyr Phe Asn 100 105 110 115 tca tcg ttt acc tcc atc tgg ata cct tat tgt atc aag cta act agc 436 Ser Ser Phe Thr Ser Ile Trp Ile Pro Tyr Cys Ile Lys Leu Thr Ser 120 125 130 aat ggt ggt aca gtg gat gaa aag tgt ttc tct gtt gat gaa ata gtg 484 Asn Gly Gly Thr Val Asp Glu Lys Cys Phe Ser Val Asp Glu Ile Val 135 140 145 caa cca gat cca ccc att gcc ctc aac tgg act tta ctg aac gtc agt 532 Gln Pro Asp Pro Pro Ile Ala Leu Asn Trp Thr Leu Leu Asn Val Ser 150 155 160 tta act ggg att cat gca gat atc caa gtg aga tgg gaa gca cca cgc 580 Leu Thr Gly Ile His Ala Asp Ile Gln Val Arg Trp Glu Ala Pro Arg 165 170 175 aat gca gat att cag aaa gga tgg atg gtt ctg gag tat gaa ctt caa 628 Asn Ala Asp Ile Gln Lys Gly Trp Met Val Leu Glu Tyr Glu Leu Gln 180 185 190 195 tac aaa gaa gta aat gaa act aaa tgg aaa atg atg gac cct ata ttg 676 Tyr Lys Glu Val Asn Glu Thr Lys Trp Lys Met Met Asp Pro Ile Leu 200 205 210 aca aca tca gtt cca gtg tac tca ttg aaa gtg gat aag gaa tat gaa 724 Thr Thr Ser Val Pro Val Tyr Ser Leu Lys Val Asp Lys Glu Tyr Glu 215 220 225 gtg cgt gtg aga tcc aaa caa cga aac tct gga aat tat ggc gag ttc 772 Val Arg Val Arg Ser Lys Gln Arg Asn Ser Gly Asn Tyr Gly Glu Phe 230 235 240 agt gag gtg ctc tat gta aca ctt cct cag atg agc caa ttt aca tgt 820 Ser Glu Val Leu Tyr Val Thr Leu Pro Gln Met Ser Gln Phe Thr Cys 245 250 255 gaa gaa gat ttc tac ttt cca tgg ctc tta att att atc ttt gga ata 868 Glu Glu Asp Phe Tyr Phe Pro Trp Leu Leu Ile Ile Phe Gly Ile 260 265 270 275 ttt ggg cta aca gtg atg cta ttt gta ttc tta ttt tct aaa cag caa 916 Phe Gly Leu Thr Val Met Leu Phe Val Phe Leu Phe Ser Lys Gln Gln 280 285 290 agg att aaa atg ctg att ctg ccc cca gtt cca gtt cca aag att aaa 964 Arg Ile Lys Met Leu Ile Leu Pro Pro Val Pro Val Pro Lys Ile Lys 295 300 305 gga atc gat cca gat ctc ctc aag gaa gga aaa tta gag gag gtg aac 1012 Gly Ile Asp Pro Asp Leu Leu Lys Glu Gly Lys Leu Glu Glu Val Asn 310 315 320 aca atc tta gcc att cat gat agc tat aaa ccc gaa ttc cac agt gat 1060 Thr Ile Leu Ala Ile His Asp Ser Tyr Lys Pro Glu Phe His Ser Asp 325 330 335 gac tct tgg gtt gaa ttt att gag cta gat att gat gag cca gat gaa 1108 Asp Ser Trp Val Glu Phe Ile Glu Leu Asp Ile Asp Glu Pro Asp Glu 340 345 350 355 aag act gag gaa tca gac aca gac aga ctt cta agc agt gac cat gag 1156 Lys Thr Glu Glu Ser Asp Thr Asp Arg Leu Leu Ser Ser Asp His Glu 360 365 370 aaa tca cat agt aac cta ggg gtg aag gat ggc gac tct gga cgt acc 1204 Lys Ser His Ser Asn Leu Gly Val Lys Asp Gly Asp Ser Gly Arg Thr 375 380 385 agc tgt tgt gaa cct gac att ctg gag act gat ttc aat gcc aat gac 1252 Ser Cys Cys Glu Pro Asp Ile Leu Glu Thr Asp Phe Asn Ala Asn Asp 390 395 400 ata cat gag ggt acc tca gag gtt gct cag cca cag agg tta aaa ggg 1300 Ile His Glu Gly Thr Ser Glu Val Ala Gln Pro Gln Arg Leu Lys Gly 405 410 415 gaa gca gat ctc tta tgc ctt gac cag aag aat caa aat aac tca cct 1348 Glu Ala Asp Leu Leu Cys Leu Asp Gln Lys Asn Gln Asn Asn Ser Pro 420 425 430 435 tat cat gat gct tgc cct gct act cag cag ccc agt gtt atc caa gca 1396 Tyr His Asp Ala Cys Pro Ala Thr Gln Gln Pro Ser Val Ile Gln Ala 440 445 450 gag aaa aac aaa cca caa cca ctt cct act gaa gga gct gag tca act 1444 Glu Lys Asn Lys Pro Gln Pro Leu Pro Thr Glu Gly Ala Glu Ser Thr 455 460 465 cac caa gct gcc cat att cag cta agc aat cca agt tca ctg tca aac 1492 His Gln Ala Ala His Ile Gln Leu Ser Asn Pro Ser Ser Leu Ser Asn 470 475 480 atc gac ttt tat gcc cag gtg agc gac att aca cca gca ggt agt gtg 1540 Ile Asp Phe Tyr Ala Gln Val Ser Asp Ile Thr Pro Ala Gly Ser Val 485 490 495 gtc ctt tcc ccg ggc caa aag aat aag gca ggg atg tcc caa tgt gac 1588 Val Leu Ser Pro Gly Gln Lys Asn Lys Ala Gly Met Ser Gln Cys Asp 500 505 510 515 atg cac ccg gaa atg gtc tca ctc tgc caa gaa aac ttc ctt atg gac 1636 Met His Pro Glu Met Val Ser Leu Cys Gln Glu Asn Phe Leu Met Asp 520 525 530 aat gcc tac ttc tgt gag gca gat gcc aaa aag tgc atc cct gtg gct 1684 Asn Ala Tyr Phe Cys Glu Ala Asp Ala Lys Lys Cys Ile Pro Val Ala 535 540 545 cct cac atc aag gtt gaa tca cac ata cag cca agc tta aac caa gag 1732 Pro His Ile Lys Val Glu Ser His Ile Gln Pro Ser Leu Asn Gln Glu 550 555 560 gac att tac atc acc aca gaa agc ctt acc act gct gct ggg agg cct 1780 Asp Ile Tyr Ile Thr Thr Glu Ser Leu Thr Thr Ala Ala Gly Arg Pro 565 570 575 ggg aca gga gaa cat gtt cca ggt tct gag atg cct gtc cca gac tat 1828 