KR20010101224A - Secreted and Transmembrane Polypeptides and Nucleic Acids Encoding the Same - Google Patents

Abstract

The present invention relates to novel polypeptides and nucleic acid molecules encoding the polypeptides. Further, herein, a vector comprising a nucleic acid sequence and a host cell, a chimeric polypeptide molecule comprising a polypeptide of the invention fused with a heterologous polypeptide sequence, an antibody binding to a polypeptide of the invention, and a method of producing a polypeptide of the invention Is provided.

Description

Secretion and transmembrane polypeptides, and nucleic acids encoding them {Secreted and Transmembrane Polypeptides and Nucleic Acids Encoding the Same}

Extracellular proteins play an important role, among other things, in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secreted polypeptides (eg, mitotic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. do. These secretory polypeptides or signaling molecules generally reach their site of action in the extracellular environment via the secretory pathway of the cell.

Secretory proteins have a variety of industrial uses, including pharmaceuticals, diagnostics, biosensors, and bioreactors. Most protein drugs currently available such as thrombolytics, interferons, interleukins, erythropoietins, colony promoters and various other cytokines are secreted proteins. In addition, membrane proteins that are their receptors also have potential as therapeutic or diagnostic agents. Efforts to find new natural secreted proteins are being made by both industry and academia. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Examples of screening methods and techniques are described in, eg, Klein et al ., Proc. Natl. Acad. Sci. , 93: 7108-7113 (1996) and US Pat. No. 5,536,637.

Membrane binding proteins and receptors may play an important role, among other things, in the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, such as proliferation, migration, differentiation or interaction with other cells, is typically dictated by information received from other cells and / or adjacent environments. Often, this information is delivered by secreted polypeptides (eg, mitotic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides and hormones) to be accepted and translated by various cellular receptors or membrane binding proteins. do. Such membrane-binding proteins and cellular receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatase, receptors involved in cell-cell interactions, and cellular adhesin molecules such as selectins and integrins. For example, the introduction of signals that regulate cell growth and differentiation is in part regulated by phosphorylation of several cellular proteins. Protein tyrosine kinases, enzymes that accelerate this process, can also act as growth factor receptors. Examples include fibroblast growth factor receptors and nerve growth factor receptors.

Membrane binding proteins and receptor molecules have a variety of industrial uses, including pharmaceuticals and diagnostics. For example, receptor immunoadhesin can be used as a therapeutic agent to block receptor-ligand interactions. Membrane binding proteins can also be used to screen for potential peptide or small molecule inhibitors for related receptor / ligand interactions.

Efforts to find new natural receptors or membrane-bound proteins have been made by both industry and academia. Much of this effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for new receptors or membrane binding proteins.

1.PRO1800

Hep27 protein is synthesized and accumulates in the nucleus of human hepatoblastoma cells (HepG2 cells) after growth arrest induced by butyrate treatment (Gabrielli et al ., Eur. J. Biochem. 232: 473-477 (1995)]. Hep27 synthesis is inhibited in cells deviated from butyrate blockade, thereby resuming DNA synthesis. The Hep27 protein sequence shows great homology with known short-chain alcohol dehydrogenase (SCAD) protein families, suggesting that Hep27 is a new member of the SCAD protein family. Depending on intranuclear placement, Hep27 has a region similar to the two-part intranuclear targeting sequence, and expression and protein synthesis of Hep27 mRNA suggest that there is regulation at the post-transcriptional level.

We herein describe the identification and characterization of novel polypeptides (named herein PRO1800 polypeptides) that are homologous to the Hep27 protein.

2.PRO539

The growth of multicellular organisms depends, at least in part, on mechanisms for specifying, directing, or maintaining location information that patterns cells, tissues, or organs. Various secretory signaling molecules, such as transforming growth factor-beta (TGF-β), Wnt, fibroblast growth factor, and elements of the Hedgehog family, correlate with the patterning activity of various cells and structures in Drosophila and vertebrates (Perrimon, Cell 80: 517-520 (1995)).

Coastal-2 is a novel kinesin-based protein of the hedgehog signaling pathway. The hedgehog ( Hh ), which functions at a wide variety of developmental stages (Perrimon's supra), is a segment-polarity of Drosophila melanogaster by gene screening. ) Was first identified as Nusslein-Volhard et al. Roux. Arch. Dev. Biol. 193: 267-282 (1984)]. Drosophila Hh gene has been only one confirmed, Hh homologues of mammalian Sonic (Sonic) Hh (SHh), Desert (Desert) Hh (DHh) and Indian (Indian) has three kinds of the isolation of the Hh (IHh) in the Coachella Echelard et al. Cell 75: 1417-30 (1993) and Riddle et al. Cell 75: 1401-16 (1993). SHh is expressed at high levels in spinal and basal plates of developing vertebrate embryos. In vitro explant analysis and ectopic expression of SHh in transgenic animals show that SHh plays a central role in the patterning of neural tubes (Echelard et al. Supra, Krauss et al. Cell 75, 1432-44 (1993), Riddle et al. Cell 75: 1401-16 (1993), and Roelink et al. Cell 81: 445-55 (1995). )]]. In vitro explant analysis and displacement expression of SHh in transgenic animals indicate that SHh plays a central role in neural tube patterning (Echelard et al. (1993) supra, Ericson et al. Cell 81: 747-56 (1995), Marti et al. Nature 375: 322-5 (1995), Roelink et al. (1995), supra, Hines (Hynes et al., Neuron 19: 15-26 (1997)). Hh is also known as the development of limbs (Krauss et al., Cell 75, 1431-44 (1993) and Laufer et al., Cell 79, 993-1003 (1994)), Development [Fan and Tessier-Lavigne, Cell 79, 1175-86 (1994) and Johnson et al. Cell 79: 1165-73 (1994)] , Lung development [Bellusci et al., Devlop. 124: 53-63 (1997)] and development of skin (Oro et al., Science 276: 817-21 (1997)). Likewise, IHh and DHh are involved in the development of bone, intestine and germ cells (Apelqvist et al. Curr. Biol. 7: 801-4 (1997), Bellusci et al., Suppl. 124: 53-63 (1997), Bitgood et al. Curr. Biol. 6: 298-304 (1996) and Roberts et al. Development 121: 3163-74 (1995). SHh knockout mice further support the idea that SHh is important in many aspects of vertebrate development (Chiang et al., Nature 383: 407-13 (1996)). These mice have been shown to lack central structures such as spinal cords and basal plates, no ventral cell type of neural tube, no terminal limb structure, cyclopia, and most of spinal column and ribs.

At the cell surface, Hh signal patch screen (Ptch) literature of the 12-transmembrane domain protein [Hooper (Hooper) and Scott (Scott), [Cell 59: et al., 751-65 (1989) and or kkano (Nakano) Nature 341: 508-13 (1989) and Smo G-protein-linked like receptors (Alcedo et al., Cell 86: 221-232 (1996)) and van den Heuvel. Heuvel and Ingham, Nature 382: 547-551 (1996). Document of genetic and biochemical evidence that both, Ptch and Smo are part of the support the model of the receptor component receptor complex [Chen (Chen), and the host rule (Struhl) [Cell 87: 553-63 (1996)], Marigo et al., Nature 384: 176-9 (1996) and Stone et al. Nature 384: 129-34 (1996). Being the Hh and Ptch combined and then reducing the normal inhibitory effect of Ptch on Smo, Smo is able to deliver the Hh signal through the plasma membrane. Loss-of-function mutations in the Ptch gene have been identified in patients with basal cell nevus syndrome (BCNS), a hereditary disease characterized by multiple basal cell carcinoma (BCC). In addition, dysfunctional Ptch gene mutations have been correlated with most sporadic basal cell carcinomas (Chidambaram et al., Cancer Research 56: 4599-601 (1996)), Gailani et al. Nature Genet. 14: 78-81 (1996), Hahn et al. (Cell 85: 841-51 (1996)), Johnson et al. (Science 272: 1668-71 (1996)), Unden ( Unden) et al. Cancer Res. 56: 4562-5 and Wicking et al., Am. J. Hum. Genet. 60: 21-6 (1997)]. Loss of Ptch function is thought to cause unregulated Smo signaling in basal cell carcinoma. Likewise, activating Smo mutations has been identified in sporadic BCC tumors (Xie et al. Nature 391: 90-2 (1998)), which acts as a signaling subunit in the receptor complex for SHh . To emphasize. However, the exact mechanism by which Ptch to Smo activity of the control is still unknown, the Hh signal is not described a signal transmission mechanism that is passed to the downstream from the receptor target. Epistatic analysis of genes in Drosophila has identified several segment-polarity genes that appear to act as components of the Hh signaling pathway (Ingham, Curr.Opin.Genet.Dev. 5: 492-8 (1995) and Perrimon [supra]. Such genes include kinesin-like molecules, Cos- 2 (Robbins et al. Cell 90: 225-34 (1997)) and Sisson et al. Cell 90: 235- 45 (1997)], a protein named fused (Preat et al., Genes 135: 1047-62 (1990), Therond et al., Proc. Natl. Acad Sci. USA 93: 4224-8 (1996)], a novel molecule whose function is known as Suppressor of fused (Pham et al. Genes 140: 587-98 (1995) and Preat). Genes 132: 725-36 (1996)], and zinc finger protein Ci. [Alexandre et al., Genes Dev. 10: 2003-13 (1996), Dominguez et al. (Science 272: 1621-5 (1996)) and Orenic et al., Genes Dev. 4: 1053-67 (1990)]. Other factors involved in Hh signaling include the transcription factor CBP (Akimaru et al., Nature 386: 735-738 (1997)), the negative modulator slimb [Jiang and Strhlhl] Nature 391: 493-496 (1998) and SHh reaction element COUP-TFII (Krishnan et al., Science 278: 1947-1950 (1997)).

