KR20020047191A - The prv-1 gene and use thereof - Google Patents

Abstract

The present invention relates to a nucleotide sequence encoding a PRV-1 protein and comprising essentially SEQ ID NO: 1. The invention also relates to a method for detecting this gene, the mRNA encoded by this gene and the polypeptide.

Description

PBR-1 gene and its use {THE PRV-1 GENE AND USE THEREOF}

The present invention provides a nucleotide sequence encoding a PRV-1 gene, a recombinant DNA containing the nucleotide sequence, a vector containing the recombinant DNA and cells transformed with these vectors, and a PRV-1 polypeptide, an antibody against the polypeptide, A method of detecting a PRV-1 polypeptide and a drug comprising an antibody against a PRV-1 polypeptide or a PRV-1 polypeptide.

Also true polycythemia or p. True primary polycythemia (erythremia), also called vera, is a malignant blood disease with increased formation of red blood cells, granulocytes, and megakaryocytes. This disease is of clone origin and occurs as a result of mutation of one hematopoietic progenitor cell. The incidence of true polycythemia in Germany is 4 to 6 per million people. If left untreated, the disease can lead to death within 18 months. Treatment with blood or chemotherapy prolongs the average survival over 13 years.

Diabetic polycythemia is diagnosed by clinical criteria. Clinical features include headache, pruritus, nystagmus in two thirds of patients, bleeding or thrombosis in one third of patients, gout caused by increased production of uric acid, and in some cases septic ulcers. The most important experimental findings are an increase in values for hemoglobin, hematocrit, erythrocyte count and total erythrocyte volume, and in many cases also neutrophil granulocytosis or thrombocytopenia. On the one hand, most of the criteria are rather widespread, and on the other hand, not all patients fulfill these criteria, so true myelodysplasia can lead to other myeloproliferative disorders, such as chronic granulocytic leukemia or essential thrombocytopenia. It is often difficult to establish a diagnosis apart from To date, the molecular cause of diabetes mellitus is not fully known. However, accurate diagnosis is important because true polycythemia causes severe processes if not treated.

Therefore, it is an object of the present invention to discover and diagnose the molecular cause of true primary polycythemia.

This goal was achieved by isolating genes that are not expressed in healthy control subjects but which are specifically expressed in connection with true polycythemia. This gene was named PRV-1 gene ( polycythemia r ubra v era).

Similar nucleotide sequences are described in International Patent Application WO 98/50552.

Therefore, some of the subject matter of the present invention relates to a polynucleotide encoding the PRV-1 gene and essentially comprising SEQ ID NO: 1. The polynucleotide of the present invention may be one or two strands of DNA or RNA. If they are RNA, it will be apparent to one of ordinary skill in the art that the "U" nucleotides are present in place of the "T" nucleotides. "Polynucleotide" is understood to mean a nucleic acid containing at least 15 nucleotides.

Nucleotide sequences according to the invention are illustrated in FIG. 1. The present invention therefore relates to polynucleotides corresponding to the sequences shown in FIG. 1 and to polynucleotides exhibiting minor sequence differences with this nucleotide sequence. Within the meaning of the present application, a minor difference means that several, preferably up to 50, particularly preferably up to 25 nucleotides can be exchanged, but which do not affect the function of the gene encoded by this nucleotide sequence. It is considered to mean the sequence. One skilled in the art knows that a base triplet encoding one amino acid can be replaced with another triplet encoding the same amino acid. In addition, less important regions may be deleted and / or mutated to a lesser extent. In certain embodiments, the polynucleotide comprises nucleotides 36 to 1346 of SEQ ID NO: 1, which are coding regions of the PRV-1 gene. Other embodiments include nucleotides 36 to 1262 or 36 to 1238 of SEQ ID NO: 1. This region probably appears to encode the active region of the PRV-1 polypeptide. Finally, the polynucleotides of the invention also include nucleotides 39 to 1346, 39 to 1262, or 39 to 1238 of SEQ ID NO: 1, such that no codon encoding the starting methionine is present. Preferred embodiments are polynucleotides comprising nucleotides 99-1346, 99-1262, or 99-1238 of SEQ ID NO: 1. This prevents the codon encoding the signal peptide of the PRV-1 polypeptide from being present at the 5 'end.

The polynucleotide according to the invention may also be a fragment of the PRV-1 gene. In general, this fragment has more than 100 nucleotides, preferably more than 300 nucleotides. Fragments can also be used as primers or probes, especially in PCR, in which case the fragments can be truncated to fit this purpose. Generally, primers are 10-30 nucleotides in length and probes are 15-50 nucleotides in length.

The PRV-1 gene is an endogenous gene whose expression in healthy individuals is limited to only a few organs. Usually, it is expressed mainly in the hematopoietic organs, ie bone marrow and fetal liver, slightly expressed in the spleen, but not in the heart, muscle, pancreas or kidney. In patients with true polycythemia, this gene is very strongly overexpressed, especially in hematopoietic cells.

