KR20030091952A - Specific human antibodies for selective cancer therapy - Google Patents

Abstract

The present invention relates to peptides or polypeptides comprising Fv molecules, constructs thereof, fragments or constructs of any of these having enhanced binding properties to selectively and / or specifically bind to target cells for other cells. Wherein the binding selectivity or specificity is primarily determined by the first hypervariable portion, where Fv is scFv or dsFv and optionally has one or more tags. Improved binding relates to a binding site that is substantially exposed and / or overexpressed on or in a target comprising cells for other cells on or within which the binding site is substantially unavailable and / or not expressed. will be. The invention also relates to a method for isolating said peptides and polypeptides obtained from phage display libraries and nucleic acid molecules encoding them. The present invention provides pharmaceutical compositions and kits for the diagnosis and treatment of diseases, in particular cancer, more particularly acute myeloid leukemia, comprising the peptides or polypeptides.

Description

SPECIFIC HUMAN ANTIBODIES FOR SELECTIVE CANCER THERAPY

Tissue-selective targeting of therapeutic agents is a recent problem in the pharmaceutical industry. Novel cancer treatments based on targeting have been designed to increase the specificity and efficacy of the treatment while reducing toxicity thereby improving overall efficacy. Mouse monoclonal antibodies (MAb's) against tumor associated antigens have been used in attempts of chemotherapy conjugates to target toxins, radionucleotides and tumors. In addition, differentiation antigens such as CD19, CD20, CD22 and CD25 have been utilized as cancer specific targets in the treatment of hematopoietic malignancies. Despite extensive research, this approach has some limitations. One limitation is that isolation of appropriate monoclonal antibodies that exhibit selective binding is difficult. The second limitation is that it requires high antibody immunogenicity as a prerequisite for successful antibody isolation. A third limitation is that the immune response to a mouse antibody (human anti-mouse antibody-HAMA response) is often induced in patients, which further shortens serum life and interferes with repetitive treatment, thereby reducing the therapeutic value of the antibody. This last limitation has stimulated interest in manipulating chimeric or humanized monoclonal antibodies of murine origin and finding human antibodies.

There are a number of factors that affect the therapeutic efficacy of monoclonal antibodies (Mab) for cancer treatment. These factors include the specificity of antigen expression, expression levels, antigenic heterogeneity and tumor accessibility in tumor cells. Leukemias and lymphomas generally responded more sensitively to treatment with antibodies than solid tumors such as carcinomas. MAbs rapidly bind to leukemia and lymphoma cells in the bloodstream and easily penetrate into malignant tumor cells in lymphoid tissues, making lymphoid tumors an excellent target for MAb-based therapies. An ideal system would involve identifying MAbs that recognize markers on the cell surface of stem cells that produce progeny cells of malignant tumors.

To aid in the discovery / generation of Mabs, phage libraries have been used to select random single chain Fv (scFv) that binds to certain target proteins isolated such as antibodies, hormones and receptors. In addition, the use of antibody display libraries, particularly phage scFv libraries, in general facilitates alternative means of discovering unique molecules for targeting specific but unrecognized and unidentified cell surface regions.

Leukemia, lymphoma and myeloma are cancers that originate in the bone marrow and lymphoid tissue and are associated with unregulated growth of cells. Acute lymphoblastic leukemia ("ALL") is a heterogeneous disease defined by specific clinical and immune characteristics. As with other forms of ALL, the definitive cause of most cases of B-cell ALL ("B-ALL") is unknown, but in many cases the single cell results in abnormal and continual increase in the disease. By acquired genetic modification in DNA.

AML is a heterogeneous group of tumors with progenitor cells that give rise to finally differentiated cells of the bone marrow family (red blood cells, granulocytes, monocytes and platelets) under normal conditions. As with other forms of tumors, AML is associated with acquired genetic modifications that allow normally differentiated bone marrow cells to be replaced by relatively less differentiated blast cells, indicating one or more types of early bone marrow differentiation. AML generally develops in the bone marrow and to a lesser extent in the second hematopoietic organ. AML primarily affects adults and most affects the onset between 15 and 40 years of age, but is known to affect both children and older adults. Almost all patients with AML require treatment immediately after diagnosis to achieve clinical relief without abnormal levels of traces of undifferentiated subcellular circulation.

To date, various monoclonal antibodies have been developed that induce cytolytic activity against tumor cells. Humanized versions of the monoclonal antibody MuMAb4D5 that direct the extracellular domain of P185 have been approved by the FDA and are being used to treat human breast cancer (US Pat. Nos. 5,821,337 and 5,720,954). After binding, the antibody can inhibit the growth of tumor cells that depend on the HER2 growth factor receptor. In addition, chimeric antibodies against CD20, which result in rapid reduction of peripheral B cells, including those associated with lymphoma, have recently been approved by the FDA (US Pat. No. 5,843,439). Binding of the antibody to target cells results in complement-dependent cell lysis. This product has recently been approved and is currently used clinically to treat low grade B cell non-Hodgkin's lymphoma.

Several other humanized and chimeric antibodies are under development or in clinical trials. In addition, humanized Ig that specifically reacts with the CD33 antigen, expressed both in normal bone marrow cells as well as in most types of myeloid leukemia cells, has been described as anticancer drugs calicheamicin, CMA-676 (Sievers et al., Blood, 90 (10 Suppl. 1 Part 1), 504A (1997). The conjugate, known as the drug Mylotarg, has recently been approved (Caron et al., Cancer Supplement, 73, 1049-1056 (1994)). In view of cell lytic activity, additional anti-CD33 antibodies (HuM195), currently in clinical trials, were treated with gelonin toxin (McGraw et al., Cancer Immunol. Immunother, 39, 367-374 (1994)) and radioactive. Isotope ¹³¹ I (Caron et al., Blood 83, 1760-1768 (1994)), ⁹⁰ Y (Jurcic et al., Blood, 92, (10 Suppl. Part 1-2), 613A (1998))) and Several cytotoxic agents were conjugated, including ²¹³ Bi (Sgouros et al., J. Nucl. Med., 38 (5 Suppl.), 231P (1997)).

Chimeric antibodies against leukocyte antigen CD-45 (cHuLym3) are in preclinical stages for the treatment of human leukemia and lymphoma as conditioning for bone marrow transplantation (Sun et al., Cancer Immunol. Immunother., 48, 595 -602 (2000)). For in vitro assays, specific cell lysis was observed in ADCC (antibody dependent cell-mediated cytotoxicity) assays (Henkart, Immunity, 1, 343-346 (1994); Squier and Cohen, Current Opin. Immunol., 6 , 447-452 (1994)).

These preliminary results appear to be possible, but they have the following limitations. The final product contains a non-human sequence that results in a problematic immune response to non-human materials such as HAMA. The HAMA response interferes with repetitive treatment and shortens the life of the serum for the product. Moreover, the method allows only isolation of a single antibody species and only separation of antibodies to known and purified antigens. In addition, the method is not selective as long as it permits the separation of antibodies against cell surface markers present in normal cells as well as malignant tumor cells.

Thus, a method of overcoming the above limitations would be desirable. In addition, the method would ideally be able to identify target ligands or markers, such as in cells associated with cancer cells or mediation of cancer cell metastasis. In addition, the method will enable the production of antibodies to the target. Phage display techniques seem to provide the above capabilities.

The use of phage display techniques has allowed for the isolation of scFv containing the complete human sequence. For example, fully human antibodies against human TGFb2 receptors based on milk scFv clones have recently been developed from phage display techniques. The scFv (Thompson et al., J. Immunol Methods, 227, 17-29 (1999)), which is converted to fully human IgG4 that can compete with the binding of TGFb2, has strong anti-proliferative activity. This technique, known to those skilled in the art, is described more clearly in the following publications: Smith, Science, 228, 1315 (1985); Scott et al, Science, 249, 386-390 (1990); Cwirla et al., PNAS, 87, 6378-6382 (1990); Devlin et al., Science, 249, 404-406 (1990); Griffiths et al., EMBO J., 13 (14), 3245-3260 (1994); Bass et al., Proteins, 8, 309-314 (1990); McCafferty et al., Nature, 348, 552-554 (1990); Nissim et al., EMBO J., 13, 692-698 (1994); U.S. Patents 5,427,908, 5,432,018, 5,223,409, and 5,403,484, lib.

Using the phage display technique, the inventors of the present invention have identified cellular markers present in or on cells with diseased or malignant tumor conditions. Accordingly, it is an object of the present invention, in particular, to identify peptides and polypeptides that recognize cellular markers that are substantially exposed or overexpressed in or on cells in a diseased or malignant tumor state.

Another object of the present invention is to identify the peptides and polypeptides by using and expanding phage display techniques as an aid.

Another object of the present invention is to identify the peptides and polypeptides by immuno-cross-reactivity.

Another object of the invention is that the peptides and polypeptides are of fully human origin.

Another object of the present invention is that the peptides and polypeptides are isolated against antibodies that are not necessarily immunogenic.

Another object of the present invention is to provide a peptide or polypeptide for preventing, delaying or treating cancer, in particular blood related cancers such as leukemia or lymphoma.

It is another object of the present invention to provide local targeting of cells with cancer, either alone or with peptides and polypeptides associated or coupled with anticancer agents and / or diagnostic labels or markers.

Another object of the present invention is to provide a method for producing a targeting agent for a given ligand.

Another object of the present invention is to identify specific motifs that recognize cellular markers that are overexpressed in malignant tumor conditions and that can be used in the construction of targeting or diagnostic markers or markers for anticancer agents.

Another object of the present invention is to provide a composition comprising an effective amount of the peptide, polypeptide motif associated or coupled to an anticancer agent or diagnostic label or marker.

It has been established that scFv invades tissue and is removed from blood more quickly than full sized antibodies because they are smaller in size. Adams, G. P., et al., Br. J. Cancer 77, 1405-1412 (1988); Hudson, P. J., Curr. Opin. Immunol. 11 (5), 548-557 (1999); Wu, A. M., et al., Tumor Targeting 4, 47 (1999)]. Thus, scFv is often used in diagnostics involving radiolabels, such as tumor imaging, to enable more rapid removal of radiolabels from the body. Many cancer targeting scFv multimers have recently undergone preclinical evaluation of in vivo stability and efficacy. Adams, G. P., et al., Br. J. Cancer 77, 1405-1412 (1988); Wu, A. M., et al., Tumor Targeting 4, 47 (1999)].

Single chain Fv (scFv) fragments consist of the variable domains of the heavy (VH) and light (VL) chains of an antibody that are bound together by a polypeptide linker. The linker is functional in that the (V _H ) and (V _L ) domains allow the scFv to recognize or bind to its target with an affinity or increased affinity similar to that of the parent antibody. It is long enough to overlap with the Fv domain. Commonly used linkers include glycine and serine residues to provide flexibility and protease resistance.

Typically, scFv monomers are designed by the polypeptide linker to the C-terminus of the V _H domain, which is bound to the N-terminal residue of V _L. Optionally reverse orientation is used. That is, the C-terminus of the V _L domain is tied to the N-terminal residue of V _H via a polypeptide linker. See Power, B., et al., J. Immun. Meth. 242, 193-204 (2000). Polypeptide linkers are typically about 12 amino acids in length. When the linker is reduced to about 3-12 amino acids, the scFv cannot overlap with the functional Fv domain and instead associates with the second scFv to form a dibody. Also, if the length of the link is less than 3 amino acids, the scFv combination becomes trimer or tetramer, depending on linker length, composition and Fv domain orientation. BE Powers, PJ Hudson, J. Immun. Meth. 242 (2000) 193-194.

Recently, it has been found that multivalent antibody fragments such as scFv dimers, trimers and tetramers often provide more pronounced affinity than binding of the parent antibody to the target. This higher affinity provides a number of advantages, including ideal pharmacokinetics for tumor targeting applications.

Thus, the greater binding affinity of the multivalent form is desirable in diagnostic and therapeutic regimens. For example, scFv can be used as a blocker that binds to a target receptor and blocks the binding of a "natural" ligand. In this example, there is a high affinity combination between the scFv and the receptor, thereby reducing the chance of separation that may allow undesirable binding of the natural ligand to the target. In addition, the high affinity is critical, particularly when the target receptor is associated with adhesion and rolling, or when the target receptor is on cells present in high sheer flow regions, such as platelets.

Accordingly, the subject of the present invention is a multivalent form of Y1 and Y17 scFv. Such multivalent forms include, but are not limited to dimers, trimers and tetramers, sometimes referred to herein as dimers, triabodies and tetrabodies, respectively.

The present invention relates to tissue targeting and identification by phage display techniques of peptides and polypeptides that specifically bind to target cells. The peptides and polypeptides are Fv molecules, constructs thereof, fragments or constructs of any of these. More specifically, the peptides and polypeptides may have anticancer activity and / or are associated with or conjugated to anticancer agents, in particular anticancer agents for blood related cancers.

The invention will be described in more detail with reference to the accompanying drawings described below, by way of example and not of limitation.

1 shows binding of phage clones to fixed platelets as measured by EIA analysis. The data is presented by the action of absorbance at 405 nm.

2A, 2B and 2C show the binding of mononuclear cell samples from three individual AML patients to scFv as measured by FACS analysis. The fluorescence intensity of bound cells is shown by two FITC-labeled test samples (control scFv and scFv clone Y1).

3 shows the binding of Y-I to Ficoll-purified platelets (3a) and monocytes (3b) as measured by FACS analysis. The fluorescence intensity of bound cells is shown by two FITC labeled test samples (control scFv and scFv clone Y1).

4 shows the binding of FITC-labeled scFv clone Y1 to cord-blood CD34 + hepatocytes. CD34 + mediated cells of the FL3-H channel were analyzed for binding to their FITC-labeled negative control scFv (FIG. 4A) or FITC-labeled scFv clone Y1 (FIG. 4B) in the FLI-H channel. It was. 4C shows FSC and SSC dot graph analysis of the same FITC-labeled scFv clone Y1 as 4b. The circular regions in FIGS. 4B and 4C show subpopulations of CD34 + cells that bind scFv clone Y1.

5 shows FACS analysis of samples from two patients with pre-B-ALL cells: from children (5a, 5c, 5e) and from adults (5b, 5d, 5f). Commercially available PE-labeled CD19 (marker for normal peripheral B-cells; FIGS. 5A, 5C), with FITC-labeled negative control scFv (5a, 5b) or FITC-labeled YI scFv (5c, 5d) or A double staining procedure using either PE-labeled CD34 (marker for hepatocytes: FIG. 5D) was used. 5B is a double negative control. The fluorescence intensity (x-axis) of cells bound by FITC-labeled sample (scFv clone Y1) for the staining pattern of negative control is shown (5e and 5f).

6 provides the results of binding comparative studies performed using Jurkat cells. Along with the negative control, a FACS analysis of the binding of FITC-labeled Y-I scFv monomers, dimers and trimers to Jurkat cells is shown.

7 provides the results of a study comparing the binding of IgG-Y-I and scFv-Y1. The dual staining procedure was used to compare the binding of the full-size IgG-Y1 to the scFv-Y1 form. IgG-YI 5 ng was used for FACS analysis in RAJI cells (YI negative cells; FIG. 7A) and Jurkat cells (Y1 positive cells; FIG. 7B). For detection, PE labeled goat anti-human IgG was used. ˜1 μg (200 fold) was used for binding of scFv-YI-I, followed by staining with PE-labeled rabbit anti-scFv antibody and FACS analysis (FIG. 7C).

8 shows a comparison of binding between YI dimers, Y1 scFv (CONY1) and Y1 IgG.

9 shows a binding comparison between Y1 sulfide bridge dimer and Y1 scFv (CONY1).

10 is a graph of Superdex 75 profile of Y1-cys-kak.

11 shows the size of dimers compared to monomers in reducing and non-reducing conditions.

12 provides the results of the ELISA assay.

13 is a chart of epitopes of anti-GPIbα antibodies.

14 is an amino acid sequence number.

Detailed description of the invention

Specificity is defined herein as the recognition of a target ligand and binding following it by one or more domains in a peptide or polypeptide of the invention.

Selectivity is defined herein as the ability of a targeting molecule to select and bind a cell state, all cell types or cell states obtained from one cell type or a mixture of cell types or cell states that may be specific for the targeting molecule.

Conservative amino acid substitutions are defined as changes in amino acid composition by altering one or more amino acids of a peptide, polypeptide or protein or fragment thereof. Such substitutions are generally by amino acids having similar properties (eg, acidic, basic, aromatic, size, positive or negatively charged, polar, nonpolar), wherein the substitution is in a substantially principal manner a peptide, polypeptide or protein Does not alter the properties of (e.g., charge, IEF, affinity, avidity, conformation, solubility) or activity. Representative substitutions that may be made with such conservative amino acid substitutions may be between the following groups of amino acids:

(i) Glycine (G), Alanine (A), Valine (V), Leucine (L) and Isoleucine (I)

(ii) aspartic acid (D) and glutamic acid (E)

(iii) Alanine (A), Serine (S) and Threonine (T)

(iv) histidine (H), lysine (K) and arginine (R)

(v) Asparagine (N) and Glutamine (Q)

(vi) Phenylalanine (F), Tyrosine (Y) and Tryptophan (W)

Conservative amino acid substitutions may be made mainly at the flanking region of the molecule as well as other parts of the molecule, such as hypervariable portions that are reactive to the selective and / or specific binding properties of the variable heavy chain cassette. Additionally or alternatively, the modification may reconstruct the molecule to form full size antibodies, dimers (dimers), trimers (trimers), and / or tetramers (tetramers), minibodies or microstructures. This can be done by creating a microbody.

As used in the description and claims of the invention, Fv is defined as a molecule consisting of the variable portion of the heavy chain of a human antibody and the variable portion of the light chain of a human antibody, which may be the same or different, wherein the variable portion of the heavy chain is variable Connected to, linked to, fused to, covalently attached to, or associated with, a portion.

Fragments of Fv molecules are defined as any molecule that is smaller than the original Fv and retains the selective and / or specific binding properties of the original Fv. Non-limiting examples of such fragments include (1) a body comprising a fragment of only the heavy chain of Fv, (2) a microbody comprising a small portion of the antibody heavy chain variable region (PCT Application PCT / IL99 / 00581), (3) Analogs comprising fragments of the light chain, and (4) analogs comprising functional units of the light chain variable portion.

An anticancer agent is an agent that has anticancer activity, ie, any activity that inhibits the growth or differentiation of cells with cancer or immature pre-cancer, or any activity that inhibits metastasis of cells with cancer. In the present invention, the anticancer agent is also an agent having an anti-angiogenic activity that prevents, inhibits, delays or stops the formation of angiogenesis of tumor tissues, or is also used for the attachment and metastatic invasion of cells with cancer and cells with preliminary cancer. agents having anti-adhesive activity which inhibits, delays or stops invastion).

Inhibition of cancer cell growth herein refers to (i) prevention of cancer or metastatic growth, (ii) slowing cancer or metastatic growth, (iii) overall prevention of the growth or metastasis of cancer cells, leaving intact and living cells, or (iv) defined as death of cancer cells. More specifically, inhibition of cancer growth can be applied in particular for blood-related cancers such as AML, multiple myeloma or chronic lymphocytic leukemia.

Phagemids are defined as phage particles that carry plasmid DNA. Because it carries plasmid DNA, phagemid particles do not have enough space to contain the entire complement of the phage genome. Components lost from the phage genome are essential information for the package of phage particles. Thus, in order to propagate phage, it is necessary to incubate certain phage particles with helper phage strains that complement lost package information.

Cassettes applied to polypeptides and as defined herein refer to predetermined sequences of contiguous amino acids that act as frameworks, are thought to be single units, and are manipulated as such. Amino acids may be replaced, inserted, removed or attached at one or both ends. Similarly, stretches of amino acids can be replaced, inserted, removed or attached at one or both ends.

As used herein, immunoglobulin (Ig) molecules are defined in any of five classes: IgG, IgA, IgD, IgE or IgM. The IgG class includes several subclasses, including but not limited to IgG1, IgG2, IgG3, and IgG4.

A pharmaceutical composition refers to a formulation comprising a peptide or polypeptide of the invention and a pharmaceutically acceptable carrier, excipient or diluent thereof.

Pharmaceutical formulations refer to agents useful for the prophylactic treatment or diagnosis of a mammal, including but not limited to humans, cattle, horses, pigs, mice, dogs, cats or any other warm blooded animal. The pharmaceutical formulation is selected from the group comprising radioisotopes, toxins, oligonucleotides, recombinant proteins, antibody fragments and anticancer agents. Non-limiting examples of the pharmaceutical preparations include antiviral agents including acyclovir, ganciclovir and zidovudine; Antithrombosis / restenosis agents including cilostazol, dalteparin sodium, leviparin sodium and aspirin; Zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, dexibuprofen Anti-inflammatory agents including sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib and nimesulid; Anti autoimmune agents, including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide and cyclophosphamide; And anti-adhesion / anti-agglomerating agents, including limaprost, clorcromene and hyaluronicacid.

Antileukemia agents are agents that have anti-leukemia activity. For example, anti-leukemia agents include agents that inhibit or stop the proliferation of leukemia or immature pre-leukemia cells, agents that kill leukemia or pre-leukemia cells, or other anti-leukemic agents of leukemia or pre-leukemia cells. There are agents that increase sensitivity, and agents that inhibit the metastasis of leukemia cells. In the present invention, the anti-leukemic agent may also be an agent having antiangiogenic activity that prevents, inhibits, delays or stops angiogenesis of the tumor.

As used herein, the term “affinity” is a measure of the binding strength (combination constant) between a receptor (eg, one binding site on an antibody) and a ligand (eg, a determinant of an antigen). The strength of the sum of the non-covalent correlations between the binding sites on a single antigen-antibody and a single epitope is the affinity of the antibody for that epitope. Low affinity antibodies tend to bind weakly and tend to separate easily, whereas high affinity antibodies remain more strongly bound to the antigen and more tightly bound. The term "avidity" differs from affinity because it reflects the value of the antigen-antibody interaction.

Specificity of antibody-antigen interactions: Although antigen-antibody responses are specific, in some cases antibodies induced by one antigen may cross react with another irrelevant antigen. Such cross reactions occur when two different antigens contain identical or similar epitopes or anchor sites thereof, or when an antibody specific for one epitope binds to an irrelevant epitope with similar chemical properties.

Subblasts are cells of immature stages of cell development, distinguished from dormant cells by a higher cytoplasmic to nuclear ratio.

Platelets are disc-like cytoplasmic sections of megakaryocytes that are ejected from the marrow sinus and then circulate into the surrounding blood flow. Platelets have several physiological functions, including a major role in coagulation. Platelets contain granules in the center, have a clear plasma around them, and do not contain clear nuclei.

The term “epitope” is used herein to mean an antigenic site or antigenic determinant that interacts with an antibody, antibody fragment, antibody complex or binding fragment thereof or complex comprising a T-cell receptor. The term epitope is used herein interchangeably with tersm ligands, domains and binding regions.

A given cell may express a protein (or epitope) having a binding site for a given antibody on its surface, but the binding site is hidden in a cell in a state that may be referred to as the first step (Step I). For example, sterically hindered or blocked, or lack of the properties required to bind by the antibody. Stage I can be, for example, a normal, healthy, disease-free condition. If the epitope is in hidden form, it is not recognized by certain antibodies. In other words, the antibody does not bind to the epitope or the cells of step I. However, the epitope may be exposed, for example, by unblocking due to modifications in itself, modification of nearby or combined molecules, or changes in placement in regions. Examples of modifications include changes in folding, changes in post-translational modifications, changes in phospholipidation, changes in sulfates, changes in glycosylation, and the like. The modifications may occur when the cell enters a different state, which can be referred to as the second stage (phase II). Examples of second state (s) include activation, proliferation, transformation or malignancy. Upon modification, the epitope can be exposed and the antibody can bind.

The term "Fab fragment" as used herein is a monovalent antigen-binding fragment of an immunoglobulin. Fab fragments consist of parts of the light and heavy chains.

Polyclonal antibodies are the product of an immune response and are formed by a number of different B-lymphocytes. Monoclonal antibodies are derived from single cells.

As used herein, agglutination refers to the process by which suspended bacteria, cells, discs or other particles of a similar size attach to form agglomerates. The process is similar to precipitation, but the particles are larger and in suspension than in solution.

The term aggregation refers to agglomerates of platelets induced in vitro, and thrombin and collagen as part of a continuous mechanism result in the formation of thrombus or hemostatic plugs.

Expression patterns of genes can be studied by analyzing the amount of gene product produced at various times, in various tissues, and under various conditions. If the amount of gene product is greater than that found in a steady state, such as a disease free control, the gene may be considered "overexpressed."

A promoter is a region on DNA where RNA polymerase binds to initiate transcription.

Antibodies, immunoglobulins, are protein molecules that bind to antigens. These consist of units of four polypeptide chains (two heavy chains and two light chains) linked together by disulfide bonds. Each of the chains always has a region and a variable region. These can be divided into five classes, IgG, IgM, IgA, IgD and IgE, depending on the heavy chain component. They are produced by B lymphocytes and recognize specific foreign antigenic determinants and promote the removal of those antigens.

Antibodies can be produced and used in many forms, including antibody complexes. The term "antibody complex" or "antibody complexes" as used herein is used to mean a complex of one or more antibodies with another antibody or antibody fragment (s) or a complex of two or more antibody fragments.

F (ab ') 2 fragments are bivalent antigen binding fragments of immunoglobulins obtained by pepsin digestion. It contains part of two light chains and two heavy chains.

Fc fragments are non-antigen-binding portions of immunoglobulins. It contains the carboxy terminal portion of the heavy chain and the binding site for the Fc receptor.

The Fd fragment is the variable region and the first always region of the heavy chain of immunoglobulin.