Mutants of Cos-2 are lethal to embryos and exhibit traits similar to overexpression of Hh , including overlapping central elements of each segment and expansion domains of Hh reactive genes. In contrast, mutant embryos for fused and Ci exhibit traits similar to loss of function of Hh , including the deletion of the back of each segment, the replacement of all or all of the mirror mirror overlap, and the replacement of all the mirror mirror overlap. Busson et al., Roux. Arch. Dev. Biol. 197: 221-230 (1998)]. Molecular characteristics of Ci are described, such as he suggests that transcription factors that directly activate the Hh responsive genes such as Wingless and Dpp [Alexander (Alexandre) et al., [(1996) supra] and Dominguez gejjeu (Dominguez) [(1996 ) supra]]. Similarly, molecular analysis of fused revealed that he is structurally related to serine threonine kinase and that both intact N-terminal kinase domains and C-terminal regulatory regions are required for proper functioning [Preat et al. Nature 347: 87-9 (1990), Robbins et al. (1997) supra, Therond et al., Proc. Natl. Acad. Sci. USA 93: 4224-8. (1996)]. Consistent with the putative opposite function of Cos-2 and fused , fused mutations are inhibited not only by Cos-2 mutants but also by Suppressor of fused mutants [Preat et al. Genetics 135: 1047-62 ( 1993)]]. However, while fused null mutations and N-terminal kinase domain mutations can be completely suppressed by Suppressor of fused mutations, C-terminal mutations of fused exhibit strong Cos-2 traits at the Suppressor of fused background dose. This suggests that in the absence of Suppressor of fused , the fused kinase domain can act as a constitutive activator of SHh signaling. Recent studies have shown that 92 kDa of Drosophila fused , Cos-2 and Ci are present in microtubule-bound multiprotein complexes and Hh signaling separates them from microtubules (Robbins et al. Cell 90: 225-34 (1997) and Sisson et al. Cell 90: 235-45 (1997). Both fused and Cos-2 are phosphorylated in response to Hh treatment (Robbins et al. supra and Therond et al. Genes 142: 1181-98 (1996)). The resulting kinase has been characterized. Until recently, the only known homologues of vertebrates for these components are elements of the Gli protein family (eg, Gli-1 , Gli-2 and Gli-3 ). These are putative transcription factors that are zinc fingers structurally related to Ci . Among them, Gli-1 was found to be a candidate mediator of the SHh signal [Hynes et al., Neuron 15: 35-44 (1995), Lee et al. Development 124: 2537-52 (1997) and Alexandre et al., Genes Dev. 10: 2003-13 (1996)], suggesting that the mechanism of gene activity in response to Hh can be conserved between flies and vertebrates. In order to determine if other signaling elements in the Hh cascade have been conserved in evolution and to investigate at the biochemical level the function of fused in the Hh signaling cascade, we isolated and characterized human fused cDNA. Tissue distribution in mice indicates that fused is expressed in SHh reactive tissue. Biochemical studies have demonstrated that fused is a functional kinase. Functional studies have demonstrated that fused is an activator of Gli and that the dominant negative form of fused can block SHh signaling in Xenopus embryos. Taken together these data demonstrated that both Cos-2 and fused are directly involved in Hh signaling.

Other references regarding coastal-2 proteins include Simpson et al., Dev. Biol. 122: 201-209 (1987), Grau et al., Dev. Biol. 122: 186-200 (1987), Preat et al. (Genetics 135: 1047-1062 (1993)), Sisson et al. Cell 90: 235-245 (1997) and Robbins ( Robbins et al., Cell 90: 225-234 (1997).

Herein, the inventors have identified and described the cDNA encoding the human coastal-2 homolog polypeptide (designated herein as PRO539).

3.PRO982

Both industry and academia are working to find new natural secreted proteins. Much effort has been focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Herein, the inventors describe the identification and characterization of novel secreted polypeptides (named herein PRO982 polypeptides).

4.PRO1434

The nel gene is known to encode a protein expressed in chicken nervous tissue (Watanabe et al., Genomics 38 (3): 273-276 (1996)). Recently, two new human cDNAs (named NELL1 and NELL2), encoding polypeptides homologous to the polypeptides encoded by the chicken's Nell gene and comprising six EGF-like repeats, have been identified and characterized. Watanabe et al., Supra. When such genes are expressed neuron-specific, it is believed that these genes may play a role in neural development. Thus, there is considerable interest in identifying and characterizing NELL1 and NELL2, new polypeptides homologous to Nell.

Herein, the inventors describe the identification and characterization of novel polypeptides that are homologous to the Nell protein (named PRO1434 polypeptide herein).

5. PRO1863

Both industry and academia are working to find new natural transmembrane proteins. Much effort is focused on screening mammalian recombinant DNA libraries to find coding sequences for novel transmembrane proteins. Herein, the inventors describe the identification and characterization of novel transmembrane polypeptides, herein designated PRO1863 polypeptides.

6.PRO1917

Characterization of inositol phosphatase is of interest because it is the basis for understanding the signaling activity that stimulates the release of Ca ²⁺ from endoplasmic reticulum. It is possible to confirm multiple inositol polyphosphate phosphatase that is highly expressed in the kidney and liver by molecular cloning (Craxton et al. (1997) Biochem J. 328: 75-81).

7.PRO1868

The inflammatory response is complex and mediated by various signaling molecules produced locally by mast cells, nerve endings, platelets, white blood cells and complement activation. Some of these signaling molecules make the endothelial cell layer more porous (or make the endothelial cell layer recognize specific carbohydrates and express selectins that act as cell surface molecules that recognize and attract white blood cells). Stronger leukocyte binding is mediated by integrins that mediate leukocyte migration through the endothelium. Other signaling molecules act as chemoattractants, causing the bound white blood cells to move toward the source of chemotaxis. Other signaling molecules produced during the course of the inflammatory response leave the blood and stimulate the bone marrow to produce more white blood cells and release them into the bloodstream.

Typically, inflammation is initiated by an antigen, which can actually be any molecule capable of initiating an immune response. Under normal physiological conditions, these are foreign molecules, but molecules produced by the organism itself can also act as catalysts known to be present in the symptoms of various diseases.

T-cell proliferation is the culture of mixed lymphocytes or mixed lymphocyte responses (MLRs) are established guidelines for the ability of compounds to stimulate the immune system. In an inflammatory response, the leukocytes that respond may be neutrophils, eosinophils, monocytes, or lymphocytes. Histological examination of affected tissues provides evidence of immune stimulatory or inhibitory responses (see Current Protocols in Immunology, ed John E. Coligan, 1994, John Wiley and Sons, Inc.).

Inflammatory bowel disease (IBD) is a general description of intestinal diseases, including ulcerative colitis (UC) and Crohn's disease (both of which are classified as separate diseases but have common characteristics and may have common symptoms). Is the term used for As a general diagnostic criterion, it is difficult to determine exactly whether the patient has any of these two diseases (typically the type and location of the lesion in each disease). A characteristic UC lesion is a superficial ulcer of the mucosa, which appears in the colon near the rectum. CD lesions are characterized by a wide range of linear fissures, which can sometimes appear anywhere in the intestine, including the stomach, esophagus and duodenum.

Conventional treatments for IBD generally include anti-inflammatory or immunosuppressive substances that only partially relieve the subject's pain, such as sulfasalazine, corticosteroids, 6-mercaptopurine / azatoprine, or cyclospores. Administering phosphorus. However, if anti-inflammatory / immune suppression therapy fails, colon resection is the last line of defense. About 30% of CD patients should have surgery within one year of diagnosis, and the likelihood of surgery increases thereafter by about 5% each year. Unfortunately, CD also shows high recurrence rates, as about 5% of patients have to be reoperated after the first year of surgery. In addition, UC patients are actually at high risk for colorectal cancer. Perhaps this is due to a relapse cycle in which the epithelium is damaged and then regrows, which continues to increase the risk of tumorous deformity.

One element of a recently discovered immunoglobulin macrofamily known as the Junctional Adhesion Molecule (JAM) has been found to be selectively concentrated in the intercellular junctions of endothelial and epithelial cells of different origins [Martin-Par] Martin-Padura, I. et al., J. Cell Biol. 142 (1): 117-27 (1998)]. JAM is a type I endogenous membrane protein with two extracellular chain disulfide loops of the V-type. JAM is indeed homologous to the A33 antigen (FIG. 1 or 18). Monoclonal antibodies directed to JAM have been found to inhibit the passage of endothelial monolayers of spontaneous chemokine-induced monocytes in vitro (Martin-Padura supsup).

The expression of JAM has recently been found to increase in the colon of CRF2-4 − / − mice with colitis. CRF2-4-/-(IL-10R subunit knockout mice) develop spontaneous colitis mediated by lymphocytes, monocytes and neutrophils. As a result, it can be predicted that the compounds of the present invention increase or are associated with expression levels in human diseases such as inflammatory bowel disease, other inflammatory bowel disease and colorectal cancer.

The compounds of the present invention also show significant homology with the A33 antigen, a known colorectal cancer-related marker. The A33 antigen is expressed in at least 90% of the epithelium of primary or metastatic colon cancer and normal colon. In tumors occurring in the mucosa of the colon, the A33 antigen is uniformly expressed in at least 95% of all cases. However, the A33 antigen is not detected in a wide range of other normal tissues, ie its expression appears to be organ specific. Thus, the A33 antigen appears to play an important role in the induction of colorectal cancer.