The PRV-1 gene encodes a protein representing the protein sequence shown in FIG. Signal peptides present in the protein sequence of all surface molecules and usually removed when the protein is processed are separated by hyphens. The protein has SEQ ID NO: 2. Another aspect of the present invention is a polypeptide that is essentially pure polypeptide having SEQ ID NO: 2 or polypeptide having SEQ ID NO: 2 but no signal peptide (ie, amino acids 22-437 of SEQ ID NO: 2). Other embodiments include amino acids 1-409, 22-409, 1-401, or 22-401 (probably the active region of this protein) of SEQ ID NO: 2.

With regard to biological activity, the polypeptides according to the invention are preferably glycosylated and most preferably N-glycosylated. Thus, one or more of the amino acids Asn-46, Asn-189 and Asn-382 (amino acid number refers to SEQ ID NO: 2) of the PRV-1 polypeptide may be glycosylated. The invention also includes fragments of the polypeptides of the invention that are N-glycosylated. The fragment is at least 50 amino acids in length, preferably at least 100 amino acids, most preferably at least 150 amino acids. In other embodiments, the polypeptide may be O-glycosylated.

It is apparent to one of ordinary skill in the art that certain amino acids can be replaced with other amino acids without impairing the biological activity of the protein. Such altered forms of polypeptides of the invention may also be part (variants) of the subject matter of the invention. Amino acid substitutions are those that do not negatively affect the biological activity of the protein. One of ordinary skill in the art can use known rules for selecting replacements.

Depending on the method of preparation, the PRV-1 polypeptide may have a glycosyl phosphatidylinositol anchor, for example. It is then linked to the amino acid corresponding to amino acids 407-409 of SEQ ID NO: 2. GPI anchors are used to anchor proteins by lipids outside of the cell membrane. However, for reasons not so clearly concluded thus far, it is often observed that GPI-bound proteins are also released into the medium. This is called "shedding". To date, it has not been elucidated whether this is a specific process, ie whether the protein is cleaved from the membrane by enzymes in a controlled manner or if it represents nonspecific loss of anchors. In conclusion, it is very likely that PRV-1 is found both on and outside the cell membrane. Since secreted forms that are not membrane bound can diffuse as growth factors and reach other cells, this form is probably more important with regard to the effect of the polypeptide as a growth factor and growth inhibitor.

It is apparent to those skilled in the art that by manipulating these C-terminal amino acids, one can influence the adhesion of proteins to cell membranes. This is particularly relevant for the preparation of defined DNA constructs intended to express a PRV-1 polypeptide or fragment thereof. Codons encoding these amino acids can be mutated or deleted.

The gene encodes a surface receptor of the uPAR / Ly6 family. This receptor family can introduce mitogenic signals, ie signals that stimulate cell division. It is therefore assumed that overexpression of the PRV-1 gene contributes to the overproliferation of these cells, especially on bone marrow cells of patients with true polycythemia.

PRV-1 is not expressed on granulocytes of healthy individuals or patients suffering from other myeloproliferative diseases, such as chronic granulocytosis leukemia, acute granulocytosis leukemia, essential thrombocytopenia or secondary erythrocytosis.

In order to be able to use the polypeptide encoded by the PRV-1 gene in an analysis and detection method, it is preferably functional in the coding region of the PRV-1 gene, or at least the promoter, which is nucleotide sequence 1 or at least nucleotides 36 to 1346 of SEQ ID NO: 1. Conveniently generated from recombinant DNA comprising nucleotides 39 to 1262 or 39 to 1238. However, the synthetic DNA may also comprise only fragments of SEQ ID NO: 1.

The invention also relates to a vector containing recombinant DNA to a PRV-1 polypeptide or fragment thereof, and to host cells transfected or transformed with the vector. Host cells are prokaryotic cells, for example E. coli. It may be a bacterium such as E. coli. However, in this case the expressed polypeptide is not glycosylated. Therefore, eukaryotic host cells that are capable of post-translational glycosylation and other modifications are desirable. Examples of eukaryotic host cells include insect cells such as Sf9 cells, and mammalian cells such as 293 cells, COS cells, CHO cells and HeLa cells when expressed after infection with recombinant baculovirus. These examples are not limiting. It is also possible to use yeast cells as host cells. It will be apparent to one of ordinary skill in the art that glycosylation patterns can differ depending on the host cell. Therefore, the biological activity of the expression product can vary. Particular preference is given to host cells that glycosylate the expression product in such a way that the biological activity of the protein is retained.