Gly Thr Gly Glu His Val Pro Gly Ser Glu Met Pro Val Pro Asp Tyr 580 585 590 595 acc tcc att cat ata gta cag tcc cca cag ggc ctc ata ctc aat gcg 1876 Thr Ser Ile His Ile Val Gln Ser Pro Gln Gly Leu Ile Leu Asn Ala 600 605 610 act gcc ttg ccc ttg cct gac aaa gag ttt ctc tca tca tgt ggc tat 1924 Thr Ala Leu Pro Leu Pro Asp Lys Glu Phe Leu Ser Ser Cys Gly Tyr 615 620 625 gtg agc aca gac caa ctg aac aaa atc atg cct tag cctttctttg 1970 Val Ser Thr Asp Gln Leu Asn Lys Ile Met Pro 630 635 gtttcccaag agctacgtat ttaatagcaa agaattgact ggggcaataa cgtttaagcc 2030 aaaacaatgt ttaaaccttt tttgggggag tgacaggatg gggtatggat tctaaaatgc 2090 cttttcccaa aatgttgaaa tatgatgtta aaaaaataag aagaatgctt aatcagatag 2150 atattcctat tgtgcaatgt aaatatttta aagaattgtg tcagactgtt tagtagcagt 2210 gattgtctta atattgtggg tgttaatttt tgatactaag cattgaatgg ctatgttttt 2270 aatgtatagt aaatcacgct ttttgaaaaa gcgaaaaaat caggtggctt ttgcggttca 2330 ggaaaattga atgcaaacca tagcacaggc taattttttg ttgtttctta aataagaaac 2390 ttttttattt aaaaaactaa aaactagagg tgagaaattt aaactataag caagaaggca 2450 aaaatagttt ggatatgtaa aacatttact ttgacataaa gttgataaag attttttaat 2510 aatttagact tcaagcatgg ctattttata ttacactaca cactgtgtac tgcagttggt 2570 atgacccctc taaggagtgt agcaactaca gtctaaagct ggtttaatgt tttggccaat 2630 gcacctaaag aaaaacaaac tcgtttttta caaagccctt ttatacctcc ccagactcct 2690 tcaacaattc taaaatgatt gtagtaatct gcattattgg aatataattg ttttatctga 2750 atttttaaac aagtatttgt taatttagaa aactttaaag cgtttgcaca gatcaactta 2810 ccaggcacca aaagaagtaa aagcaaaaaa gaaaaccttt cttcaccaaa tcttggttga 2870 tgccaaaaaa aaatacatgc taagagaagt agaaatcata gctggttcac actgaccaag 2930 atacttaagt gctgcaattg cacgcggagt gagtttttta gtgcgtgcag atggtgagag 2990 ataagatcta tagcctctgc agcggaatct gttcacaccc aacttggttt tgctacataa 3050 ttatccagga agggaataag gtacaagaag cattttgtaa gttgaagcaa atcgaatgaa 3110 attaactggg taatgaaaca aagagttcaa gaaataagtt tttgtttcac agcctataac 3170 cagacacata ctcatttttc atgataatga acagaacata gacagaagaa acaaggtttt 3230 cagtccccac agataactga aaattattta aaccgctaaa agaaactttc tttctcacta 3290 aatcttttat aggatttatt taaaatagca aaagaagaag tttcatcatt ttttacttcc 3350 tctctgagtg gactggcctc aaagcaagca ttcagaagaa aaagaagcaa cctcagtaat 3410 ttagaaatca ttttgcaatc ccttaatatc ctaaacatca ttcatttttg ttgttgttgt 3470 tgttgttgag acagagtctc gctctgtcgc caggctagag tgcggtggcg cgatcttgac 3530 tcactgcaat ctccacctcc cacaggttca ggcgattccc gtgcctcagc ctcctgagta 3590 gctgggacta caggcacgca ccaccatgcc aggctaattt ttttgtattt tagcagagac 3650 ggggtttcac catgttggcc aggatggtct cgagtctcct gacctcgtga tccacccgac 3710 tcggcctccc aaagtgctgg gattacaggt gtaagccacc gtgcccagcc ctaaacatca 3770 ttcttgagag cattgggata tctcctgaaa aggtttatga aaaagaagaa tctcatctca 3830 gtgaagaata cttctcattt tttaaaaaag cttaaaactt tgaagttagc tttaacttaa 3890 atagtatttc ccatttatcg cagacctttt ttaggaagca agcttaatgg ctgataattt 3950 taaattctct ctcttgcagg aaggactatg aaaagctaga attgagtgtt taaagttcaa 4010 catgttattt gtaatagatg tttgatagat tttctgctac tttgctgcta tggttttctc 4070 caagagctac ataatttagt ttcatataaa gtatcatcag tgtagaacct aattcaattc 4130 aaagctgtgt gtttggaaga ctatcttact atttcacaac agcctgacaa catttctata 4190 gccaaaaata gctaaatacc tcaatcagtc tcagaatgtc attttggtac tttggtggcc 4250 acataagcca ttattcacta gtatgactag ttgtgtctgg cagtttatat ttaactctct 4310 ttatgtctgt ggattttttc cttcaaagtt taataaattt attttcttgg attcctgata 4370 atgtgcttct gttatcaaac accaacataa aaatgatcta aacc 4414 <210> 2 <211> 638 <212> PRT <213> Homo sapiens <400> 2 Met Asp Leu Trp Gln Leu Leu Leu Thr Leu Ala Leu Ala Gly Ser Ser 1 5 10 15 Asp Ala Phe Ser Gly Ser Glu Ala Thr Ala Ala Ile Leu Ser Arg Ala 20 25 30 Pro Trp Ser Leu Gln Ser Val Asn Pro Gly Leu Lys Thr Asn Ser Ser 35 40 45 Lys Glu Pro Lys Phe Thr Lys Cys Arg Ser Pro Glu Arg Glu Thr Phe 50 55 60 Ser Cys His Trp Thr Asp Glu Val His His Gly Thr Lys Asn Leu Gly 65 70 75 80 Pro Ile Gln Leu Phe Tyr Thr Arg Arg Asn Thr Gln Glu Trp Thr Gln 85 90 95 Glu Trp Lys Glu Cys Pro Asp Tyr Val Ser Ala Gly Glu Asn Ser Cys 100 105 110 Tyr Phe Asn Ser Ser Phe Thr Ser Ile Trp Ile Pro Tyr Cys Ile Lys 115 120 125 Leu Thr Ser Asn Gly Gly Thr Val Asp Glu Lys Cys Phe Ser Val Asp 130 135 140 Glu Ile Val Gln Pro Asp Pro Pro Ile Ala Leu Asn Trp Thr Leu Leu 145 150 155 160 Asn Val Ser Leu Thr Gly Ile His Ala Asp Ile Gln Val Arg Trp Glu 165 170 175 Ala Pro Arg Asn Ala Asp Ile Gln Lys Gly Trp