Since colon cancer is a frequent disease, early diagnosis and treatment are medically important targets. Monoclonal antibodies (mAbs), which may be specific because they have fluorescent, nuclear magnetic or radioactive tags, can be used to diagnose and treat colon cancer. Radioactive genes, toxins and / or drug-tagged. The mAb can be used to treat patients with early symptoms. MAbs can also be used for diagnostics during the diagnosis and treatment of colon cancer. For example, if the serum level of the patient's A33 antigen is increased, this drop after surgery indicates successful resection of the tumor. On the other hand, an increase in serum A33 antigen levels after surgery suggests that the first tumor may metastasize or a new primary tumor may appear.

Such monoclonal antibodies can be used in place of surgery or in combination with surgery and / or other chemotherapy. For example, a preclinical analysis and local study of patients infected with colorectal cancer using the mAb for A33 is described in Welt et al., J. Clin. Oncol. 8: 1894-1906 (1990) and Welt et al., J. Clin. Oncol. 12: 1561-1571 (1994), and U.S. Patent Nos. 4,579,827 and U.S.S.N. No. 424,991 (European Patent No. 199,141) relates to the therapeutic administration of monoclonal antibodies, the latter of which relates to the use of anti-A33 mAbs.

Here, we describe the identification and characterization of novel polypeptides that are homologous to the A33 antigen protein (named PRO1868 polypeptide herein).

8.PRO3434

Both industry and academia are working to find new natural secreted proteins. Much effort has been focused on screening mammalian recombinant DNA libraries to find coding sequences for novel secreted proteins. Herein, the inventors describe the identification and characterization of novel secreted polypeptides, designated herein as PRO3434 polypeptides.

9.PRO1927

Proteins are glycosylated by a complex set of reactions mediated by membrane bound glycosyltransferases. There are many different glycosyltransferases that arrange the synthesized carbohydrate structure. N-acetylglucosaminyltransferase proteins include a group of glycosyltransferases that provide a variety of important biological functions in mammalian organisms. As an example, UDP-N-acetylglucosamine: alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a hybrid complex N-glycan of mannose-containing N-glycans. Is a glycosyltransferase that catalyzes the first step necessary in the conversion of Sarkar et al., Proc. Natl. Acad. Sci. USA. 88: 234-238 (1991)]. UDP-N-acetylglucosamine: alpha 1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase is an essential enzyme for the production of tri- and tetra-antennae asparagine-linked sugar chains, Recently, cDNA cloning was used to purify the small intestine of the bovine [Minowa et al., J. Biol. Chem. (1998) 273 (19): 11556-62]. It is of interest to identify and characterize other elements of the N-acetylglucosaminyltransferase protein family, more generally to identify novel glycosyltransferases.

<Overview of invention>

1.PRO1800

We have found a cDNA clone (DNA35672-2508) that is homologous to a nucleic acid encoding Hep27 protein and encodes a new polypeptide (named "PRO1800" herein).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1800 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1800 polypeptide having a sequence of about 1 or about 16 to about 278 amino acid residues in FIG. 2 (SEQ ID NO: 2) or (b) the DNA of (a) DNAs having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% of the molecules with the complement.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1800 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between about 36 or about 81 and about 869 of the nucleotide of FIG. 1 (SEQ ID NO: 1).

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203538 (DNA35672-2508) or (b) complementary to the nucleic acid molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203538 (DNA35672-2508).

In another aspect, the invention provides that (a) at least about 80%, preferably at least about 85%, and more preferably, at least about 80% sequence identity with amino acid residue 1 or the sequence of about 16 to about 278 of FIG. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the invention provides a DNA that encodes a PRO1800 polypeptide having at least 230 nucleotides and, under stringent conditions, a test DNA molecule (a) having amino acid residue 1 of FIG. 2 (SEQ ID NO: 2) or a sequence from about 16 to about 278. Hybridize with the complement of the molecule or DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably about 90 At least%, most preferably at least about 95%, relates to an isolated nucleic acid molecule produced by isolating test DNA molecules.

In certain aspects, the invention provides an isolated nucleic acid molecule comprising or complementary to DNA encoding a PRO1800 polypeptide with or without an N-terminal signal sequence and / or starting methionine. Experiments have shown that the signal peptide spans from about 1 to about 15 amino acid positions in the sequence of FIG. 2 (SEQ ID NO: 2).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, and more preferably at least about 80 as compared to residue 1 of Figure 2 (SEQ ID NO: 2) or the amino acid sequence of about 16 to about 278 At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1800 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length, It can be derived from the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1).

In another embodiment, the present invention provides an isolated PRO1800 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO1800 polypeptide, which in some embodiments comprises the amino acid sequence comprising residue 1 or about 16 to about 278 of FIG. 2 (SEQ ID NO: 2).

In another aspect, the present invention provides that sequence identity with amino acid residue 1 of Figure 2 (SEQ ID NO: 2) or with a sequence from about 16 to about 278 is at least about 80%, preferably at least about 85%, more preferably at least about 90% Above, most preferably, it is directed to an isolated PRO1800 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, and more preferably about 90% or more, as compared to residue 1 of Figure 2 (SEQ ID NO: 2) or the amino acid sequence of about 16 to about 278 , Most preferably, at least about 95% comprising an isolated PRO1800 polypeptide comprising an amino acid sequence that is recorded as positive.

In another aspect, the invention provides an isolated PRO1800 polypeptide comprising the amino acid residue 1 of Figure 2 (SEQ ID NO: 2) or a sequence from about 16 to about 278, or a fragment thereof sufficient to provide a binding site for an anti-PRO1800 antibody. It is about. Preferably, the PRO1800 fragment retains the qualitative biological activity of the native PRO1800 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO1800 polypeptide having a sequence of about 1 or about 16 to about 278 amino acid residues in FIG. 2 (SEQ ID NO: 2) or (b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably Preferably at least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) removing the polypeptide from the cell culture. It provides a polypeptide produced by the step of recovering.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1800 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1800 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1800 polypeptide by contacting the native PRO1800 polypeptide with a candidate molecule and monitoring the biological activity mediated by the polypeptide.

In another embodiment, the invention relates to a composition comprising a PRO1800 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

2.PRO539

We found a cDNA clone (DNA47465-1561) that is homologous to the nucleic acid encoding the Coastal-2 protein and encodes a new polypeptide (designated herein as "PRO539").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO539 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO539 polypeptide having a sequence from about 1 to about 830 amino acid residues in FIG. 4 (SEQ ID NO: 7) or (b) a complement of the DNA molecule of (a) above. DNA having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO539 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between nucleotides about 186 and about 2675 of FIG. 3 (SEQ ID NO: 6). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203661 (DNA47465-1561) or (b) complementary to the nucleic acid molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203661 (DNA47465-1561).

In another aspect, the invention provides that (a) at least about 80%, preferably at least about 85%, and more preferably at least about 90% sequence identity with the sequence of amino acid residues 1 to about 830 of FIG. 4 (SEQ ID NO: 7). At least%, most preferably at least about 95%, of a DNA encoding a polypeptide or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

In another aspect, the present invention provides a DNA molecule encoding a PRO539 polypeptide having a sequence of amino acid residues 1 to about 830 of (a) in FIG. b) hybridizing with the complement of the DNA molecule of (a), wherein the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably about At least 90%, most preferably at least about 95%, relates to an isolated nucleic acid molecule produced by isolating test DNA molecules.

In certain aspects, the invention provides an isolated nucleic acid molecule comprising or complementary to DNA encoding a PRO539 polypeptide with or without starting methionine.

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, more preferably at least about 90% as compared to the amino acid sequence of residues 1 to about 830 of FIG. 4 (SEQ ID NO: 7). , Most preferably at least about 95% is directed to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide that is recorded as positive or (b) the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO539 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length, It can be derived from the nucleotide sequence shown in Figure 3 (SEQ ID NO: 6).

In another embodiment, the present invention provides an isolated PRO539 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO539 polypeptide, which in some embodiments comprises an amino acid sequence comprising residues 1 to about 830 of FIG. 4 (SEQ ID NO: 7).

In another aspect, the invention provides that sequence identity with the sequences of amino acid residues 1 to about 830 of Figure 4 (SEQ ID NO: 7) is at least about 80%, preferably at least about 85%, more preferably at least about 90%, most Preferably, it relates to an isolated PRO539 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the present invention provides at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably, as compared to the amino acid sequence of residues 1 to about 830 of Figure 4 (SEQ ID NO: 7). Preferably, it relates to an isolated PRO539 polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as being positive.

In another aspect, the invention relates to an isolated PRO539 polypeptide comprising the sequence of amino acid residues 1 to about 830 of FIG. 4 (SEQ ID NO: 7), or a fragment thereof sufficient to provide a binding site for an anti-PRO539 antibody. . Preferably, the PRO539 fragment retains the qualitative biological activity of the native PRO539 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO539 polypeptide having a sequence from about 1 to about 830 amino acid residues in FIG. 4 (SEQ ID NO: 7) or (b) Hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably about At least 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. It provides a polypeptide produced by.

In another embodiment, the present invention relates to agonists and antagonists of native PRO539 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO539 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO539 polypeptide by contacting the native PRO539 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide. In a preferred embodiment, biological activity refers to the ability to bind microtubules or to complex with fused and cubitus interruptus.

In another embodiment, the invention relates to a composition comprising a PRO539 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

In another embodiment, the present invention provides compounds and methods for developing antagonists against the regulation of hedgehog signaling by PRO539 and agonists that promote this regulation. In particular, antagonists of vertebrate PRO539 that block, block, inhibit, and / or lose the normal function of PRO539 in the SH signaling pathway include both small bioorganic molecules and antisense nucleotides.

In another embodiment, the present invention provides a selectively spliced human PRO539 variant.

In another embodiment, the present invention provides a screening method or assay for identifying molecules that alter the regulation of hedgehog signaling by PRO539. Preferably, this molecule interferes with the interaction of PRO539 with the protein that forms the complex (eg, fused or cubitus interruptus) or prevents or inhibits the separation of the complex. This analysis includes incubating the mixture comprising PRO539 and the substrate with the candidate molecule and investigating the candidate molecule's ability to modulate PRO539 hedgehog signaling. The screened molecules are drug candidates that are preferably small molecules.