Another aspect of the invention is a method of making a polypeptide according to the invention. In this method, DNA encoding the polypeptide of the present invention is expressed in a host cell. Culture medium or cells are used for isolation of subsequent polypeptides depending on whether the expressed polypeptide is secreted into or left in the culture medium by the host cell. The polypeptide of the invention is then concentrated and / or purified using methods known in the art, such as chromatography. Methods for purifying proteins are described, for example, in Scopes, R., Protein Purification: Principles and Practice (3rd edition), Springer Verlag (1994). In one particular embodiment, the methods of the present invention comprise the step of concentrating and / or purifying the glycosylated polypeptide. This step may occur before the polypeptide of the invention is essentially purified or after the polypeptide of the invention has already been purified essentially. In the latter case, glycosylated residues of the purified polypeptide are isolated and isolated. In the most preferred embodiment of this method, the N-glycosylated polypeptide is specifically isolated. In another embodiment of this method, the glycosylated polypeptide is isolated at one or more of the amino acids Asn-46, Asn-189 and Asn-382 of SEQ ID NO: 2.

PRV-1 polypeptides isolated from or granularly produced from granulocytes can be used for both diagnosis of and treatment of diabetes mellitus.

One therapeutic possibility is "antisense therapy". This method uses "antisense" RNA molecules that are complementary to PRV RNA. Since the PRV-1 RNA has the sequence 5'-AAAAGCAGAAAGAGATTACCAGCC-3 '(SEQ ID NO: 3) at its beginning, the essential antisense RNA for this sequence is represented by the following nucleotide sequence: 5'-GGCTGGTAATCTCTTTCTGCTTTT-3' (SEQ ID NO: 4). Have This antisense RNA is incorporated into the vector and introduced into the true polycythemia cell. This RNA is introduced, for example by transfection, wherein the vector used for transfection is preferably configured to be specifically introduced into true polycythemia cells. Expression of antisense RNA causes the PRV-1 mRNA to no longer be translated into the polypeptide. Cells treated in this manner do not form any PRV-1 protein.

The present invention therefore also relates to a method for detecting true polycythemia, characterized by detecting the PRV-1 polypeptide or epitope thereof and determining the extent of its expression.

Overexpression of this receptor on mature cells outside the bone marrow, for example on granulocytes, strongly suggests the presence of true polycythemia disease. This overexpression is conveniently detected by immunoassay using antibodies to the PRV-1 receptor. Suitable test methods are known immunoassays which allow the use of PRV-1 polypeptide specific antibodies in combination with other labeled antibodies that may be immobilized or in solution. Labeling can be done in a manner known per se, for example using radioisotopes, by fluorescence or luminescence, using enzymes, by coloration reactions or using other groups suitable for measurement. These variations are known to those of ordinary skill in the art and do not require any further explanation. According to the invention, ELISA tests are particularly preferred.

Antibodies necessary to specifically detect the PRV-1 receptor can likewise be prepared in a manner known per se. Both monoclonal and polyclonal antibodies are suitable and preference is given to using monoclonal antibodies.

Peptides derived from proteins can also be used to prepare antibodies. Within the context of the present invention, success has been achieved using peptides having the following sequences:

a) KVSDLPRQWTPKN (amino acids 34 to 46) [SEQ ID NO: 5], and

b) SAREKRDVQPPASQH (amino acids 391 to 405) [SEQ ID NO: 6]

Polyclonal antibodies are usually produced by immunizing a suitable host (rabbit) with a PRV-1 polypeptide appropriately bound to an immunological support (adjuvant) to elicit an immune response. Monoclonal antibodies can be generated in a manner known per se using hybrid cell technology. Antibodies can be purified by affinity purification. Preparation and purification of antibodies are described, for example, in "Antibodies: A Laboratory Manual" by Harlow abd Lane, Cild Spring Harbor Laboratory Press.

In addition, such polyclonal or monoclonal antibodies against PRV-1 may also be used to treat this disease.

In other embodiments, the PRV-1 receptor can be detected using the RT-PCR method. To this end, RNA is first and foremost isolated from PRV-1 overexpressing cells, which are generally granulocytes. The RT primers are then used to perform reverse transcription in a manner known per se. RT primers are preferably primers having the following nucleotide sequence (SEQ ID NO: 7):

ATTAGGTTATGAGGTCAGAGGGAGGTT

In this way, certain PRV-1 RNAs are modified with DNA. This DNA is then amplified by a PCR reaction in a manner known per se. The following two primers are preferably used in the propagation cycle.

As a sense primer (SEQ ID NO: 8)

GCAGAAAGAGATTACCAGCCACAGACGG.

As an antisense primer (SEQ ID NO: 9)

GAATCGTGGGGGTAATAGAGTTAGCAGG.

One skilled in the art can easily find other primers that are also suitable using the sequences described.