Contaminating proteins are proteins that may be present in a sample without being specifically selected.

Peptido-mimetics are small molecules, peptides, polypeptides, lipids, polysaccharides, or conjugates thereof that have the same action or activity of another entity, such as an antibody.

Phagemids are plasmid vectors designed to contain origins of replication obtained from filamentous phage such as m13 of fd.

A wide range of diseases exist with respect to cells that have been altered or otherwise modified with diseases that express cell specific and / or disease specific ligands on the surface. These ligands can be used to achieve the recognition, selection, diagnosis and treatment of specific diseases through the recognition, selection, diagnosis and treatment of each individual cell. The present invention provides peptides or polypeptides comprising Fv molecules, constructs thereof, fragments thereof, constructs of these fragments, or fragments of the constructs, all of which have improved binding properties. These binding properties allow the peptide or polypeptide molecule to selectively and / or specifically bind to the target cell for other riches, the binding specificity and / or selectivity being determined primarily by the first hypervariable portion. The Fv may be scFv or dsFv.

The above-described Fv molecules can be used to target diseased cells. The diseased cell may be, for example, a cancer cell. Non-limiting examples of types of cancer that can be diagnosed and / or treated by specific targeting include carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, normal carcinomas and melanoma. Leukemia, lymphoma and myeloma are cancers of bone marrow and lymphoid tissue and are associated with uncontrolled fertility of cells.

New approaches to diagnosing and treating diseases, especially cancer, have been developed in recent years. There are tumor targeting approaches that use targeting molecules that can be selected and produced in various ways. One approach to identifying possible targeting molecules is phage display. Phage display is displayed on the surface of a filamentous bacteriophage by the fusion of a peptide, polypeptide, antibody or protein to their phage coat protein along with DNA encoding the displayed protein present and selected by their expression and present in the phage virion. Technique. The scFv produced by the phage display technique consists of the variable domains of each of the antibody heavy and light chains, which are linked by a flexible amino acid polypeptide space (Nissim et al., EMBO J, 13, 692-698 (1994)).

Phage display libraries (also called phage peptide / antibody libraries, phage libraries or peptide / antibody libraries) comprise large populations of phage (typically 10 ⁸ -10 ⁹ ), each phage particle displaying a different peptide or polypeptide sequence. These peptide or polypeptide fragments can be constructed in various lengths. The displayed peptides or polypeptides may be derived from, but are not limited to, heavy or light chains of human antibodies.

In the present invention, scFv antibody libraries generated by phage display techniques can be used to obtain and generate targeting molecules. Flow cytometry, particularly fluorescence-activated cell sorting (“FACS”), has been used to identify and isolate specific phage clones, peptides or polypeptides that recognize target cells. Phage-expressed scFv antibody fragments are capable of in vivo selection, enrichment and selection of high affinity clones (US Pat. No. 5,821,337, US Pat. No. 5,720,954). Thus, this kind of library is a powerful means of generating new tools for research and clinical use and has many advantages over conventional approaches (Caron et al., Cancer Supplement, 73, 1049-1056 (1994) ). The library contains the potential of high diversity of antibody molecules (Nissim et al., EMBO J., 692-69 8 (1994)). In the present invention, stable human cDNA can be used as a continuous source of material for antibody production (US Pat. No. 5,843,439). Molecular recognition and selection are not affected by the in vivo immunity of the target protein of interest.

Affinity selection of phage displayed antibodies provides a useful method for enriching antigen-reactive scFv obtained from large libraries, while this requires a number of steps to isolate single clones and characterize soluble scFv. The scFv itself may be modified to enhance affinity and / or binding by performing conservative amino acid substitutions, or by generating fragments of scFv or constructs of these fragments.

The scFv of the present invention specific for different human cells and tissues is optionally associated, combined, fused or linked with a pharmaceutically effective amount of a pharmaceutical agent and / or radioisotope, together with a pharmaceutically effective carrier, to provide anti-disease and / or anticancer activity. And / or to form drug-peptide compositions, fusions or conjugates for diagnosis of such purposes.

Phage clones are selected and identified by a multistep process known as abiopanning. Biopanning is performed by incubating phage display protein ligand variants (phage display library) together with targeting, removing unbound phage by washing techniques, and specifically eluting bound phage. The eluted phage is optionally amplified before further binding cycles, and any amplification concentrates pools of specific sequences for phage clones that carry antibody fragments that display the best binding to the target. After several cycles, individual phage clones are characterized and the sequence of peptides displayed by the clones is determined by sequencing the corresponding DNA of phage virions.

The scFv obtained by this method is called a lead compound. Lead compounds are defined as compounds which are in the final format comprising the core peptide or polypeptide. The leader compound may be modified and / or expanded, but it must maintain a core peptide or polypeptide or some conservatively modified form thereof. Modifications by way of amino acid substitutions may occur, for example, at the N-terminus, at the carboxy terminus, or at any CDR region of Fv or upstream or downstream thereof. Modifications also include, but are not limited to, coupling to fused proteins, drugs or toxins, construction of multiplexes, and expansion to complete antibody molecules. One preferred category of lead compounds provided herein is the scFv obtained as the final product of the biopanning process.

One embodiment of the invention provides one or more unnatural modifications of a peptide or polypeptide of the invention. Such unnatural modifications may make the peptide or polypeptide more immunogenic or more stable. Unnatural modifications include, but are not limited to, peptoid modifications, semipeptoid modifications, cyclic peptide modifications, N-terminal modifications, C-terminal modifications, peptide bond modifications, backbone modifications, and residue modifications. It doesn't happen.

The choice of antigen specific phage antibodies was highly dependent on biopanning for a single immobilized antigen. There was a limited choice of using whole cells as targets. In the present invention, whole cells were used to select specific antibodies that recognize crystalloids on the surface of leukemia cells, wherein the specific receptors have not been known or characterized previously. This method does not allow for convenient adjustment of antibody concentration or removal of certain predominant antibody reactivity. In addition, the phage can be enriched for those with multiple copies of scFv as opposed to those with high affinity clones. Nevertheless, the advantage of this approach is that it becomes a separate tool for isolating novel human antibody molecules.

Embodiments of the invention provide peptides or polypeptides comprising Fv molecules, constructs thereof, fragments or constructs of any of these, that bind to unknown ligands on a first cell having a first state and a second state. Wherein said binding is effective in a second state rather than a substantially first state, and specifically or selectively binds to a ligand on a second cell by immune cross-reactivity, wherein said Fv is scFv or dsFv, optionally Has one or more tags.

Another embodiment provides the peptides or polypeptides of the invention, wherein the selective and / or specific binding of the peptides or polypeptides to the ligands of the second cell is determined primarily by the first hypervariable portion.

Another embodiment provides the peptide or polypeptide of the invention, wherein the first hypervariable portion is a CDR2 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24.

Another embodiment provides a peptide or polypeptide of the invention, wherein the first hypervariable region is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24, wherein the binding selectivity or specificity is By a second hypervariable part and / or by a third hypervariable part and / or by one or more upstream and / or one or more downstream regions flanked by the first, second and third hypervariable parts, respectively. get affected.

Another embodiment provides a ligand of a second cell bound by a peptide or polypeptide of the invention. The two cell selection protocols are as follows: megakaryocytes are large multinucleated cells derived from hematopoietic stem cells of bone marrow. Platelets destroy the megakaryocyte cytoplasm and enter the surrounding blood. In vivo, a wide range of cytokines directly affect hepatocytes. For example, thrombopoietin increases the number of platelets by directly increasing the differentiation of hepatocytes into megakaryocytes. Thus, the cells express many cell surface markers that are also found in prematurely mature cells.

Malignant tumor blood cells (leukemia and lymphoma) are characterized by immature cells expressing cell surface proteins normally found in partially differentiated hematopoietic progenitors. Thus, platelets are an interesting source for the identification of early mature cell surface markers expressed in diseased or malignant blood cells. In one protocol described below, specific cells such as but not limited to platelets carrying unknown ligands were used in the initial biopanning step. Subsequent clone selection was performed with certain target cells, including but not limited to surface markers of targeted cells such as AML cells. In this method, phage clones obtained by biopanning on platelets provide a tool for recognizing and binding ligands on blood cells of diseased or malignant interest.

The aforementioned targets include cells derived from isolated tissues. The isolated tissue may be a diseased tissue, more specifically, cancer tissue. The cancerous tissue may be derived from any form of malignant tumor, including but not limited to carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma.

In addition to the biopanning methods described above, another approach is based on the separation of peptides or polypeptides that bind ligands on cells, as determined by direct panning to the ligands.

The present invention provides a peptide or polypeptide comprising a Fv molecule, a construct thereof, a fragment of any one of them, or a construct of a fragment. The construct may be a multimer (eg, dimer, trimer, tetramer) or full size Ig molecules, and the fragments may be small or microsomes. All derived constructs and fragments possess enhanced binding properties to selectively and / or specifically bind to target cells for other cells. The binding selectivity and / or specificity is mainly determined by the first hypervariable portion, wherein the Fv is scFv or dsFv and optionally has one or more tags.

In the embodiment of the present invention, tags are inserted or attached to Fv peptides or polypeptides to assist in their preparation, identification and diagnosis. The tag may later be removed from the molecule. Non-limiting examples of the tag include AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S.Tag®, T7, V5 , VSV-G (Jarvik and Telmer, Ann. Rev. Gen., 32, 601-618 (1998)), and KAK-Tag (lysine-alanine-lysine). The tag is preferably c-myc or KAK.

The two variable chains of the Fv molecules of the invention can be linked or linked together by spaces of 0-20 amino acid residues in length. The spacer may or may not be branched. The linker is preferably 0-15 amino acid residues to make a single chain Fv (“scFv”), and the linker is most preferably (Gly ₄ Ser) ₃ . The scFv can be obtained from phage display library.

The Fv molecule itself consists of a first chain and a second chain, each chain comprising a first, a second and a third hypervariable portion. The hypervariable loops in the variable domains of the light and heavy chains are referred to as Complementary Determining Regions (CDRs). The heavy and light chains each have CDR1, CDR2 and CDR3. These regions are contemplated to form antigen binding sites and may be specifically modified to exhibit improved binding activity. The most variable in nature among these regions is the CDR3 region of the heavy chain. It is understood that the CDR3 region is the most exposed region of the Ig molecule and is the location primarily responsible for the selective and / or specific binding properties observed and presented as provided herein.

One embodiment of the invention is substantially exposed and / or overexpressed on or within a target comprising a cell for another cell on which or within which a binding site is substantially unavailable and / or not expressed. Provided are peptides or polypeptides comprising Fv molecules, constructs thereof, fragments or constructs of any of these, having enhanced binding properties to selectively and / or specifically bind to a specific binding site, wherein said binding The selectivity or specificity is mainly determined by the first hypervariable portion and the Fv is scFv or dsFv and optionally has one or more tags.

Another embodiment of the invention provides a peptide or polypeptide wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24.

Another embodiment provides a peptide or polypeptide of the invention wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24, wherein said binding selectivity or specificity is secondary By the second hypervariable part and / or by the third hypervariable part and / or by one or more upstream regions flanked by the first, second and third hypervariable parts, respectively, and / or by the one or more downstream regions. Affected by the second and third hypervariable regions are CDR2 and CDR1 regions, respectively.

One embodiment of the invention provides a peptide or polypeptide that binds to a target cell, which is a cell that is activated, excited, modified, altered, impaired, or diseased. Another embodiment of the invention provides a target cell which is a cancer cell. The target cell may be selected from the group consisting of, but not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma. In a preferred embodiment, the cancer cells are leukemia cells. In the most preferred embodiment, the leukemia cells are AML cells.

Peptides or polypeptides of the invention are also any constructs or modified constructs of Fv that retain the hypervariable portions of the heavy and / or light chains and have selective and / or specific binding properties. Non-limiting examples of constructs or modified constructs include multimers and complete antibodies of scFv, such as scFv, dsFv, dimers, trimers, tetramers (also called dimers, trimers, tetramers), and the like, and their And any other multimer that may comprise one or more hypervariable domains of the antibody. Peptides or polypeptides of the invention are also fragments or modified constructs of any construct that have some or all of the binding properties of the original construct.

Peptides or polypeptides of the invention are also constructs of fragments having some or all of the selective and / or specific binding properties of the original construct. Fv described in this specification may selectively and / or specifically bind to target cells and may be associated or conjugated to an anticancer agent or an anti-disease agent.

Peptides, polypeptides, fragments thereof, constructs thereof, and fragments of the constructs of the Fv molecules of the invention can be prepared in either prokaryotic or eukaryotic expression systems. In one embodiment of the present invention, the eukaryotic expression system is a mammalian system, and the peptide or polypeptide produced in the mammalian expression system is substantially free of mammalian contaminants after purification. Eukaryotic cell systems as defined herein refer to expression systems that produce peptides or polypeptides by genetic engineering methods, wherein the host cell is a eukaryote. In another embodiment of the invention, prokaryotic systems for the production of peptides or polypeptides of the invention use E. coli as a host for fragment vectors. Peptides or polypeptides produced in the E. coli system are substantially free of E. coli contaminating proteins after purification. When using a prokaryotic expression system, it is possible to add methionine residues to the N-terminus of some or all of the sequences provided herein. Removal of N-terminal methionine residues after peptide or polypeptide production for full expression of the peptide or polypeptide is by way of non-limiting example a sugar such as the use of aeromonas aminopeptidase under appropriate conditions (US Pat. No. 5,763,215). It may be carried out by a method commonly known in the art.

The present invention provides for the production of scFv based on the Fv peptide of the present invention. The promoter included in the vector used for cloning and amplification of scFv in prokaryotic cells can be variously selected. A promoter is a DNA sequence located upstream of a structural gene and capable of regulating the expression of the gene. The promoter is found in its natural state in the chromosome (s) of the organism and can also be engineered into prokaryotic or eukaryotic expression vectors. Promoters engineered to specific loci on a given DNA fragment finely regulate and precisely control the expression of a given gene. In the present invention, several promoters have been used in constructs comprising genes encoding the selected Fv. Non-limiting examples of promoters are deo, P1-P2, osmB, λP _L , β-lac-U5, SRα5 and CMV initial promoters. Deo is a double strand that creates a host capable of expressing a DNA encoding a given naturally occurring polypeptide or polypeptide analog under the control of the structural E. coli- derived deoxyribonucleotide promoter deoP1-P2 upon introduction into an appropriate E. coli. DNA plasmid. Further details are given in US Pat. No. 5,795,776 (Fischer, August 18, 1998) and US Pat. No. 5,945,304 (Fischer, August 31, 1999).

Expression of the E. coli osmB promoter is regulated by osmotic pressure. Vectors carrying this promoter can be used to produce high levels of various recombinant eukaryotic and prokaryotic polypeptides under the control of an osmB promoter in an E. coli host. Further details are given in US Pat. No. 5,795,776 (Fischer, August 18, 1998) and US Pat. No. 5,945,304 (Fischer, August 31, 1999).

λ P _L is a thermoinducible λ bacteriophage promoter regulated by a thermal labile inhibitor cI ⁸⁵⁷ . For a more detailed description see Hendrix et al. Lambda II, Cold Spring Harbor Laboratory (1983).

β-lac-U5 is the lacZ promoter (Gilbert and Muller-Hill, PNAS (US), 58, 2415 (1967)).

SRα5 is a mammalian cDNA expression system consisting of a monkey virus 40 (SV40) early promoter and an R-U5 segment of human T-cell leukemia virus type 1 length terminal repeat. This expression system is a primary or secondary grade that is more active than the SV40 early promoter in various cell types (Takebe et al., Molecular and Cellular Biology, 8, 466-472 (1988)).

Human cytomegalovirus promoters, known as CMV intermediate / initial enhancers / promoters, are most preferably used in the present invention to promote conservative expression of clone DNA insertions in mammalian cells. The CMV promoter is described in Schmidt, E. V. et al., (1990) Mol. Cell. Biol., 10, 4406 and US Pat. Nos. 5,168,062 and 5,385,839.

In a preferred embodiment of the invention, the promoter for induction of the phagemid system of the prokaryotic organism is selected from the group consisting of deo, osmB , λP _L , β-lac-U5 and CMV promoters. In a more preferred embodiment of the invention, the β-lac-U5 promoter was used for the induction of phagemid systems in E. coli. In the most preferred embodiment, the CMV promoter is used.

In one embodiment of the invention, a peptide or polypeptide of the invention comprises (a) a leader sequence that is present only in the sequence to be encoded and not in the mature protein; (b) a variable region of a heavy chain of 135-145 amino acids size, including a first hypervariable region of modified 4-12 amino acids; (c) a space region of ≦ 20 amino acids that can be shortened or eliminated; (d) then the variable region of the light chain specifically modified as described above; (e) subsequent tag sequences that are not optionally present in the final injectable product. Spacers, which are typically present in the scFv at a length of about 15 amino acid residues, allow the two variable chains (heavy and light) to fold into the functional Fv domain. This functional Fv domain possesses selective and / or specific enhanced binding activity.

In another embodiment, (d) is followed by a tag sequence or label that can be used for conjugation, diagnostic and / or identification purposes. In this embodiment, the tag is designed to link between a peptide or polypeptide of the invention and a therapeutic or diagnostic agent for the target cell.

The spacer region of the scFv may be straight or branched and is usually composed of a number of glycine and serine residues of formula (Gly4Ser) n, usually in total 0-20 amino acids in length, preferably 0-15 amino acids in length and straight chain to be. By changing the length of the spacer, various multimers can be obtained. In one embodiment of the invention, the spacer is 0-5 amino acids in length. In another embodiment, the spacer is <3 amino acids in length (described below).

Examples of amino acid sequences of the scFv molecules of the present invention are as follows:

Leader sequences are underlined by dashed lines. The V _H region is encoded by the amino acid sequence in bold. This particular clone is derived from germline V _H 3-DP32, but the wiring of each clone depends on its specific origin (described below). The amino acid sequence described in the box encodes the V _H -CDR3 sequence, the hypervariable of all clones derived from this library. The spacer region connecting the V _H and V _L regions is a flexible polypeptide encoded by amino acids indicated in italics. Finally, the V _L region is presented. The fused VL fragments in all clones are derived from a single unmutated V gene of germline IGLV3SI, followed by a c-myc tag underlined by a wave line. The complete amino acid sequence is identical to SEQ ID NO: 25.

The list of VH fragments (obtained from 49 germline) is first produced by PCR from rearranged V-genes of peripheral blood lymphocytes of non-immunized humans (called the "naive list") by the supplier of the library. The origin (wiring) of the V _H -sequence can be identified by homology test (Blast search) using one of the websites described below.

The binding properties of the antibody can be optimized in one of several ways. One way of optimizing an antibody to obtain greater binding affinity compared to the original leader compound is based on replacing amino acid residues in the leader compound to induce higher variability or to extend the sequence. For example, the entire original V _L region can be replaced with a V _L region obtained from subtypes of different antibodies.

Another way to optimize binding affinity is to construct phagemid display mutation libraries. For phagemid display mutation libraries, oligonucleotides are synthesized so that each amino acid of the core sequence in V _H and V _L CDR3 is independently selected by any other amino acid, preferably in a conservative manner known in the art, Can be substituted. The present invention provides a set of specific antibody scFvs displayed on phage, wherein the displayed antibody fragments and soluble antibody fragments that can be extracted from phage virions have the same biological activity.

Phage display libraries used herein were constructed from peripheral blood lymphocytes of non-immunized humans, and Fv peptides were previously selected for uncharacterized and unpurified antigens on the surface of target cells. As described herein, previously uncharacterized and unrefined antigens are selective and / or specific for isolated antibody fragments that have not been identified, characterized, isolated or purified by biochemical or molecular means prior to the current operation. Refers to a ligand presented on the surface of a cell that is observed or predicted in the present work by means of the specific binding.

The scFv of the present invention displays enhanced binding to target cells. Improved binding indicates specific surface markers. Specific surface markers are molecules that are isolated within the cell membrane and are accessible to circulating recognition molecules. The presence of surface markers develops phage display techniques through the biopanning techniques described above. In the present invention, specific surface markers are used to characterize and differentiate various cell types as well as to serve as binding sites for various forms of Fv. Various hematopoietic cell types can be differentiated according to their surface markers, and similarly diseased or cancerous cells display surface markers specific to their type and stage.

The selection of scFv clones can be performed by the following two different biopanning methods.

1. direct selection by using diseased or cancerous cells as target cells, and

2. By using a first cell, such as a normal cell, in a second state, such as an activated, excited, modified, altered or impaired state, whereby the binding site of the first cell in the second state is substantially Cascading selection, which will include exposed or displayed unknown ligand. By immune cross-reactivity, the resulting clones selectively and / or specifically bind to new and unknown ligands on the second cell following the subsequent biopanning or selection step. After further optional amplification and subsequent purification, the targeting molecule can be constructed from the recognition site of the purified recognition molecule that is selective and / or specific for an unknown ligand on the second cell.

In one embodiment of the invention, the first cell may be a normal cell in a first state that is inactivated and in a second state that is activated, excited, modified, altered or impaired. The second cell in the cascaded selection may be a human cell. In another embodiment of the invention, the second cell in the cascade selection may be a diseased cell. In a more preferred embodiment, the second cells in the stepwise selection are cancer cells such as, but not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma. In a more preferred embodiment, the second cell is a leukemia cell. In the most preferred embodiment, the second cell is an AML cell.

A more preferred embodiment of the present invention provides a peptide or polypeptide wherein the selective and / or specific binding of the peptide or polypeptide to the ligand of the second cell is determined primarily by the first hypervariable portion. In a more preferred embodiment, the hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24.

Another embodiment of the invention provides a ligand of a second cell bound by a peptide or polypeptide of the invention. Another embodiment provides any molecule that recognizes and binds a ligand bound by a peptide or polypeptide of the invention.

Improved binding to cancer cells is most likely due to overexpression of ligand and / or exposure of binding sites in cancer cells as compared to expression in normal cells. As used herein, the overexpression of the term ligand is at the basal level under normal and nonmalignant conditions for a particular cell type and / or expression of a gene or product thereof that is usually silent at certain stages of a particular cell type and / or cell cycle. It is defined as the increased expression of the gene expressed by.

In a more preferred embodiment of the invention, the target cells of the biopanning process are included in the cell suspension. Hematopoietic cells are obtained in suspension, and biopanning can be performed by mixing the phage library and blood cell suspension and then washing with some buffer. Phage are extracted from human cells, propagated, and the displayed antibody fragment sequences are determined.

In a more preferred embodiment of the invention, the blood cell suspension comprises leukocyte cells. In the most preferred embodiment, the blood cell suspension comprises AML cells. In another embodiment of the invention, the target cell is derived from an isolated organ or portion thereof.

In another embodiment of the invention, the target cell or the second cell is from one cell line. Cell lines can be cultured and manipulated to assist in determining the binding properties of the Fv clone. Cell lines may also be useful for the development of diagnostic kits.

In a preferred embodiment, the cell line is a hematopoietic cell line, including but not limited to Jurkat, Molt-4, HS-602, U937, TF-I, THP-1, KG-1, ML-2 and HUT -78 cell lines.

In a preferred embodiment of the invention, the CDR3 region is assembled, inserted, coupled or fused into or on any one of the 84 cassettes (SEQ ID NOs: 30-113). In a more preferred embodiment, the CDR3 region comprises 49 cassettes (SEQ ID NOs: 30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112 and 113, assembled, inserted, coupled or fused thereon. In the most preferred embodiment, the CDR3 region is assembled, inserted, coupled or fused to the cassette of SEQ ID NO: 61 or to the C-terminus of any such sequence having at least 90% sequence similarity thereto.

In one embodiment, the amino acid sequences of the cassettes are fixed on the surface, while the sequences replaced, inserted or attached can be highly variable. The cassette may consist of several domains, each of which plays a significant role in the foremost construct. Cassettes of certain embodiments of the invention include framework region 1 (FRI), CDRI, framework region 2 (FR2), CDR2 and framework region 3 (FR3) from the N-terminus.

In one embodiment of the invention, it is possible to replace separate regions in the cassette. For example, the CDR2 and CDR1 hypervariable portions of the cassette can be replaced or modified by non-conservative or preferably conservative amino acid substitutions. More specifically, the CDR2 and CDR1 regions of the cassette of conservative amino acids selected from the group consisting of SEQ ID NOs: 30-113 or fragments thereof may be replaced by SEQ ID NOs: 115 and 114, respectively. More specifically, SEQ ID NOs: 30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, The CDR2 and CDR1 regions of the cassette of conservative amino acids or fragments thereof selected from the group consisting of 94, 97, 99, 103, 106, 112 and 113 may be replaced by SEQ ID NOs: 115 and 114, respectively.

In a preferred embodiment of the invention, the peptide or polypeptide comprises a heavy chain and a light chain, each chain comprising first, second and third hypervariable regions that are CDR3, CDR2 and CDR1 regions, respectively. Binding selectivity and specificity is determined by the CDR3 region of the chain, possibly by the CDR3 region of the light chain, preferably by the CDR3 region of the heavy chain, and secondly by the CDR2 and CDR1 regions of the light chain, preferably the heavy chain. do. Binding selectivity and specificity may also be affected by upstream or downstream secondaryly flanked by the first, second and / or third hypervariables.

In a preferred embodiment, the CDR3 region of the peptide or polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24.

In a more preferred embodiment, the CDR3 region of the heavy chain has an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24, CDR2 has the same amino acid sequence as SEQ ID NO: 115, and the CDR1 region has the same amino acid sequence as SEQ ID NO: 114 Has

In a most preferred embodiment of the invention, the CDR3 region has the same amino acid sequence as SEQ ID NO: 8.

In addition to the heavy and light chains, Fv comprises a flexible spacer of 0-20 amino acid residues. The spacer may be branched or straight chain. Two possible sequences of spacers are identical to SEQ ID NOs: 123 and 124.