In another embodiment, the methods of the present invention comprise (a) culturing a test cell or tissue, (b) administering a compound capable of inhibiting hedgehog signaling regulated by PRO539 and (c) hedge A diagnostic technique for determining whether a particular disease is regulated by hedgehog signaling, comprising determining whether hog signaling is regulated.

3.PRO982

We have found a cDNA clone (DNA57700-1408) encoding a new polypeptide (designated herein as "PRO982").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO982 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding amino acid residue 1 of Figure 6 (SEQ ID NO: 9) or a PRO982 polypeptide having a sequence from about 22 to about 125, or (b) the DNA molecule of (a) above. DNA having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO982 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between residues about 89 and about 400 of FIG. 5 (SEQ ID NO: 8). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203583 (DNA57700-1408) or (b) complementary to the DNA molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203583 (DNA57700-1408).

In another aspect, the present invention provides that (a) sequence identity with amino acid residue 1 of Figure 6 (SEQ ID NO: 9) or with a sequence from about 22 to about 125 is at least about 80%, preferably at least about 85%, more preferably Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the present invention has at least about 50, preferably at least about 100 nucleotides and, under stringent conditions, the test DNA molecule may comprise (a) amino acid residue 1 of FIG. 6 (SEQ ID NO: 9) or from about 22 to about 125 A DNA molecule encoding a PRO982 polypeptide having a sequence or (b) hybridizes with the complement of the DNA molecule of (a), wherein the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably Preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%, to an isolated nucleic acid molecule produced by isolating test DNA molecules.

In certain aspects, the invention provides an isolated nucleic acid molecule comprising or complementary to DNA encoding a PRO982 polypeptide with or without an N-terminal signal sequence and / or starting methionine. Experiments have shown that the signal peptide spans from amino acid position about 1 to about 21 in the sequence of FIG. 6 (SEQ ID NO: 9).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, and more preferably at least about 80 as compared to residue 1 of Figure 6 (SEQ ID NO: 9) or the amino acid sequence of At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO982 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the present invention provides an isolated PRO539 polypeptide encoded by any of the isolated nucleic acid sequences defined above.

In certain aspects, the invention provides an isolated native sequence PRO982 polypeptide, which in some embodiments comprises the amino acid sequence comprising residues 1 or about 22-125 of FIG. 6 (SEQ ID NO: 9).

In another aspect, the invention provides that sequence identity with amino acid residue 1 of Figure 6 (SEQ ID NO: 9) or with a sequence from about 22 to about 125 is at least about 80%, preferably at least about 85%, more preferably at least about 90% Above, most preferably, it is directed to an isolated PRO982 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, more preferably about 90% or more, as compared to residue 1 of Figure 6 (SEQ ID NO: 9) or the amino acid sequence of about 22 to 125, Most preferably, it is directed to an isolated PRO982 polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as being positive.

In another aspect, the invention relates to an isolated PRO982 polypeptide comprising amino acid residue 1 of Figure 6 (SEQ ID NO: 9) or a sequence from about 22 to about 125, or a fragment thereof sufficient to provide a binding site for a PRO982 antibody will be. Preferably, the PRO982 fragment retains the qualitative biological activity of the native PRO982 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO982 polypeptide having a sequence of about 1 or about 22 to about 125 amino acid residues in FIG. 6 (SEQ ID NO: 9) or (b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably Preferably at least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) removing the polypeptide from the cell culture. It provides a polypeptide produced by the step of recovering.

4.PRO1434

We found a cDNA clone (DNA68818-2536) that is homologous to the nucleic acid encoding the Nel protein and encodes a new polypeptide (named herein "PRO1434").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding the PRO1434 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1434 polypeptide having a sequence of about 1 or about 28 to about 325 amino acid residues in FIG. 8 (SEQ ID NO: 11) or (b) the DNA of (a) DNAs having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% of the molecules with the complement.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1434 polypeptide comprising DNA that hybridizes with the complement of a nucleotide of about 581 or about 662 and about 1555 of the nucleotide of FIG. 7 (SEQ ID NO: 10). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203657 (DNA68818-2536) or (b) complementary to the nucleic acid molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203657 (DNA68818-2536).

In another aspect, the present invention provides that (a) sequence identity with amino acid residue 1 of Figure 8 (SEQ ID NO: 11) or with a sequence from about 28 to about 325 is at least about 80%, preferably at least about 85%, more preferably Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the present invention provides a DNA that encodes a PRO1434 polypeptide having at least 65 nucleotides and, under stringent conditions, a test DNA molecule (a) having amino acid residue 1 of FIG. 8 (SEQ ID NO: 11) or a sequence from about 28 to about 325. At least about 80%, preferably at least about 85%, and more preferably hybridize with the molecule or (b) the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) Preferably at least about 90%, most preferably at least about 95%, an isolated nucleic acid molecule produced by isolating a test DNA molecule.

In certain aspects, the present invention includes or is capable of encoding DNA that encodes a PRO1434 polypeptide and its soluble variant (ie, the transmembrane domain is deleted or inactivated) with or without an N-terminal signal sequence and / or initiating methionine. An isolated nucleic acid molecule is provided that is complementary to a coding nucleic acid molecule. Experiments have shown that the signal peptide spans from about 1 to about 27 amino acid positions in the sequence of FIG. 8 (SEQ ID NO: 11).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, and more preferably at least about 80 when compared to residue 1 of Figure 8 (SEQ ID NO: 11) or the amino acid sequence of about 28 to about 325 At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1434 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length, It can be derived from the nucleotide sequence shown in Figure 7 (SEQ ID NO: 10).

In another embodiment, the present invention provides an isolated PRO1434 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the present invention provides an isolated native sequence PRO1434 polypeptide, which in some embodiments comprises the amino acid sequence comprising residue 1 or about 28 to about 325 of FIG. 8 (SEQ ID NO: 11).

In another aspect, the present invention provides that sequence identity with amino acid residue 1 of Figure 8 (SEQ ID NO: 11) or with a sequence from about 28 to about 325 is at least about 80%, preferably at least about 85%, more preferably at least about 90% Above, most preferably, it is directed to an isolated PRO1434 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, and more preferably about 90% or more when compared to residue 1 of Figure 8 (SEQ ID NO: 11) or the amino acid sequence of about 28 to about 325 And, most preferably, to an isolated PRO1434 polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as being positive.

In another aspect, the invention provides an isolated PRO1434 polypeptide comprising a sequence of amino acid residue 1 of Figure 8 (SEQ ID NO: 11) or from about 28 to about 325, or a fragment thereof sufficient to provide a binding site for an anti-PRO1434 antibody It is about. Preferably, the PRO1434 fragment retains the qualitative biological activity of the native PRO1434 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO1434 polypeptide having a sequence of about 1 or about 28 to about 325 amino acid residues in FIG. 8 (SEQ ID NO: 11), or (b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably At least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. It provides a polypeptide produced by the step of.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1434 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1434 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1434 polypeptide by contacting the native PRO1434 polypeptide with a candidate molecule and monitoring the biological activity mediated by the polypeptide.

In another embodiment, the present invention relates to a composition comprising a PRO1434 polypeptide or an agonist or antagonist as defined above together with a pharmaceutically acceptable carrier.

5. PRO1863

We have found a cDNA clone (DNA59847-2510) encoding a new transmembrane polypeptide (designated herein as "PRO1863").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1863 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1863 polypeptide having a sequence of about 1 or about 16 to about 437 amino acid residues in FIG. 10 (SEQ ID NO: 16) or (b) the DNA of (a) DNAs having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% of the molecules with the complement.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1863 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between about 17 or about 62 and about 62 and about 1327 nucleotides of FIG. 9 (SEQ ID NO: 15). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203576 (DNA59847-2510) or (b) complementary to the nucleic acid molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203576 (DNA59847-2510).

In another aspect, the invention provides that (a) at least about 80%, preferably at least about 85%, more preferably sequence identity with amino acid residue 1 of Figure 10 (SEQ ID NO: 16) or the sequence from about 16 to about 437 Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the present invention provides a DNA that encodes a PRO1863 polypeptide having at least 345 nucleotides and, under stringent conditions, a test DNA molecule (a) having amino acid residue 1 of FIG. 10 (SEQ ID NO: 16) or a sequence from about 16 to about 437. At least about 80%, preferably at least about 85%, and more preferably hybridize with the molecule or (b) the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) Preferably at least about 90%, most preferably at least about 95%, an isolated nucleic acid molecule produced by isolating a test DNA molecule.

In certain aspects, the present invention includes or is capable of encoding DNA that encodes a PRO1863 polypeptide with or without an N-terminal signal sequence and / or initiating methionine and a soluble variant thereof (ie, the transmembrane domain is deleted or inactivated). An isolated nucleic acid molecule is provided that is complementary to a coding nucleic acid molecule. Experiments have confirmed that the signal peptide spans from about 1 to about 17 amino acid positions in the sequence of FIG. 10 (SEQ ID NO: 16). Experiments have confirmed that the transmembrane domain spans from about 243 amino acid positions from about 243 in the PRO1863 amino acid sequence (FIG. 10, SEQ ID NO: 16).

In another aspect, the present invention provides an antibody comprising (a) at least about 80%, preferably at least about 85% and more preferably at least about 80 when compared to residue 1 of Figure 10 (SEQ ID NO: 16) or the amino acid sequence of about 16 to about 437 At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1863 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length, It can be derived from the nucleotide sequence shown in Figure 9 (SEQ ID NO: 15).