Since RNA is used as the starting material in this method, the PCR signal is positive only when the PRV-1 gene is also expressed. As explained above, this is the case when the patient has true polycythemia. PRV is not expressed in granulocytes of healthy subjects. In conclusion, the absence of any RT-PCR signal means that no true polycythemia is present. Quantification by RT-PCR method is preferably performed using TaqMan® technology. This quantification requires probes in addition to primers. The preferred sequence of the probe is 5'-TTCTTGTTGAACCACACCAGACAAATCGG-3 '(SEQ ID NO: 10). Therefore, quantitative RT-PCR for detecting PRV-1 transcripts is also part of the subject of the present invention.

Alternatively, blotting methods, preferably Northern Blot, may be used to diagnose true polycythemia. For this method, RNA is isolated from granulocytes and then observed for expression of PRV-1 using a blotting method such as northern blotting. The cDNA sequence of SEQ ID NO: 1 or a segment of this sequence can be used as a probe. Hybridization then occurs only if the granulocytes are derived from a patient suffering from true polycythemia, because only in that case there is any expression on the granulocytes. The absence of hybridization means that the individual from which granulocytes are derived does not have true polycythemia.

Fragments of genes can also be used for northern blot hybridization. This fragment is usually at least 100 bases in length, preferably at least 300 bases in length. Alternatively, various different fragments of a gene can be prepared that can be used as probes in northern blots by digesting the gene with restriction endonucleases. If fragments are derived from cDNA, they exist as two strands that must be separated into one strand for hybridization. Suitable examples are Bam HI-PstI fragments of base pair 420 to base pair 831, or PstI-PstI fragments of base pair 831 to base pair 1900.

Expression of PRV-1 mRNA and consequently PRV-1 can also be detected, among other things, by reverse transcription of mRNA by RT-PCR reaction followed by amplification of cDNA, wherein the amplified DNA is detected using a probe by hybridization method. do.

In the case of a positive diagnosis, the disease must be treated because death can lead to a relatively short period of time if not treated. In such treatments, specific antibodies against PRV-1 can be used, where appropriate, to which cytotoxic components can be bound.

The present invention therefore further relates to a drug comprising an antibody against the PRV-1 receptor in addition to the usual excipients.

Because PRV-1 receptors are overexpressed in true polycythemia, many antibodies bind on the surface of affected granulocytes when they come into contact with anti-PRV-1 antibodies. The binding of many antibodies to these cells stimulates immune cells to destroy these granulocytes. In this way, it is possible to specifically eliminate true polycythemia cells.

Surprisingly, it has also been found that PRV-1 polypeptide exhibits hematopoietic activity. PRV-1 polypeptides can stimulate certain hematopoietic progenitor cells to form red blood cell colonies. Particularly exhibiting this function are N-glycosylated PRV-1 polypeptides. Thus, preferred polypeptides of the invention are N-glycosylated PRV-1 polypeptides and fragments thereof which exhibit growth factor activity.

Therefore, another aspect of the present invention relates to a drug comprising, in addition to a pharmaceutically acceptable excipient, a PRV-1 polypeptide or a biologically active fragment thereof. The PRV-1 polypeptide is preferably a glycosylated PRV-1 polypeptide, more preferably an N-glycosylated PRV-1 polypeptide or a biologically active fragment thereof. The invention also relates to a drug comprising at least one polypeptide according to the invention.

The invention further relates to the use of a PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof as an in vivo and ex vivo growth factor. PRV-1 polypeptides or biologically active fragments thereof or biologically active variants thereof may be used to treat all pancytopenia and pancreatic abnormalities (changes in peripheral blood and cellular components of bone marrow) in the bone marrow and blood circulation. have. Polypeptides of the invention, for example, in the case of renal failure, chemotherapy or systemic radiation therapy, treat anemia, treat neutropenia and thrombocytopenia during chemotherapy or systemic radiation therapy, swelling (proliferation) and half into the patient. It can be used for in vitro treatment of peripheral or bone marrow stem cells for hematology and for treatment of sepsis, systemic inflammatory response syndrome (SIRS) or local inflammatory response. The polypeptides of the present invention or drugs containing them can be administered in a wide variety of ways. Dosage forms include intravenous, intramuscular, subcutaneous, intraperitoneal, oral, transdermal and transmucosal administration.

Polynucleotides according to the invention can also be used to treat pancytopenia and pancreatic abnormalities. In this case, the purpose is to express the PRV-1 polypeptide or functional fragment thereof in the cells of the diseased patient. Gene therapy methods are used first in this regard. The cells are isolated from the patient and transfected with the polynucleotide of the present invention (in vitro manipulation), after which they are sent back to the patient. It is also conceivable how the polynucleotides of the invention can be introduced into target cells by viral metastasis. Expression of the inserted nucleic acid then leads to hematopoietic activity.