A preferred embodiment of the invention is an scFv having a CDR3 sequence identical to SEQ ID NO: 8 and a complete scFv sequence identical to SEQ ID NO: 25.

Another preferred embodiment of the invention is an scFv having a CDR3 sequence identical to SEQ ID NO: 20 and a complete scFv sequence identical to SEQ ID NO: 203.

In the most preferred embodiment of the invention, the CDR3, CDR2 and CDR1 regions have amino acid sequence numbers 8, 115 and 114, respectively.

In an embodiment of the present invention, the Fv peptides include, but are not limited to, CDR1 and CDR2 of a variable heavy chain comprising a cassette having an amino acid sequence selected from the group consisting of SEQ ID NOs: 30-113; A CDR3 region of a variable heavy chain, preferably having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24; An upstream region flanking CDR3 having the amino acid sequence of SEQ ID NO: 117; A downstream region flanking the CDR3 region having the amino acid sequence of SEQ ID NO: 116; A spacer of 0-20 amino acid residues of SEQ ID NO: 123 or 124; The variable light chain region of SEQ ID NO: 7.

Similarly, in another embodiment, the upstream region flanking the CDR2 region has an amino acid sequence of SEQ ID NO: 119, and the downstream region flanking the CDR2 region has an amino acid sequence of SEQ ID NO: 118, and flanks the CDR1 region. The upstream region has the amino acid sequence of SEQ ID NO: 121, and the downstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 120.

In a preferred embodiment of the present invention, the second and third hypervariable parts are CDR2 and CDR1 hypervariable parts, respectively, the CDR3 amino acid sequence is SEQ ID NO: 8, the CDR2 amino acid sequence is SEQ ID NO: 115, and the CDR1 amino acid sequence is SEQ ID NO: 114 The upstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 117, the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 116, and the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 119. Wherein the downstream region flanked by the CDR2 region has the amino acid sequence of SEQ ID NO: 118, the upstream region flanked by the CDR1 region has the amino acid sequence of SEQ ID NO: 121, and the downstream region flanked by the CDR1 region has the amino acid sequence of SEQ ID NO: 120 Has

Another preferred embodiment of the invention provides an Fv molecule comprising a first chain having first, second and third hypervariables and a second chain having first, second and third hypervariables, One of the hypervariable parts of the first chain has a sequence selected from the group consisting of SEQ ID NOs: 8-24, and one of the hypervariable parts of the second chain is from the group consisting of SEQ ID NOs: 1-6 and 125-202 Having a sequence selected, wherein the first, second and third hypervariable regions are CDR3, CDR2 and CDR1 regions, respectively, and the Fv is scFv or dsFv and optionally has one or more tags.

Another embodiment of the invention comprises (i) a hypervariable portion wherein the first and second chains are each selected from the group consisting of SEQ ID NOs: 8-24, or (ii) the first and second chains of The first hypervariable part is selected from the group consisting of SEQ ID NOs: 8-24, or (iii) the first hypervariable part is selected from the group consisting of SEQ ID NOs: 8-24, and the first chain of the second chain The hypervariable part is selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, or (iv) the first hypervariable part of the first chain is selected from the group consisting of SEQ ID NOs: 1-6 and 125 and 202, and the second The first hypervariable part of the chain provides a peptide or polypeptide selected from the group consisting of SEQ ID NOs: 8-24.

Another embodiment provides the peptide or polypeptide of the invention wherein the second and third hypervariable portions of the first chain are SEQ ID NOs: 114 and 115, respectively.

With respect to all amino acid sequences (e.g. CDR regions, CDR flanking regions) of ≤ 25 amino acid residues described herein, it is understood and considered as another embodiment of the invention that these amino acid sequences are one or more amino acids in their range. Including substitution (s), preferably said substitutions are conservative amino acid substitutions. With respect to all amino acid sequences of> 25 amino acid residues described herein, it is to be understood and contemplated as embodiments of the invention that these amino acid sequences include amino acid sequences having a sequence similarity of ≧ 90 to the original sequence within their range. Altschul et al., Nucleic Acids Res., 25, 3389-3402 (1997). Similar or homologous amino acids are defined as non-identical amino acids that display similar properties such as acidic, basic, aromatic, size, positive or negative charge, polarity, and nonpolarity.

Amino acid similarity or homology or proportion of sequence similarity is determined by comparing the amino acid sequences of two different peptides or polypeptides. One typically aligns two sequences using one of a variety of computer programs designed for purposes and compares amino acid residues at each position. Subsequently, amino acid identity or homology is determined. The operation is then applied to determine the proportion of amino acid similarity. It is usually desirable to compare amino acid sequences to detect subtle relationships between peptide, polypeptide or protein molecules due to the greatly increased sensitivity. Protein comparison can calculate the presence of conservative amino acid substitutions, whereby a mismatch can still yield a positive score if non-identical amino acids have similar physical and / or chemical properties [Altschul et al. , Nucleic Acids Res., 25,3389-3402 (1997).

In an embodiment of the invention, the three hypervariable portions of each of the light and heavy chains may be interchanged between two of the chains and / or between the chains and between the three hypervariable positions.

Those skilled in the art will understand that evidence of specific and / or selective binding of the peptides or polypeptides of the present invention requires the use of appropriate negative controls. Suitable negative controls may be peptides or polypeptides whose amino acid sequences are nearly identical to the peptides or polypeptides of the invention and which differ only in the hypervariable CDR3 regions. Another suitable negative control may be a peptide or polypeptide having the same size and / or general three-dimensional structure as the peptide or polypeptide of the present invention, but having a completely unrelated amino acid sequence. Another suitable negative control may be a peptide or polypeptide having completely different physical and chemical properties as compared to the peptide or polypeptide of the invention. Negative controls used in the development of the present invention are designed N14 having the same CDR3 sequence as SEQ ID NO: 28 and C181 having the same CDR3 sequence as SEQ ID NO: 29. However, other negative controls may likewise be appropriate.

Another embodiment provides nucleic acid molecules, preferably DNA molecules, that encode the Fv peptides or polypeptides of the invention.

In a preferred embodiment of the invention, in order to optimize the selective binding of the Fv, the CDR3 sequence conferring the first binding selectivity and / or specificity for the Fv can be shifted to any other heavy chain germline. More specifically, they can be moved to one of 84 possible heavy chain wires. These 84 wirings (SEQ ID NOS: 30-113) are shown as (a) the wiring from which the claimed phage clone was isolated, (b) the 48 additional wirings available in the phage display library, and (c) the alternative wiring as claimed herein. Including Tomlinson et al, J. Mol. Biol., 227 (3): 776-798 (1992). In addition to the CDR3 region itself, the local straight or three-dimensional environment of the CDR3 region potentially plays a role in guiding or promoting proper CDR3 binding. For example, any of the 49 germline sequences (SEQ ID NOs: 30-32, 35, 37-39, 41, 43, 45, 46, 48) having any CDR3 sequences, referred to herein as SEQ ID NOs: 8-24, 125 , Peptides derived from (51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112 and 113) are also included in the present invention. .

Wiring DP-32 is a cassette for some clones of the present invention. The C-terminus of this germline has been replaced with sequences that help to prepare phage display libraries. The seven carboxy terminal amino acids of SEQ ID NO: 61 have been replaced by the seven amino acid sequences of SEQ ID NO: 122.

The CDR3 region of the Fv of the present invention may contain the core sequence ARG / Gly / LysPhe Pro that specifically binds to AML cells. Eight examples of such CDR3 regions are listed in Table 2. Although the portif coincides with the three N-terminal amino acid residues of the CDR3 region in each case, it may also be located elsewhere in the CDR3 region. Alternatively, the portif is a binding motif used to assemble or construct a binding region or anchor of a portion of a larger binding or targeting or recognition molecule or used alone as a target vehicle.

Another embodiment of the invention provides a binding motif comprising the amino acid sequence of R ₁ -X Phe Pro-R ₂ , wherein R ₁ and R ₂ are each 0-15, preferably 1-9 amino acids. And the residue is any one of Arg, Gly or Lys. Most preferably, CDR3 comprises the amino acid sequence of R ₁ -X Phe Pro-R ₂ , wherein R ₁ and R ₂ each comprise 0-15 amino acid residues and X is in Arg, Gly or Lys Which one.

In another preferred embodiment of the peptide or polypeptide of the invention, 1-1000 amino acids can be added at either the C-terminus or the N-terminus of the peptide, wherein the peptide maintains biological activity. In a preferred embodiment of the invention, 150-500 amino acids can be added to either the C-terminus or the N-terminus of the peptide or polypeptide, wherein the peptide maintains biological activity. In another preferred embodiment of the invention, 800-1000 amino acids can be added at either the C-terminus or the N-terminus of the peptide or polypeptide, wherein the peptide or polypeptide maintains biological activity.

An example of expanding the core amino acid sequence is by assembling a full size immunoglobulin Ig using the leading compound as the core of the Ig. Full sized Ig may belong to the class of immunoglobulins that can induce endogenous cytolytic activity, such as through activation of complement or cell lytic activity (eg, IgG1, IgG2 or IgG3). Full sized Ig may belong to the immunoglobulin class of strongly binding antibodies (eg, IgG4). Upon binding, the full size Ig can act in one or more of a number of ways, such as by flagging the body's defense mechanisms, by transforming extracellular cell signaling, or by causing damage to target cells.

One preferred embodiment of the invention provides an Ig molecule expressed as a recombinant polypeptide and produced in a eukaryotic cell system. In a preferred embodiment of the invention, the Ig polypeptide is an IgG polypeptide, which is produced in a mammalian cell system. In a more preferred embodiment, the mammalian cell system comprises a CMV promoter.

In a preferred embodiment of the invention, the IgG molecules in both the light and heavy chains comprise CDR3, CDR2 and CDR1 hypervariables. In a more preferred embodiment of the invention, the Fv molecule comprises CDR3, CDR2 and CDR1 regions having SEQ ID NOs: 8, 115 and 114, respectively. The CDR3, CDR2 and CDR1 regions may be heavy or light chains.

Another preferred embodiment of the invention provides light chains having the same sequence as SEQ ID NO: 27 and heavy chains having the same sequence as SEQ ID NO: 26 or IgGs having heavy and light chains having at least 90% sequence similarity thereto. In the most preferred embodiment of the invention, the two heavy chains of IgG are identical and the two light chains of IgG are identical.

In another embodiment, the peptides of the invention are constructed to fold in multivalent Fv form.

The present invention provides Y1 or Y17 peptides or polypeptides comprising scFv molecules. As used herein, scFv is defined as a molecule consisting of the variable region of the heavy chain of the same or different human antibodies and the variable region of the light chain of the human antibody, wherein the variable region of the heavy chain is linked, linked to the variable region of the light chain. , Fused or covalently attached or associated.

Y1 and Y17 scFV constructs may be multiplexes (eg, dimers, trimers, tetramers, etc.) of scFv molecules comprising one or more hypervariable domains of Y1 or Y17 antibodies. All scFv-derived constructs and fragments possess enhanced binding properties to selectively and / or specifically bind to target cells for other cells. The binding selectivity and / or specificity is mainly determined by the hypervariable portion.

Hypervariable loops within the variable domains of the light and heavy chains are called complementary determining regions (CDRs). The heavy and light chains each have CDR1, CDR2 and CDR3 regions. The most variable of these regions is the CDR3 region of the heavy chain. This CDR3 region is understood to be the most exposed region of the Ig molecule and is the position that most contributes to the selective and / or specific binding properties observed as presented herein.

Y1 and Y17 peptides of the invention can be constructed to fold into multivalent Fv forms. Y1 and Y17 multimeric forms have been constructed to enhance binding affinity and specificity and increase lifespan in the blood.

Multivalent forms of scFv have been produced by other methods. One approach was to link two scFvs by linker. Another approach involves using disulfide bonds between two scFvs for linking. The simplest approach for the generation of Fv of dimers or trimers is described in Holliger et al., PNAS, 90, 6444-6448 (1993) and in A. Kortt, et al., Protein Eng, 10, 423-433 (1997). One such method was designed to make dimers of scFv by adding sequencing of the FOS and JUN protein regions to form a leucine zipper between them at the c-terminus of the scFv. Kostelny SA et al., Immunol. 1992 Mar 1; 148 (5): 1547-53; De Kruif J et al., J Biol Chem. 1996 Mar 29; 271 (13): 7630-4. Another method was designed to make tetramers by adding the streptavidin coding sequence at the c-terminus of the scFv. Streptavidin consists of four subunits, so when the scFv-streptavidin is folded, the four subunits accept themselves to form tetramers. See Kiriyanov SM et al., Hum Antibodies Hybridomas, 1995; 6 (3): 93-101]. In another method, free cysteine is introduced into a given protein to make dimers, trimers, and tetramers. Cross linkers based on peptides with variables of the maleimide group (2-4) were used to cross link certain proteins to free cysteine. Cochran JR et al., Immunity, 2000 Mar; 12 (3): 241-50].

In this system, phage libraries (described above) were designed to display scFv that can be folded into the monovalent form of the Fv region of an antibody. In addition, as described above, the construct is suitable for the expression of bacteria. Genetically engineered scFvs comprise heavy and light chain variable regions linked by 15 amino acid flexible peptide spacers that are sequentially encoded. Preferred spacer is (Gly ₄ Ser) ₃ . Depending on the amino acid configuration, the length of the spacer provides a spacer that is not large so that the VH and VL regions are folded into a functional Fv domain that provides effective binding to the target.

The present invention refers to Y1 and Y17 multimers produced by any method known in the art. A preferred method of forming multimers, especially dimers, uses cysteine residues to form disulfide bonds between two monomers. In this embodiment, the dimer is formed by adding cysteine (called Y1-cys scFv or Y1 dimer) to the carboxyl terminus of the scFv to promote dimer formation. After the DNA constructs are prepared (see Examples 2D and 6D) and used for transfection, the Y1 dimer is allowed to be expressed in vivo into the production vector and folded again. Proteins were analyzed by SDS-PAGE, HPLC and FACS. A two liter fermentation batch of antibodies was operated. Y1-cys was expressed in E. coli strain BL21 and then refolded in arginine. After refolding, the proteins were dimerized and purified by Q-Sepharose and gel filtration (Sefadex 75). Two peaks were detected by SDS-PAGE (non-reduced) and gel filtration. The peaks were collected separately and analyzed by FACS. Binding of monomers and dimers to Jurkat cells was confirmed by FACS. Binding by dimers required only 1/100 amount of monomeric antibody for the same level of pigmentation, and dimers were found to have greater avidity. Conditions for dimer refolding were determined and a material comprising> 90% monomer (mg amount) was produced after the subsequent dialysis, chromatography and gel filtration steps. Purified dimers were characterized by gel filtration and SDS-PAGE analysis under oxidizing conditions. The binding capacity of dimers was confirmed by radio receptor assay, ELISA and FACS analysis.

The CONY1 scF antibody fragment is derived from Y1 scFV. The myc tag of the Y1 scFv was removed by a synthetic oligonucleotide DNA sequence encoding the amino acid lysine, alanine, lysine (KAK), clearing the DNA sequence.

To compare the binding of scFv monomers (also called CONY1) with YI dimers, binding competition experiments were performed in vivo on KG-1 cells. In addition, these experiments also compared the binding of complete YI IgG to scFv Y1 monomers. To carry out this study, Y1 IgG was labeled with biotin. This study shows that Y1 IgG competes with IgG Y1-biotin. Unrelated human IgG did not compete with labeled Y1 IGg. Y1 scFv (5 μg and 10 μg) partially competed with Y1 IgG-biotin (50 ng). The study also showed that most Y1 IgG binding was "blocked" in 1 ng of IgGY1-FITC bound to KG-1 cells (serum-free) to the same level as 1 μg of scFv-FITC with serum present. These studies also showed that the binding of the Y1 dimer was at least 20 times more than that of the scFV monomer when analyzed by radio receptor assay, ELISA or FACS.

In another embodiment, lysine-alanine-lysine was added to the cysteine at the carboxyl terminus (called YI-cys-kak scFv). The amino acid sequence of this scFv construct is reproduced as follows.

Y1-cyc-kak was generated in λ-pL vectors in bacteria. Expression in the λ-pL vector was induced by increasing the temperature to 42 ° C. Inclusion bodies were obtained from induced cultures and semi-purified by aqueous solution to remove unwanted soluble proteins. Inclusion bodies were dissolved in guanidine, reduced by DTT, and refolded in vitro into a solution based on arginine / ox-glutathione. After refolding, the protein was dialyzed and concentrated to a buffer containing urea / phosphate buffer by tangential flow filtration. Proteins were redefined and concentrated by ion-chromatography in SP-columns.

In order to achieve higher levels of expression in E. coli of CONY1 scFv as well as in Y1-cys-KaK scFv, we introduced amino acids encoding alanine residues at position 2 of the N-terminal sequence of the scFv construct. . Four-fold levels of expression were obtained with the newly modified constructs.

ELISA analysis was performed to identify the difference in binding between monomer (also known as CONY1 scFv-Y1-kak) and dimer YI-cys-kak (cysteine dimer) for platelet-derived antagonist GPIb (glycocalcin). Was performed. Binding to GPIb was detected using polyclonal anti single chain antibodies and / or novel polyclonal anti-VL (from rabbit) and anti-rabbit HRP. Dimers were about 20-100 times more active than monomers. For example, 12.8 mg / ml of monomer was used to reach 0.5 OD units, which was compared to only 0.1 mg / ml dimer. See FIG. 12.

The dimers were characterized by SDS-page electrophoresis, gel filtration chromatography, ELISA, radioactive receptor binding and FACS. The apparent affinity of the dimer was higher than that of the monomer due to the avidity effect. This effect was confirmed by ELISA for glycocalysin, FACS for KG-1 cells, and competition in radioreceptor assays.

HPLC was performed to analyze dimers after refolding and purification from the Superdex 75 gel filtration column. In FIG. 10, Y 1 -cys-kak (dimer) is the first peak on the left side (˜10.8 minutes), and the subsequent peak is the monomer (˜12 minutes). The dimer is about 52 kDa and the monomer is 26 kDa, which move in the same column according to the protein size marker. The balance between dimers and monomers can be altered by varying the state of refolding (concentration of oxidant and concentration of protein in refold buffer). Dimers and monomers were separated by chromatography on a Superdex 75 column.

In FIG. 11, the gel appears as a mixed population of dimers and monomers. In the reduced form, the monomers appear to be in non-reduced form due to the reduction between the two monomers, and the two clusters appear to be monomeric parts of about 30 kDa and dimers of about 60 kDa (in gel filtration experiments).

In addition, FACS binding assays for KG-1 cells showed that dimers are more sensitive than monomers when performing two or three stage binding assays. Dimers directly labeled by FITC showed some advantages over monomers (10 times less material used). Radioreceptor analysis in KG-1 cells when dimers were used as competitors showed that dimers were 30 times more efficient than monomers.

Varying the length of the spacer is another preferred method of forming dimers, trimers and tetramers (often referred to as dimers, trimers and tetramers, respectively). Dimers are formed under conditions where the spacers connecting the two variable chains of the scFv are generally shortened. This shortened spacer prevents two variable chains from the same molecule from folding into the functional Fv domain. Instead, the domain is forced to mate with the complementary domain of another molecule to form two binding domains. In a preferred method, spacers of only 5 amino acids (Gly ₄ Ser) were used for dimer construction. This dimer may be formed from two identical scFvs or from two different populations of scFvs, retain the selective and / or specific enhanced binding activity of the parent scFv (s), and / or increased binding strength or Shows affinity.

In a similar manner, the trimers are formed under the condition that the spacers connecting the two variable chains of the scFv are usually shortened to less than 5 amino acid residues, and that the two variable chains from the same molecule are folded into the functional Fv domain. prevent. Instead, three separate scFv molecules associate to form a trimer. In a preferred method, trimers were obtained by completely removing the flexible spacer. The trimer may be formed from three identical scFvs, or from two or three different populations of scFvs, and retain and / or increase the selective and / or specific enhanced binding activity of the parent scFv (s). Bond strength or affinity.

Tetramers are similarly formed under conditions in which the space connecting the two variable chains of the scFv is usually shortened to less than 5 amino acid residues, preventing the two variable chains obtained from the same molecule from folding into the functional Fv domain. . Instead, four separate scFv molecules associate to form a tetramer. This tetramer is formed from four identical scFvs, or from 1-4 individual units obtained from different populations of scFvs, retains selective and / or specific enhanced binding activity of the parent scF (s), and / or Increased bond strength or affinity.

Whether the trimer or tetramer is formed under conditions where the spacer is usually up to five amino acid residues in length depends on the amino acid sequence of the particular scFv (s) in the mixture and reaction conditions.

In a preferred method, tetramers are formed via biotin / streptavidin association. A new fermentation construct has been formed that can be enzymatically labeled with biotin (herein referred to as Y1-biotag or Y1-B). The sequence, the substrate for the BirA enzyme, was added at the Y1 C-terminus. BirA enzyme adds biotin to lysine residues in the sequence. Y1-biotag was cloned and expressed in E. coli. Inclusion body stock was separated and refolded. The purity of the folded protein was> 95% and> 100 mg was obtained from 1-L culture (small scale, unoptimized conditions). The molecular weight of this form was found to be similar to that of scFv according to HPLC, SDS-PAGE and mass spectrometry. The Y1-biotag was found to be the most consistent reagent for FACS analysis. However, when binding of Y1-biotag to KG-1 cells is observed in the presence of serum, high concentrations (10 times higher) are required for comparable binding in the absence of serum. Nevertheless, the construct provided the advantage of specific biotinylation in which the binding site of the molecule was maintained intact. In addition, each molecule is labeled with only one biotin so that each molecule receives one biotin at the carboxyl terminus.

Restrictive labeling of one biotin / molecule at a predetermined position enabled the production of tetramers by streptavidin. The tetramer was formed by incubating Y1-B with streptavidin-PE.

FACS analysis showed that tetramers prepared by Y1-biotag and streptavidin-PE were 100-1000 times more sensitive than Y1 scFv monomers in the absence of serum. Y1-biotag tetramers with streptavidin-PE appear to specifically bind to one of the Y1-reactive cell lines (KG-1). The difference between the background binding and this response was very high and provided high sensitivity for detecting small amounts of receptors. FACS evaluation of normal whole blood with Y1-SAV tetramers indicated that there was a less reactive population. Monocytes and granulocytes were positive to a small extent. For cell lines with positive results, such as KG-1 cells, tetramers were at least 100 times more reactive.

The tetramer was then incubated with the cell sample. Small amounts of Y1 tetramer (5 ng) bind well to the cell line (KG-1), providing a 10-20 fold higher response than previously observed in other Y1 antibody forms. A small amount of response was observed when negative cell lines were observed with varying amounts of tetramers.

Embodiments of the invention are performed in a first target cell in a second state other than the first state, which (a) substantially exposes or displays a binding site comprising an unknown ligand to generate a first population of recognition molecules. One or more biopanning steps; (b) binding starting with the resulting stock of the recognition molecule of step (a) and comprising an unknown ligand having an immune cross-reactivity with the unknown ligand of the first cell to generate a second population of recognition molecules Subsequent biopanning and / or selection steps performed on a second cell displaying the location; (c) amplification and purification of the second population of recognition molecules of step (b); And (d) comprising a targeting molecule that is selective and / or specific for an unknown ligand on the second cell; (c) constructing the peptide or polypeptide from the recognition site of the purified recognition molecule. And a targeting molecule that binds to an unknown immune cross-reactive binding site on the second cell.

Preferred embodiments provide a first cell that is a normal cell, a first state that is inactive and a second state that is activated, excited, modified, altered, or impaired. In a more preferred embodiment, the second cell is a diseased cell. In a more preferred embodiment, the diseased cell is a cancer cell. The cancer cells may be carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, normal carcinomas and melanoma, but is not limited thereto. In a more preferred embodiment, the cancer cells are leukemia cells. In the most preferred embodiment, the leukemia cells are AML cells.

Embodiments of the present invention provide for the use of a peptide or polypeptide optionally associated, coupled, combined, linked or fused to a pharmaceutical formulation in the manufacture of a medicament. In a preferred embodiment, the medicament is active against diseased cells. In a more preferred embodiment, the activity is against cancer cells. The cancer cells may be carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, normal carcinomas and melanoma, but is not limited thereto. In a more preferred embodiment, the cancer cells are leukemia cells. In the most preferred embodiment, the leukemia cells are AML cells.

Embodiments of the present invention provide pharmaceutical compositions comprising mixtures of different monomer scFvs and / or mixtures of dimers or trimers or tetramers constructed from different scFvs.

Another embodiment provides the use of a peptide or polypeptide of the invention associated with, attached to, bound to, bound to, bound to, or fused to a pharmaceutical formulation in the manufacture of a medicament. The medicament may have activity against diseased cells, more specifically cancer cells. The cancer cells may be carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, normal carcinomas and melanoma, but is not limited thereto. In a more preferred embodiment, the medicament is active against leukemia cells. In the most preferred embodiment, the medicament is active against AML cells. The activity of the medicament against these cells can cause a delay in cancer growth, complete prevention of any growth, or death of the cancer cells.

In the embodiment of the present invention, the activity of the pharmaceutical or pharmaceutical composition is to inhibit cell growth.

The peptides or polypeptides of the invention can be used to prepare compositions for use in inhibiting the growth of cancer cells, preferably leukemia cells, most preferably AML cells, and preferably pharmaceutical compositions. In the embodiment of the present invention, the peptide or polypeptide can be used to prepare a composition for inhibiting growth of cancer cells, the composition comprising one or more compounds having a pharmaceutical ligand that is selective and / or specific for cancer cells.