In another embodiment, the present invention provides an isolated PRO1863 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO1863 polypeptide which, in some embodiments, comprises an amino acid sequence comprising residue 1 or about 16 to about 437 of FIG. 10 (SEQ ID NO: 16).

In another aspect, the present invention provides that sequence identity with amino acid residue 1 of Figure 10 (SEQ ID NO: 16) or with a sequence from about 16 to about 437 is at least about 80%, preferably at least about 85%, more preferably at least about 90% Above, most preferably, it is directed to an isolated PRO1863 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, and more preferably about 90% or more when compared to residue 1 of Figure 10 (SEQ ID NO: 16) or the amino acid sequence of about 16 to about 437 , Most preferably, at least about 95% comprising an isolated PRO1863 polypeptide comprising an amino acid sequence that is recorded as positive.

In another aspect, the invention provides an isolated PRO1863 polypeptide comprising the amino acid residue 1 of Figure 10 (SEQ ID NO: 16) or a sequence from about 16 to about 437, or a fragment thereof sufficient to provide a binding site for an anti-PRO1863 antibody. It is about. Preferably, the PRO1863 fragment retains the qualitative biological activity of the native PRO1863 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO1863 polypeptide having a sequence of about 1 or about 16 to about 437 amino acid residues in FIG. 10 (SEQ ID NO: 16) or (b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably Preferably at least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) removing the polypeptide from the cell culture. It provides a polypeptide produced by the step of recovering.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1863 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1863 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1863 polypeptide by contacting the native PRO1863 polypeptide with a candidate molecule and monitoring the biological activity mediated by the polypeptide.

In another embodiment, the present invention relates to a composition comprising a PRO1863 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

6.PRO1917

We have found a cDNA clone (DNA76400-2528) that encodes a new polypeptide (named "PRO1917" herein) that is homologous to inositol phosphatase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1917 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding amino acid residue 1 of Figure 12 (SEQ ID NO: 18) or a PRO1917 polypeptide having a sequence from about 31 to about 487, or (b) the DNA molecule of (a) above. DNA having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1917 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between residues about 96 and about 1466 of FIG. 11 (SEQ ID NO: 17). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203573 (DNA76400-2528) or (b) complementary to the DNA molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203573 (DNA76400-2528).

In another aspect, the invention provides that (a) at least about 80%, preferably at least about 85%, and more preferably, at least about 80% sequence identity with amino acid residue 1 of FIG. 12 (SEQ ID NO: 18) Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the present invention has at least about 50, preferably at least about 100 nucleotides and, under stringent conditions, a test DNA molecule may comprise (a) amino acid residue 1 of FIG. 12 (SEQ ID NO: 18) or from about 31 to about 487 A DNA molecule encoding a PRO1917 polypeptide having a sequence or (b) hybridizes with the complement of the DNA molecule of (a), wherein the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably Preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%, to an isolated nucleic acid molecule produced by isolating test DNA molecules.

In certain aspects, the invention provides an isolated nucleic acid molecule comprising or complementary to DNA encoding a PRO1917 polypeptide with or without an N-terminal signal sequence and / or starting methionine. Experiments confirmed that the signal peptide spans about 30 from amino acid position 1 in the sequence of FIG. 12 (SEQ ID NO: 18).

In another aspect, the present invention provides an antibody comprising (a) at least about 80%, preferably at least about 85% and more preferably at least about 80 when compared to residue 1 of FIG. At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1917 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the present invention provides an isolated PRO1917 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO1917 polypeptide, which in some embodiments comprises the amino acid sequence comprising residue 1 or about 31 to about 487 of FIG. 12 (SEQ ID NO: 18).

In another aspect, the present invention provides that sequence identity with amino acid residue 1 of FIG. 12 (SEQ ID NO: 18) or the sequence of about 31 to about 487 is at least about 80%, preferably at least about 85%, more preferably about 90% Above, most preferably, it is directed to an isolated PRO1917 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, and more preferably about 90% or more when compared to residue 1 of Figure 12 (SEQ ID NO: 18) or the amino acid sequence of about 31 to about 487 And, most preferably, to an isolated PRO1917 polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as being positive.

In another aspect, the invention provides an isolated PRO1917 polypeptide comprising the amino acid residue 1 of Figure 12 (SEQ ID NO: 18) or a sequence from about 31 to about 487, or a fragment thereof sufficient to provide a binding site for an anti-PRO1917 antibody. It is about. Preferably, the PRO1917 fragment retains the qualitative biological activity of the native PRO1917 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO1917 polypeptide having an amino acid residue 1 of FIG. 12 (SEQ ID NO: 18) or a sequence from about 31 to about 487 or ( b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably At least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. It provides a polypeptide produced by the step of.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1917 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO1917 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1917 polypeptide by contacting the native PRO1917 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In another embodiment, the invention relates to a composition comprising a PRO1917 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

7.PRO1868

The present invention relates to compositions and methods for diagnosing and treating inflammatory diseases in mammals, including humans. The present invention is based on identifying proteins (including agonist and antagonist antibodies) that stimulate or inhibit an immune response in mammals. Inflammatory diseases can be treated by inhibiting the inflammatory response. Molecules that increase the inflammatory response stimulate or increase the immune response to the antigen. If it is beneficial to inhibit the inflammatory response, it may inhibit the molecule that stimulates the inflammatory response. If it is beneficial to increase the inflammatory response, molecules that stimulate the inflammatory response can be used in therapy. If it is useful to inhibit the inflammatory response, it may be possible to suppress these irritating molecules. Neutralizing antibodies are examples of molecules that inhibit molecules with immune stimulatory activity, which antibodies would be beneficial in the treatment of inflammatory diseases. Inflammatory diseases can also be ameliorated by inhibiting the inflammatory response using molecules that inhibit the inflammatory response (either directly or through the use of antibody agonists).

Thus, the proteins of the present invention are useful in the diagnosis and / or treatment (including prevention) of immune related diseases. Antibodies that bind to stimulatory proteins are useful for inhibiting inflammatory responses. Antibodies that bind to inhibitory proteins are useful for stimulating inflammatory responses and the immune system. In addition, the proteins and antibodies of the invention are useful for preparing drugs and drugs for the treatment of inflammation and immune related diseases.

In one embodiment, the invention relates to antagonists and agonists of PRO1868 polypeptide that inhibit one or more functions or activities of the PRO1868 polypeptide.

In another embodiment, the present invention is directed to a method of determining the presence of a PRO1868 polypeptide comprising exposing a cell suspected of comprising a PRO1868 polypeptide to an anti-PRO1868 antibody and determining binding of the antibody to the cell. .

In another embodiment, the invention relates to detecting the expression level of a gene encoding a PRO1868 polypeptide in (a) a test sample of tissue cells obtained from a mammal and (b) a control sample of known normal tissue cells of the same cell type. Including a method of diagnosing an inflammation related disease in a mammal, wherein a high level of expression in a test sample indicates the presence of an inflammatory disease in the subject mammal.

In another embodiment, the invention comprises (a) contacting an anti-PRO1868 antibody with a test sample of tissue culture cells obtained from a mammal and (b) detecting the formation of the complex of the antibody with the PRO1868 polypeptide. A method of diagnosing an inflammatory disease in an animal. The detection method can be qualitative or quantitative and can be performed by comparing the formation of the complex in a control sample of known normal tissue cells of the same cell type. Large amounts of complexes formed in the test sample indicate the presence of tumors in the mammal from which the test tissue cells were obtained. The antibody preferably comprises a detectable label. Formation of the complex can be monitored, for example, by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. Test samples are generally obtained from individuals suspected of having deficiencies or abnormalities associated with an inflammatory response.

In another embodiment, the invention relates to a diagnostic kit comprising an anti-PRO1868 antibody and a carrier (eg, a buffer) in a suitable container. This kit preferably contains instructions for using an antibody to detect the PRO1868 polypeptide.

In another embodiment, the present invention provides a container comprising: a container; Label on container; And a composition comprising an active substance contained in a container, wherein the composition is effective to stimulate or inhibit an inflammatory response in a mammal, and a label on the container can be used to treat an inflammatory disease using the composition. Active agent in the composition is a substance that stimulates or inhibits the expression and / or activity of the PRO1868 polypeptide. In a preferred aspect, the active agent is a PRO1868 polypeptide or an anti-PRO1868 antibody.

Another embodiment relates to a method for identifying a compound capable of inhibiting the expression and / or activity of a PRO1868 polypeptide by contacting the candidate compound with the PRO1868 polypeptide for a period of time under conditions sufficient for the candidate compound and the PRO1868 polypeptide to interact. will be. In certain aspects, the candidate compound or PRO1868 polypeptide is immobilized on a solid phase support. In another aspect, the non-fixed component comprises a detectable label.

In another aspect, the present invention, inflammatory bowel disease, systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, spondyloarthropathy, systemic sclerosis (sclerosis), idiopathic inflammatory myopathy (dermatitis, polymyositis), Sjogren ( Sjogren's syndrome, systemic vesicles, pseudosarcoma, autoimmune hemolytic anemia (immune prothrombocytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis Central and peripheral nervous system such as Grave's disease, Hashimoto's thyroiditis, juvenile lymphoma thyroiditis, atrophic thyroiditis, diabetes, immune-mediated nephropathy (glomerulonephritis, tubulointerstitial nephritis), multiple sclerosis Disease, idiopathic polyneuropathy, infectious hepatitis (A, B, C, D, E, and other non-hepatic viral hepatitis) Hepatobiliary diseases, autoimmune chronic active hepatitis, primary gallbladder cirrhosis, granulomatous hepatitis, and sclerotic cholangitis, inflammatory and fibrotic lung diseases (e.g. cystic fibrosis, eosinophilic pneumonia, idiopathic pulmonary fibrosis and irritable pneumonia) ), Gluten-sensitive bowel disease, Whipple's disease, bullous skin disease, erythema polymorphism and contact dermatitis, autoimmune or immune-mediated skin diseases, psoriasis, eosinophilic pneumonia, idiopathic pulmonary fibrosis and A method for treating an inflammatory disease by administering to a subject in need thereof a therapeutically effective amount of a PRO1868 antagonist to treat a disease selected from transplant related diseases, including allergic diseases of the lung, graft rejection and graft versus host reaction. .