Surprisingly, it has also been found that at higher concentrations the PRV-1 polypeptide has an inhibitory effect on the growth of cells. Thus, for example, it has been observed that adding an increased amount of PRV-1 protein virtually completely stops the formation of red blood cells and granulocyte / monocyte colonies. This effect is similar to the action of interferon-α, which is used therapeutically in chronic myeloid leukemia (CML) and true polycythemia. Endogenous inhibitors have been used when chemical cytostatic agents, such as interferon-α, have not yet been available and to some extent compared to the hydroxyureas used to date. The disadvantage of interferon-α is that this active compound has serious side effects. The patient feels as if he is suffering from severe influenza. The present invention makes it possible to use a blood production inhibitor, wherein the inhibitory activity is concentration dependent.

Therefore, another aspect of the present invention relates to the use of a PRV-1 polypeptide used to inhibit the growth of a cell as described herein, in particular its use as a cytostatic agent. It is preferred that the polypeptide is used to inhibit the growth of hematopoietic cells. The present invention also relates to the use of a polypeptide of the invention for the manufacture of a medicament for the treatment of proliferative disease. These diseases are specifically myeloproliferative diseases, true polycythemia, essential thrombocytopenia, myeloid fibrosis, CML and all leukemias and lymphomas, and solid tumors.

Another aspect of the invention relates to the use of polynucleotides or biologically active fragments thereof or biologically active variants thereof used to inhibit the growth of cells, as described herein. Polynucleotides can be incorporated into suitable vectors and transfected into suitable target cells. After the PRV-1 polypeptide or a biologically active fragment thereof or a biologically active variant thereof is expressed at an appropriate concentration, a growth inhibitory effect is initiated. In the same way, the polynucleotides can be incorporated into a viral vector, after which the appropriate target cells are virally infected so that PRV-1 is expressed. The present invention also relates to poly of the present application for use in the preparation of proliferative diseases, such as myeloproliferative diseases, true polycythemia, essential thrombocytopenia, myelofibrosis, CML and all leukemias and lymphomas, and solid tumors. It relates to the use of nucleotides.

The invention also relates to kits for detecting disorders of true polycythemia or hematopoietic system. These kits comprise a polynucleotide of the invention and / or a polypeptide of the invention and / or one or more antibodies of the invention. In addition, the kit may also include a composition or container suitable for carrying out the detection reaction. Examples of this composition may include buffers, membrane blocking agents, hybridization solutions, secondary antibodies, substrate solutions for detection reactions, and the like. The kit is preferably used to carry out a PCR reaction, RT-PCR, Northern blot, Southern blot, Western blot and ELISA, RIA or similar reaction.

The following examples are provided by way of explanation.

<Example 1>

Characterization of the PRV Gene

The following experiments were performed to characterize genes:

Granulocytes were isolated from blood obtained by bleeding stored blood or true polycythemia patients using the following protocol.

An equal volume of 3% dextran solution in 0.9% NaCl was added to the blood and the mixture was allowed to stand at room temperature (RT) for 20 minutes.

The mixture was separated into two phases. The light colored phase above was removed and centrifuged at 1800 g for 10 minutes at RT.

Discard supernatant and resuspend cell pellet in equal volume of 0.9% NaCl.

In each case 35 ml of cells in NaCl were layered on 15 ml Ficoll-Hypaque.

Cells on Picol-High Park were then centrifuged for 60 minutes at RT at 1800 g without using a brake.

Two layers with cell pellets and interphase were formed.

The layer and the interface were aspirated off and the cell pellet was resuspended in 10 ml of ice cooled 0.2% NaCl for 30 seconds and immediately after 30 seconds 10 ml of ice cooled 1.6% NaCl were added.

Cells were centrifuged at 1800 g for 10 minutes at RT.

They were then washed once in 10 ml of PBS and centrifuged.

Cell pellets contained 95-99% pure granulocytes.

RNA was isolated from these cells using standard methods.

10 mg of this RNA was observed for PRV-1 expression by Northern blot. The entire cDNA sequence shown in SEQ ID NO: 1 was used as the probe.

This experiment was performed on samples of 39 true polycythemia patients and 29 control stored blood. PRV-1 probes have been found to hybridize strongly in patients with true polycythemia. No hybridization was observed in healthy control samples.

<Example 2>

PRV-1 has growth factor activity

The fetus was removed from pregnant mice at 13.5 days after pregnancy. Fetal livers were removed. Cells contained in them were stained using antibodies and column chromatography was made to enrich certain cells and leave no other cell types. This results in a cell mixture rich in certain hematopoietic progenitor cells (colony forming unit-erythrocytes, CFU-E), so that a total of 2% of fetal livers consist of CFU-E and 30-40% of abundant cells are CFU-E. Is made of.

These CFU-Es were transfected using retroviruses. To this end, the packaging cells named 293-T themselves transfected 48 hours before. 293-T cells are a coining human fetal kidney cell line. 293-T cells are stably transfected with several genes from retroviruses. When these 293-T cells are transfected with two plasmids, now called pOS and pKAT, 293-T cells produce retroviruses that can infect mouse fetal liver cells. When 293-T cells are transfected with a blank pOS vector and pKAT, wild type retroviruses are produced that express only retroviral proteins. On the other hand, cloning of human genes, such as PRV-1 into pOS vectors, results in the production of retroviruses that express this protein when infecting cells. 293-T cells secrete retrovirus into cell culture medium.