Peptides or polypeptides of the invention can be administered alone or in association with a pharmaceutically effective amount of a pharmaceutical preparation, a pharmaceutically effective carrier and optionally an adjuvant, or comprising a conjugate, link or fused pharmaceutical or pharmaceutical composition. Can be. The pharmaceutical composition may comprise proteins, diluents, preservatives and antioxidants [Osol et al. (eds.), Remington's Pharmaceutical Sciences (16th ed), Mack Publishing Company, (1980).

In another embodiment, the pharmaceutical agent is an antibody or fragment thereof linked to a peptide or polypeptide of the invention by peptide bonds.

In a preferred embodiment, the toxin is, for example, gelonine, Pseudomonas exotoxin (PE), PE40, PE38, diphtheria toxin, lysine and variants or derivatives thereof.

In a preferred embodiment, radioisotopes used include gamma-radiators, positron-radiators and x-ray emitters that can be used for localization and / or treatment, and beta- and alpha-radiators that can be used for treatment. .

In a particular embodiment of the invention, the therapeutic radioisotope is ¹¹¹ indium, ¹¹³ indium, ^99m rhenium, ¹⁰⁵ rhenium, ¹⁰¹ rhenium, ^99m technetium, ^121m tellurium, ^122m tellurium, ^125m tellurium, ¹⁶⁵ thulium, ¹⁶⁷ thulium, ¹⁶⁸ Thulium, ¹²³ iodine, ¹²⁶ iodine, ¹³¹ iodine, ¹³³ iodine, ^{81 m} krypton, ³³ xenon, ⁹⁰ yttrium, ²¹³ bismuth, ⁷⁷ bromine, ¹⁸ fluorine, ⁹⁵ ruthenium, ⁹⁷ ruthenium, ¹⁰³ ruthenium, ¹⁰⁵ ruthenium, ¹⁰⁷ mercury, ²⁰³ mercury, ⁶⁷ gallium, ⁶⁸ gallium, and the like.

In another specific embodiment of the present invention, the anticancer agent is doxorubicin, adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine. (Ara-C), cyclophosphazdde, prednisone, daunorubicin, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alfa, Hydroxyurea, temozolomide, thalidomide, bleomycin and derivatives thereof.

Embodiments of the present invention provide a method for inhibiting cancer cell growth, comprising contacting a cancer cell with a substantial amount of the peptide or polypeptide of the invention. In a preferred embodiment, the cancer cells may be, but are not limited to, carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma. In a more preferred embodiment, the cancer cells are leukemia cells. In the most preferred embodiment, the leukemia cells are AML cells. Embodiments of the invention allow for in vivo and ex vivo treatment of a patient. More particular embodiments of the present invention allow ex vivo purging of autologous bone marrow to remove abnormal hepatocytes.

In a more particular embodiment of the invention, the blood of a leukemia patient can be circulated in vitro through a system comprising a peptide or polypeptide of the invention conjugated to an anticancer agent. After removal of bound cells and unbound anticancer agents, blood cells may be reintroduced into the body of the patient. Alternatively, the blood of a leukemia patient can be circulated extracellularly through a system comprising a peptide or polypeptide of the invention attached to a solid phase. Cells that have passed through the system and do not bind to the peptides or polypeptides of the invention attached to the solid phase can be reintroduced into the body of the patient.

In another preferred embodiment of the invention, peptides or polypeptides can be used to remove abnormal hepatocytes prior to transplantation to the ex vivo autologous bone marrow in suspension. Abnormal purging of hepatocytes may be accomplished by the solid support (non-limiting examples of magnetic beads and proteins to which a peptide or polypeptide of the invention (ie, targeting molecule), a construct, fragment, fragment of a construct, or a construct of a fragment is bound). By moving the suspension onto a chemical culture). Thus, ex vivo purged bone marrow can then be used for autologous bone marrow transplantation. This preferred embodiment is based on the identification in the present invention of phagemid clone (Y1) which binds to hepatocytes released from bone marrow of leukemia patients but does not bind to hepatocytes released from healthy donor bone marrow. Similarly, Y1 phagemid clone binds to leukemia cells as well as blast cells determined to be abnormal by FACS analysis.

Subblasts are defined herein as major cells that are precursors to all cells circulating in mammalian organisms. Because of their progenitor properties, blasts were not found to circulate in significant amounts in adult organisms. The presence of circulating blasts without exogenous stimulation may be an indication of malignant tumors of the hematopoietic system, for example, and their subsequent disappearance may indicate the alleviation of the malignant tumor disease.

In another embodiment of the invention, the pharmaceutical composition is used for prophylaxis.

In a preferred embodiment, two or more peptides or polypeptides of the invention are combined to form a mixture.

In this specification, a mixture is defined as two or more molecules or particles of different species contained in a single formulation. Different species of molecules neither form covalent chemical bonds nor noncovalent chemical bonds.

In one embodiment of the invention, the peptide or polypeptide of the invention is linked, fused or conjugated to a pharmaceutical formulation.

In another embodiment of the invention, the link between the peptide and the pharmaceutical agent is a direct link. In the present specification, a direct link between two or more neighboring molecules is obtained through chemical bonds between elements or groups of elements in the molecule. The chemical bond may be, for example, an ionic bond, a covalent bond, a hydrophobic bond, a hydrophilic bond, an electrostatic bond or a hydrogen bond. The linkage may be selected from the group consisting of amines, carboxy, amides, hydroxyls, peptides and disulfides, but is not limited thereto. The direct link is preferably a protease resistant bond.

In another embodiment, the link between the peptide and the pharmaceutical agent is affected by the linker compound. Linker compounds used in the description and claims of the invention are defined as compounds that link two or more sites together. The linker may be straight or branched chain. The branched linker compound may consist of a compound branched into a double branch, triple branch or quadruple branch or more. The linker compound may be, but is not limited to, dicarboxylic acid, maleimido hydrazide, PDPH, carboxylic acid hydrazide and small peptides. Examples of other linker compounds include dicarboxylic acids such as succinic acid, glutaric acid and adipic acid; Maleimido such as N- [ε-maleimidocaproic acid] hydrazide, 4- [N-maleimidomethyl] cyclohexane-1-carboxyhydrazide and N- [κ-maleimidodecanoic acid] hydrazide] ; PDPH, such as (3- [2-pyridyldithio] propionyl hydrazide) conjugated to a sulfhydryl reactive protein; Carboxylic acid hydrazides selected from 2-5 carbon atoms; And direct coupling using a small peptide linker, for example, between the free sugar of the anticancer drug doxorubicin and the scFv. Non-limiting examples of small peptides include AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S.Tag®, T7, V5 , VSV-G and KAK-Tag.

Any known method of administration of a peptide or polypeptide of the invention may be intravenous, intramuscular, subcutaneous, topical, intratracheal, intramedullary, intraperitoneal, lymphatic, nasal, sublingual, oral, rectal, vaginal, respiratory, buccal , Intradermal, transdermal or pleural, etc.

For intravenous administration, the formulation is preferably prepared such that the amount administered to the patient is an effective amount of about 0.1 mg to about 1000 mg of the given composition. More preferably, the amount administered is in the range of about 1 mg to about 500 mg of the given composition. The compositions of the present invention are effective in a wide range of amounts and include the diseases to be treated, the lifetime of the peptide or polypeptide-based pharmaceutical compositions in the body of Hornaza, the physical and chemical properties of the pharmaceutical preparations and pharmaceutical compositions, the dosage form of the pharmaceutical compositions, the treatment or diagnosis It depends not only on the singularity of the patient, but also on other variables considered important by the treating physician.

Pharmaceutical compositions for oral administration may be in the form of tablets, liquids, emulsion suspensions, syrups, pills, caplets, capsules. The pharmaceutical composition may be administered by a device.

Pharmaceutical compositions for topical administration may be in the form of creams, ointments, lotions, patches, solutions, suspensions or gels.

In addition, the pharmaceutical compositions may be prepared in solid, liquid or sustained release formulations.

Compositions comprising antibody fragments produced according to the present invention may comprise conventional pharmaceutically acceptable diluents or carriers. Tablets, pills, caplets and capsules can include conventional excipients such as lactose, starch and magnesium stearate. Suppositories may include excipients such as waxes and glycerol. Injectable solutions include sterile pyrogen-free media such as saline and may contain buffers, stabilizers or preservatives. Conventional enteric skin may also be used.

The invention also includes a method for generating antibody fragments by synthetic means known in the art.

Embodiments of the invention include pharmaceutical compositions comprising one or more peptides or polypeptides of the invention attached, coupled, combined, linked, or fused to an imaging agent for use in diagnostic localization and / or imaging of a tumor.

Another embodiment of the invention provides a diagnostic kit for in vitro analysis of treatment efficacy before, during or after treatment comprising an imaging agent comprising a peptide of the invention linked to an indicator marker molecule. The invention also provides a method of using an imaging agent for diagnostic localization and / or imaging of cancer, more specifically tumors, which method comprises the steps of: a) contacting a cell with said composition, b) bound to said cell. Measuring radioactivity, and c) visualizing the tumor.

In a preferred embodiment of the invention, the imaging agent of the kit is a fluorescent dye, said kit providing an analysis of the therapeutic efficacy of cancer, more specifically blood related cancers such as leukemia, lymphoma and myeloma. FACS analysis is used to determine the proportion of cells stained by the imaging agent and the intensity of pigmentation at each stage of the disease, such as at diagnosis, during treatment, during remission, and during relapse.

The invention also provides compositions comprising an effective amount of an imaging agent, a peptide of the invention and a physiologically acceptable carrier.

In a preferred embodiment, the indicator marker molecule is any known marker known in the art, including but not limited to radioisotopes, X-ray opaque elements, paramagnetic ions or fluorescent molecules and the like.

In a particular embodiment of the invention, the directed radioisotope is ¹¹¹ indium, ¹¹³ indium, ^{99 m} rhenium, ¹⁰⁵ rhenium, ¹⁰¹ rhenium, ^{99 m} technetium, ^{121 m} tellurium, ^{122 m} tellurium, ^{125 m} tellurium, ¹⁶⁵ thulium, ¹⁶⁷ thulium, ¹⁶⁸ thulium , ¹²³ iodine, ¹²⁶ iodine, ¹³¹ iodine, ¹³³ iodine, ^81m krypton, ³³ xenon, ⁹⁰ yttrium, ²¹³ bismuth, ⁷⁷ bromine, ¹⁸ fluorine, ⁹⁵ ruthenium, ⁹⁷ ruthenium, ¹⁰³ ruthenium, ¹⁰⁵ ruthenium, ¹⁰⁷ mercury, ²⁰³ mercury, ⁶⁷ Gallium and ⁶⁸ gallium, but are not limited thereto.

According to another preferred embodiment, the indicator marker molecule is a fluorescent marker molecule. According to a more preferred embodiment, the fluorescent marker molecule is fluorescein, phycoerythrin or rhodamine or variants or conjugates thereof.

The present invention also provides a composition comprising an effective amount of the imaging agent of the present invention, a pharmaceutical agent linked thereto and a physiologically acceptable carrier.

The invention also provides a method of contacting an organizing agent or cell to be imaged with an imaging agent of the present invention under conditions such that the imaging agent binds to organs and cells and images the bound imaging agent, thereby imaging the organs and cells. It provides a method of imaging an organ or cell comprising the.

The present invention also provides a method of treating an organ in vivo, comprising contacting an organ of the composition of the present invention with the organ that is to be treated under the conditions of treating the organ.

In a preferred embodiment of the invention, peptides or polypeptides can be used to target malignant tumor cells, more specifically leukemia cells of whole blood, by monitoring and imaging the cells, such as by FACS analysis. Table numbers with higher scores (eg, 4 times higher) for tumor cells compared to normal cells are the subject of treatment.

The present invention provides a method of treating a cancer patient comprising administering to the patient an effective amount of a peptide or polypeptide of the invention to treat cancer. In a preferred embodiment, the cancer is selected from the group comprising carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, sarcoma and melanoma. In a more preferred embodiment, the cancer is leukemia, and in the most particular embodiment, the leukemia is AML.

In the most preferred embodiment, the peptides or polypeptides of the invention specifically or selectively bind to AML cells. The present invention provides a ligand present on AML bound to a peptide or polypeptide of the present invention, and also provides a peptide or polypeptide binding to the ligand.

The novel antibody fragments or their corresponding peptide analogs of the invention are used in the manufacture of compositions or medicaments for the treatment of various diseases and conditions.

The present invention

a) including the primary recognition site by a direct biopanning procedure on the target cell or by indirect biopanning on the first target cell in a second state other than the first state and then directly on the second target cell. Isolating and selecting one or more targeting molecules to generate one or more targeting molecules;

b) amplification, purification and identification of said one or more targeting molecules; And

c) construction of a targeting agent from one or more targeting molecules or recognition sites thereof, wherein the targeting agent can be a peptide, polypeptide, antibody or antibody fragment or multiplex thereof

It provides a method for producing a targeting agent comprising a.

The targeting agent may additionally be designed to couple, attach, combine, link or fuse or associate with the pharmaceutical formulation.

In a preferred embodiment of the invention, the targeting agent is an anti-disease or anticancer agent.

In another embodiment of the invention, the pharmaceutical agent is selected from the group comprising radioisotopes, toxins, oligonucleotides, recombinant proteins, antibody fragments and anticancer agents. The radioisotope is ¹¹¹ indium, ¹¹³ indium, ^99m rhenium, ¹⁰⁵ rhenium, ¹⁰¹ rhenium, ^99m technetium, ^121m tellurium, ^122m tellurium, ^125m tellurium, ¹⁶⁵ thulium, ¹⁶⁷ thulium, ¹⁶⁸ thulium, ¹²³ iodine, ¹²⁶ iodine, ¹³¹ iodine, ^Be selected from the group consisting of ¹³³ iodine, ^{81 m} krypton, ³³ xenon, ⁹⁰ yttrium, ²¹³ bismuth, ⁷⁷ bromine, ¹⁸ fluorine, ⁹⁵ ruthenium, ⁹⁷ ruthenium, ¹⁰³ ruthenium, ¹⁰⁵ ruthenium, ¹⁰⁷ mercury, ²⁰³ mercury, ⁶⁷ gallium and ⁶⁸ gallium Can be.

In another embodiment, the toxin may be selected from the group comprising gelonin, Pseudomonas exotoxin (PE), PE40, PE38, diphtheria toxin, lysine and variants or derivatives thereof.

In another embodiment of the present invention, the anticancer agent is doxorubicin, morpholino-doxorubicin (MDOX), adriamycin, cis-platinum, taxol, calichemicin, vincristine, cytarabine (Ara). -C), cyclophosphazd, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide, bleomycin and derivatives thereof Selected from the group.

The present invention provides a biopanning step comprising (a) incubating a phage display library having cells derived from blood; (b) washing to remove unbound phage; (c) eluting bound phage obtained from blood cells; (d) amplifying the resulting bound phage; And (e) determining the displayed peptide sequence of the bound phage to identify the peptide.

The present invention provides peptides or polypeptides having the formula or structure:

A-X-B

Wherein X is a hypervariable CDR3 region of 3 to 30 amino acids, A and B may each be an amino acid chain 1 to 1000 amino acids in length, A is an amino terminus and B is a carboxy terminus.

In a preferred embodiment of the invention, A is 150-250 amino acid residues and B is 350-500 amino acid residues.

In another preferred embodiment, the CDR3 region of the peptide is 5-13 amino acid residues.

In another preferred embodiment, X in the formula is an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24.

In another embodiment of the invention, the peptide or polypeptide is part of a larger or complete antibody or multimer.

In another embodiment, the dimeric molecule comprises two peptides or polypeptides, one of which is a peptide or polypeptide of the invention. Dimer molecules may comprise two identical peptides or polypeptides of the invention.

In a preferred embodiment of the invention, X is an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24 of the dimer molecule.

Another embodiment provides nucleic acid molecules encoding peptides or polypeptides or dimer molecules of the invention.

The present invention provides the use of a peptide or polypeptide optionally associated with, attached, coupled, combined, linked or fused to a pharmaceutical formulation in the manufacture of a medicament.

The invention also provides the use of a peptide or polypeptide in the manufacture of a medicament having activity against diseased cells, more specifically cancer cells. The cancer cells may be selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, normal carcinomas and melanoma. More specifically, the cancer cells may be leukemia cells, and most specifically, the leukemia cells may be AML cells.

Exchangeable systems, as defined herein and described in the Examples below, are nucleic acid constructs designed to allow the exchange or replacement of redefined variable regions within a construct without the need for further manipulation or reassembly of molecules. The system allows for quick and convenient preparation of certain nucleic acid molecules.

Summary of the Invention

The present invention specifically relates to the identification, construction of, peptides or polypeptides that selectively and / or specifically bind to target cells for blood-related cancer cells, associated with, combined, conjugated or fused with one or more agents. Provides use of the state.

One embodiment of the invention encompasses Fv molecules, constructs thereof, fragments of any one of these, or constructs of fragments, having enhanced binding properties to selectively and / or specifically bind to target cells for other cells. A peptide or polypeptide is provided wherein said binding selectivity or specificity is determined primarily by a first hypervariable region, said Fv being a single chain Fv ("scFv") or a bisulfide Fv ("dsFv"), optionally one or more It has a tag.

Another embodiment of the invention is substantially exposed to and / or on or within a target comprising cells for other cells wherein the binding site is not substantially available and / or expressed therein or / or Provided are peptides or polypeptides comprising Fv molecules, constructs thereof, fragments or constructs of any of these having enhanced binding properties to selectively and / or specifically bind to an overexpressed binding site, wherein The binding selectivity or specificity is mainly determined by the first hypervariable portion, wherein the Fv is scFv or dsFv and optionally has one or more tags.

Another embodiment of the invention provides a Fv molecule, constructs thereof, fragments or constructs of any of these having enhanced binding properties to selectively and / or specifically bind to target cells for other cells. A peptide or polypeptide is provided, wherein the Fv molecule comprises a first chain having first, second, and third hypervariables, and a second chain having first, second, and third hypervariables; One of the hypervariable parts of the chain has a sequence selected from the group comprising SEQ ID NOs: 8-24, and one of the hypervariable parts of the second chain has a sequence selected from the group comprising SEQ ID NOs: 1-6 and 125-202 Wherein the first, second and third hypervariable portions are CDR3, CDR2 and CDR1 sites, respectively, and the Fv is scFv or dsFv and optionally has one or more tags.

In another embodiment of the present invention,

(a) the first and second chains each comprise a first hypervariable portion selected from the group comprising SEQ ID NOs: 8-24,

(b) the first hypervariable parts of the first and second chains are identical and are selected from the group comprising SEQ ID NOs: 8-24,

(c) the first hypervariable part of the first chain is selected from the group comprising SEQ ID NOs: 8-24, and the first hypervariable part of the second chain is selected from the group comprising SEQ ID NOs: 1-6 and 125-202 Or

(d) the first hypervariable portion of the first chain is selected from the group comprising SEQ ID NOs: 1-6 and 125-202, and the first variable region of the second chain is selected from the group comprising SEQ ID NOs: 8-24 .

Another embodiment of the invention is a peptide comprising a Fv molecule, a construct thereof, a fragment of any one of these, or a construct of a fragment, that binds an unknown ligand on a first cell having a first and a second state, or A polypeptide is provided, wherein the binding is effective in the second state but substantially ineffective in the first state, and specifically or selectively binds to a ligand on the second cell by immune cross-reactivity, wherein the Fv is scFv or dsFv , Optionally has one or more tags.

Another embodiment of the present invention

(a) substantially exposing or displaying binding sites comprising unknown ligands in a second state other than the first state to create a first population of recognition molecules, and one or more biopanning performed on the first target cell. ) step;

(b) starting with the resulting stock of the recognition molecule of step (a) and performed in a second cell displaying a binding site comprising an unknown ligand having immune cross-reactivity to the unknown ligand of the first cell Subsequent biopanning and / or selection steps to produce a second population of;

(c) amplification and purification of the second population of recognition molecules of step (b); And

(d) comprising a targeting molecule that is selective and / or specific for an unknown ligand on the second cell; (c) constructing from the recognition site of the purified recognition molecule of the peptide or polypeptide.

Provided are methods for identifying targeting molecules that bind to unknown immune cross-reactive binding sites on first and second cells comprising a.

Another embodiment of the invention provides a binding motif comprising the amino acid sequence of R ₁ -X Phe Pro-R ₂ , wherein R ₁ and R ₂ each comprise 0-15 amino acid residues, and X is One of Arg, Gly or Lys.

Another embodiment of the present invention

a) by a biopanning process directly in the target cell, or indirectly by a biopanning process in a first target cell in a second state other than the first state, and then directly in the second target cell to produce one or more targeting molecules. Isolating and selecting one or more targeting molecules comprising a major recognition site by a biopanning process;

b) amplification, purification and identification of said one or more targeting molecules;

c) construction of a targeting agent which may be a peptide, polypeptide, antibody or antibody fragment or multimer thereof from said at least one targeting molecule or recognition site thereof;

It provides a method of producing a targeting agent comprising the steps.

Another embodiment of the present invention provides a peptide or polypeptide having the formula or structure:

A-X-B

Wherein X is a hypervariable CDR3 region of 3 to 30 amino acids, and A and B may each be an amino acid chain 1 to 1000 amino acids in length, where A is an amino acid terminus and B is a carboxy terminus.

The following examples are set forth to aid the understanding of the present invention, but are not intended to limit the scope of the invention in any way and should not be so interpreted. Although specific reagents and reaction conditions have been described, modifications can be understood to mean within the scope of the present invention. Accordingly, the following examples are provided to further illustrate the present invention.

Example 1

1. Preparation of Cell, Bacterial Strains, ScFv Phage Display Library, Cell Membrane and Protein Purification for Biopanning Process

1.1 Preparation of Leukemia Cells.

Blood samples were obtained from leukemia patients. Monocytes (major cells) were isolated from other blood cells from Ficoll Cushion (Iso-prep, Robbins Scientific Corp., Snuuyvale, Calif., USA). Centrifugation was performed at 110 x g for 25 minutes. Cells at the interface were collected and washed twice with PBS. The cells were then suspended and counted in RPMI + 10% female calf serum (FCS). 10% FCS and 10% DMSO were added to lymphocytes for long term storage and then frozen at -70 ° C.

1.2 Preparation of Fixed Platelets.

Platelet concentrates obtained from blood banks were incubated at 37 ° C. for 1 hour. Equal volumes of 2.0% paraformaldehyde were added and platelets were fixed at 40 ° C. for 18 hours. Platelets were washed twice with cold saline (centrifuged at 2500 x g for 10 minutes), resuspended in 0.01% HEPES in saline, and counted using a microscope.

The sensitivity of platelets to plasma von Willibrands factor and ristocetin was confirmed. Plasma von Willibrand factor (vWF; 18 μg / ml) and ristocetin (0.6 mg / Ml) were added to fixed platelets and platelet aggregation was induced, followed by a chronolog lumi-aggregometer ).

1.3 Bacteria Strains-TG-1 and HB2151:

Fresh bacterial cultures for infection were prepared by proliferating the cells for A6 ₀₀ of 0.5-0.9 (geometrically cell proliferation). E. coli TG-1 cells were used for phage propagation and E. coli HB2151 cells were used for scFv protein production.

1.4 scFv Display Phage Library Source.

The scFv library (Nissim et al., EMBO J., 13, 692-698 (1994)) was provided by Dr. A. Nissim with the consent of MRC. The library was originally constructed as a phagemid library in which the V _H and V _L domains display scFv fragments linked by flexible polypeptides. The scFv displayed in the phagemid library was fused to the N-terminus of a small amount of phage coat protein pIII and subcloned into Ears pHEN1 vector (Nissim et al., EMBO J., 13, 692-698 (1994)). The list of antibody fragments was first produced by PCR from a rearranged V-gene of peripheral blood lymphocytes of non-immunized humans (called the "naive list"). To diversify the list, random nucleotide sequences encoding heavy chain CDR3 4-12 residues in length were introduced into banks of 49 cloned human V _H gene segments. The fused V _L fragment among all clones is from a single unmutated V gene of germline IGLV3S1, forming a single point library of about 10 ⁸ clones.

1.5 Preparation of Membrane from AML Cells.

To a pellet containing 108 washed cells, 1 ml of cold lysis solution (0.3 M sucrose, 5 mM EDTA, 1 mM PMSF) was added and then spun at 11,000 × g at 4 ° C. for 20 minutes. The supernatant fluid was discarded and the pellet was resuspended in TE (10 mM Tris, 1 mM EDTA, 1 mM PMSF) and then spun as described above. The final pellet was resuspended in 6 ml PBS at A280 of 0.4 and used to coat 3 Maxisorb Immune-Tubes (NUNC) for 2 hours at 37 ° C. After coating, the tube was washed three times with PBS and then blocked with MPBS for 2 hours at room temperature. Prior to biopanning, the tube was washed three more times with PBS.

Example 2

2. Manipulation of phagemid particles: biopanning process

2.1 Phagemid Selection and Amplification: Phagemids expressing epitopes of particular interest were selected from the library by the following four steps of biopanning:

a) binding of phagemid particles to a target, more specifically binding of phagemid particles to washed target cells or cell membranes

b) removal of unbound phagemid particles, more specifically by large scale washing

c) elution of bound phagemid particles

d) proliferation and amplification of eluted phagemid particles, more specifically in E. coli

2.2 Clone Identification:

The four-step biopanning procedure was typically repeated 3-5 times. Selected phagemid clones are propagated individually and further characterized by a) to c) below.

a) DNA sequencing

b) In vitro comparison of phage binding to several cell types

c) Infection of E. coli HB2151 to produce soluble scFv

2.3 Sequence Analysis:

~ 800 bp of encoded scFv DNA in phagemid particles was amplified by PCR using upstream primer # 203743 (5'-GAAATACCTATTGCCTACGG) and downstream primer # 181390 (5'-TGAATTTTCTGTATGAGG). DNA fragments were fully sequenced from both ends by an automated ABI PRISM DNA sequencer (310 Genetic Analyzer, Perkin Elmer). Two additional primers located in the flexible polypeptide linkage region between the heavy and light chains, primer # 191181 (5'-CGATCCGCCACCGCCAGAG) and its complementary primer # 191344 (5'-CTCTGGCGGTGGCGGATCG) were used for sequencing.