In another embodiment, the present invention comprises detecting the expression level of a gene encoding a PRO1868 polypeptide in (a) a test sample of tissue cells obtained from a mammal and (b) a control sample of known normal tissue cells of the same cell type. A method of diagnosing a tumor in a mammal is provided, wherein a high level of expression in the test sample indicates the presence of the tumor in the mammal from which the test tissue cell was obtained.

In another embodiment, the invention comprises (a) contacting an anti-PRO1868 antibody with a test sample of tissue cells obtained from a mammal and (b) detecting complex formation of the anti-PRO1868 and PRO1868 polypeptide in the test sample. To provide a method for diagnosing a tumor in a mammal. The detection method can be qualitative or quantitative and can be performed by comparing the formation of the complex in a control sample of known normal tissue cells of the same cell type. A large amount of complex formed in the test sample indicates the presence of tumors in the mammal from which the test tissue cells were obtained. The antibody preferably comprises a detectable label. Formation of the complex can be monitored, for example, by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. Preferably, the test sample is obtained from a mammalian individual in whom tumor cells (eg, cancer cells) are supposed to grow or proliferate.

In another embodiment, the present invention provides a cancer diagnostic kit comprising an anti-PRO1868 antibody and a carrier (eg, a buffer) in a suitable container. This kit preferably contains instructions for using an antibody to detect the PRO1868 polypeptide.

In another embodiment, the present invention provides a method of inhibiting growth of tumor cells, comprising exposing cells overexpressing PRO1868 polypeptide to an effective amount of a substance that inhibits expression and / or activity of the PRO1868 polypeptide. do. This material is preferably an anti-PRO1868 polypeptide, small organic and inorganic peptides, phosphopeptides, antisense or ribozyme molecules, or triple helical molecules. In certain aspects, this substance, such as an anti-PRO1868 antibody, induces cell death. In another aspect, tumor cells are also exposed to radiation treatment and / or cytotoxic or chemotherapeutic agents.

In another embodiment, the present invention provides a container comprising: a container; Label on container; And a composition comprising an active substance contained in a container, wherein the composition is effective to inhibit the growth of tumor cells, wherein the label on the container is characterized by overexpression of the PRO1868 polypeptide using the composition. The active substance in the composition is a substance that inhibits the expression and / or activity of the PRO1868 polypeptide. In a preferred aspect, the active agent is an anti-PRO1868 antibody.

We found a cDNA clone (DNA77624-2515) that is homologous to a nucleic acid encoding the A33 antigen and encodes a new polypeptide (named "PRO1868" herein).

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1868 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO1868 polypeptide having a sequence of about 1 or about 31 to about 310 amino acid residues in Figure 14 (SEQ ID NO: 20) or (b) the DNA of (a) DNAs having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% of the molecules with the complement.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1868 polypeptide comprising DNA that hybridizes with the complement of a nucleotide about 51 or a nucleic acid between about 141 and about 980 of FIG. 13 (SEQ ID NO: 19). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203553 (DNA77624-2515) or (b) complementary to the nucleic acid molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203553 (DNA77624-2515).

In another aspect, the invention provides that (a) at least about 80%, preferably at least about 85%, more preferably sequence identity with amino acid residue 1 of Figure 14 (SEQ ID NO: 20) or the sequence from about 31 to about 310 Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the invention provides a DNA that encodes a PRO1868 polypeptide having at least 390 nucleotides and, under stringent conditions, a test DNA molecule (a) having amino acid residue 1 of FIG. 14 (SEQ ID NO: 20) or a sequence from about 31 to about 310. At least about 80%, preferably at least about 85%, and more preferably hybridize with the molecule or (b) the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) Preferably at least about 90%, most preferably at least about 95%, an isolated nucleic acid molecule produced by isolating a test DNA molecule.

In certain aspects, the present invention includes or may include DNA encoding a PRO1868 polypeptide with or without an N-terminal signal sequence and / or initiating methionine and a soluble variant thereof (ie, the transmembrane domain is deleted or inactivated). An isolated nucleic acid molecule is provided that is complementary to a coding nucleic acid molecule. Experiments confirmed that the signal peptide spans about 30 from amino acid position 1 in the sequence of FIG. 14 (SEQ ID NO: 20). Experiments have shown that the transmembrane domain spans about 263 from the amino acid position about 243 in the PRO1868 amino acid sequence (FIG. 14, SEQ ID NO: 20).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, and more preferably at least about 80 when compared to residue 1 of Figure 14 (SEQ ID NO: 20) or the amino acid sequence of At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1868 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length, It can be derived from the nucleotide sequence shown in Figure 13 (SEQ ID NO: 19).

In another embodiment, the present invention provides an isolated PRO1868 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO1868 polypeptide, which in some embodiments comprises the amino acid sequence comprising residue 1 or about 31 to about 310 of FIG. 14 (SEQ ID NO: 20).

In another aspect, the invention provides that sequence identity with amino acid residue 1 of Figure 14 (SEQ ID NO: 20) or with a sequence from about 31 to about 310 is at least about 80%, preferably at least about 85%, more preferably at least about 90% Above, most preferably, it is directed to an isolated PRO1868 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, and more preferably about 90% or more when compared to residue 1 of Figure 14 (SEQ ID NO: 20) or the amino acid sequence of about 31 to about 310 , Most preferably, at least about 95% comprising an isolated PRO1868 polypeptide comprising an amino acid sequence that is recorded as positive.

In another aspect, the invention provides an isolated PRO1868 polypeptide comprising the amino acid residue 1 of Figure 14 (SEQ ID NO: 20) or a sequence from about 31 to about 310, or a fragment thereof sufficient to provide a binding site for an anti-PRO1868 antibody. It is about. Preferably, the PRO1868 fragment retains the qualitative biological activity of the native PRO1868 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO1868 polypeptide having a sequence of about 1 or about 31 to about 310 amino acid residues in FIG. 14 (SEQ ID NO: 20), or (b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably Preferably at least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) removing the polypeptide from the cell culture. It provides a polypeptide produced by the step of recovering.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1868 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1868 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1868 polypeptide by contacting the native PRO1868 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In another embodiment, the present invention relates to a composition comprising a PRO1868 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

In another embodiment, the present invention provides a composition containing a PRO1868 polypeptide, or agonist or antagonist antibody, as a mixture with a carrier or excipient. In one aspect, the composition contains a therapeutically effective amount of a peptide or antibody. In another aspect, if the composition contains an inflammatory stimulatory molecule, the composition (a) increases the infiltration of inflammatory cells in the tissue of the mammal in need thereof, (b) stimulates an immune response in the mammal in need or Useful for increasing T-lymphocyte proliferation in response to antigen in a mammal in need thereof. In another aspect, if the composition contains an inhibitory molecule, the composition (a) reduces invasion of inflammatory cells in the tissue of the mammal in need thereof, and (b) inhibits an immune response in the mammal in need thereof. Or to reduce the proliferation of T-lymphocytes in response to antigen in a mammal in need thereof (c). In another aspect, the composition contains additional active ingredients, which may be, for example, other antibodies or cytotoxic substances or chemotherapeutic substances. Preferably the composition is sterile.

In another embodiment, the present invention relates to nucleic acids encoding anti-PRO1868 antibodies, and vectors and recombinant host cells comprising the nucleic acids. In another embodiment, the present invention provides a method of producing the antibody by culturing the host cell transformed with the nucleic acid encoding the antibody under the conditions in which the antibody is expressed and recovering the antibody from the cell culture. It is about.

8.PRO3434

We have found a cDNA clone (DNA77631-2537) encoding a new polypeptide (designated herein as "PRO3434").

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO3434 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding a PRO3434 polypeptide having the amino acid residue 1 of FIG. 16 (SEQ ID NO: 22) or a sequence from about 17 to about 1029, or (b) the DNA molecule of (a) above. DNA having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO3434 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between about 46 or about 94 and about 3132 residues of FIG. 15 (SEQ ID NO: 21). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203651 (DNA77631-2537) or (b) complementary to the DNA molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203651 (DNA77631-2537).

In another aspect, the present invention provides that (a) at least about 80%, preferably at least about 85%, and more preferably, at least about 80% sequence identity with amino acid residue 1 of FIG. Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the invention provides a test DNA molecule having at least about 460 nucleotides and which, under stringent conditions, (a) encodes a PRO3434 polypeptide having amino acid residue 1 of FIG. 16 (SEQ ID NO: 22) or a sequence from about 17 to about 1029. Hybridizing with the DNA molecule or (b) the complement of the DNA molecule of (a), wherein the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more Preferably at least about 90%, most preferably at least about 95%, it relates to an isolated nucleic acid molecule produced by isolating test DNA molecules.

In certain aspects, the invention provides an isolated nucleic acid molecule comprising or complementary to DNA encoding a PRO3434 polypeptide with or without an N-terminal signal sequence and / or starting methionine. Experiments confirmed that the signal peptide spans about 16 from amino acid position 1 in the sequence of FIG. 16 (SEQ ID NO: 22).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, and more preferably at least about 80 when compared to residue 1 of Figure 16 (SEQ ID NO: 22) or the amino acid sequence of At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO3434 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the present invention provides an isolated PRO3434 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO3434 polypeptide, which in some embodiments comprises an amino acid sequence comprising residues 1 or about 17-1029 of FIG. 16 (SEQ ID NO: 22).