After 2 days, cell culture medium of transfected 293-T cells containing retroviruses are harvested and filtered once through a 0.45 μm filter. To transfect fetal liver cells, these latter cells are mixed with filtered cell culture medium containing retroviruses and centrifuged at 1800 rpm and 20 ° C. for 2 hours in the presence of added Polybren. Separated. Transfected fetal liver cells were then cultured in medium [Methocult, cell containing fetal calf serum, erythropoatin (EPO) / ml 0.0001-0.4 IU and methyl cellulose (0.8%) in addition to common salts and amino acids. Cultured from Cell Systems. CFU-E requires EPO to form hematopoietic colonies. Methyl cellulose solidifies the medium in jelly form, thereby immobilizing the individual cells in the jelly, making them immobile as opposed to in liquid medium. Therefore, one can observe whether hematopoietic colonies were formed from one cell or not. CFU-E forms erythrocyte colonies, which are colonies containing red blood cells and their progenitor cells.

After 3 days, the number of developed hematopoietic colonies was counted. Various mixtures were compared. Not every mixture was observed in each experiment: mixtures 1 to 3 were very similar controls, each of which was individually compared to mixture 4.

Mixture 1: Cells Not Transfected with Retroviruses;

Mixture 2: Cells Transfected with a Blank pOS Vector;

Mixture 3: cells transfected with “untreated fluorescent protein (GFP)”, a protein that is not hematopoietically active;

Mixture 4: Cells transfected with pOS-PRV-1 (vector + gene of the invention).

This table lists the results from three experiments performed as described. The number in each case represents the number of colonies. Mixture 1 Mixture 2 Mixture 3 Mixture 4 Not transfected Ball vector (pOS) GFP (pOS-GFP) PRV-1 (pOS-PRV-1) Experiment 1 116 156 80 326 Experiment 2 271 273 410 Experiment 3 120 131 291

Experiments demonstrate that CFU-E transfected with PRV-1 forms much more colonies (up to 3x more) than the various control CFU-Es. This result implies that PRV-1 is a growth factor for CFU-E.

<Example 3>

Solubility of PRV-1 Growth Factor

Further experiments were conducted to see if PRV-1 is a soluble growth factor or if cell-cell contact is needed. Not only retroviruses were produced by the packaging cell line 293-T after transfection with the pOS and pKAT vectors. Nevertheless, 293-T cells also synthesize a gene cloned into pOS, in this case a protein encoded by PRV-1. If the gene product is a soluble protein, it is secreted into the medium surrounding the packaging cell line 293-T. Retroviruses did not form when 293-T cells were transfected with only the pOS vector without PKAT. The cell culture medium contains only soluble proteins produced by the cells. Medium derived from pOS-PRV-1-transfected cells and containing no retroviruses was mixed with CFU-E and the whole was plated in methyl cellulose medium. And the resulting colonies were counted.

The following results were obtained:

Solubility of PRV-1. The number in each case represents the number of colonies. Mixture 1 Mixture 2 Mixture 3 Mixture 4 Not transfected Ball vector (pOS) GFP (pOS-GFP) PRV-1 (pOS-PRV-1) Experiment 4 137 187 557

In this experiment also CFU-E treated with PRV-1 containing medium formed much more hematopoietic cells than control cells. From these results it can be concluded that PRV-1 is a soluble growth factor.

<Example 4>

PRV-1 also has an inhibitory cytostatic effect

Experiments were performed on peripheral blood cells. Since a small number of progenitor cells are also circulating in the peripheral blood of healthy individuals, hematopoietic colonies from peripheral blood cells can be cultured in a suitable medium (methyl cellulose). 40 ml of peripheral venous blood were drawn from a healthy donor (with heparin or EDTA introduced from the beginning as an anticoagulant). 15 ml of Picol / High Park were added to the blood and the mixture was centrifuged without breaking at 1600 rpm for 40 minutes. This produced a density gradient that separates blood into its cell constructs. After centrifugation, what was called mononuclear cells, which also contained liver cells, were found at the interface between serum and Ficoll. This interface was removed and washed in PBS (isotropic salt solution). This produced purified mononuclear cells, about 0.1% of which were hematopoietic stem cells.

Mononuclear cells were treated in particularly enriched medium (IMDM) containing an added concentration of 3% FCS (fetal calf serum). This 3% FCS / IMDM then included a modification, ie with or without PRV-1.