Met Val Leu Glu Tyr 180 185 190 Glu Leu Gln Tyr Lys Glu Val Asn Glu Thr Lys Trp Lys Met Met Asp 195 200 205 Pro Ile Leu Thr Thr Ser Val Pro Val Tyr Ser Leu Lys Val Asp Lys 210 215 220 Glu Tyr Glu Val Arg Val Arg Ser Lys Gln Arg Asn Ser Gly Asn Tyr 225 230 235 240 Gly Glu Phe Ser Glu Val Leu Tyr Val Thr Leu Pro Gln Met Ser Gln 245 250 255 Phe Thr Cys Glu Glu Asp Phe Tyr Phe Pro Trp Leu Leu Ile Ile Ile 260 265 270 Phe Gly Ile Phe Gly Leu Thr Val Met Leu Phe Val Phe Leu Phe Ser 275 280 285 Lys Gln Gln Arg Ile Lys Met Leu Ile Leu Pro Pro Val Pro Val Pro 290 295 300 Lys Ile Lys Gly Ile Asp Pro Asp Leu Leu Lys Glu Gly Lys Leu Glu 305 310 315 320 Glu Val Asn Thr Ile Leu Ala Ile His Asp Ser Tyr Lys Pro Glu Phe 325 330 335 His Ser Asp Asp Ser Trp Val Glu Phe Ile Glu Leu Asp Ile Asp Glu 340 345 350 Pro Asp Glu Lys Thr Glu Glu Ser Asp Thr Asp Arg Leu Leu Ser Ser 355 360 365 Asp His Glu Lys Ser His Ser Asn Leu Gly Val Lys Asp Gly Asp Ser 370 375 380 Gly Arg Thr Ser Cys Cys Glu Pro Asp Ile Leu Glu Thr Asp Phe Asn 385 390 395 400 Ala Asn Asp Ile His Glu Gly Thr Ser Glu Val Ala Gln Pro Gln Arg 405 410 415 Leu Lys Gly Glu Ala Asp Leu Leu Cys Leu Asp Gln Lys Asn Gln Asn 420 425 430 Asn Ser Pro Tyr His Asp Ala Cys Pro Ala Thr Gln Gln Pro Ser Val 435 440 445 Ile Gln Ala Glu Lys Asn Lys Pro Gln Pro Leu Pro Thr Glu Gly Ala 450 455 460 Glu Ser Thr His Gln Ala Ala His Ile Gln Leu Ser Asn Pro Ser Ser 465 470 475 480 Leu Ser Asn Ile Asp Phe Tyr Ala Gln Val Ser Asp Ile Thr Pro Ala 485 490 495 Gly Ser Val Val Leu Ser Pro Gly Gln Lys Asn Lys Ala Gly Met Ser 500 505 510 Gln Cys Asp Met His Pro Glu Met Val Ser Leu Cys Gln Glu Asn Phe 515 520 525 Leu Met Asp Asn Ala Tyr Phe Cys Glu Ala Asp Ala Lys Lys Cys Ile 530 535 540 Pro Val Ala Pro His Ile Lys Val Glu Ser His Ile Gln Pro Ser Leu 545 550 555 560 Asn Gln Glu Asp Ile Tyr Ile Thr Thr Glu Ser Leu Thr Thr Ala Ala 565 570 575 Gly Arg Pro Gly Thr Gly Glu His Val Pro Gly Ser Glu Met Pro Val 580 585 590 Pro Asp Tyr Thr Ser Ile His Ile Val Gln Ser Pro Gln Gly Leu Ile 595 600 605 Leu Asn Ala Thr Ala Leu Pro Leu Pro Asp Lys Glu Phe Leu Ser Ser 610 615 620 Cys Gly Tyr Val Ser Thr Asp Gln Leu Asn Lys Ile Met Pro 625 630 635 <210> 3 <211> 638 <212> PRT <213> Homo Sapiens <220> <221> PEPTIDE (222) (1) .. (638) <223> Growth Hormone Receptor <220> <221> DOMAIN 222 (149) .. (233) <223> Fibronectin type 3 domain <220> <221> DOMAIN (222) (161) .. (244) <223> Fibronectin type III domain <400> 3 Met Asp Leu Trp Gln Leu Leu Leu Thr Leu Ala Leu Ala Gly Ser Ser 1 5 10 15 Asp Ala Phe Ser Gly Ser Glu Ala Thr Ala Ala Ile Leu Ser Arg Ala 20 25 30 Pro Trp Ser Leu Gln Ser Val Asn Pro Gly Leu Lys Thr Asn Ser Ser 35 40 45 Lys Glu Pro Lys Phe Thr Lys Cys Arg Ser Pro Glu Arg Glu Thr Phe 50 55 60 Ser Cys His Trp Thr Asp Glu Val His His Gly Thr Lys Asn Leu Gly 65 70 75 80 Pro Ile Gln Leu Phe Tyr Thr Arg Arg Asn Thr Gln Glu Trp Thr Gln 85 90 95 Glu Trp Lys Glu Cys Pro Asp Tyr Val Ser Ala Gly Glu Asn Ser Cys 100 105 110 Tyr Phe Asn Ser Ser Phe Thr Ser Ile Trp Ile Pro Tyr Cys Ile Lys 115 120 125 Leu Thr Ser Asn Gly Gly Thr Val Asp Glu Lys Cys Phe Ser Val Asp 130 135 140 Glu Ile Val Gln Pro Asp Pro Pro Ile Ala Leu Asn Trp Thr Leu Leu 145 150 155 160 Asn Val Ser Leu Thr Gly Ile His Ala Asp Ile Gln Val Arg Trp Glu 165 170 175 Ala Pro Arg Asn Ala Asp Ile Gln Lys Gly Trp Met Val Leu Glu Tyr 180 185 190 Glu Leu Gln Tyr Lys Glu Val Asn Glu Thr Lys Trp Lys Met Met Asp 195 200 205 Pro Ile Leu Thr Thr Ser Val Pro Val Tyr Ser Leu Lys Val Asp Lys 210 215 220 Glu Tyr Glu Val Arg Val Arg Ser Lys Gln Arg Asn Ser Gly Asn Tyr 225 230 235 240 Gly Glu Phe Ser Glu Val Leu Tyr Val Thr Leu Pro Gln Met Ser Gln 245 250 255 Phe Thr Cys Glu Glu Asp Phe Tyr Phe Pro Trp Leu Leu Ile Ile Ile 260 265 270 Phe Gly Ile Phe Gly Leu Thr Val Met Leu Phe Val Phe Leu Phe Ser 275 280 285 Lys Gln Gln Arg Ile Lys Met Leu Ile Leu Pro Pro Val Pro Val Pro 290 295 300 Lys Ile Lys Gly Ile Asp Pro Asp Leu Leu Lys Glu Gly Lys Leu Glu 305 310 315 320 Glu Val Asn Thr Ile Leu Ala Ile His Asp Ser Tyr Lys Pro Glu Phe 325 330 335 His Ser Asp Asp Ser Trp Val Glu Phe Ile Glu Leu Asp Ile Asp Glu 340 345 350 Pro Asp Glu Lys Thr Glu Glu Ser Asp Thr Asp Arg Leu Leu Ser Ser 355 360 365 Asp His Glu Lys Ser His Ser Asn Leu Gly Val Lys Asp Gly Asp Ser 370 375 380 Gly Arg Thr Ser Cys Cys Glu Pro Asp Ile