Example 3

3. Biopanning Protocol

3.1 Basic Biopanning Protocol: The biopanning process is an integral part of the phage display technique described above. Three biopanning protocols have been developed and used in this work.

a) Protocol AM (After AML Cell Membrane Panning / Bacterial Elution, Total AML Cell Panning / Trypsin Elution)

b) Protocol YPR (Fixed Human Platelet Panning / Acid Elution)

c) protocol YPNR (fixed human platelet panning / acid elution)

The protocol is described in detail below.

3.1.1 Protocol AM

3.1.1.1 Pre-Washing: A 1 ml aliquot containing 2 × 10 ⁷ cold AML cells obtained from the patient and stored at −70 ° C. is rapidly dissolved at 37 ° C. and immediately 10 ml cold 2% PBS-Milk (MPBS) Diluted with. Cells were spun 5 'at 120 xg at room temperature, washed twice, resuspended in MPBS and counted on a hemocytometer. Cell membranes were prepared as described in section 1.5.

3.1.1.2 Selection was made by addition of 2 ml MPBS containing 10 ¹² phagemids originally obtained from Nissim Library on immobilized AML cell membranes. The tube was shaken slowly for 30 minutes and then further incubated for 90 minutes without shaking, with both steps at room temperature. After three pannings on AML cell membranes, one panning was performed on whole AML cells.

3.1.1.3 Washing: To remove excess unbound phagemids, the tube contents were transferred gently and the tubes were washed 10 times with PBS, 0.1% Tween, then 10 times with PBS alone.

3.1.1.4 Elution: Geometrically proliferating E. coli TG-1 cells (2 ml) were added directly to the tube and incubated with gentle shaking at 37 ° C. for 30 minutes. As mentioned above, the aliquot was plated for titration and the remaining volume was plated for propagation.

3.1.1.5 Amplification: Colonies obtained from large plates were scraped and pooled. An aliquot of Ampicillin-directed E.coli TG-1 cells (~ 10 ⁷ ) was grown in liquid culture until A600 became ~ 0.5, then infected with helper phage (VSC-M13, stratazine) and amplified significantly. Phagemid stock solution was produced. Phagemid was determined by PEG precipitation process (18a). The amplified T1 6MI stock solution (˜10 ¹¹ phagemid / ml) was used for the subsequent panning cycle. The selection process was repeated two more cycles using 10 ¹¹ phagemids of the stock solutions that were already amplified. The amplified stock solution of the third panning process on the immobilized membrane was called T16M3.

3.1.1.6 Repanning Whole Cells: Intact AML cells were panned using a third membrane panning, amplified stock of T16M3. Selection was carried out with gentle shaking at 4 ° C. for 2 hours at a final volume of 0.5 ml MPBS containing 2 × 10 ⁷ cells of phagemid (Nisim Library) and 10 ¹⁰ colony forming units (CFU), and 10 ¹³ wild type bacteriophage M13. It was. Bound phagemids were eluted from washed cell pellets with 50 μl of trypsin: EDTA (0.25%: 0.05%) and then neutralized by addition of 50 μl of FCS. For titration and amplification, 1 ml of E. coli TG-I culture (A600 = 0.5) was used. The final amplified stock solution was called T16M3.1.

3.1.2 Protocol YPR

3.1.2.1 Selection: Clone selection was performed by panning 10 ⁸ immobilized human platelets with 10 ¹¹ phagemids (Nisim library) in 1 ml PBS / HEPES / 1% BSA buffer. While mixing the samples by rotation, 1 hour at room temperature was allowed to bind.

3.1.2.2 Cell Washing: Platelets were washed five times by low speed centrifugation (3500 × g) and resuspended as described above.

3.1.2.3 Elution: The first cycle of bound phagemid was eluted from fixed platelets by acid dissolution technique:

Platelets were incubated with 200 μl 0.1 M glycine (pH 2.2) at room temperature for 10 minutes. After neutralization with 0.5 M Tris-HCl, pH 8.0 and centrifugation, the remaining platelet-bound phages are eluted by the addition of 200 μl trypsin-EDTA (0.25% / 0.05) and neutralized by the addition of 50 μl FCS. I was. The cells were removed by centrifugation and supernatant fluid containing phage eluted from both acid and trypsin elution protocols was collected and referred to as YPR (a) -1 and YPR (t) -1 stock solutions, respectively. Then, these stock solutions were amplified by adding 1 ml of TG-1 cells growing exponentially at 37 ° C for 30 minutes. Aliquots were plated for titration and remaining infected E. coli cells were plated on 2 × TV / AMP 15 cm plates. The plate was incubated overnight at 30 ° C. The yield after panning of each cycle was measured by counting colonies on titration plates.

3.1.2.4 Amplification: The clones were amplified as described in section 3.1.1.5. Amplified stock solutions of ˜10 ¹² phagemids / ml, obtained from acid and trypsin elution protocols, respectively, were used for panning in the following cycle.

3.1.2.5 Panning of the second and third cycles was performed with the following modifications to the first panning cycle of the YPR procedure: (i) R1 (a) combined with 10 ¹² of R1 (t) for the second panning 10 ¹² were used, and (ii) elution was performed with only glycine (pH 2.2). The amplified eluate of the second cycle was called R2. (iii) For biopanning of the third cycle, R2 10 ¹² was used, and elution was performed as with the second cycle. Three cycles of amplified stock solution were called R3.

3.1.3 YPNR Protocol

3.1.3.1 Biopanning and washing were performed essentially as described in the YPR protocol. However, in this protocol, (i) elution was performed with glycine (pH 2.2) after each of three panning cycles, and (ii) two subsequent pannings were performed without amplification after the first panning and amplification. The first, second and third periods were referred to as YPNR1, YPNR2 and YPNR3, respectively.

3.2 Selection of negative control scFv clones

3.2.1 N14 CDR3 Sequence: During all binding experiments, single clones were screened from the naive library (before selection). Phage stock and soluble scFv called N14 were prepared from the clones. Sequence analysis shows that this belongs to the V _H 4-DP65 gene family. The sequence of the 11-mer V _H -CDR3 encoded by this clone and termed N14 CDR3 is (SEQ ID NO: 28):

Phe Leu Thr Tyr Asn Ser Tyr Glu Val Pro Thr

3.2.2 C181 CDR3 Sequence: An additional negative clone, C181, was used for binding assays. Clone C181 (recombinant hepatitis B virus [HBV] particle) belongs to the VH3-DP35 group, and the sequence of 9-mer VH-CDR3 encoded by this clone and called C181 CDR3 is as follows (SEQ ID NO: 29):

Thr Asn Trp Tyr Leu Arg Pro Leu Asn

Example 4

4. Generation, Purification, Labeling and Characterization of scFv Clones

4.1 Generation of Soluble scFv: The vector pHEN1, originally used to construct the phagemid library, was designed with an amber stop codon encoded at the junction of the scFv gene and the pII1 gene. Thus, when a vector of selected clones is introduced into the non-suppressor strain E. coli HB2151 by phagemid infection, this system enables the production of soluble scFv and secretion into the bacterial periplasm [Harrison et al. , Methods in Enzymology, 267,83-109 (1996). The scFv is then readily recoverable from the culture broth. Soluble scFv is produced under the control of the lacZ promoter induced by IPTG (Gilbert and Muller-Hill, PNAS (US), 58, 2415 (1967)).

The sequence encoding the c-myc tag (10 amino acids-Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu: SEQ ID NO: 123) is contained in the upstream vector of Amber mutation. The C-terminus of the expressed scFv must carry a c-myc tag that can be detected using a mouse anti-myc tag antibody (derived from the European Collection of Cell Culture (ECACC) 9E10-Hybridoma).

4.2 Purification of scFv on Protein-A Bead Affinity Columns

The scFv of selected clones and control clone C181 both belong to the VH3 group and can be purified on a Protein-A column. Portions of the surrounding cytoplasm (100-250 ml) obtained from the induced culture of each clone were prepared and incubated with protein-A sepharose beads. Bound scFv was recovered from the column by acid elution (0.1 M glycine, pH 3.0). Concentrates of the recovered protein were measured by A280 measurement, followed by PBS buffer exchange by dialysis, or on a G-25 Sepharose column.

4.3 Purification of N14-scFv on Sephacryl S-200 Columns: The scFv of negative clone N14 belongs to the VH4 gene family and therefore cannot be purified on a Protein-A affinity column. For scFv-N14 purification, total protein in the surrounding cytoplasmic portion of 200 ml of induced culture was precipitated by 60% ammonium sulfate. The pellet is resuspended in 2 ml 0.1 × PBS, 5 mM EDTA, 5 mM PMSF and loaded onto a Sephaerly S-200 column (1.5 × 90 cm) pre-equilibrated with transfer buffer (0.1 × PBS, 5 mM EDTA). I was. The protein was portioned and the portion containing N14-scFv (detected by SDS-PAGE and Western analysis) was pooled, lyophilized and suspended in 1/10 volume H20. N14-scFv (unlabeled and FITC-labeled) was then used as a negative control in FACS assays.

4.4 Labeling by FITC of Purified scFv: Approximately 1 mg of purified scFv from each formulation was resuspended in PBS and instructed by the manufacturer using a Fluoro-Tag FITC Conjugation Commercial Kit (Sigma cat. # FITC-1). Thus coupled to FITC.

4.5 Quantitative Analysis of Purified and Labeled scFv

4.5.1 After purification and FITC labeling, the profiles of each preparation (labeled and unlabeled) were analyzed by SDS-PAGE, Western blotting, HPLC using Superdex-75 columns (A280 and A495) and fluorescence. The assay shows about 80% purity of N 14 scFv and 90% purity for V _H 3 clones, with about two molecules of FITC conjugated to each scFv molecule (F / P ratio 2: 1).

4.5.2 The binding activity after FITC labeling was assessed to demonstrate the retention of scFv specificity (see Example 5).

4.6 Biochemical Characterization of Phagemid Clones: Several types of assays, including SDS-PAGE, mass spectrometry (only for Y1 and Y17 scFv) and HPLC, were used to assess the structure and measure the purity of various scFv formulations (Example 8 Reference). Western analysis and EIA were used to identify scFv and FACS was used to characterize scFv binding.

Example 5

5. Binding Analysis

Binding of selected clones to cells was assessed at two levels: phagemid levels and levels of soluble scFv.

5.1 Binding at the phagemid level

For this purpose, phagemid raw material was prepared separately from each selected clone.

5.1.1 Colony Test: In a set of experiments, 10 ⁹ specific phagemids derived from the biopanning protocol and producing infected E. coli ampicillin resistance, and serve as "blockers" without carrying ampicillin resistance A mixture of 10 ¹¹ wild type M13 phages was incubated with 10 ⁵ cells selected from a panel of cell types. After incubation and washing, bound phage was eluted with trypsin and aliquots were used to infect E. coli TG-I. E. coli was then plated onto 2 × TY / AMP plates and incubated at 30 ° C. overnight. The number of colonies obtained for each clone was calculated and compared. As a result, the binding affinity and specificity of phagemid is measured.

5.1.2 White / Blue Colony Test: In this test, each test included an internal control and another specific phagemid was named pGEM7 at the same rate as in section 5.1.1, ie 1/100 above. Mixed with control phagemid (Promega Corp., Madison, Wisconsin, USA). This pGEM7 phagemid carries resistance to ampicillin, but it does not express any recombinant polypeptide at the N-terminus of its pIII gene. Colonies were counted after TG-1 infection and incubation in ampicillin plates containing 1 mM X-gal. The resulting colonies containing pGEM7 are blue, while the colonies obtained from specific phagemids are white. For each test tube the concentration factor derived from the ratio of input / output of white / blue colonies (grow on the same plate) was calculated.

5.1.3 Phagemid EIA

5.1.3.1 Phagemid Binding to Selected Cells: About ⁵ × 10 ⁵ of selected cells were fixed with acetone: methanol (1: 1) on the surface of a 24 well plate. The binding test required 10 ⁹ phagemids. Binding was performed at 37 ° C. for 1 hour, followed by large scale washings with PBS / Tween (0.05%). After extensive washing with PBS, plates were incubated with rabbit anti-M13, anti-rabbit IgG-HRP and substrate. The intensity of the resulting color was read by an ELISA plate reader, which was proportional to the level of bound phagemid.

5.1.3.2 Binding of Phagemid to Fixed Platelets: Polystyrene microtiter plates were coated with 10 ⁸ fixed platelets and incubated overnight at 4 ° C. Binding was assessed using about 10 ¹⁰ phagemids. Washing of the plates and determination of constant temperature and binding level were performed as described in 5.1.3.1 above.

5.1.4 Binding assays of specific proteins selected from the group consisting of human growth hormone (hGH), fibrinogen, fibronectin, BSA, SM (skim milk) and glycocalysin (proteolytic fragments of GPIb) were performed. Binding was analyzed in the following manner. Polystyrene microtiter plate wells were coated with one of the proteins to be tested at 2 μg / well. The coating was made while incubating overnight at 4 ° C. Binding was tested by adding about 10 ¹⁰ phagemids. After extensive washing with PBS, the plates were incubated with rabbit anti-M13, anti-rabbit BRP and substrate. The level of binding was measured by the intensity of the color produced. Optical density was measured at A ₄₀₅ . Each sample was analyzed twice and averaged.

5.2 Binding Tests at scFv Levels: The binding of scFv generated in the surrounding cytoplasm of HB2151 was compared in several cell types by two different assays, EIA and FACS analysis.

5.2.1 EIA of Soluble scFv: About ⁵ × 10 ⁵ AML cells were incubated with 5-10 μg of total protein. Binding was performed at 4 ° C. for 1 hour before EIA was performed using mouse anti-myc antibody, anti mouse HRP and substrate. More unbound antibody was removed by washing the cells three times with PBS after each step. The intensity of the color produced is read by an ELISA plate reader (OD ₄₀₅ ). As mentioned above, the color intensity is proportional to the level of binding.

5.2.2 FACS analysis of cells

5.2.2.1 Analysis of colored cells by the "3-step staining" procedure: FACS analysis was performed and specificity of selected clones was tested and confirmed. Initially, a "three step staining" process was performed using crude extract or purified unlabeled scFv followed by mouse anti-myc antibody and finally FITC- or PE-conjugated anti mouse antibody.

FACS analysis requires 5-8 × 10 ⁵ cells, picol-purified and resuspended in PBS + 1% BSA. Bonding was performed at 4 ° C. for 1 hour. After each step, cells were washed and resuspended in PBS + 1% BSA. After the last staining step, the cells were fixed by resuspension in PBS, 1% BSA, 2% formaldehyde and determined by FACS (Becton-Dickinson).

5.2.2.2 Coloration of Cells with FITC-labeled scFv In a single staining step: FITC-labeled scFv was incubated with 5-8 × 10 ⁵ picol-purified cells in PBS + 1% BSA. Bonding was carried out at 4 ° C. for 1 hour. Cells were then washed, fixed as in section 5.2.2.1 above, and read by FACS.

Example 6 Panning and Sequencing Results

6.1 Results of the AM Protocol

6.1.1 Panning Results for AM Protocol: Measurements (injection) of phagemids used for panning and measurements (calculations) of bound phagemids eluted in the AM protocol are summarized in the table below (Table 1).

Panning results derived from protocol AM Injection stock Cell source Elution Calculation Amplified Stock Solution Nissim Library-2x10 ¹¹ AML membrane Bacteria TG-1 3 x 10 ⁴ T16M1 T16MI-10 ¹¹ AML membrane Bacteria TG-I 6.4 x 10 ⁵ T16M2 T16M2-10 ¹¹ AML membrane Bacteria TG-1 10 ⁶ T16M3 T16M3-10 ¹⁰ AML cell Trypsin 2 x 10 ⁶ T16M3.1

Check the concentration of the product (output) obtained with each successive panning. In addition, when panning AML whole cells using T16M3, the yield does not drop, either because the bound phagemid is specific for a component on the outer cell surface, or this specific system contains a relatively large number of nonspecific bound phagemids. Imply that you can.

6.1.2 Clonal Sequence Results for the AM Protocol: Clones were isolated and sequenced from T16M1, T16M2 and T16M3 yield stocks, but the results presented below are mainly clones derived from T16M3.1 yield stocks (AML intact cell panning). Clones AM10, AM11 and AM12 were identified in the T16M3 stock solution, but not in the subsequent calculations.

The amino acid sequences displayed in V _H -CDR3 and their frequency in the clone yields tested are summarized in Table 2.

Selected clones obtained from T16M3 and T16M3.1 calculations after AM biopanning protocol Clone # V _H -CDR3 size V _H -CDR3 sequence Wiring Frequency at T16M3 Output Frequency in T16M3.1 output AM1 8 Pro Trp Asp Asp Val ThrPro Pro1 2 3 45 6 7 8 V _H 3-DP47 5/31 8/51 AM2 12 Gly Phe Pro Arg IleThr Pro Pro Ser AlaGlu Ile 1 2 3 4 56 7 8 9 10 11 12 V _H 3-DP46 11/31 20/51 AM3 5 Gly Phe Pro Met Pro1 2 3 4 5 V _H 3-DP46 1/31 2/51 AM6 10 Gly Phe Pro His SerSer Ser Val SerArg 1 2 3 4 56 7 8 9 10 V _H 3-DP46 4/31 6/51 AM7 11 Arg Phe Pro MetArg His Glu Lys ThrAsn Tyr1 2 3 4 56 7 8 9 10 11 V _H 3-DP46 3/31 4/51 AMS 8 Arg Phe Pro Pro ThrAla Thr Iie1 2 3 4 56 7 8 V _H 3-DP46 6/31 8/51 AM9 7 Thr Gin Arg ArgAsp Leu Gly1 2 3 4 56 7 V _H 3-DP87 0/31 2/51 AM10 11 Lys Phe Pro GlyGly Thr Val ArgGly Leu Lys1 2 3 4 56 7 8 9 10 11 V _H 3-DP46 0/31 1/31 AM11 12 Gly Phe Pro Val IieVal Glu Gln ArgGin Ser Thr1 2 3 4 56 7 8 9 10 11 12 V _H 3-DP49 0/31 1/31 AM12 10 Arg Phe Pro GinArg Val Asp AsnArg Val1 2 3 4 56 7 8 9 10 V _H 3-DP46 0/31 1/31

The amino acid sequence of ^Arg / _Gly PhePro is present in 7 of the 10 isolated clones shown in Table 2. Also note that the identified motifs in each case represent the three amino acids at the N-terminus of the CDR3 region. Thus, the motif may be an efficient anchor or binding site, alone or with other amino acid residues extending beyond one or both ends of the CDR3 region or as part of a larger peptide or polypeptide or Fv molecule.

Other CDR3 regions with high affinity for binding to AML cells can be constructed based on the core sequence ^Arg / _Gly PhePro. These can be constructed by altering any of the 5-12-mers by addition, deletion or mutation, while maintaining the ^Arg / _Gly PhePro core sequence.

The CDR3 region of the invention has the amino acid sequence R1- ^Arg / _Gly PhePro-R2, wherein R1 comprises 0-15 amino acids, preferably 0-9, most preferably 0-1 amino acids, R2 Comprises amino acid sequences obtained from 1-15 amino acids, most preferably 1-9 amino acids. R1 and R2 are amino acid sequences that do not adversely affect the specific binding of ^Arg / _Gly PhePro sequences to AML cells.

The CDR3 region of the light chain of the clone is identical and is referred to as SEQ ID NO: 125.

6.2 Results of the YPR and YPNR protocols

6.2.1 Panning Results for YPR and YPNR Protocols: The measurements (injection) of phagemids used for panning and the measurements (calculations) of eluted bound phagemids are summarized in the following tables (Table 3, Table 4).

Panning Results Derived from YPR Protocol Injection stock Elution Calculation Amplified Stock Solution Nissim Library 10 ¹¹ Mountain trypsin 10 ⁷ 4x10 ⁷ R1 (a) R1 (t) Pooled (R1 (a) -10 ¹² , + R1 (t) -10 ¹² ) mountain ⁵ x 10 ⁵ R2 R2-10 ¹² mountain 3 x ^{10 8} R3

Table 3 shows that trypsin elution yields four times greater yield than acid elution in the second cycle.

Repanning according to the YPNR protocol without the amplification step preferentially minimizes the possibility of amplifying phagemid infection or bacterial infection. The resulting calculation is shown in Table 4.

Panning Results Derived from YPNR Protocol Injection stock Elution Calculation Elution stock Nissim Library 10 ¹¹ mountain 3 x 10 ⁷ YPNR1 YPNR1-3x10 ⁷ mountain 4 x 10 ⁵ YPNR2 YPNR2-4x10 ⁵ mountain 10 ³ YPNR3

As expected, the results presented in Table 4 show a decrease in phage product after each cycle of panning. This protocol was used to prevent bias due to amplification of nonspecific phage.

6.2.2 Clone Sequence Results for YPR and YPNR Protocols

Several clones from the third panning by both protocols were selected for sequencing. The amino acid sequences shown in Table 5 are from the CDR3 region of the heavy chain (V _H -CDR3). The germline and frequency at which sequences appear in the calculation of R3 are also shown in this table.

Y-series clones selected after YPR biopanning protocol with R3 yield Clone # V _H -CDR3 size V _H -CDR3 sequence Wiring frequency Y1 6 Met Arg Ala ProVal Ile1 2 3 45 6 VM-DP32 14/30 Y16 6 Thr Gly Gln SerIle Lys Arg Ser1 2 3 45 6 7 8 V _H 3-DP26 1/30 Y17 6 Leu Thr His ProTyr Phe1 2 3 45 6 V _H 3-DP32 7/30 Y-27 6 Ler Arg Pro ProGlu Ser1 2 3 45 6 V _H 3-DPS2 3/30 Y-44 11 Thr Ser Lys Asn ThrSer Ser Ser LysArg His1 2 3 45 6 7 89 10 11 V _H 3-DP32 2/30 Y-45 12 Arg Tyr Tyr Cys ArgSer Ser Asp CysThr Val Ser1 2 3 45 6 7 89 10 11 12 V _H 3-DP49 1/30 Y-52 10 Phe Arg Arg MetGln Thr Val ProAla Pro1 2 3 45 6 7 89 10 V _H 3-DP49 1/30

Many of the isolated clones obtained from the YPNR protocol were Y1.

The CDR3 region of the light chain of the clone is identical and is referred to as SEQ ID NO: 125.

Example 7

7. Results of Combined Evaluation

7.1 Binding of Selected Phagemid Clones to AML Cells (AM Clone Series): A white / black colony test as described in Example 5, which is a binding assay to assess binding of phagemids to cells, was performed with AM clones. Except for clone AM7, no selective binding was detected for the cells tested. As phagemid or purified scFv, significant but non-selective binding to all target cells of clone AM7 was observed. The results do not show any enrichment for the AM clone series.

7.2 Combination of Y clone series

7.2.1 EIA Using Phagemid Binding-Fixed Platelets: After three cycles of panning using two different protocols, phage clones were tested by EIA for binding to fixed platelets. Phagemid stocks were prepared from each selected clone and these clones were tested in two sets of EIA. Each sample was analyzed twice and the average calculated. The results are summarized in FIG. 1, indicating that six of the nine Y-series clones show a positive EIA response. The highest degree of binding was associated with clones Y1, Y16, Y17 and Y-27. Phage stock M13 (wild type bacteriophage) and E6 (selected on CLL leukemia cells) were used as negative controls. The predominant clone, phage Y1, showed the highest binding to immobilized platelets, and with Y17 showed significantly higher binding than M13 or E6 phage clones.

Example 8

8. Detailed Characterization of scFv and Clone Binding

Structure and Identification of 8.1 scFv: The naïve structure of Y-I was evaluated by HPLC analysis with Superdex75 column and by mass spectrometry. The results of the former method indicate the presence of monomers, dimers and tetramers in the formulation. Mass spectrometry was sensitive enough to identify the expected molecular weight of 26.5 kD and a 24 kD molecular weight was obtained when the c-myc tag was removed.

However, the results of SDS-PAGE show that intact and uncut molecules have a clear molecular weight of 30 kD despite the nucleic acid sequence and the expected molecular weight of 26.5 kD according to the mass spectrometry results. Western analysis using c-myc-specific antibodies confirmed the 30 kD result of SDS-PAGE and supported the suggestion that the c-myc tag is present at the end of the intact molecule. The difference between the results of the two processes is due to the level of accuracy of the methods as well as the moving conditions of the SDS-PAGE, which can alter the apparent molecular weight of the tested protein.

8.2 Binding of Platelet-Selected Clones to Leukemia Cells: As noted in the introduction, platelet cell surface markers can be expressed in early mature hematopoietic cells. Binding of platelet selected clones was tested by FACS analysis. FACS analysis was performed after destaining the whole blood, followed by RBC or on Iso-prep- (Piccol Cushion) purified mononuclear cells. ScFv was prepared from each clone purified from Protein-A and FITC labeled (described in sections 4.1-4.4). To enable the production of intact scFv in the non-suppressor E. coli strain HB2151, the amber codon (TAG) found in VH-CDR3 of the Y-27 clone was mutated by DNA designation site mutation and glutaric acid (GAG). ). Target cells for this study were cells isolated from fresh blood samples from various patients with leukemia. The samples were obtained from three medical centers in Israel.