In another aspect, the present invention provides that sequence identity with amino acid residue 1 of FIG. 16 (SEQ ID NO: 22) or with a sequence from about 17 to about 1029 is at least about 80%, preferably at least about 85%, more preferably about 90% Above, most preferably, it is directed to an isolated PRO3434 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, more preferably about 90% or more, as compared to residue 1 of Figure 16 (SEQ ID NO: 22) or the amino acid sequence of about 17 to 1029, Most preferably it is directed to an isolated PRO3434 polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as being positive.

In another aspect, the invention provides an isolated PRO3434 polypeptide comprising the amino acid residue 1 of Figure 16 (SEQ ID NO: 22) or a sequence from about 17 to about 1029, or a fragment thereof sufficient to provide a binding site for an anti-PRO3434 antibody It is about. Preferably, the PRO3434 fragment retains the qualitative biological activity of the native PRO3434 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO3434 polypeptide having amino acid residue 1 of FIG. 16 (SEQ ID NO: 22) or a sequence from about 17 to about 1029, or ( b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably At least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. It provides a polypeptide produced by the step of.

In another embodiment, the present invention relates to agonists and antagonists of native PRO3434 polypeptides. In certain embodiments, the agonist or antagonist is an anti-PRO3434 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO3434 polypeptide by contacting the native PRO3434 polypeptide with a candidate molecule and monitoring the biological activity mediated by the polypeptide.

In another embodiment, the invention relates to a composition comprising a PRO3434 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

9.PRO1927

We have found a cDNA clone (DNA82307-2531) that encodes a new polypeptide (designated herein as "PRO1927") homologous to glycosyltransferase.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising DNA encoding a PRO1927 polypeptide.

In one aspect, the isolated nucleic acid is (a) a DNA molecule encoding amino acid residue 1 of Figure 18 (SEQ ID NO: 24) or a PRO1927 polypeptide having a sequence from about 24 to about 548, or (b) the DNA molecule of (a) above. DNA having a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%.

In another aspect, the invention relates to an isolated nucleic acid molecule encoding a PRO1927 polypeptide comprising DNA that hybridizes with the complement of a nucleic acid between residues about 120 and about 1694 of FIG. 17 (SEQ ID NO: 23). Preferably, hybridization occurs under stringent hybridization and washing conditions.

In another aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by (a) the human protein cDNA of ATCC Accession No. 203537 (DNA82307-2531) or (b) complementary to the DNA molecule of (a) above. An isolated nucleic acid molecule comprising DNA having at least about 80%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% sequence identity with the sieve. In a preferred embodiment, the nucleic acid comprises DNA encoding the same mature polypeptide encoded by the human protein cDNA of ATCC Accession No. 203537 (DNA82307-2531).

In another aspect, the invention provides that (a) at least about 80%, preferably at least about 85%, more preferably sequence identity with amino acid residue 1 of Figure 18 (SEQ ID NO: 24) or the sequence from about 24 to about 548 Relates to an isolated nucleic acid molecule comprising a DNA encoding a polypeptide of at least about 90%, most preferably at least about 95%, or (b) the complement of the DNA of (a).

In another aspect, the present invention has at least about 50, preferably at least about 100 nucleotides and, under stringent conditions, a test DNA molecule may comprise (a) an amino acid residue 1 of FIG. 18 (SEQ ID NO: 24) or from about 24 to about 548 A DNA molecule encoding a PRO1927 polypeptide having a sequence or (b) hybridizes with the complement of the DNA molecule of (a), wherein the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably Preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95%, to an isolated nucleic acid molecule produced by isolating test DNA molecules.

In certain aspects, the present invention includes or is capable of encoding DNA that encodes a PRO1927 polypeptide with or without an N-terminal signal sequence and / or initiating methionine and soluble variants thereof (ie, the transmembrane domain is deleted or inactivated). An isolated nucleic acid molecule is provided that is complementary to a coding nucleic acid molecule. Experiments confirmed that the signal peptide spans about 23 from amino acid position 1 in the sequence of FIG. 18 (SEQ ID NO: 24). Experiments have shown that the type II transmembrane domain spans from about 6 to about 25 amino acid positions in the PRO1927 amino acid sequence (FIG. 18, SEQ ID NO: 24).

In another aspect, the invention provides an antibody comprising (a) at least about 80%, preferably at least about 85%, and more preferably at least about 80 when compared to residue 1 of Figure 18 (SEQ ID NO: 24) or the amino acid sequence of At least 90%, most preferably at least about 95% of the DNA encoding a polypeptide that is recorded as positive or (b) an isolated nucleic acid molecule comprising the complement of the DNA of (a).

Another embodiment relates to fragments of the PRO1927 polypeptide coding sequence that can be used as hybridization probes. The nucleic acid fragment is about 20 to about 80 nucleotides, preferably about 20 to about 60 nucleotides, more preferably about 20 to about 50 nucleotides, and most preferably about 20 to about 40 nucleotides in length.

In another embodiment, the present invention provides an isolated PRO1927 polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides an isolated native sequence PRO1927 polypeptide, which in some embodiments comprises the amino acid sequence comprising residue 1 or about 24 to 548 of FIG. 18 (SEQ ID NO: 24).

In another aspect, the present invention provides that sequence identity with amino acid residue 1 of FIG. 18 (SEQ ID NO: 24) or the sequence of about 24 to 548 is at least about 80%, preferably at least about 85%, more preferably at least about 90% And, most preferably, to an isolated PRO1927 polypeptide comprising an amino acid sequence that is at least about 95%.

In another aspect, the invention provides about 80% or more, preferably about 85% or more, more preferably about 90% or more, as compared to residue 1 of Figure 18 (SEQ ID NO: 24) or the amino acid sequence of about 24 to 548, Most preferably, it is directed to an isolated PRO1927 polypeptide comprising an amino acid sequence wherein at least about 95% is recorded as being positive.

In another aspect, the invention provides an isolated PRO1927 polypeptide comprising the amino acid residue 1 of Figure 18 (SEQ ID NO: 24) or a sequence of about 24 to 548, or a fragment thereof sufficient to provide a binding site for an anti-PRO1927 antibody. It is about. Preferably, the PRO1927 fragment retains the qualitative biological activity of the native PRO1927 polypeptide.

In another aspect, the invention provides an antibody comprising (i) a test DNA molecule under stringent conditions (a) a DNA molecule encoding a PRO1927 polypeptide having amino acid residue 1 of FIG. 18 (SEQ ID NO: 24) or a sequence from about 24 to about 548 (or b) hybridizing with the complement of the DNA molecule of (a), and the sequence identity of the test DNA molecule with (a) or (b) is at least about 80%, preferably at least about 85%, more preferably At least about 90%, most preferably at least about 95%, (ii) culturing the host cell comprising the test DNA molecule under conditions suitable for expression of the polypeptide, and (iii) recovering the polypeptide from the cell culture. It provides a polypeptide produced by the step of.

In another embodiment, the present invention relates to agonists and antagonists of native PRO1927 polypeptide. In certain embodiments, the agonist or antagonist is an anti-PRO1927 antibody.

In another embodiment, the present invention relates to a method for identifying an agonist or antagonist of a native PRO1927 polypeptide by contacting the native PRO1927 polypeptide with a candidate molecule and monitoring the biological activity mediated by said polypeptide.

In another embodiment, the invention relates to a composition comprising a PRO1927 polypeptide, or an agonist or antagonist as defined above, together with a pharmaceutically acceptable carrier.

10. Additional Embodiments

In another embodiment of the invention, the invention provides herein a vector comprising DNA encoding any of the polypeptides. Also provided are host cells comprising such arbitrary vectors. By way of example, the host cell may be a CHO cell, E. coli. E. coli or yeast. Also provided are methods of producing any of the polypeptides described herein, which include culturing the host cell under conditions suitable for expression of the polypeptide of interest and recovering the polypeptide of interest from the cell culture.

In another embodiment, the present invention provides chimeric molecules comprising any polypeptide described herein fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any polypeptide described herein fused with an epitope tag sequence or an Fc region of an immunoglobulin.

In another embodiment, the present invention provides antibodies that specifically bind to any of the above or below polypeptides. Optionally, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single chain antibody.

In another embodiment, the present invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, which probes can be derived from any of the above or below nucleotide sequences.

In another embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide.

In one aspect, an isolated nucleic acid molecule is (a) a cell of a transmembrane protein with or without a full length amino acid sequence as disclosed herein, an amino acid sequence lacking a signal peptide as disclosed herein, or a signal peptide as disclosed herein. About 80% sequence identity with the complement of the DNA molecule or (b) the DNA molecule encoding (a) the PRO polypeptide having the foreign domain or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein At least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, even more preferably at least about 85%, even more preferably At least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89%, more preferably at least about 90%, more Preferably at least about 91%, more preferably at least about 92%, more preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably about 96 At least%, more preferably at least about 97%, more preferably at least about 98%, more preferably at least about 99%.

In another aspect, an isolated nucleic acid molecule comprises (a) a coding sequence of a full-length PRO polypeptide cDNA as disclosed herein, a coding sequence of a PRO polypeptide lacking a signal peptide as disclosed herein, a signal peptide as disclosed herein DNA molecule comprising the coding sequence of the extracellular domain of the transmembrane PRO polypeptide with or without the coding sequence of any other fragment specifically defined of the full-length amino acid sequence as disclosed herein, or (b) the DNA molecule of (a) above. At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, more preferably at least about 80% sequence identity with the complement Is at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89% , More preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, more preferably at least about 93%, more preferably at least about 94%, even more preferably At least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at least about 98%, more preferably at least about 99%.