Leu Glu Thr Asp Phe Asn 385 390 395 400 Ala Asn Asp Ile His Glu Gly Thr Ser Glu Val Ala Gln Pro Gln Arg 405 410 415 Leu Lys Gly Glu Ala Asp Leu Leu Cys Leu Asp Gln Lys Asn Gln Asn 420 425 430 Asn Ser Pro Tyr His Asp Ala Cys Pro Ala Thr Gln Gln Pro Ser Val 435 440 445 Ile Gln Ala Glu Lys Asn Lys Pro Gln Pro Leu Pro Thr Glu Gly Ala 450 455 460 Glu Ser Thr His Gln Ala Ala His Ile Gln Leu Ser Asn Pro Ser Ser 465 470 475 480 Leu Ser Asn Ile Asp Phe Tyr Ala Gln Val Ser Asp Ile Thr Pro Ala 485 490 495 Gly Ser Val Val Leu Ser Pro Gly Gln Lys Asn Lys Ala Gly Met Ser 500 505 510 Gln Cys Asp Met His Pro Glu Met Val Ser Leu Cys Gln Glu Asn Phe 515 520 525 Leu Met Asp Asn Ala Tyr Phe Cys Glu Ala Asp Ala Lys Lys Cys Ile 530 535 540 Pro Val Ala Pro His Ile Lys Val Glu Ser His Ile Gln Pro Ser Leu 545 550 555 560 Asn Gln Glu Asp Ile Tyr Ile Thr Thr Glu Ser Leu Thr Thr Ala Ala 565 570 575 Gly Arg Pro Gly Thr Gly Glu His Val Pro Gly Ser Glu Met Pro Val 580 585 590 Pro Asp Tyr Thr Ser Ile His Ile Val Gln Ser Pro Gln Gly Leu Ile 595 600 605 Leu Asn Ala Thr Ala Leu Pro Leu Pro Asp Lys Glu Phe Leu Ser Ser 610 615 620 Cys Gly Tyr Val Ser Thr Asp Gln Leu Asn Lys Ile Met Pro 625 630 635 <210> 4 <211> 6789 <212> DNA <213> Homo Sapiens <220> <221> gene (222) (1) .. (6789) Growth Hormone Receptor (GHR) <220> <221> misc_feature <222> (7) N is a, c, g, or t <220> <221> repeat_region <222> (580) .. (882) <223> complement MER4B dispersed <220> <221> repeat_region (222) (884) .. (1226) <223> complement MER4D dispersed <220> <221> misc_feature <222> (1064) N is a, c, g, or t <220> <221> repeat_region (222) (1227) .. (1915) <223> complement MER21 dispersed <220> <221> misc_feature <222> (1447) N is a, c, g, or t <220> <221> misc_feature <222> (1450) N is a, c, g, or t <220> <221> repeat_region (2644) .. (2689) <223> complement MER4D dispersed <220> <221> repeat_region (2690) .. (3507) <223> complement LTR1B dispersed <220> <221> repeat_region (222) (3508) .. (3772) <223> complement MER4B dispersed <220> <221> repeat_region (222) (3845) .. (4102) <223> complement MER49 dispersed <220> <221> mRNA (222) (4165) .. (4230) <220> <221> CDS (4165) .. (4221) <220> <221> exon (222) (4165) .. (4230) <220> <221> repeat_region (222) (4400) .. (4785) <223> complement MSTA dispersed <220> <221> repeat_region (222) (6053) .. (6223) <223> complement LTR1B dispersed <220> <221> repeat_region <222> (6232) .. (6303) <223> complement MER4B dispersed <400> 4 aacttanagt atcaaagcag caagtagatt tgaaggaatt gttacaatgc aattttgctt 60 tcccgccact ttaaaatcaa ggtgtagtac tttatttact ttaggaaaat gtttgctttt 120 tgtcataatt ccttattgca tatgagagta aatgatctat agatgaagat aataataaaa 180 tttagagaga gaataaaaaa gaaacacttt cacagctgaa aggctgcttc ccagttagct 240 aactgggagg agttactgaa aaagtacatt gaaaagcggc tcaggggcag gtgaattgga 300 ctcaccaggc tctgacattc agagagatgg gaatgagtca gctcactgtc cagcacatct 360 ttattttatt tctctttctt gttttatatc agaaatagat ttcttggcat tgttactgtg 420 ggtttctatt aaggactgaa caaaagtatt aataatctga gagtatgtaa aaaaaaattc 480 attttctcct actatactct cataacacag aatattttgg tgaccagaga tcaccaaaat 540 gtgtgtggtg tcaacgaaaa gagtcaaact ctctaaaata tttgaagaga ttttttctga 600 gccaaatgtg agtgaacatg gcctgtgaca tagccctcag gaggtcctga gaacatgtgc 660 ccaaggtggt cagggtacag cttggttttt atatatttta gggaggcata agacatcaat 720 caaatacatt taagaaatac gttgatttgg ttcagaaagg caggacaact caaatgggga 780 gcttccaggc tataggtaaa tttaaacatt ttctggttga caattagttg agtttgtctg 840 aagacctggg attaatggaa aggactattc aggttaagat atgtttctta ttggacctaa 900 aactgtgcct ggctcttagt tgattactgc ctggatctgg gaaggaagga aggaaaacaa 960 agggggaagg ggattctcta tagaatgtgg atttttccca taagagactt tgtagggcaa 1020 tttcaaggca tggcaaggaa atatactttg gggctaatat tttnccttgt ctcataatgt 1080 tatgccagag tcatattgaa aagcaagtca caatatacaa ggtcaaataa aaccatctga 1140 tgagaaccca tggtttgtag ggcatgactc cccagaaccc ttaggtagga atttgggcaa 1200 gataaaaaat cggaacttag tcctcggcgg gaatctctcc ccacacaaat tctccaacag 1260 attcttcagt gggacaccaa ctgggtggtt ctcaaattca attcaattct gaccaatcta 1320 cctatctacc tggaaatagc atcagataac cacaggttta cggctcattc caacaatact 1380 gtcccccact tcagatgcca actgcaagta ataggttgtt acctatactt ctagccagtc 1440 agctgtnaan tggtgttccc acaacctccc cctccggttt gataatttga gacagcttgc 1500 ttacatgtac cagcttatta gaaaggatat tacaaaggac acagatgaag agatggatag 1560 ggtaaggtat gtgggttgga gttgcagagt