Clones Y1 and Y17 showed dominant binding to the leukemia cells tested, while all other Y-series clones showed only background level binding. Table 6 shows the binding of FITC-labeled Y-I and Y-17 to various leukemia cells.

Y-I binding specificity-B cell line for leukemia cells B cell system ScFv AML CML B-CLL B-ALL Multiple myeloma T-based leukemia Normal lymphocytes N14 / C181 0/68 0/6 0/6 0/6 0/5 0/3 0/18 Y1 54/68 2/6 1/6 3/6 4/5 2/3 0115 Y17 3/3 N.D. * 1/1 2/2 N.D. * N.D. * 11/11 * Not measured

The results presented in part in Table 6 represent the part of the patient whose cells were identified by FACS analysis when reacting positive with each tested antibody. The molecule represents the number of positive patients and the denominator represents the total number of patients tested for a given scFv / cell type combination. Y-17 bound strongly to all tested cells, so this binding was considered non-cell selective. However, Y1 binding has been found to be very selective in some instances of leukemia cells, especially in the acute stage. Y1-scFv binding was also analyzed as described below.

Representative results of YI binding to three AML samples are shown in Table 3. In each case, a large portion of the cell population fluoresces at a significantly higher intensity than that of the fluorescence obtained by staining with a negative control scFv. These results indicate that for each patient Y1 binds to a different part of the total cell population. The right Y-I peak in each graph is thought to represent the minimum number of Y1-binding cells in the population, with the portion of total cells below this peak best representing the minimum percentage of YI-binding cells in each sample.

8.3 Binding of Y-I to Normal Blood Cells: Binding of Y1 to Ficoll purified normal blood cells was analyzed according to different blood cell types. No binding to normal lymphocytes was detected, but Y1 binds to Ficoll purified monocytes obtained from 9/28 subjects, platelets from 5/8 subjects and red blood cells (RBCs) from 1/4 subjects. However, CD14-specific antibodies bound cells of all monocyte preparations and many neutrophil preparations. A summary of this analysis is presented in FIG.

FACS Analysis of Binding of scFv to Ficoll Purified Normal Blood Cells Antibodies Lymphocyte Monocytes Neutrophils Platelets RBC N14 0/18 0/4 0/4 0/3 0/4 Y1 0/28 9/28 0/4 5/8 1/4 CD14 0/15 14/14 8/14 0/5 0/4

The results of these bindings represent the portions of normal blood samples that were identified by FACS analysis when reacted positive with each tested antibody. FITC-Y1 scFv was selected from immobilized platelets but exhibits relatively low binding affinity for platelets.

4 shows the binding of Yi to Ficoll purified platelets 4a and monocyte mediated cells 4b. Migration in monocyte cell populations was greater than that observed in platelets, and the means of measurement were 30 and 50 times greater fluorescence than negative controls, respectively. This observation is most suitable due to the nature of platelets that multiplely attach to picol-purified monocytes. The following experiment shows that Y1 binding is not observed in any normal monocytes, granulocytes, platelets or RBCs tested in the analysis of whole blood samples. Similarly, no binding of Y1 to platelets was observed when derived from platelet rich plasma (PRP). Under the same binding conditions (in whole blood, followed by RBC lysis with FACS lysis solution [Becton Dickenson]), Y1 bound to leukemia cells in a manner similar to that obtained after Ficol purification. Thus, we can conclude that under natural conditions, the Y-1 epitope on platelets or monocytes is hidden. During the Ficoll purification process, the epitope is exposed to make it accessible for recognition by Y1, while in leukemia cells the epitope is exposed in both purified and unpurified conditions.

In addition to normal hematopoietic cell progenitors of the lymphoid or bone marrow system, the binding of Y1 to hematopoietic stem cells (CD34 + cells) in cord blood was tested. 5 shows the results of binding of FITC-labeled scFv clones to cord blood CD34 + hepatocytes, FIG. 5A shows the results of binding of CD34 + mediated cells to FITC-labeled negative control scFv, and FIG. 5B shows FITC-labeled scFv The same assay for binding of CD34 + mediated cells to clone Y1 is shown. FIG. 5C shows FSC and SSC dot plot analysis of the same FITC-labeled scFv clone Y-I sample as in FIG. 5B. The results of this analysis indicate the presence of two CD34 + hepatocyte subpopulations derived from umbilical cord blood with a difference in forward scatter (FSC) in the indication of cell size. Y1 binds to cells of the smaller size in two populations. 5B and 5C show the subpopulations of CD34 + cells that bind to clone Y1 scFv. In addition, the analysis indicates that the smaller sized cells are dead cells present in the cell population, and Y1 binding may indicate the presence of intracellular ligands recognized by Y1.

The experiment was performed in peripheral blood cells of healthy donors pretreated with GM-CSF (GM-CSF treatment caused release of hepatocytes into the bloodstream). Results similar to those shown in FIG. 5 were obtained.

8.4 Binding specificity of Y1 scFv compared to various cellular markers on AML cells: Y1 staining of Ficoll-purified peripheral cells and bone marrow cells from AML patients were compared with staining of cells by a panel of other antibodies. The results of this FACS analysis on samples from 14 patients are summarized in Table 8. Note that there is considerable variation in the frequency of pigmented cells in preparations from various individuals for all markers tested, including Y1. No correlation between the binding of the various markers and the binding of Y1 suggests that Y1 does not bind to any ligand bound by another tested marker and that the YI ligand does not constitute any tested cell surface marker. .

Comparison of Y1 scFv binding and antibody binding for various cellular markers AML patient Y1 CD13 CD14 CD33 CD34 BN / PB ** One 0 ND 2.5 47 4 PB 2 34 88 0 80 83 PB 3 66 100 20 87 9 BM 4 86 83 2 73 3 BM 5 100 100 0 100 0 BM 6 0 72 0 49 One BM 7 59 20 93 100 0 BM 8 40 86 40 48 6.5 BM 9 70 75 67 75 One PB 10 25 24 55 82 5 PB 11 26 76 17 83 52 PB 12 60 40 60 94 ND PB 13 17 ND 13 75 15 PB 14 0 24 27 70 0 BM ** BM / PB-Bone Marrow / Ambient Blood

The results are expressed as the percentage of cells in a picol-purified sample of a given patient, identified by FACS analysis upon positive reaction with each individual antibody.

In view of the Y1 concentrate (~ 1 μg / 5x10 ⁵ ) required for binding detection, the results indicate that the Y1 scFv has a relatively high binding affinity for specific ligands on AML cells.

In addition to the results shown in Table 8 showing the binding of Y1 to AML cells, we limited the sample size for samples of these other leukemias, but Y1 is the most different type of leukemia cells tested, including B-ALL cells. It was mentioned above that it can bind to (Table 6). 6 shows a FACS analysis of the binding of Y1 scFv to pre-B-ALL cells obtained from two patients. Commercially available PE-labeled CD19 (marker for normal peripheral B-cells; FIGS. 6A, 6C) or PE-labeled CD34 (marker for hepatocytes), with FITC-labeled negative control scFv or FITC-labeled Y1 scFv; A dual staining procedure using FIG. 6d) was used. 6B is a double negative control. The fluorescence intensity (x-axis) of cells bound by FITC-labeled sample (scFv clone Y1) for the staining pattern of negative control is shown (6e and 6f). The results in FIG. 6 indicate that most leukemia, pre-B-ALL cells in each of the two tested samples were positive for Y1 cell staining due to Y-I binding.

8.5 Binding of Y1-scFv to Cell Lines: Several cell lines derived from malignant tumor hematopoietic system were screened for their ability to be recognized by Y1. FACS analysis shows that Y1 binds to a number of tested cells (Table 9). Note that only one human B-cell line and one mouse bone marrow cell line were tested. Importantly, this binding was limited to cells that grow exponentially. Stationary phase cells typically did not bind to Y1, indicating that Y1 ligand expression is regulated during the cell's life cycle. In addition, the bond strengths differ between the responding cells. This observation suggests that there is a difference in the expression number or affinity of ligands of different cells.

Binding of Y1 to Hematopoietic Cell Lines type High reactivity Moderate reactivity Low reactivity Human bone marrow KG-1; THP-1; U937; Tf-1; MEG HL-60; HEL; K-562; MC1010 NB-4 Human B-cell Namalwa; Daudi; UMUC3, RAJI Human T-cell Jurkat; Hs-602 CCRF-CEM; Molt-4; Hut-78 Mouse bone marrow M1; P388D1; PU5-1.8; WEHI-274.1

8.6 Binding of purified Y1 in the presence of DTT: Once the Y1 clone was selected, a process for generating scFv was also developed. The results of the FTLC analysis of the Y1 batch indicate that the protein is multiplexed, forming predominantly monomers and tetramers at a ratio between two forms in which one agent and another are different. To obtain a homogeneous material, 5 mM DTT was added during affinity purification on a Protein-A Sepharose column and then removed by PBS buffer exchange. Indeed, after the DTT treatment, most (> 90%) of material was found in the monomer portion. No significant difference was found between the binding of the monomeric form of Y1 (purified in the presence of DTT and analyzed on HPLC) and the binding of the mixture of Y1 forms.

8.7 Y1 is a clone specific for leukemia cells: Y1 cassette belongs to the VH-DP32 germline. Several other clones originating from the same wiring were isolated and described in detail in Example 6. These clones include Y17, Y-27 and Y-44. The major sequences of all these clones (ie, germline cassettes) differ only in their CDR3 regions. However, only Y1 shows selectivity for leukemia cells. The CD3 sequences of these clones are summarized in Table 10, and the binding profiles of the clones are summarized in Table 11.

CDR3 sequence of the V _H 3-DP32 isolated clone Clone # V _H 3-DP32 sequence Wiring Y1 Met Arg Ali Pro Val Ile1 2 3 4 56 V _H -3DP32 Y17 Leu Thr His Pro Tyr Phe1 2 3 4 56 V _H -3DP32 Y-27 Leu Arg Pro Pro Glu Ser1 2 3 4 56 V _H -3DP32 Y-44 Thr Ser Lys Asn Thr SerSer Ser Lys Arg His1 2 3 4 56 7 8 9 1011 V _H -3DP32

Binding Profiles of V _H 3-DP32 Isolated Clones Clone # Binding specificity Y1 Binds to multiple leukemia cells Y17 Binds to all tested hematopoietic cells, including normal lymphocytes Y-27 Does not bind to any hematopoietic cells tested Y-44 Does not bind to any hematopoietic cells tested

Tables 10 and 11 show that the major sequences are identical among the four clones except for the V _H -CDR3 region, but the binding profiles between the mutual clones are quite different. This observation reinforces the idea that the sequence of the V _H -CDR3 region plays an important role in the specificity of the binding site for the antigen. Note that neither the length of the CDR3 sequence nor the specific germline cassette in which it is located is likely a major determinant of binding specificity. Y17 and Y-27 each contain 6-mer CDR3 like Y1, and the heavy chains of all three clones are from the same germline. In the case of Y17 and Y-27, there was no selective binding of hematopoietic cells.

Example 9

9.1 Construction of the trimer: The vector pHEN-Y1 encoding the original Y1 was individually amplified using PCR for the V _L and V _H regions. Sense oligonucleotide 5'- AACTCGAGTGAGCTGACACAGGACCCT, and antisense oligonucleotide 5'- TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the V _L PCR reaction. CDNA products of expected size of ˜350 bp were purified, sequenced and digested with XhoI and NotI restriction enzymes.

The same procedure was used to amplify the V _H region (using sense oligonucleotide 5'-ATGAAATACCTATTGCCTACGG and antisense oligonucleotide 5'-AACTCGAGACGGTGACCAGGGTACC). V _H PCR products were digested with NcoI and XhoI restriction enzymes. A triple suture process with a pHEN vector pre-digested with NcoI-NotI was used. The final vector is called pTria-Y1.

After transformation of E. coli, several clones were isolated for further analysis, including DNA sequencing, protein expression, and extraction of bacteria from the surrounding cytoplasmic space. SDS-PAGE and Western blot analysis under reducing conditions were performed to confirm the size of the Y1 trimer.

9.2 Construction of Dimers

PTria-Y1 obtained above was linearized with XhoI restriction enzyme, preannealed synthetic complementary double stranded oligonucleotides (5'-TCGAGAGGTGGAGGCGGT and 5'TCGAACCGCCTCCACCTC) and XhoI position between Y1-heavy and Y1-light chains Sutured. This new vector was called pDia-Y1. As described above for the trimer, DNA sequence and protein expression were confirmed.

9.3 Expression and Purification of Dimers and Trimers

Expression in E. coli is essentially as described above for scFv-Y1. However, the purification of Y1 dimers and trimers obtained from the periplasm of transformed E. coli cells was different. The scFv Y1 monomeric form can be purified on an affinity column of Protein-A Sepharose Beads. However, the multimeric form of Y1 is ineffective for purification by this process. Thus, the peripheral cytoplasmic protein extracted from bacteria was precipitated overnight with 60% ammonium sulfate, resuspended in H ₂ O, and then on a Sephacryl-200 (Pharmacia) size exclusion column pre-sulphated with 0.1.xPBS. Charged in. Fractions were collected and analyzed by HPLC and separated fractions containing either dimer or trimer form were collected for FITC labeling and FACS analysis.

9.4 Binding of Y1 Dimers and Trimers to Cells

FACS analysis was performed on Jurkat cells using a "three step staining process". First, the crude extract or purified unlabeled scFv was stained, followed by the mouse anti-myc antibody and finally the FITC- or PE-conjugated anti-mouse antibody. FACS analysis requires 5-8 × 10 ⁵ cells, picol-purified and resuspended in PBS + 1% BSA. Bonding was performed at 5 ° C. for 1 hour. After each step, cells were washed and resuspended in PBS + 1% BSA. After the final staining step, cells were fixed by resuspension in PBS, 1% BSA, 2% formaldehyde and then read by FACS (Becton-Dickinson).

The binding of Y1-scFv was compared to that of dimers and trimers. In this assay (FIG. 7), the binding profiles of all three forms were very similar, indicating that modifications in the molecule did not alter, hide, or destroy the apparent binding affinity of Y1 to the ligand.

9.5 Generation of Y1-cys-kak (cysteine dimer)

One liter of λpL-y1-cys-kak bacterial culture was induced at 42 ° C. for 2-3 hours. This culture was centrifuged at 5000 RPM for 30 minutes. The pellet was resuspended in 180 ml of TE (50 mM Tris-HCl pH 7.4, 20 mM EDTA). 8 ml of lysosome (obtained from 5 mg / ml stock) were added and incubated for 1 hour. 20 ml of 5 M NaCl and 25 ml of 25% tryptone were added and incubated for an additional hour. This mixture was centrifuged at 4 ° C. for 60 minutes at 13000 RPM. The supernatant was discarded. The pellet was resuspended in TE with the help of a tissuemiser (or homogenizer). This process was repeated 3-4 times until the enclosure (pellets) became gray / light brown. Inclusion bodies were dissolved in 6 M guanidine-HCl, 0.1 M Tris pH 7.4, 2 mM EDTA (1.5 g of inclusions in 10 ml solubilization buffer gave ˜10 mg / ml soluble protein). This was incubated for at least 4 hours. Protein concentration was measured and made to a concentration of 10 mg / ml. DTE was added to a final concentration of 65 mM and incubated overnight at room temperature. Refolding was initiated by diluting (dropping) 10 ml of protein in 0.5 M arginine, 0.1 M Tris pH 8, 2 M EDTA, 0.9 mM GSSG. The refolding solution was incubated at ˜10 ° C. for 48 hours. The refolding solution containing the protein was dialyzed in 25 mM phosphate buffer pH 6, buffer containing 100 mM urea and concentrated to 500 ml. The condensed / dialyzed solution was bound to an SP-Sepharose column and the protein eluted by a gradient of NaCl (up to 1 M).

Affinity study of S-S Y1-dimer compared to CONY1 and Y1-IgG using 9.6 KG-1 cells and using Radioactive Receptor Binding Assay (RRA)

The analytical system involves the use of radioligand prepared by iodination with ¹²⁵ I using either Chloramine T on Y1-IgG construct or Bolton-Hunter reagent on CONY1 (Y1 scFv) construct. Assay tubes contained labeled probes with 5 × 10 ⁶ KG-1 cells per 0.2 ml in PBS + 0.1% BSA and various amounts of unlabeled competitor. After incubation for 1 hour with shaking at 4 ° C, cells were washed thoroughly with cold buffer and radioactivity counted.

In a RRA study using labeled Y1-IgG, 2 ng / tube of ¹²⁵ I-Y1-IgG were used and competition was performed with each of the three molecules. The results are provided in FIG. 8. The results presented in this figure indicate that the affinity of the SS Y1 dimer was 30 times higher than that of CONY1. The approximate measure of the affinity of Y 1 -IgG in this experiment is 2 × 10 ⁻⁸ M. Thus, the corresponding affinity of the dimer is ⁴ × 10 ⁻⁸ M.

For the second RRA using labeled CONY1, 100 ng / tube of ¹²⁵ I-Y1-IgG was used and competition was performed with each of three molecules. The results are provided in FIG. 9. This figure shows that the affinity of SS dimer is 20 times higher than that of CONY1. The approximate measure of affinity of CONY1 in this experiment is 10 ⁻⁶ M. Thus, the corresponding affinity of the dimer is 5 × 10 ⁻⁸ M.

9.7 ELISA for GC (Glycocalicin)

100 μl of purified glycocalysine was incubated overnight at 4 ° C. in a 96 plate well maxisorp plate. The plates were washed three times with PBST (PBS + 0.05% tween) followed by 200 ml of PBST-milk (PBST + 2% nonfat milk) at room temperature for 1 hour. The plates were washed with PBST and monomer or dimers (100 μl) were added to different concentrations of PBST-milk for 1 hour at room temperature. At this time, the plates were washed and anti-V _L polyclones (derived from immunized rabbits with V _L from Y1) were added for 1 hour. Plates were washed and anti-rabbit HRP was added for an additional hour. The plate was washed five times and 100 μl TMB base was added for about 15 minutes, followed by the addition of 100 μl of 0.5 H ₂ SO ₄ to stop the reaction. The optical density of the plates was measured at 450 nm in an ELISA reader.

9.8 Y1 Reactivity with Recombinant Glycocalicin (GC) Expressed in the E. coli System

DNA fragments encoding the N-terminal soluble portion of human platelet GP1b-glycocalicin (GC, amino acids 1 to 493) were cloned into an IPTG inducible prokaryotic vector catheter. E. coli (BL21 DE3) cells with freshly constructed plasmids were grown so that O.D. was 0.7-0.8 at 37 ° C. than in the presence of IPTG for 3 hours induction at 37 ° C. SDS-polyacrylamide gels loaded with lysate (total protein content) of E. coli cells from natural semi-purified human platelets or from cells derived or not induced were analyzed. N-terminus of scFv Y1-biotinylated, polyclonal rabbit anti-human GC antibody, commercial mouse anti human CD42 monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HIP1 Pharmigen, AN51 DAKO) and gpIba (Sc-7071, Santa Cruz) Western blot analysis was performed with polyclonal antibodies against. The two polyclonal antibodies recognized both GCs from recombinant bacteria as well as GCs from natural human platelets. scFv Y1 and commercial antibodies only recognized GCs derived from natural humans, but did not recognize recombinant platelet GCs derived from bacteria.

Post-translational modifications such as glycosylation and sulfateization are essential for commercial antibodies that bind scFv and GC. Prokaryotic (E. coli) systems lack post-translational modification mechanisms such as glycosylation and sulfation.

9.9 Tetra of Y1 Preparation

The construct was designed in which the sequence LNDIFEAQKIEWHE was added to the C-terminus of Y1 by PCR and cloned into the IPTG inducible expression system. The clones were referred to as Y1-biotags. This sequence is the substrate for the enzyme BirA, which can covalently link biotin to lysine (K) residues in the presence of free biotin [Phenotypic analysis of antigen-specific T lymphocytes. Science. 1996 Oct 4; 274 (5284): 94-6, Altman JD et al. The constructs were generated as inclusion bodies in BL21 bacteria cells. Refolding was performed as described above. Inclusion bodies were dissolved in guanidine-DTE. Refolding was done by dilution in buffer containing arginine-tris-EDTA. Water, which was subjected to dialysis and concentration, was subjected to HiTrapQ ion exchange purification.

Purified Y1-biotag scFv was incubated with BirA enzyme (purchased from Avidity) and biotin recommended by the provider. Biotinylated Y1-biotag was analyzed by HAVA test (measured amount of biotin per molecule), indicating that there were about> 0.8 biotin residues / molecules.

Biotinylated Y-1 biotag was incubated with streptavidin-PE (phycoerythrin) to form a complex and used for FACS experiments using KG-1 cells (positive for Y1). Streptavidin can bind up to four biotinylated Y-1-biotag molecules. The sensitivity of binding increased at least 100-fold due to the increase in avidity.

The Y1-biotag sequence is as follows:

Example 10

Construction of full sized Y1-IgGI

Total IgG molecules induce cellular responses in vivo as mediated by longer lifespan in vivo and by ADCC or CDC (complement dependent cytotoxicity; Tomlinson, Current Opinions of Immunology, 5, 83-89 (1993)). It has a number of advantages over the Fv form, including the potential for it. By the molecular cloning approach described below, we converted the Y1 Fv region to full size IgGI molecules. Y1-IgG1 constructs were performed by linking cDNA fragments to each other in the order shown.

10.1 Leader Sequences Compatible with Mammalian Expression Systems: Exchangeable acid systems were designed to allow convenient insertion of the necessary elerAent for the entire IgG molecule. The following complementary double stranded oligonucleotides encoding putative leader sequences were synthesized, annealed and sutured to the XhoI position of the mammalian expression vector (SRα5 promoter).

5'-TCGACCTCATCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGACACAGGGTCCTGG GCCGAT and 5'-GATCGATTGCACCAGCTGGATATCGGCCCAGGACCCTGTGTCCTGAGTGAGGAGGGTGAGGAGCAGCAGCCCAGGCCATGGTGATGAGG. Two Kozak elements upstream of the starting ATG codon were included. In addition, an internal EcoRV position was introduced between the presumed cleavage position and the XhoI position of the leader sequence to allow for subcloning of various regions. This modified vector was called pBJ-3.

10.2 A V _L coding sequence derived from the Y1 scFv cDNA sequence was inserted between the leader sequence and the light chain region coding sequence at all times. Similarly, a V _H coding sequence derived from the Y1 scFv cDNA sequence was inserted between the leader sequence and the heavy chain region coding sequence at all times. This was done by PCR amplification of the vector pHEN-Y1 encoding the original Y1 to obtain the V _L and V _H regions separately.

10.3 Oligonucleotides

5'-TTTGATATCCAGCTGGTGGAGTCTGGGGGA (sense) and 5'-GCTGACCTAGGACGGTCAGCTTGGT (antisense) were used for the V _L PCR reaction. CDNA products of expected size of ˜350 bp were purified, sequenced and digested with EcoRV and AvrII restriction enzymes. The same procedure was used to amplify and purify the VH cDNA region using the following sense and antisense oligonucleotides: 5'-GGGATATCCAGCTG (C / G) (A / T) GGAGTCGGGC and 5'-GGACTCGAGACGGTGACCAGGGTACCTTG, respectively.

10.4 Always region: The always heavy chain region CH1-CH3 derived for the always λ3 (CL-λ3) region and IgG1 cDNA was synthesized as follows:

10.4.1 For the CL-λ3 region always, RT-PCR was performed on mRNA extracted from normal peripheral B-cells (CD 19+ cells) with sense 5'-CCGTCCTAGGTCAGCCCAAGGCTGC and antisense 5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT oligonucleotides. PCR products of expected size (˜400 bp) were purified, sequenced and digested with AvrII and NotI restriction enzymes.

10.4.2 For the IgGI region (γ chain) always, human B cell clones immobilized in BTG (CMV-clone # 40) were selected for PCR amplification. This clone has been shown to secrete IgG1 against human CMV and also to induce ADCC responses in in vitro assays. For CH1-CH3 cDNA, oligonucleotides 5'-CCGCTCGAGTGC (T / C) TCCACCAAGGGCCCATC (G / C) GTCTTC (sense) and 5'-TTTGCGGCCGCTCATTTACCC (A / G) GA GACAGGGAGAGGCT (antisense) are synthesized and PCR amplification It was used for. As described for the CL cDNA coding sequence, PCR products of expected size (˜1500 bp) were purified, sequenced and digested with AvrII and NotI restriction enzymes.

10.5 For the final expression vector, the triple closure process was performed using the EcoRV-NotI predigested vector, EcoRV-AvrII variable cDNA and AvrII-NotI always region. The final vectors for heavy and light chain expression were named Y-I-HC and Y1-LC, respectively.

10.6 An additional vector, pBJ-Y1-LP, was constructed based on Y1-LC to allow double selection based on the puromycin resistance gene (PAC). For this vector, the neomycin resistance gene of the Y1-LC plasmid was replaced with a fragment of ˜1600 bp encoding the PAC gene (obtained from the pMCC-ZP vector).

10.7 The open reading frame (ORF) of both Y-1-IgG-HC and Y1-IgG-LC and their encoded amino acid sequences are as shown below:

10.7.1 ORF of Y1-IgG-HC (V _H C _{H 1} C _{H 2} C _H 3)

10.7.2 ORF of Y1-IgG-LC (V _L C _L )

Leader sequences are underlined. The VH and VL regions are encoded by amino acids in bold, respectively, followed by the IgG1 (heavy chain) or λ3 (light chain) always sequence region.

10.8 Expression of Y1 Heavy and Light Chains in CHO Cells

Vectors Y1-HC and Y1-LC were used separately for transfection and selection of stable cells expressing heavy or light chains. After selection and cell growth in G418, the secreted proteins were analyzed for IgGI expression by capture EIA analysis and by Western blot analysis as described below.