Stem cell technologies containing 30% FCS, 1% BSA (bovine serum albumin), mercaptoethanol, 2 mM L-glutamine, EPO (erythropoatin) / ml 3 IU and 1.0% methyl cellulose Mononuclear cells in IMDM were added at a density of 7 × 10 ⁵ cells / ml to commercially available media (Methocult) supplied by Cell Technologies). Cells were grown for 14 days in this medium. Small liver cells present in this mixture could develop into hematopoietic colonies. In general, 100-200 hematopoietic colonies were generated for every 7 × 10 ⁵ cells used.

Cell lines expressing very high amounts of PRV-1 were also constructed. The PRV-1 produced by these cells was changed to no longer have a lipid anchor. The expression product consists of amino acids 1-401 of SEQ ID NO: 2, and therefore amino acids 402-437 are missing. This altered PRV-1 is not incorporated into the cell membrane by a lipid anchor like wild type PRV-1, but instead is completely secreted from the cell. As in Example 3, the cell line consists of 293 cells that do not produce any retrovirus but express the protein (PRV-1).

For hematopoietic colony analysis, cells expressing altered PRV-1 (293-GPI-less-PRV-1) or in IMDM medium in which mononuclear blood cells are now incubated for 48 hours with untransfected cells 293 Were treated in medium incubated with for 48 hours. The cells were then examined for their ability to form hematopoietic colonies. The number of erythrocyte (red) and myeloid (white) blood cell colonies was measured after 14 days. The experiment was repeated three times and was also performed on different days using different blood donors. Replicas were also evaluated within the experiment. The following results were obtained:

Experiment 1

Cell supernatant Donor 1 Donor 2 Red colony White colony Red colony White colony 293 248/221 70/114 127/161 25/66 293-GPI-less-PRV-1 7/3 0/0 31/19 0/0

Experiment 2

Cell supernatant Donor 1 Donor 2 Red colony White colony Red colony White colony 293 99/91 20/19 49/33 8/1 293-GPI-less-PRV-1 0/0 0/0 0/0 0/0

Experiment 3

Cell supernatant Donor 1 Donor 2 Red colony White colony Red colony White colony 293 107/207 22/30 24/32 5/8 293-GPI-less-PRV-1 4/3 0/6 0/1 3/0

From this data it can be concluded that higher doses of PRV-1 than those used in Example 3 have cytostatic effects.

Example 5

Growth Factor PRV-1 is N-glycosylated

Granulocytes were isolated from patients with true polycythemia and protein extracts were prepared from these cells using standard protocols. These protein extracts were treated according to the protocol for "N-Glycosidase F diglycosylation Kit" supplied by Boehringer Manheim. Specifically, this is a "denaturation buffer". Was added to the protein extracts and the mixture was heated at 95 ° C. for 3 minutes before they were treated with “reaction buffer” or “reaction buffer” + N-glycosidase. Each mixture was incubated at 37 ° C. overnight, and proteins were analyzed by PAGE gel electrophoresis followed by Western blot. PRV-1 protein was detected with an antibody against a protein having amino acid sequence 5. The results indicate that the size of purified PRV-1 protein from granulocytes was 60-65 kDa, whereas after digesting with N-glycosidase, the size was only 40 kDa. This clearly demonstrates that PRV-1 is glycosylated on asparagine residues (asparagine = N).

Claims (24)

Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; An N-glycosylated polypeptide comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2 or fragments thereof containing 50 or more amino acids. Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; A polypeptide comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2. An antibody against the polypeptide of claim 1. The antibody of claim 3, wherein the antibody is a monoclonal antibody. A method for detecting true polycythemia, wherein a PRV-1 polypeptide is reacted with at least one antibody according to claim 3 or 4 by immunoassay. 6. The method of claim 5, wherein the antibody used is a polyclonal or monoclonal antibody according to claim 3 or 4. In addition to the usual excipients, the drug for treating true polycythemia comprising the antibody according to claim 3 or 4. The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; A polypeptide essentially comprising one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2; And A drug comprising at least one pharmaceutically acceptable excipient. Nucleotides 1-1600 of SEQ ID NO: 1; Nucleotides 36-1346 of SEQ ID NO: 1; Nucleotides 36-1262 of SEQ ID NO: 1; Nucleotides 36-1238 of SEQ ID NO: 1; Nucleotides 39-1346 of SEQ ID NO: 1; Nucleotides 39-1262 of SEQ ID NO: 1; Nucleotides 39-1238 of SEQ ID NO: 1; Nucleotides 99-1346 of SEQ ID NO: 1; A polynucleotide comprising essentially one of nucleotides 99-1262 of SEQ ID NO: 1 and nucleotides 99-1238 of SEQ ID NO: 1; And A drug comprising at least one pharmaceutically acceptable excipient. The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; Use of a polypeptide or biologically active fragment or variant thereof comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2 as a growth factor. The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; A drug for treating pancytopenia and pancreatic abnormality in bone marrow and blood circulation of a polypeptide or biologically active fragment or variant thereof comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2 Use to manufacture. Nucleotides 1-1600 of SEQ ID NO: 1; Nucleotides 36-1346 of SEQ ID NO: 1; Nucleotides 36-1262 of SEQ ID NO: 1; Nucleotides 36-1238 of SEQ ID NO: 1; Nucleotides 39-1346 of SEQ ID NO: 1; Nucleotides 39-1262 of SEQ ID NO: 1; Nucleotides 39-1238 of SEQ ID NO: 1; Nucleotides 99-1346 of SEQ ID NO: 1; Use of a polynucleotide or a fragment or variant thereof comprising essentially one of nucleotides 99-1262 of SEQ ID NO: 1 and nucleotides 99-1238 of SEQ ID NO: 1 for the manufacture of a drug for treating pancytopenia and pancreatic dysplasia in bone marrow and blood circulation Intended use. The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; In vitro or in vitro treatment of endogenous and / or chemotactic cell lines with polypeptides or biologically active fragments or variants thereof comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2 And / or used for propagation. The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; A use for inhibiting cell growth of a polypeptide or biologically active fragment or variant thereof comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2. Use according to claim 14, characterized in that the polypeptide is used as a cell proliferation inhibitor. The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; A use for the manufacture of a medicament for the treatment of a proliferative disease of a polypeptide or biologically active fragment or variant thereof comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2. 17. The use according to claim 16, wherein said proliferative disease is selected from the group consisting of myeloproliferative disease, true polycythemia, essential thrombocytopenia, myeloid fibrosis, CML, all leukemias and lymphomas, and solid tumors. Nucleotides 1-1600 of SEQ ID NO: 1; Nucleotides 36-1346 of SEQ ID NO: 1; Nucleotides 36-1262 of SEQ ID NO: 1; Nucleotides 36-1238 of SEQ ID NO: 1; Nucleotides 39-1346 of SEQ ID NO: 1; Nucleotides 39-1262 of SEQ ID NO: 1; Nucleotides 39-1238 of SEQ ID NO: 1; Nucleotides 99-1346 of SEQ ID NO: 1; Use of a polynucleotide or fragment or variant thereof comprising essentially one of nucleotides 99-1262 of SEQ ID NO: 1 and nucleotides 99-1238 of SEQ ID NO: 1 for use in inhibiting cell growth. Nucleotides 1-1600 of SEQ ID NO: 1; Nucleotides 36-1346 of SEQ ID NO: 1; Nucleotides 36-1262 of SEQ ID NO: 1; Nucleotides 36-1238 of SEQ ID NO: 1; Nucleotides 39-1346 of SEQ ID NO: 1; Nucleotides 39-1262 of SEQ ID NO: 1; Nucleotides 39-1238 of SEQ ID NO: 1; Nucleotides 99-1346 of SEQ ID NO: 1; A use for the manufacture of a medicament for the treatment of a proliferative disease of a polynucleotide or fragment or variant thereof comprising essentially one of nucleotides 99-1262 of SEQ ID NO: 1 and nucleotides 99-1238 of SEQ ID NO: 1. 20. The use according to claim 19, wherein said proliferative disease is selected from the group consisting of myeloproliferative disease, true polycythemia, essential thrombocytopenia, myeloid fibrosis, CML, all leukemias and lymphomas, and solid tumors. Nucleotides 1-1600 of SEQ ID NO: 1; Nucleotides 36-1346 of SEQ ID NO: 1; Nucleotides 36-1262 of SEQ ID NO: 1; Nucleotides 36-1238 of SEQ ID NO: 1; Nucleotides 39-1346 of SEQ ID NO: 1; Nucleotides 39-1262 of SEQ ID NO: 1; Nucleotides 39-1238 of SEQ ID NO: 1; Nucleotides 99-1346 of SEQ ID NO: 1; One or more polynucleotides or fragments or variants thereof comprising essentially one of nucleotides 99-1262 of SEQ ID NO: 1 and nucleotides 99-1238 of SEQ ID NO: 1, and / or The polypeptide of claim 1 or Amino acids 1-437 of SEQ ID NO: 2; Amino acids 1-409 of SEQ ID NO: 2; Amino acids 1-401 of SEQ ID NO: 2; Amino acids 22-437 of SEQ ID NO: 2; One or more polypeptides or biologically active fragments or variants thereof comprising essentially one of amino acids 22-409 of SEQ ID NO: 2 and amino acids 22-401 of SEQ ID NO: 2, and / or At least one antibody according to claim 3 or 4 Kit for detecting a hematopoietic disorder or true polycythemia comprising a. The kit for detecting PRV-1 protein according to claim 21, which is an ELISA test kit. 22. The kit for detecting PRV-1 mRNA according to claim 21, which is a semi-quantitative or quantitative RT-PCR assay kit. The kit for detecting PRV-1 mRNA according to claim 21, which is a northern blot kit.