ttccatgacc tctctgagtg cagcatcttc 1620 atgtgttcag ctatccagaa tctctcggat taagacattg gccactggtg atcaaattaa 1680 ccttgagtcc ctctcccctt cctgaggttg gagagtgggg ctgaagtgtc tcaacctcta 1740 atcaactctt ggtctttcct gtgaccatgc cccatcctga ggctctccag gagcccccag 1800 gcatcagtca actcattagc atacgaaaga cacttatcac tacagagatt cgaaggattt 1860 taggaactgt gtcaagaaac ggagacaagg tcaaatatgt atttcacaat atcaccagta 1920 gtttcactgg gaggtaaaac tcagtgttta ctgtgggcct gagccatgct gaccctctaa 1980 gaataactta gaggtaacgt gatcagatgt ggggaattct ggagaaacac ctttcaccac 2040 caagcccaga caagagatgc atacttttct agctgggatg cttacaaagc aacccactct 2100 aatacttcaa ggtagagtga cactacattc atcatttttc attttttcct gttttttatg 2160 ccatctacta ctaatgtcaa tcaaattacg actgtgttta tagtggatga attatggacc 2220 atctcacacc ataaagttct gtttctctca tgttgagctt ttcacctccc ttcattccct 2280 ccctacttcc aggatcattc acatgtttat ttctaaaaat aaactttttt tactgaactt 2340 tttttcatac tgtttaaaaa gaatttatat ttctcttcat tcttacagat aagattcaag 2400 tttaaactca aataatgtag gaaatctttt tttaaaaaat tgttccctac tgtgtctagg 2460 cgtgagaccc aaaagtaatt aagaccaggt tttcatttgc tgtgatttgt gtgagttctt 2520 tttagaggtt aggtgcaatt ttaattttta aaagggggat tattatgaga ggagaaatca 2580 tactttatca tttgaaaatg atgccataac aggtgttagc agaaaaatca aactgtaaaa 2640 tattttaaag agatttattc tgagccaata taagtgactg tggccccatt gaaatgagcg 2700 agttccctga tccctctcac agagcttgcg acagggatgt ggctcacctg ttcagttgcc 2760 ccaccgctca aacccctagg gggagaatac agacggtcag gtgcaaaggc tggggcaagt 2820 gccttggccc cttggcccct tagccccgag gtagtgtcta ggggtggggt gcctgcaacc 2880 ccagtgttac aaagttcttt cagctttgca gtccacggac agcttgagtg ttaatcagct 2940 caatggaccc tctgccttat agcaaaggca gagggccagt gtgacagctt tctgtatccc 3000 aagctcttgc ccagtgtcct agaaaaaaca gatcatacag gggctcgaag gatgagtgca 3060 aggttttatt gagtagtgga ggtggctctc agcaagatgg atggggagtg ggaagtgggg 3120 atggagtggg aaggtgaact tcctctgaag tcgggcagcc cagtggctgg actcttctcc 3180 aacctccccc aggcaagctc ctctcagcgt ccagatgttc ctcttccctc tctctctctg 3240 ccgcatcatt tcaccatctg tctgctggtc agctggcttg ctggtgtgct ggtctgttgg 3300 tctgctggtc tgcttctgga acctcaggtt cagagtttat atgagtgcac gatagggggt 3360 gttttgggcc aaaaggtagc tttttggaca tgaaaacgga aatgcctgtt cccatttagg 3420 gctgcaggtc ttcaggcttg agggtggggc ctttgcccag gaactaccct cttctaccca 3480 gtgtttccct gtctcctgtc catatcacca gtattcacag tctcaaggag tcttgagaaa 3540 gtgtgcccaa ggccgtcaga ttcagtttgg ttctgtatgt ttcagggagg caggaattac 3600 aggcaaagac ataaatcagt acatggaagg tatacattgg ttcactctga aaaggcagga 3660 tgtcttgaag tggggacttg caggtcatag tttggttcag agattcttta atctgcagtt 3720 ggttaaagga acaaaactgt acagaagctt cgagttagca aaaagaaata tttaaattaa 3780 gataaggatg ctatgtcaga gtcagccaca aaatgacctg tttagcaaga ttaatggcct 3840 ataggtgtga cttaaccctt gccttgcatg gcctaaggtc ttgtttataa tttagtatct 3900 tattgcccaa agagtctatt tagtcagtct tatgatctct actttaacat taatgctggt 3960 cacttgtgcc taaactccaa aggggaggta tatccaacct gccttcccat tgtggccagg 4020 aacctttctc tggagtcccc ttggccaaga aggggtccat tcggttggtt tgggaagctg 4080 aggattttgt ttttagttta cacagggtca tatcagattg ttttgatggg gatgactaat 4140 ggttttcttc tctttctgtt tcag cca cag cag cta tcc tta gca gag 4188 Pro Gln Gln Leu Ser Leu Ala Glu 1 5 cac cct gga gtc tgc aaa gtg tta atc cag gcc taaagacaa gtaagaattt 4240 His Pro Gly Val Cys Lys Val Leu Ile Gln Ala 10 15 cagtcctttt tcttccttca atgatatttt ccatgtttta gtgtaattaa gctactatcc 4300 tttctctatt ttatttggga tggtagtaac tggaatagtg actgagttga aattttatag 4360 gcaagcaaaa cattttttaa ggatttattt tttaacttct gatatagttt ggatgtttgt 4420 cccttccaaa tctcatgtaa tccccaatgt tggaagtgga gactgggagg agatgtttgg 4480 gtcatgtggg cagattcctc atgaatggtt tagcaccctc ctctttgtgc tgtcctcacc 4540 atgagtgagt tctcatgaga tctggttgtt taaaagtgtg tggcacctcc cccttcaatc 4600 tcttgctccc actctcgccc tgtgagacac ctgctccgct tcaccatgat tataggcttc 4660 ctgaggcttt caccagaagc agatgctaat acagcctgca gaactgtgag ccatttaaat 4720 catttttctt tataaatcac ccagcctcag gtactttttt atagcaatga aagcaaacta 4780 atacaacttc tgtgcaaggc tgcttttttt tctatttttt gcttgtgctt gaaggttaag 4840 taaggccaaa ttaatgaagg aggaaaaaag aggaaatgat acatcatgga tcaacaatta 4900 tttattgaat ttaggaaact gcctcttttt ataaattctt tttaaaatta ttttcattat 4960 tatcttgaag tatttatcta aggtttacac tggtagaaag ttaaacttgt ctctccaacc 5020 aaattgcctt aagcttcaaa attatgcctt attgtaagct ctttcttaac cttaaaatga 5080 ctttacacat tccccgctgg tcctttgaca atctcctctt caaccacaag acagaacccc 5140 