10.8.1 Capture EIA Assay: Wells of 96 well plates Mouse pre-coated with anti-human IgGI Fc (Sigma). The supernatant obtained above was added to the wells and the presence of heavy chain IgGI was detected with biotinylated goat anti-γ chain specific antibody (Sigma), streptavidin-HRP and substrate. ELISA plate reader monitored the development of color at A ₄₀₅ .

10.8.2 Western Blot Analysis: Supernatants for these cells were transferred in 12.5% SDS-PAGE. Expression of each chain was determined by (a) goat anti-human IgG-HRP (H + L; Sigma Cat # A8667) for heavy chain detection and (b) biotinylated goat anti-human λ3 chain for light chain detection (Southern Biotechnology Association). , Cat # 2070-08).

Expression of both chains was confirmed by the above analysis, and co-transfection was performed to obtain full size Y1-IgG1.

10.9 Expression and Purification of Y1-IgG

10.9.1 Cell Culture and Transfection: CHO cells were cultured at 37 ° C. under 5% CO ₂ atmosphere with 10% female calf serum and 40 μl / mi gentamicin in F-12 medium. 0.8 × 10 6 cells were sprinkled onto a 90 mm dish one day before transfection. Cultures were co-infected with 10 μg of light and heavy chain DNA by FuGene (Roche) transfection reagent technique. After 2 days of growth in non-selective medium, cells were incubated for 10-12 days in F-12 medium containing 550 μg / ml neomycin and 3 μg / ml puromycin. The cells were trypsinized and cloned by limiting the dilution of 0.5 cells / well in Costar 96-well plates. Individual colonies were separated and grown in 6 well dishes and transferred to flasks.

10.9.2 Determination of Heavy and Light Chain Secretion: The concentration of antibody secreted into the supernatant of transfected CHO cells was measured using a sandwich ELISA assay. To determine the concentration of the antibody, the following reagents were used: monoclonal anti human IgG1 (Fc) (Sigma) as the coated antibody, goat anti-human IgG (γ-chain specific) biotin conjugate, as a detection agent, And pure human IgG1, lambda (Sigma) as standard. Based on the ELISA assay, the production rate was changed to 3-4 μg / ml.

10.9.3 Generation and Purification of MAbs from Cells: Cells were grown in roller bottles with neomycin and puromycin supplemented with 10% female calf serum in F-12 medium to give a final concentration of 1-2x10 ⁸ cells per bottle. . For production, the cells were cultured in the same medium, but with 2% female calf serum for 2 more days. Secreted antibodies were purified on protein G-Sepharose column (Pharmacia). Binding was done in 20 mM sodium phosphate buffer, pH 7.0 and elution was performed in 0.1 M glycine buffer, pH 2.8-3-0. The amount of purified antibody was measured by UV absorbance and purity was analyzed by SDS-PAGE. A complete IgG antibody under undenatured conditions has a predicted molecular weight of 160 kD. In the modified gels, both the heavy and light chains are 55 and 28 kD in predictive molecular weight, respectively.

10.9.4 Binding of Full-Size Y1-IgG Molecules: A binding experiment was performed to determine the binding level of Y1-IgG molecules compared to the binding level of scFv-Y1 molecules. A two step staining procedure was used where 5 ng of Y1-IgG was reacted with both RAJI cells (negative control, FIG. 7A) and Jurkat cells (Y1 positive cells, FIG. 7B). For detection, PE-labeled goat anti-human IgG was used. Similarly, 1 μg scFv-Y1 was reacted with Jurkat cells (FIG. 7C) and PE-labeled rabbit anti-scFv was used for detection. The results indicate that both Y1-IgG and scFv-Y1 bind to Jurkat cells, and about 10 ³ fold more scFv-Y1 molecules are needed to obtain detection levels similar to those of Y1-IgG.

Short description of the table

Table 1: Panning results derived from protocol AM. The measured number of phagemids used for panning (injection) and the measured number (calculated) of eluted bound phagemids are summarized for four successive steps of the AM biopanning protocol. The term used to distinguish each separate stock solution as well as the cell source and elution medium for each result are described.

Table 2: Selected clones after AM biopanning protocol. The number of amino acid residues in the CDR3 region (VH-CDR3 size) and the CDR3 amino acid sequences for the different clone types isolated are summarized. In addition, the frequency of each clone type is shown in two AM biopanning calculations, namely T16M3 and T16M3.1.

Table 3: Panning Results Derived from YPR Protocol. The measured number (injection) of phagemid used for panning and the measured number (calculation) of bound phagemid eluted are summarized. The terms used to distinguish each separate stock solution as well as the elution medium for each result are described.

Table 4: Panning results derived from YPNR protocol. The measured number of phagemids used for panning (injection) and the measured number (calculated) of eluted bound phagemids are summarized for three successive steps of the YPNR biopanning protocol. The terms used to distinguish each separate stock solution as well as the elution medium for each result are described.

Table 5: Y-series clones selected after YPR biopanning protocol with R3 yield. Several different clones were identified in the R3 yield stock. The number of amino acid residues comprising the V _H -CDR3 region of the identified clones and their amino acid sequences as well as the germline names are described in detail.

Table 6: Binding Specificity of Y1 to Leukemia Cells. As measured by FACS analysis, the results of binding experiments of three different scFv clones, each of which reacts with a mixture of cells, each containing primarily one of seven different leukemia cell types, are shown. The results represent a portion of patients with cells identified by FACS analysis upon positive reaction with each tested antibody. The molecule represents the number of positive patients and the denominator represents the total number of patients tested for a given combination of scFv / leukemia cell types.

Table 7: FACS analysis of binding of scFv to Ficoll purified normal blood cells. Three scFv clones were analyzed for binding to five different Picol purified normal hemoblast cell types, respectively. These binding results represent portions of normal blood samples identified by FACS upon positive reaction with each tested antibody.

Table 8: Comparison of Y1 scFv binding and antibody binding to various cellular markers. The results of FACS analysis of staining by Y1 and by a panel of other antibodies are shown. Picol purified peripheral and bone marrow cells from ANE patients were prepared and studied the binding specificity of Y1 scFv compared to various cellular markers on AML cells. The results are expressed as the percentage of cells in the Picol purified sample of a given patient, identified by FACS analysis upon positive reaction with each Fv. Four different antibodies were run for comparison: (1) markers for CD13-granulocytes and monocytes; (2) markers for CD14-monocytes and neutrophils; (3) markers for CD33-normal bone marrow cells and leukemia bone marrow cells; And (4) markers for CD34-hepatocytes.

Table 9: Binding of Y1 to Hematopoietic Cell Lines. FACS analysis was performed to determine binding of Y1 scFv to three different categories of human leukemia cell lines and to one rat cell line. Cell lines in which Y1 binds positively (reactive) or cell lines that are not (reactive) are described.

TABLE 10 CDR3 sequences of V _H 3-DP32 isolated clones. After different biopanning and selection procedures, several clones based on DP32 wiring were isolated. Clones Y1, Y17, Y-27 and Y-44 were identified during biopanning selection on platelets (YPR and YPNR protocols). The sequence of the V _H -CDR3 region of each of these clones is shown.

Table 11: Binding profiles of V _H 3-DP32 isolated clones. The binding specificity of some hematopoietic cells of clones from DP32 was tested by FACS analysis.

The present invention has been described with reference to specific examples, materials and data. Those skilled in the art will appreciate that alternative means for using or manufacturing the various aspects of the present invention may be used. Such alternative means should be construed as being included within the scope and spirit of the invention as defined by the following claims.

Claims (259)

A peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of any of these, or a construct of a fragment having enhanced binding properties to selectively and / or specifically bind to a target cell for another cell, Wherein said binding selectivity or specificity is determined primarily by a first hypervariable region, said Fv being scFv or dsFv, optionally having one or more tags. The peptide or polypeptide of claim 1, wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24. The method of claim 1, wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24, wherein the binding selectivity or specificity is selected by the second hypervariable portion, A peptide or polypeptide that is secondarily affected by and / or by one or more upstream or downstream regions flanked by the first, second and / or third hypervariables. The peptide or polypeptide of claim 2, wherein the peptide or polypeptide is an scFv having SEQ ID 25, wherein the first hypervariable portion is the same CDR3 region as SEQ ID NO: 8. 4. The peptide or polypeptide of claim 1, wherein the scFv molecule comprises a straight or branched chain spacer of up to 20 amino acid residues. The peptide or polypeptide of claim 5, wherein the spacer comprises SEQ ID NO: 123 or SEQ ID NO: 124. 7. The peptide or polypeptide of claim 1, wherein the target cell is an activated, excited, modified, altered, disordered, abnormal or diseased cell. The peptide or polypeptide of claim 7 wherein the diseased cell is a cancer cell. The peptide or polypeptide of claim 7 wherein the cells are selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastomas, normal carcinomas and melanoma cells. The peptide or polypeptide of claim 9, wherein the cell is a leukemia or myeloma cell. The peptide or polypeptide of claim 9, wherein the leukemia or myeloma cell is a B-cell malignant tumor. The peptide or polypeptide of claim 10, wherein the leukemia cells are acute myeloid leukemia cells or B-cell malignancies. The cassette of claim 2, further comprising a cassette of conservative amino acids or fragments thereof having an amino acid sequence selected from the group consisting of SEQ ID NOs: 30-113, or having at least 90% amino acid similarity thereto. Or a fragment that provides a framework in which a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24 is established, inserted, attached, coupled, combined, or fused Polypeptide. The method of claim 13, wherein the cassette is SEQ ID NO: 30-32, 33, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87 Or a peptide or polypeptide selected from the group consisting of 89-92, 94, 97, 99, 103, 106, 112 and 113, or having an amino acid sequence having at least 90% amino acid similarity with it. The peptide or polypeptide of claim 13, wherein the cassette has an amino acid sequence of SEQ ID NO: 61 or has at least 90% amino acid similarity with it. The peptide or polypeptide of claim 15, wherein the cassette has an amino acid sequence of SEQ ID NO: 61 or has at least 90% amino acid similarity with it. The peptide or polypeptide of claim 15, wherein the seven carboxy-terminal amino acid residues of SEQ ID NO: 61 are replaced by the seven amino acid residues of SEQ ID NO: 122. 16. The peptide or polypeptide of claim 3, wherein the second and third hypervariables are CDR2 and CDR1 hypervariables, respectively. The peptide or polypeptide of claim 2, wherein the CDR3 region has the amino acid sequence of SEQ ID NO: 8. 4. The peptide or polypeptide of claim 18, wherein the CDR2 and CDR1 regions have the amino acid sequences of SEQ ID NO: 115 and SEQ ID NO: 114, respectively. The peptide or polypeptide of claim 3, wherein the second and third hypervariable parts are CDR2 and CDR1 hypervariable parts, respectively, and the CDR3, CDR2 and CDR1 regions have amino acid sequences of SEQ ID NOs: 8, 115 and 114, respectively. The peptide or polypeptide of claim 3, wherein the upstream region flanking the CDR3 region has an amino acid sequence of SEQ ID NO: 117, and the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 116. 4. The amino acid sequence of claim 3, wherein the second hypervariable portion is a CDR2 hypervariable region, the upstream region flanking the CDR2 region has an amino acid sequence of SEQ ID NO: 119, and the downstream region flanking the CDR2 region comprises the amino acid sequence of SEQ ID NO: 118. 5. A peptide or polypeptide. The region of claim 3, wherein the third hypervariable portion is a CDR1 hypervariable region, the upstream region flanked by the CDR1 region has an amino acid sequence of SEQ ID NO: 121, and the downstream region flanked by the CDR1 region comprises the amino acid sequence of SEQ ID NO: 120. 5. A peptide or polypeptide. The peptide or polypeptide of claim 18, wherein the CDR2 and CDR1 regions of the cassette of conservative amino acids or fragments thereof selected from the group consisting of SEQ ID NOs: 30-113 are replaced by SEQ ID NOs: 115 and 114, respectively. The method of claim 18, SEQ ID NOs: 30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89- The CDR2 and CDR1 regions of a cassette of conservative amino acids or fragments thereof selected from the group consisting of 92, 94, 97, 99, 103, 106, 112 and 113 are replaced by SEQ ID NOs: 115 and 114, respectively Polypeptide. The method of claim 3, (a) the second and third hypervariable parts are CDR2 and CDR1 hypervariable parts, respectively (b) the CDR3 amino acid sequence is SEQ ID NO: 8, (c) the CDR2 amino acid sequence is SEQ ID NO: 115, (d) the CDR1 amino acid sequence is SEQ ID NO: 114, (e) the upstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 117; (f) the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 116, (g) the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 119, (h) the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 118, (i) the upstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 121, and (j) The peptide or polypeptide wherein the downstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 120. The peptide or polypeptide of claim 1, wherein the Fv is an scFv obtainable from a phage display library. The peptide or polypeptide of claim 28, wherein the phage display library is constructed from peripheral blood lymphocytes of non-immunized human, and the scFv peptide is selected against an antigen on the surface of a target cell that has not been characterized beforehand and not purified. The peptide of claim 28 comprising biopanning comprising binding a phage to a target, removing unbound phage, eluting binding phage, and propagating and amplifying the eluted phage; or A method of selecting or identifying a polypeptide. Of Fv molecules, constructs thereof, fragments or fragments of any of them having enhanced binding properties to selectively and / or specifically bind to binding sites that are substantially exposed and / or overexpressed on or in target cells A peptide or polypeptide comprising a construct, wherein the binding to the target cell occurs for another cell in which the binding site is not substantially available and / or expressed on or in the cell, and the binding selectivity or specificity is predominantly The peptide or polypeptide as determined by the first hypervariable portion, wherein Fv is scFv or dsFv and FV optionally has one or more tags. The peptide or polypeptide of claim 31, wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24. 32. The method according to claim 31, wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24, wherein the binding selectivity or specificity is defined by a second hypervariable portion, By and / or by one or more upstream or downstream regions flanked by the first, second and / or third hypervariable regions, wherein the second and third hypervariable regions are CDR2 and CDR1 regions, respectively. A peptide or polypeptide. A peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment of any of these, a construct of a fragment having improved binding properties to selectively and / or specifically bind to a target cell for another cell, wherein The Fv molecule comprises a first chain having first, second and third hypervariables and a second chain having first, second and third hypervariables, one of the hypervariable portions of the first chain being a sequence Has a sequence selected from the group consisting of numbers 8-24, one of the hypervariable parts of the second chain has a sequence selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, wherein the first and second And the third hypervariable portion is the CDR3, CDR2 and CDR1 regions, respectively, and the Fv is scFv or dsFv, and the Fv optionally has one or more tags. The method of claim 34, wherein (a) the first chain and the second chain each comprise a first hypervariable portion selected from the group consisting of SEQ ID NOs: 8-24, or (b) the first hypervariable part of the first chain and the first hypervariable part of the second chain are the same and are selected from the group consisting of SEQ ID NOs: 8-24, or (c) the first hypervariable part of the first chain is selected from the group consisting of SEQ ID NOs: 8-24, and the first hypervariable part of the second chain is selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, or (d) the first hypervariable part of the first chain is selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, and the first hypervariable part of the second chain is selected from the group consisting of SEQ ID NOs: 8-24 Peptide or polypeptide. The peptide or polypeptide of claim 34, wherein the second and third hypervariable portions of the first chain are SEQ ID NOs: 114 and 115, respectively. (a) binds to an unknown ligand on a first cell having a first and a second state, wherein the binding is effective in the second state but substantially ineffective in the first state, (b) by means of immuno-cross-reactivity, Fv molecules, constructs thereof, fragments or constructs of any of them, that specifically or selectively bind to ligands on a second cell; A peptide or polypeptide comprising: Fv is a scFv or dsFv and Fv optionally has one or more tags. The peptide or polypeptide of claim 37, wherein the first cell is a normal cell. The peptide or polypeptide of claim 37, wherein the first state is an inactivated state and the second state is an activated, excited, modified, altered or impaired state. The peptide or polypeptide of claim 37, wherein the second cell is a diseased cell. The peptide or polypeptide of claim 40 wherein the diseased cell is a cancer cell. 41. The peptide or polypeptide of claim 40 wherein the diseased cell is selected from the group consisting of carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma cells. The peptide or polypeptide of claim 42, wherein the diseased cell is a leukemia cell. The peptide or polypeptide of claim 43, wherein the leukemia cells are acute myeloid leukemia cells. The peptide or polypeptide of claim 37, wherein the selective and / or specific binding of the peptide or polypeptide to the ligand of the second cell is determined primarily by the first hypervariable portion. 46. The peptide or polypeptide of claim 45, wherein said first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24. The method of claim 46, wherein the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24, wherein the binding selectivity or specificity is selected by the second hypervariable portion, And / or is secondarily affected by one or more upstream or downstream regions flanked by the first, second and third hypervariables, respectively. A ligand expressed by a second cell and capable of binding by the peptide or polypeptide of claim 37. A molecule that recognizes and binds to the ligand of claim 48. A nucleic acid molecule encoding a peptide or polypeptide according to any one of claims 1, 31, 34 and 37. 51. The nucleic acid molecule of claim 50, wherein said nucleic acid is DNA. The peptide or polypeptide of claim 37, wherein the first state and the second state of the first cell are the same and the first cell is derived from one cell line. The cell line of claim 52, wherein the cell line is selected from the group consisting of Jurkat, Molt-4, HS-602, U937, TF-1, THP-1, KG-1, ML-2, and HUT-78. Peptide or polypeptide. (a) at least one biopanning is performed on a first target cell that is in a second state other than the first state and that substantially exposes or displays a binding site comprising one or more unknown ligands. Creating a group; (b) performing on a second cell displaying a binding site comprising at least one unknown ligand having immune cross-reactivity to the unknown ligand of the first cell to produce a second group of recognition molecules, and (a) Performing a subsequent biopanning and / or selection step beginning with the first group of recognition molecules of; (c) amplifying and purifying the second group of recognition molecules of step (b); And (d) constructing a peptide or polypeptide comprising a targeting molecule that is selective and / or specific for an unknown ligand on a second cell from the recognition site of the purified recognition molecule of step (c) A method of identifying a targeting molecule that binds to an unknown immune cross-reactive binding site on a first cell and a second cell comprising a. 55. The method of claim 54, wherein the first cell is a normal cell, the first state is an inactivated state, and the second state is an activated, excited, modified, altered or impaired state. 55. The method of claim 54, wherein said second cell is a diseased cell. The method of claim 56, wherein the diseased cell is a cancer cell. The method of claim 56, wherein the cells are selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastoma, normal somatoma and melanoma cells. The method of claim 58, wherein the cells are leukemia cells. 60. The method of claim 59, wherein said leukemia cells are acute myeloid leukemia cells. Use of a peptide or polypeptide according to claim 1 or 37 which is optionally associated, attached, coupled, combined, combined or fused to a pharmaceutical formulation in the manufacture of a medicament. 62. The use of claim 61, wherein the medicament is active against diseased cells. 63. The use of claim 62, wherein the diseased cell is a cancer cell. 63. The use according to claim 62, wherein said cells are selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastoma, normal somatoma and melanoma. The use of claim 64, wherein the cell is a leukemia cell. 66. The use of claim 65, wherein the leukemia cells are acute myeloid leukemia cells. The peptide or polypeptide according to claim 1 or 37, optionally associated, attached, coupled, combined, linked or fused to a pharmaceutical formulation for use as a medicament. The peptide or polypeptide of claim 67, wherein the medicament is active against diseased cells. The peptide or polypeptide of claim 68, wherein the diseased cell is a cancer cell. The peptide or polypeptide of claim 68, wherein the cell is selected from the group consisting of carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma cells. The peptide or polypeptide of claim 70, wherein the cell is a leukemia cell. The peptide or polypeptide of claim 71, wherein the leukemia cells are acute myeloid leukemia cells. Use of a peptide or polypeptide according to claim 1 or 37 for producing a composition for inhibiting growth of diseased cells or cancer cells. The use of claim 73, wherein the cell is a leukemia cell. The use of claim 74, wherein the leukemia cells are acute myeloid leukemia cells. Use of a peptide or polypeptide according to claim 1 or 37 for the manufacture of a composition for inhibiting cancer cell growth comprising at least one compound having a pharmaceutical ligand selective and / or specific for cancer cells. A composition comprising one or more peptides according to claim 1 or 37, and optionally a pharmaceutically effective carrier, which are associated, attached, coupled, combined, combined or fused to the pharmaceutical formulation in a pharmaceutically effective amount. 78. The composition of claim 77, wherein said peptide or polypeptide and pharmaceutical agent are bound via a linker compound. 79. The composition of claim 78, wherein said linker compound is selected from the group consisting of dicarboxylic acid, maleimido hydrazide, PDPH, carboxylic acid hydrazide and small peptides. The small peptide of claim 79, wherein the small peptide is AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S.Tag®, T7 , V5, VSV-G and KAK-Tag. 38. The tag of any of claims 1, 31, 34 and 37, wherein the tag is AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS. Or a peptide or polypeptide selected from the group consisting of, KT3, Protein C, S.Tag®, T7, V5, VSV-G, and KAK-Tag. The composition of claim 77, wherein the pharmaceutical agent is selected from the group consisting of radioisotopes, toxins, oligonucleotides, recombinant proteins, antibody fragments, and anticancer agents. The radioactive isotope of claim 82, wherein the radioisotope is indium, ¹¹¹ indium, ¹¹³ indium, ^99m rhenium, ¹⁰⁵ rhenium, ¹⁰¹ rhenium, ^99m technetium, ^121m tellurium, ^122m tellurium, ^125m tellurium, ¹⁶⁵ thulium, ¹⁶⁷ thulium, ¹⁶⁸ thulium, ¹²³ Iodine, ¹²⁶ Iodine, ¹³¹ Iodine, ¹³³ Iodine, ^81m Krypton, ³³ Xenon, ⁹⁰ Yttrium, ²¹³ Bismuth, ⁷⁷ Bromine, ¹⁸ Fluorine, ⁹⁵ Ruthenium, ⁹⁷ Ruthenium, ¹⁰³ Ruthenium, ¹⁰⁵ Ruthenium, ¹⁰⁷ Mercury, ²⁰³ Mercury, ⁶⁷ Gallium and ⁶⁸ gallium is selected from the group consisting of. 83. The composition of claim 82, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, diphtheria toxin, lysine and variants and derivatives thereof. 85. The method of claim 82, wherein the anticancer agent is doxorubicin, morpholino-doxorubicin (MDOX), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cyta. Cytarabine (Ara-C), cyclophosphazdde, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil , Interferon alpha, hydroxyurea, temozolomide, thalidomide, bleomycin, and derivatives thereof. A method of inhibiting growth of a cell comprising contacting a cell with a predetermined amount of the peptide or polypeptide according to claim 1. 87. The method of claim 86, wherein said cells are selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastoma, normal somatoma and melanoma. 88. The method of claim 87, wherein said cells are leukemia cells. 89. The method of claim 88, wherein said leukemia cells are acute myeloid leukemia cells. A pharmaceutical composition comprising at least one peptide of claim 1 or 37 attached, coupled, combined, bound or fused to an imaging agent for use in diagnostic positioning and imaging of a tumor. A method of treating a patient suffering from a disease or cancer comprising administering to a patient an effective amount of a peptide or polypeptide of claim 1 for treating the disease or cancer. 92. The method of claim 91, wherein the disease or cancer is selected from the group consisting of carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal somatoma and melanoma. 93. The method of claim 92, wherein the disease is leukemia. 94. The method of claim 93, wherein said leukemia is acute myeloid leukemia. The peptide or polypeptide of claim 1 or 37, wherein the Fv specifically or selectively binds to acute myeloid leukemia (AML) cells. 97. A ligand present on AML cells bound by the peptide or polypeptide of claim 95. 97. A peptide or polypeptide that binds to the ligand of claim 96. A diagnostic kit for in vivo analysis of therapeutic efficacy before, during or after treatment comprising the peptide or polypeptide of claim 1 attached, coupled, combined, bound or fused to an indicator marker molecule. 99. The kit of claim 98, wherein the indicator marker molecule is a fluorescent marker. 100. The kit of claim 99, wherein said fluorescent marker is selected from the group consisting of fluorescein, rhodamine, phycoerythrin and variants and conjugates thereof. 99. The kit of claim 98, wherein said kit is used for the diagnosis of a disease or cancer. 38. The peptide or polypeptide of claim 1 or 37, wherein the construct is an Ig polypeptide. The method of producing a peptide or polypeptide of claim 102, wherein the Ig polypeptide is expressed as a recombinant polypeptide and is produced in a eukaryotic cell system. 107. The method of claim 103, wherein the eukaryotic cell system is a mammalian cell system. 107. The peptide or polypeptide of claim 102, wherein said Ig polypeptide is an IgG polypeptide. 107. The peptide or polypeptide of claim 105, wherein the IgG polypeptide comprises CDR3, CDR2 and CDR1 regions having SEQ ID NOs: 8, 115, and 114, respectively. 107. The IgG polypeptide of claim 106, wherein the CDR3, CDR2 and CDR1 regions are of heavy chains. 107. The IgG polypeptide of claim 106, wherein the CDR3, CDR2 and CDR1 regions are of light chains. 107. The IgG polypeptide of claim 102, wherein the IgG has a heavy chain comprising SEQ ID NO: 26 and a light chain comprising SEQ ID NO: 27 or chains having at least 90% amino acid similarity with them. A method for producing a peptide or polypeptide according to claim 1 or 37 produced in a prokaryotic or eukaryotic cell system. 119. The method of claim 110, wherein the prokaryotic cell line comprises E. coli comprising an expression vector and the eukaryotic cell line is a mammalian cell line. 112. The method of claim 111, wherein the expression vector of the prokaryotic cell system comprises a promoter selected from the group consisting of osmB , deo, β-lac-U5, λP _L , SRα5 and CMV. A binding motif comprising the amino acid sequence of R ₁ -X Phe Pro-R ₂ , wherein each sequence of R ₁ and R ₂ comprises 0-15 amino acid residues and X is any of Arg, Gly or Lys Peptides or polypeptides comprising. 47. The method of any one of claims 2, 34 and 46, wherein the CDR3 is R ₁ -X Phe Pro-R ₂ , wherein each of R ₁ and R ₂ comprises 0-15 amino acid residues, X is any one of Arg, Gly or Lys. 38. The peptide or polypeptide of claim 1 or 37, wherein the peptide or polypeptide comprises one or more unnaturally occurring modifications. 116. The peptide or polypeptide of claim 115, wherein said non-naturally occurring modification increases the immunogenicity or stability of the peptide or polypeptide. 116. The method of claim 116, wherein the one or more modifications consist of peptoid modifications, semipeptoid modifications, cyclic peptide modifications, N-terminal modifications, C terminal modifications, peptide bond modifications, backbone modifications, and residue modifications. Peptide or polypeptide selected from the group. 68. The peptide or polypeptide of any one of claims 1, 31, 34, 37 and 67 for purging abnormal cells by purging autologous bone marrow in vitro. a) by a biopanning process directly in the target cell to produce one or more targeting molecules or indirectly by a biopanning process in a first target cell in a second state other than the first state and then directly in the second target cell. Isolating and selecting one or more targeting molecules comprising a first recognition site by a biopanning process; b) amplifying, purifying and identifying one or more targeting molecules; And c) constructing a targeting agent from one or more targeting molecules, wherein the targeting agent may be a peptide, polypeptide, antibody or antibody fragment or multiplex thereof Method of producing a targeting agent comprising a. 119. The method of claim 119, wherein the targeting agent is coupled, attached, combined, bound, fused, or associated with the pharmaceutical agent. 121. The method of claim 119 or 120, wherein the targeting agent is an anti-disease or anticancer agent. 121. The method of claim 120, wherein the pharmaceutical agent is selected from the group consisting of radioisotopes, toxins, oligonucleotides, recombinant proteins, antibody fragments, and anticancer agents. 124. The method of claim 122, wherein the radioisotope is ¹¹¹ indium, ¹¹³ indium, ^99m rhenium, ¹⁰⁵ rhenium, ¹⁰¹ rhenium, ^99m technetium, ^121m tellurium, ^122m tellurium, ^125m tellurium, ¹⁶⁵ thulium, ¹⁶⁷ thulium, ¹⁶⁸ thulium, ¹²³ iodine, ¹²⁶ iodine, ¹³¹ iodine, ¹³³ iodine, ^81m krypton, ³³ xenon, ⁹⁰ yttrium, ²¹³ bismuth, ⁷⁷ bromine, ¹⁸ fluorine, ⁹⁵ ruthenium, ⁹⁷ ruthenium, ¹⁰³ ruthenium, ¹⁰⁵ ruthenium, ¹⁰⁷ mercury, ²⁰³ mercury, ⁶⁷ gallium and ⁶⁸ gallium The method is selected from the group consisting of. 123. The method of claim 122, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, diphtheria, lysine and variants and derivatives thereof. 124. The method of claim 122, wherein the anticancer agent is vincristine, cytarabine, (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, Temozolomide, thalidomide, bleomycin and derivatives thereof. Peptides or polypeptides having the formula or structure A-X-B Wherein X is a hypervariable CDR3 region of 3 to 30 amino acids, A and B may each be an amino acid chain 1 to 1000 amino acids in length, where A is an amino terminus and B is a carboxy terminus. 126. The peptide of claim 126, wherein A is 150-250 amino acid residues and B is 350-500 amino acid residues. 126. The peptide of claim 126, wherein the CDR3 region is 5-13 amino acid residues. 126. The peptide or polypeptide of claim 126, wherein X is an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24. 127. The peptide or polypeptide of claim 127, which is part of a larger or complete antibody or multiplex. A dimeric molecule comprising two peptides or polypeptides, one of which is the peptide or polypeptide of claim 126. 126. A dimer molecule comprising the same two peptides or polypeptides of claim 126. 136. The dimer molecule of claim 131 or 132, wherein X is an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-24. 130. A nucleic acid molecule encoding the peptide or polypeptide of claim 126 or the dimer molecule of claim 130. 107. The method of claim 104, wherein the mammalian cell line comprises the SRα5 promoter. 105. The method of claim 104, wherein the mammalian cell line comprises a CMV promoter. Peptides or polypeptides substantially as described above. A peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment or construct of any of these, having improved binding properties to selectively and / or specifically bind to a target cell for another cell, wherein Binding selectivity or specificity is determined primarily by the first hypervariable portion, wherein the first hypervariable portion is a CDR3 region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 8 or 20, wherein the Fv is scFv or dsFv, optionally Peptide or polypeptide having one or more tags. 138. The method of claim 138, wherein the binding selectivity or specificity is one or more upstream flanked by the second hypervariable portion, by the third hypervariable portion, and / or the first, second and / or third hypervariable portion. Or a peptide or polypeptide secondaryly affected by a downstream region. 138. The peptide or polypeptide of claim 138, wherein the peptide or polypeptide is an scFv having SEQ ID NO: 25, wherein the first hypervariable portion is the same CDR3 region as SEQ ID NO: 8. 138. The peptide or polypeptide of claim 138, wherein the peptide or polypeptide is an scFv having SEQ ID NO: 203, wherein the first hypervariable portion is the CDR3 region identical to SEQ ID NO: 20. 138. The peptide or polypeptide of claim 138, wherein the scFv molecule comprises a straight or branched chain spacer of up to 20 amino acid residues. 142. The peptide or polypeptide of claim 142, wherein the spacer comprises SEQ ID NO: 123 or SEQ ID NO: 124. 138. The peptide or polypeptide of claim 138, wherein the target cell is a cell that is activated, excited, modified, altered, impaired, abnormal, or diseased. 145. The peptide or polypeptide of claim 144, wherein the diseased cell is a cancer cell. 145. The peptide or polypeptide of claim 144, wherein the cell is selected from the group consisting of carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma cells. 146. The peptide or polypeptide of claim 146, wherein the cell is a leukemia or myeloma cell. 146. The peptide or polypeptide of claim 146, wherein the leukemia or myeloma cell is a B-cell malignant tumor. 147. The peptide or polypeptide of claim 147, wherein the leukemia cells are acute myeloid leukemia cells or B-cell malignancies. 138. The method of claim 138, further comprising a cassette or fragment thereof of conservative amino acids having an amino acid sequence selected from the group consisting of SEQ ID NOs: 30-113, or having at least 90% amino acid similarity with them, wherein the cassette or The fragment is a peptide or polypeptide wherein the fragment is a framework in which a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8 or 20 is established, inserted, attached to, coupled, combined or fused to. 151. The cassette of claim 150, wherein the cassette is SEQ ID NOs: 30-32, 33, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87 Or a peptide or polypeptide having an amino acid sequence selected from the group consisting of 89-92, 94, 97, 99, 103, 106, 112 and 113, or at least 90% amino acid similarity thereto. 151. The peptide or polypeptide of claim 150, wherein the cassette has an amino acid sequence of SEQ ID NO: 61 or at least 90% amino acid similarity thereto. 152. The peptide or polypeptide of claim 152, wherein the cassette has an amino acid sequence of SEQ ID NO: 61 or at least 90% amino acid similarity thereto. 152. The peptide or polypeptide of claim 152, wherein the seven carboxy terminal amino acid residues of SEQ ID NO: 61 are replaced by the seven amino acid residues of SEQ ID NO: 122. 141. The peptide or polypeptide of claim 139, wherein the second and third hypervariables are CDR2 and CDR1 hypervariables, respectively. 138. The peptide or polypeptide of claim 138, wherein the CDR3 region has the amino acid sequence of SEQ ID NO: 8. 138. The peptide or polypeptide of claim 138, wherein the CDR3 region has the amino acid sequence of SEQ ID NO: 20. 155. The peptide or polypeptide of claim 155, wherein the CDR2 and CDR1 regions have the amino acid sequences of SEQ ID NO: 115 and SEQ ID NO: 114, respectively. 141. The peptide or polypeptide of claim 140, wherein the second and third hypervariables are CDR2 and CDR1 hypervariables, respectively, and the CDR3, CDR2 and CDR1 regions have amino acid sequences of SEQ ID NOs: 8, 115 and 114, respectively. 141. The peptide or polypeptide of claim 140, wherein said second and third hypervariable regions are CDR2 and CDR1 hypervariable regions, respectively, and said CDR3, CDR2 and CDR1 regions have amino acid sequences of SEQ ID NOs: 20, 115, and 114, respectively. . 141. The peptide or polypeptide of claim 139, wherein the upstream region flanking the CDR3 region has an amino acid sequence of SEQ ID NO: 117 and the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 116. 139. The region of claim 139, wherein the second hypervariable portion is a CDR2 hypervariable portion, wherein the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 119, and the downstream region flanking the CDR2 region is the amino acid of SEQ ID NO: 118. Peptide or polypeptide having a sequence. 141. The amino acid sequence of claim 139, wherein the third hypervariable portion is a CDR1 hypervariable region, the upstream region flanking the CDR1 region has an amino acid sequence of SEQ ID NO: 121, and the downstream region flanking the CDR1 region is the amino acid sequence of SEQ ID NO: 120. Peptide or polypeptide having. 155. The peptide or polypeptide of claim 155, wherein the CDR2 and CDR1 regions of the cassette of conservative amino acids or fragments thereof selected from the group consisting of SEQ ID NOs: 30-113 are replaced by SEQ ID NOs: 115 and 114, respectively. 162. The compound of claim 155, SEQ ID NOs: 30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89- CDR2 and CDR1 regions of a cassette of conservative amino acids or fragments thereof selected from the group consisting of 92, 94, 97, 99, 103, 106, 112 and 113 are replaced by SEQ ID NOs: 115 and 114, respectively . 140. The method of claim 139, wherein (a) the second and third hypervariable parts are CDR2 and CDR1 hypervariable parts, respectively (b) the CDR3 amino acid sequence is SEQ ID NO: 8, (c) the CDR2 amino acid sequence is SEQ ID NO: 115, (d) the CDR1 amino acid sequence is SEQ ID NO: 114, (e) the upstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 117, (f) the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 116, (g) the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 119, (h) the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 118, (i) the upstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 121; (j) The peptide or polypeptide wherein the downstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 120. 140. The method of claim 139, wherein (a) the second and third hypervariable parts are CDR2 and CDR1 hypervariable parts, respectively (b) the CDR3 amino acid sequence is SEQ ID NO: 20, (c) the CDR2 amino acid sequence is SEQ ID NO: 115, (d) the CDR1 amino acid sequence is SEQ ID NO: 114, (e) the upstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 117, (f) the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ID NO: 116, (g) the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 119, (h) the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ID NO: 118, (i) the upstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 121; (j) The peptide or polypeptide wherein the downstream region flanking the CDR1 region has the amino acid sequence of SEQ ID NO: 120. 138. The peptide or polypeptide of claim 138, wherein the Fv is an scFv available from phage display library. 167. The peptide or polypeptide of claim 165, wherein said phage display library was constructed from non-immunized human peripheral blood lymphocytes and the scFv peptide is selected for an antigen that is not pre-characterized and purified on the surface of the target cell. 166. The peptide or polypeptide of claim 165, comprising biopanning comprising binding a phage to a target, removing unbound phage, eluting bound phage, and propagating and amplifying the eluted phage. Or how to identify. Construction of Fv molecules, constructs thereof, fragments or fragments of any of them having enhanced binding properties to selectively and / or specifically bind to binding sites that are substantially exposed and / or overexpressed on or in target cells A peptide or polypeptide comprising an agent, wherein the binding to the target cell occurs for other cells in which the binding site is substantially unavailable and / or not expressed and / or in which the binding selectivity or specificity is predominantly The peptide or polypeptide as determined by the first hypervariable portion, wherein the first hypervariable portion is a CDR3 region consisting of SEQ ID NOs: 8 or 20, the Fv is an scFv or dsFv, and the FV optionally has one or more tags. 171. The method of claim 171, wherein said binding selectivity or specificity is at least one upstream or flanked by a second hypervariable portion, by a third hypervariable portion and / or by a first, second and / or third hypervariable portion, or A peptide or polypeptide that is secondarily affected by a downstream region, and wherein the second and third hypervariable portions are CDR2 and CDR1 regions, respectively. A peptide or polypeptide comprising a Fv molecule, a construct thereof, a fragment or construct of any of these, having binding properties enhanced to selectively and / or specifically bind to a target cell for another cell, the Fv molecule Comprises a first chain having first, second and third hypervariables and a second chain having first, second and third hypervariables, wherein one of the hypervariables of the first chain is SEQ ID NO: 8 or 20, wherein one of the hypervariable portions of the second chain has a sequence selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, wherein the first, second, and third hypervariable portions are each CDR3, A peptide or polypeptide wherein the CDR2 and CDR1 regions, Fv is scFv or dsFv, and FV optionally has one or more tags. 174. The method of claim 173, wherein (a) the first hypervariable part of the first chain and the first hypervariable part of the second chain are the same and are selected from the group consisting of SEQ ID NO: 8 or 20; or (b) the first hypervariable part of the first chain is selected from the group consisting of SEQ ID NOs: 8 or 20, and the first hypervariable part of the second chain is selected from the group consisting of SEQ ID NOs: 1-6 and 125-202; or (d) the first hypervariable part of the first chain is selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, and the first hypervariable part of the second chain is selected from the group consisting of SEQ ID NO: 8 or 20 Peptide or polypeptide. 174. The peptide or polypeptide of claim 173, wherein the second and third hypervariable portions of the first chain are SEQ ID NOs: 114 and 115, respectively. (a) binds to an unknown ligand on a first cell having a first and a second state, wherein the binding is effective in the second state but substantially ineffective in the first state, (b) a peptide or polypeptide comprising an Fv molecule, a construct thereof, a fragment or construct of any of these, that binds specifically or selectively to a ligand on a second cell by immune cross-reactivity, Wherein said Fv is an scFv or dsFv and the Fv optionally has one or more tags and the first hypervariable portion is a CDR3 region having an amino acid sequence selected from the group consisting of SEQ ID NOs: 8 or 20. 176. The peptide or polypeptide of claim 176, wherein said first cell is a normal cell. 176. The peptide or polypeptide of claim 176, wherein the first state is an inactivated state and the second state is an activated, excited, modified, altered or impaired state. 176. The peptide or polypeptide of claim 176, wherein said second cell is a diseased cell. 181. The peptide or polypeptide of claim 179, wherein the diseased cell is a cancer cell. 181. The peptide or polypeptide of claim 179, wherein the diseased cell is selected from the group consisting of carcinoma, sarcoma, leukemia, adenoma, lymphoma, myeloma, blastoma, normal carcinoma and melanoma cells. 181. The peptide or polypeptide of claim 181, wherein the diseased cell is a leukemia cell. 182. The peptide or polypeptide of claim 182, wherein the leukemia cells are acute myeloid leukemia cells. 176. The peptide or polypeptide of claim 176, wherein the selective and / or specific binding of the peptide or polypeptide to the ligand of the second cell is determined primarily by the first hypervariable portion. 176. The method of claim 176, wherein said binding selectivity or specificity is at least one upstream or downstream flanked by a second hypervariable portion, by a third hypervariable portion, and / or respectively in the first, second and third hypervariable portions. A peptide or polypeptide that is secondarily affected by a region. A ligand expressed by a second cell and capable of binding by the peptide or polypeptide of claim 176. The molecule which recognizes and binds the ligand of Claim 186. 181. A nucleic acid molecule encoding a peptide or polypeptide according to any one of claims 138, 171, 173, and 176. 186. The nucleic acid molecule of claim 188, wherein the nucleic acid is DNA. 176. The peptide or polypeptide of claim 176, wherein the first and second states of the first cell are the same and the first cell is derived from one cell line. 192. The peptide or polypeptide of claim 190, wherein said cell line is selected from the group consisting of Jurkat, Molt-4, HS-602, U937, TF-1, THP-1, KG-1, and HUT-78. 176. The use of the peptide or polypeptide of claim 138 or 176 optionally associated, attached, capped, combined, combined or fused to a pharmaceutical formulation in the manufacture of a medicament. 192. The use of claim 192, wherein the medicament is active against diseased cells. 199. The use of claim 193, wherein the diseased cell is a cancer cell. 199. The use of claim 193, wherein the cells are selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastoma, normal somatoma and melanoma. 199. The use of claim 195, wherein the cells are leukemia cells. 197. The use of claim 196, wherein said leukemia cells are acute myeloid leukemia cells. 176. The peptide or polypeptide of claim 139 or 176, optionally associated, attached, coupled, combined, linked or fused to a pharmaceutical formulation for use as a medicament. 199. The peptide or polypeptide of claim 198, wherein the medicament is active against diseased cells. 199. The peptide or polypeptide of claim 199, wherein the diseased cell is a cancer cell. 199. The peptide or polypeptide of claim 199, wherein said cell is selected from the group consisting of carcinoma, sarcoma, leukemia, adenomas, lymphomas, myeloma, blastoma, normal carcinoma and melanoma cells. 203. The peptide or polypeptide of claim 201, wherein said cell is a leukemia cell. 202. The peptide or polypeptide of claim 202, wherein said leukemia cells are acute myeloid leukemia cells. 141. Use of the peptide or polypeptide of claim 138 or 176 for the preparation of a composition for inhibiting growth of diseased cells. 204. The use of claim 204, wherein said cell is a leukemia cell. 205. The use of claim 205, wherein the leukemia cells are acute myeloid leukemia cells. Use of a peptide or polypeptide of claim 138 or 176 for the preparation of a composition for inhibiting growth of cancer cells comprising at least one compound having a pharmaceutical ligand selective and / or specific for cancer cells. 176. A composition comprising one or more peptides of claims 138 or 176 and optionally a pharmaceutically effective carrier associated, attached, coupled, combined, bound or fused to a pharmaceutically effective amount of a pharmaceutical formulation. 208. The composition of claim 208, wherein the peptide or polypeptide and pharmaceutical agent are linked via a linker compound. 209. The composition of claim 209, wherein the linker compound is selected from the group consisting of dicarboxylic acid, maleimido hydrazide, PDPH, carboxylic acid hydrazide and small peptides. 213. The small peptide of claim 210, wherein the small peptide is AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S.Tag®, T7 , V5 and VSV-G. 176. The tag of any of claims 138, 171, 173, and 176, wherein the tag is AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS Or a peptide or polypeptide selected from the group consisting of KT3, Protein C, S.Tag®, T7, V5 and VSV-G. 208. The composition of claim 208, wherein the pharmaceutical agent is selected from the group consisting of radioisotopes, toxins, oligonucleotides, recombinant proteins, antibody fragments, and anticancer agents. 213. The method of claim 213, wherein the radioisotope is indium, ¹¹¹ indium, ¹¹³ indium, ^99m rhenium, ¹⁰⁵ rhenium, ¹⁰¹ rhenium, ^99m technetium, ^121m tellurium, ^122m tellurium, ^125m tellurium, ¹⁶⁵ thulium, ¹⁶⁷ thulium, ¹⁶⁸ thulium, ¹²³ Iodine, ¹²⁶ Iodine, ¹³¹ Iodine, ¹³³ Iodine, ^81m Krypton, ³³ Xenon, ⁹⁰ Yttrium, ²¹³ Bismuth, ⁷⁷ Bromine, ¹⁸ Fluorine, ⁹⁵ Ruthenium, ⁹⁷ Ruthenium, ¹⁰³ Ruthenium, ¹⁰⁵ Ruthenium, ¹⁰⁷ Mercury, ²⁰³ Mercury, ⁶⁷ Gallium and ⁶⁸ gallium is selected from the group consisting of. 213. The composition of claim 213, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, lysine and variants and derivatives thereof. 213. The method of claim 213, wherein the anticancer agent is doxorubicin, adriamycin, cis-platinum, taxol, calichemicin, vincristine, cytarabine (Ara-C), cyclophosphazd, prednisone, daunorubicin, idarubicin , Fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide, bleomycin and derivatives thereof. 176. A method of inhibiting growth of cells comprising contacting a cell with a predetermined amount of the peptide or polypeptide of claim 138 or 176. 217. The method of claim 217, wherein the cells are selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastoma, normal somatoma and melanoma. 218. The method of claim 218, wherein the cells are leukemia cells. 219. The method of claim 219, wherein the leukemia cells are acute myeloid leukemia cells. 176. A pharmaceutical composition comprising one or more peptides of claims 138 or 176 attached, coupled, combined, bound or fused to an imaging agent for use in diagnostic positioning and imaging of a tumor. 176. A method of treating a patient suffering from a disease comprising administering to the patient an effective amount of a peptide or polypeptide of claim 138 or 176 to treat the disease. 222. The method of claim 222, wherein the disease is selected from the group consisting of carcinomas, sarcomas, leukemias, adenomas, lymphomas, myeloma, blastoma, normal somatoma and melanoma. 237. The method of claim 223, wherein the disease is leukemia. 224. The method of claim 224, wherein the leukemia is acute myeloid leukemia. 176. The peptide or polypeptide of claim 138 or 176, wherein the Fv specifically or selectively binds to acute myeloid leukemia (AML) cells. A ligand present on AML cells bound by the peptide or polypeptide of claim 226. 227. A peptide or polypeptide that binds to the ligand of claim 227. 176. A diagnostic kit for in vivo analysis of therapeutic efficacy before, during or after treatment comprising the peptide or polypeptide of claim 138 or 176 attached, coupled, combined, bound or fused to an indicator marker molecule. 229. The kit of claim 229, wherein the indicator marker molecule is a fluorescent marker. 234. The kit of claim 230, wherein the fluorescent marker is selected from the group consisting of fluorescein, rhodamine, phycoerythrin and variants and conjugates thereof. 302. The kit of claim 229, wherein the kit is used for the diagnosis of cancer. 176. The peptide or polypeptide of claim 139 or 176, wherein the construct is an Ig polypeptide. The method of producing a peptide or polypeptide of claim 233, wherein the Ig polypeptide is expressed as a recombinant polypeptide and is produced in a eukaryotic cell system. 234. The method of claim 234, wherein the eukaryotic cell line is a mammalian cell line. 236. The peptide or polypeptide of claim 233, wherein the Ig polypeptide is an IgG polypeptide. 236. The peptide or polypeptide of claim 236, wherein the IgG polypeptide comprises CDR3, CDR2 and CDR1 regions having SEQ ID NOs: 8, 115 and 114, respectively. 236. The peptide or polypeptide of claim 236, wherein the IgG polypeptide comprises CDR3, CDR2 and CDR1 regions having SEQ ID NOs: 20, 115, and 114, respectively. 237. The IgG polypeptide of claim 237, wherein said CDR3, CDR2 and CDR1 regions are of heavy chain. 238. The IgG polypeptide of claim 238, wherein said CDR3, CDR2 and CDR1 regions are of heavy chain. 237. The IgG polypeptide of claim 237, wherein said CDR3, CDR2 and CDR1 regions are of light chains. 238. The IgG polypeptide of claim 238 wherein the CDR3, CDR2 and CDR1 regions are of light chains. 238. The IgG polypeptide of claim 233, wherein the IgG has a heavy chain comprising SEQ ID NO: 26 and a light chain comprising SEQ ID NO: 27 or chains having at least 90% amino acid similarity with them. 176. A method of producing the peptide or polypeptide of claim 139 or 176 produced in a prokaryotic or eukaryotic cell system. 245. The method of claim 244, wherein the prokaryotic cell line comprises E. coli comprising an expression vector and the eukaryotic cell line is a mammalian cell line. 245. The method of claim 245, wherein the expression vector of the prokaryotic cell line comprises a promoter selected from the group consisting of osmB , deo, β-lac-U5, λ P _L and CMV. 176. The method of claim 138 or 176, wherein said CDR3 is R ₁ -X Phe Pro-R ₂ , wherein each of R ₁ and R ₂ comprises 0-15 amino acid residues and X is any of Arg, Gly or Lys. One] amino acid sequence. 176. The peptide or polypeptide of claim 138 or 176, wherein the peptide or polypeptide comprises one or more unnaturally occurring modifications. 248. The peptide or polypeptide of claim 248, wherein the non-naturally occurring modifications increase the immunogenicity or enhance the stability of the peptide or polypeptide. 252. The method of claim 249, wherein the one or more modifications are selected from the group consisting of peptoid modifications, semipeptoid modifications, cyclic peptide modifications, N-terminal modifications, C terminal modifications, peptide bond modifications, backbone modifications and residue modifications Peptide or polypeptide. 173. The peptide or polypeptide of any one of claims 138,171,173,176,176 and 198 for purging autologous bone marrow in vitro to remove abnormal cells. Peptides or polypeptides having the formula or structure A-X-B Wherein X is a hypervariable CDR3 region comprising SEQ ID NO: 8 or 20, A and B may each be an amino acid chain 1 to 1000 amino acids in length, where A is an amino terminus and B is a carboxy terminus. 252. The peptide of claim 252, wherein A is 150-250 amino acid residues and B is 350-500 amino acid residues. 253. The peptide or polypeptide of claim 253 which is part of a larger or complete antibody or multimer. A dimer molecule comprising two peptides or polypeptides, one of which is the peptide or polypeptide of claim 252. 252. A dimer molecule comprising the same two peptides or polypeptides of claim 252. 252. A nucleic acid molecule encoding the peptide or polypeptide of claim 252 or the dimer molecule of claim 254. 235. The method of claim 235, wherein the mammalian cell system comprises an SRα5 promoter. 235. The method of claim 235, wherein the mammalian cell line comprises a CMV promoter.