accatcaact ctgtggggaa gcgtctccaa attctctagt cctgaacaac atgctgcctt 5200 ctctgcttcc atggaacttt gtcctttaca acatgatagc gtttgcctcc tgacatttta 5260 gtgtgtgtgt tagccctgca tatagaactc accagattgt gtggtctgca tgaatgaatt 5320 aattctattg aactttaagg caaagcctaa actttatgct tcttctaaat cccttacatc 5380 tcctaaaaaa attctgatcc atagtagtag gtacttgttt aattaaattt tagggatgga 5440 tatttttcat cagtggaagt atatgctaga gtccatatta tgcaataagg gaagggaaga 5500 cagtgtacct aaatcagtta agatattgct attcttgttg ttattctaaa tcagttaaga 5560 tattgctatt cttgttgtta ttctagagtc acgaaatcat aatttgaatt ttatgactaa 5620 attgcagaat taatttccaa tgtgagattt taacattatt tccttggagg tgaccaaaaa 5680 ggagagctgg tactgttttt aacaactgtc attcaattgt cagttgtgcc agaccacaaa 5740 tcctttatag ccctcctgtt taagaagcat ctgacatgtt aagctgctcc ctaattaaca 5800 cagaggttgt aaaagaagtg gctgtttggt tctgtttggg tttcccagcc agtatattcc 5860 aaagcctttt ttcactcaac agatgagtta tgtgctttat attctgtaag gaaatgagaa 5920 gtaatcagtt gaaaatgtgt tactaatggt acatgcttca cattgaaacc atcctcctga 5980 cacaaacata atactttgcc cttcactgtc ccccaaagtg gcagtaggat ttctctaagt 6040 aattttcttt acttatatga gtgcaggata gggggtgttt tgggccaaaa ggtagctttt 6100 tggacatgaa aacggaaatg cctgttccca tttagggctg caggtcttca ggcttgaggg 6160 tggggccttt gcccaggaac taccctcttc tacccagtgt ttccctgtct cctgtccata 6220 tcaccagtat tcacagtctc aaggagtctt gagaaagtgt gcccaaggcc gtcagattca 6280 gtttggttct gtatgtcaca gggtctaaga agcgtaaaca ttgtgccttg ttgaaataca 6340 gcctctaggt atggaggatg tgttgaacaa cttcctacca gtcatttggc atatgttgat 6400 ttcctgtctt catgatacgt aagacgacta gctaattatc attcatatgt ggtaagtcac 6460 atagatactg acttccccta tctttccagc tttttcttat caaaagtcac ctgctctctg 6520 tcccaggaac gactggctaa agtaacctat atcagtgtct gtaacagtgg gcacctatca 6580 tagtgcacat gcttgaacat atcattgcct tttatcatca cgagcctcac atccagatgt 6640 gacagactca agtgctcaca tcacctcact ctgtcactgt atacattgtt accgtgtcac 6700 aaatatttaa cagtctgctg tgtactcagt ctttagctgt gtgccctgag ggagacagag 6760 taagatactg ccttgacatc aaggagctc 6789 <210> 5 <211> 19 <212> PRT <213> Homo Sapiens <400> 5 Pro Gln Gln Leu Ser Leu Ala Glu His Pro Gly Val Cys Lys Val Leu 1 5 10 15 Ile Gln Ala <210> 6 <211> 1474 <212> DNA <213> Homo sapiens <220> <221> gene (222) (1) .. (1474) <223> Growth Hormone Receptor (GHR) contains a deletion of exon 3 <220> <221> repeat_region 222 (268) .. (1085) <223> complement LTR1B dispersed <220> <221> repeat_region (222) (1094) .. (1165) <223> complement MER4B dispersed <400> 6 aatctttttt taaaaaattg ttccctactg tgtctaggcg tgagacccaa aagtaattaa 60 gaccaggttt tcatttgctg tgatttgtgt gagttctttt tagaggttag gtgcaatttt 120 aatttttaaa agggggatta ttatgagagg agaaatcata ctttatcatt tgaaaatgat 180 gccataacag gtgttagcag aaaaatcaaa ctgtaaaata ttttaaagag atttattctg 240 agccaatata agtgactgtg gccccattga aatgagcgag ttccctgatc cctctcacag 300 agcttgcgac agggatgtgg ctcacctgtt cagttgcccc accgctcaaa cccctagggg 360 gagaatacag acggtcaggt gcaaaggctg gggcaagtgc cttggcccct tggcccctta 420 gccccgaggt agtgtctagg ggtggggtgc ctgcaacccc agtgttacaa agttctttca 480 gctttgcagt ccacggacag cttgagtgtt aatcagctca atggaccctc tgccttatag 540 caaaggcaga gggccagtgt gacagctttc tgtatcccaa gctcttgccc agtgtcctag 600 aaaaaacaga tcatacaggg gctcgaagga tgagtgcaag gttttattga gtagtggagg 660 tggctctcag caagatggat ggggagtggg aagtggggat ggagtgggaa ggtgaacttc 720 ctctgaagtc gggcagccca gtggctggac tcttctccaa cctcccccag gcaagctcct 780 ctcagcgtcc agatgttcct cttccctctc tctctctgcc gcatcatttc accatctgtc 840 tgctggtcag ctggcttgct ggtgtgctgg tctgttggtc tgctggtctg cttctggaac 900 ctcaggttca gagtttatat gagtgcagga tagggggtgt tttgggccaa aaggtagctt 960 tttggacatg aaaacggaaa tgcctgttcc catttagggc tgcaggtctt caggcttgag 1020 ggtggggcct ttgcccagga actaccctct tctacccagt gtttccctgt ctcctgtcca 1080 tatcaccagt attcacagtc tcaaggagtc ttgagaaagt gtgcccaagg ccgtcagatt 1140 cagtttggtt ctgtatgtca cagggtctaa gaagcgtaaa cattgtgcct tgttgaaata 1200 cagcctctag gtatggagga tgtgttgaac aacttcctac cagtcatttg gcatatgttg 1260 atttcctgtc ttcatgatac gtaagacgac tagctaatta tcattcatat gtggtaagtc 1320 acatagatac tgacttcccc tatctttcca gctttttctt atcaaaagtc acctgctctc 1380 tgtcccagga acgactggct aaagtaacct atatcagtgt ctgtaacagt gggcacctat 1440 catagtgcac atgcttgaac atatcattgc cttt 1474

Claims (43)

A method of predicting a patient's response to a drug capable of binding GHR protein, Patients with increased likelihood of response to treatment with the agent, by determining the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the agent will increase or decrease Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a drug that increases the patient's kidney or growth rate, A patient with increased likelihood of response to treatment with the medicament by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the medicament will increase or decrease Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to an obesity drug, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to an infection treatment, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. As a method of predicting the patient's response to the diabetes treatment, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a terminal hypertrophy treatment, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a therapeutic agent for symptoms associated with the retention of sodium or water, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a metabolic syndrome drug, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a mood disorder or sleep disorder treatment Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a cancer drug, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a heart disease drug, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of predicting a patient's response to a hypertension drug, Patients with increased likelihood of response to treatment with the therapeutic agent by measuring the presence of an allele of the GHR gene in the patient and correlating the allele with the likelihood that the positive response to the therapeutic agent will be increased or decreased. Or identifying a patient with a reduced likelihood of response, Forecast method. A method of identifying a patient with increased or reduced treatment potential for a disease or condition using a medicament capable of binding a GHR protein, a) correlating the presence of the allele of the GHR gene with the patient's response to an agent capable of binding to the GHR protein, b) detecting the allele of step a) in the patient to identify a patient with increased or decreased likelihood of response to treatment with the medicament. A method of identifying alleles of the GHR gene that correlate with increased or reduced therapeutic potential of a disease or condition using a medicament capable of binding a GHR protein, a) measuring the presence of the allele of the GHR gene in the patient, b) an increased or decreased response to treatment with the medicament, correlating the presence of the allele of step a) with the increased or reduced likelihood of a disease or condition using a medicament capable of binding to the GHR protein Identifying alleles associated with the likelihood. 15. The method of any one of claims 1, 13 and 14, wherein the agent capable of binding to the GHR protein is an agent capable of treating a disease selected from the group consisting of: short stature, obesity, infection or diabetes ; Terminal hypertrophy or hyperauthentication, or associated milk secretion promotion, diabetes induction, lipolysis and protein assimilation; Symptoms associated with the retention of sodium or water; Metabolic syndrome; Mood disorders and sleep disorders, cancer, heart disease and high blood pressure. As a method of increasing patient growth, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent that may increase the patient's growth, (b) selecting or determining an effective amount of said medicament for the patient to be administered. As a method of treating obese patients, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent capable of improving obesity or its symptoms, (b) selecting or determining an effective amount of the medicament to be administered to the patient. As a method of treating diabetic patients, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent capable of improving diabetes or its symptoms, (b) selecting or determining an effective amount of the medicament to be administered to the patient. As a method of treating infected patients, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to a medicament capable of improving infection or its symptoms, (b) selecting or determining an effective amount of the medicament to be administered to the patient. A method of treating a patient suffering from acromegaly or giant authentication, (a) measuring the presence of an allele of a GHR gene in a patient and using the allele in a medicament capable of ameliorating terminal hypertrophy or hyperauthentication or associated milk secretion, diabetes induction, lipid degradation and protein assimilation. Correlates with the likelihood of positive or negative responses to (b) selecting or determining an effective amount of the medicament to be administered to the patient. A method of treating a patient with symptoms associated with abnormal sodium or water retention, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent capable of ameliorating the symptoms associated with abnormal sodium or water retention; , (b) selecting or determining an effective amount of the medicament to be administered to the patient. As a method of treatment of patients with metabolic syndrome, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to a medicament capable of improving metabolic syndrome or its symptoms, (b) selecting or determining an effective amount of the medicament to be administered to the patient. A method of treating a patient with a mood disorder or sleep disorder, (a) measuring the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent capable of improving the mood disorder or sleep disorder, or symptoms thereof Let's (b) selecting or determining an effective amount of the medicament to be administered to the patient. As a method of treating cancer patients, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent that can improve cancer (b) selecting or determining an effective amount of the medicament to be administered to the patient. As a method of treating patients with heart disease or hypertension, (a) determining the presence of an allele of a GHR gene in a patient and correlating the allele with the likelihood of an increase or decrease in a positive response to an agent capable of improving heart disease or hypertension, or symptoms thereof; (b) selecting or determining an effective amount of the medicament to be administered to the patient. The method according to any one of claims 16 to 25, (c) further comprising administering said effective amount of said medicament to said patient. The method of any one of the preceding claims, comprising determining whether the patient's DNA encodes a GHR polypeptide having a deletion at exon 3. The method of any one of the preceding claims, comprising measuring the presence of a GHRd3 allele in the patient. 29. The method of claim 27 or 28, comprising determining whether the patient is homozygous or heterozygous for the GHRd3 allele. 30. The method of any one of claims 27-29, wherein said measuring step comprises detecting GHRd3 nucleic acid in the sample. 31. The method of claim 30, wherein said measuring step further comprises performing a hybridization analysis. The method of any one of claims 27-29, wherein the measuring step comprises detecting a GHRd3 polypeptide in the sample. The method of claim 32, wherein said detecting step comprises detecting an antibody against a GHRd3 polypeptide in the sample. The method of any one of the preceding claims, wherein the patient is a human. The method of claim 16, wherein the patient is a patient with ISS. The method of claim 16, wherein the patient has a height less than or equal to about 2 standard deviations from the normal height, taking into account age and gender. 27. The method of claim 16 or 26, further comprising determining whether the patient has a height less than or equal to about 2 standard deviations from the normal height, taking into account age and gender. The method of any one of the preceding claims, wherein the medicament is a growth hormone polypeptide, or fragment thereof or variant thereof. The method of claim 38, wherein the effective amount of GH is at least about 0.2 mg / kg / week. The method of claim 38, wherein the effective amount of GH is at least about 0.25 mg / kg / week. The method of claim 38, wherein the effective amount of GH is at least about 0.3 mg / kg / week. The method of claim 38, wherein the effective amount of GH is from about 0.001 mg / kg / day to about 0.2 mg / kg / day. The method of claim 38, wherein the effective amount of GH is from about 0.01 mg / kg / day to about 0.1 mg / kg / day.