In a further aspect, the invention provides a DNA molecule encoding the same mature polypeptide encoded by any of (a) a human protein cDNA deposited with ATCC as disclosed herein, or (b) the DNA molecule of (a) above. At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, more preferably Preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably at least about 89%, more preferably at least about 90% At least about 91%, more preferably at least about 92%, more preferably at least about 93%, even more preferably at least about 94%, even more preferably at least about 95%, even more preferably Is at least about 96%, more preferably About 97%, more preferably at least about 98% to, more preferably, relates to an isolated nucleic acid molecule comprising a nucleotide sequence at least about 99%.

In another aspect, the invention provides an isolated nucleic acid molecule comprising or complementary to a nucleotide sequence encoding a PRO polypeptide in which the transmembrane domain is deleted or inactivated, wherein the transmembrane domain of the polypeptide is provided. Is disclosed herein. Thus, the soluble extracellular domain of the PRO polypeptides described herein is under consideration.

Another embodiment is a PRO polypeptide that can be used, for example, as a hybridization probe, to encode a fragment of a PRO polypeptide that can optionally encode a polypeptide comprising a binding site for an anti-PRO antibody, or as an antisense oligonucleotide probe. To a fragment of a coding sequence or its complement. The length of such nucleic acid fragments is generally at least about 20 nucleotides, preferably at least about 30, more preferably at least about 40, more preferably at least about 50, more preferably at least about 60, more Preferably at least about 70, more preferably at least about 80, more preferably at least about 90, more preferably at least about 100, more preferably at least about 110, more preferably about 120 At least about 130, more preferably at least about 140, more preferably at least about 140, more preferably at least about 150, more preferably at least about 160, more preferably at least about 170, more preferred Preferably at least about 180, more preferably at least about 190, more preferably at least about 200, more preferably at least about 250, more preferably at least about 300, and more preferably about 350 More preferably about 400 , More preferably about 450 or more, more preferably about 500 or more, more preferably about 600 or more, more preferably about 700 or more, more preferably about 800 or more, more preferably At least about 900, more preferably at least about 1000, wherein the term “about” refers to the length of the nucleotide sequence mentioned above plus or minus 10% of this length. A novel fragment of a PRO polypeptide-encoding nucleotide sequence can be used to align the PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well-known sequence alignment programs, and determine whether the PRO polypeptide-encoding nucleotide sequence fragment is new. It can be determined by the usual way of determining. All such PRO polypeptide-coding nucleotide sequences are considered herein. Also contemplated are PRO polypeptide fragments encoded by this nucleotide molecule fragment, preferably PRO polypeptide fragments comprising a binding site for an anti-PRO antibody.

In another embodiment, the present invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention relates to a full length amino acid sequence as disclosed herein, an amino acid sequence lacking a signal peptide as disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide as disclosed herein or Sequence identity with a PRO polypeptide having any other defined fragment of the full length amino acid sequence as disclosed is at least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably about At least 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more Preferably at least about 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, more preferably Crab is at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at about 98% Above, more preferably, it is directed to an isolated PRO polypeptide comprising an amino acid sequence that is at least about 99%.

In a further aspect, the invention provides at least about 80%, preferably at least about 81%, more preferably sequence identity with an amino acid sequence encoded by any of the human protein cDNAs deposited at ATCC as disclosed herein Preferably at least about 82%, more preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87% At least about 88%, more preferably at least about 89%, more preferably at least about 90%, more preferably at least about 91%, even more preferably at least about 92%, even more preferably Is at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at least about 98% , More preferably about 99 An isolated PRO polypeptide comprising an amino acid sequence that is at least%.

In a further aspect, the invention provides an extracellular domain of a transmembrane protein with or without a full length amino acid sequence as disclosed herein, an amino acid sequence lacking a signal peptide as disclosed herein, or a signal peptide as disclosed herein. Or about 80% or more, preferably about 81% or more, more preferably about 82% or more, as compared to the amino acid sequence of a PRO polypeptide having any other fragment specifically defined as the length of an amino acid sequence as disclosed herein, More preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, even more preferably at least about 87%, even more preferably about At least 88%, more preferably at least about 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably At least 92%, more preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more Preferably at least about 98%, more preferably at least about 99% relates to an isolated PRO polypeptide comprising an amino acid sequence that is recorded as positive.

In certain aspects, the invention provides an isolated PRO polypeptide encoded by a nucleotide sequence encoding an amino acid sequence as described above, and having no N-terminal signal sequence and / or initiating methionine. Also described herein is a method of making the isolated PRO polypeptide, which method comprises culturing a host cell comprising a vector comprising a suitable coding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, Recovering the PRO polypeptide.

In another aspect, the invention provides an isolated PRO polypeptide in which the transmembrane domain is deleted or inactivated. Also described herein is a method for producing the isolated PRO polypeptide, which method comprises culturing a host cell comprising a vector comprising a suitable coding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, and then incubating the two cell culture. Recovering the PRO polypeptide from the composition.

In another embodiment, the present invention relates to agonists and antagonists of natural PRO polypeptides as defined above. In certain embodiments, the agonist or antagonist is an anti-PRO antibody or small molecule.

In another embodiment, the present invention is directed to a method of identifying an agonist or antagonist for a PRO polypeptide, comprising contacting the PRO polypeptide with a candidate molecule and monitoring the biological activity mediated by the PRO polypeptide. Preferably, the PRO polypeptide is a native PRO polypeptide.

In another embodiment, the invention is directed to a composition comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide as described herein, with a carrier. Optionally, the carrier is a pharmaceutically acceptable carrier.

Another embodiment of the invention provides a PRO polypeptide, an agonist or antagonist thereof as described above, in the manufacture of a PRO polypeptide, an agonist or antagonist thereof, or a drug useful for the treatment of symptoms reactive to anti-PRO antibodies, or It relates to the use of anti-PRO antibodies.

The present invention relates to the identification and isolation of novel DNA, and to the recombinant production of novel polypeptides encoded by this DNA.

1 shows the nucleotide sequence of the native sequence PRO1800 cDNA (SEQ ID NO: 1), wherein SEQ ID NO: 1 is a clone referred to herein as "DNA35672-2508".

2 shows an amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in FIG.

3 shows the nucleotide sequence of the native sequence PRO539 cDNA (SEQ ID NO: 6), wherein SEQ ID NO: 6 is a clone referred to herein as "DNA47465-1561".

4 shows an amino acid sequence (SEQ ID NO: 7) derived from the coding sequence of SEQ ID NO: 6 shown in FIG.

5 shows the nucleotide sequence of the native sequence PRO982 cDNA (SEQ ID NO: 8), wherein SEQ ID NO: 8 is a clone referred to herein as “DNA57700-1408”.

FIG. 6 shows an amino acid sequence (SEQ ID NO: 9) derived from the coding sequence of SEQ ID NO: 8 shown in FIG.

FIG. 7 shows the nucleotide sequence of the native sequence PRO1434 cDNA (SEQ ID NO: 12), wherein SEQ ID NO: 12 is a clone referred to herein as “DNA68818-2536”.

8 shows an amino acid sequence (SEQ ID NO: 13) derived from the coding sequence of SEQ ID NO: 12 shown in FIG.

9 shows the nucleotide sequence of the native sequence PRO1863 cDNA (SEQ ID NO: 17), wherein SEQ ID NO: 17 is a clone referred to herein as "DNA59847-2510".

FIG. 10 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 17 shown in FIG. 9 (SEQ ID NO: 18).

11 shows the nucleotide sequence of native sequence PRO1917 cDNA (SEQ ID NO: 19), wherein SEQ ID NO: 19 is a clone referred to herein as "DNA76400-2528".

FIG. 12 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 19 shown in FIG. 11 (SEQ ID NO: 20).

FIG. 13 shows the nucleotide sequence of the native sequence PRO1868 cDNA (SEQ ID NO: 21), wherein SEQ ID NO: 21 is a clone referred to herein as "DNA77624-2515".

FIG. 14 shows an amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in FIG.

15 shows the nucleotide sequence of native sequence PRO3434 cDNA (SEQ ID NO: 23), wherein SEQ ID NO: 23 is a clone referred to herein as "DNA77631-2537".

FIG. 16 shows the amino acid sequence derived from the coding sequence of SEQ ID NO: 23 shown in FIG. 15 (SEQ ID NO: 24).

17 shows the nucleotide sequence of the native sequence PRO1927 cDNA (SEQ ID NO: 25), wherein SEQ ID NO: 25 is a clone referred to herein as "DNA82307-2531".

FIG. 18 shows an amino acid sequence derived from the coding sequence of SEQ ID NO: 25 shown in FIG. 17 (SEQ ID NO: 26).

<Detailed Description of the Preferred Embodiments>

I. Justice

"PRO polypeptide" and "PRO" as used herein refer to a variety of polypeptides, followed immediately by a number, where the full name (ie, PRO / number) refers to the specific polypeptide sequence described herein. As used herein, "PRO / numeric polypeptide" and "PRO / numeric", where the numerical portion is represented by actual numbers, are terms that include native sequence polypeptides and polypeptide variants (as further defined herein). The PRO polypeptides described herein can be isolated from a variety of sources, such as human tissue types or other sources, or can be prepared by recombinant or synthetic methods.

"Native sequence PRO polypeptide" includes polypeptides having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be prepared by recombinant or synthetic methods. The term “natural sequence PRO polypeptide” specifically refers to a naturally truncated or secreted form (eg, extracellular domain sequence) of a particular PRO polypeptide, a naturally occurring variant form of such polypeptide (eg, splicing differently). Forms) and natural allelic variants. In various embodiments of the present invention, a native sequence PRO polypeptide described herein is a mature or full length native sequence polypeptide comprising the full length amino acid sequence shown in the accompanying figures. Initiation and termination codons are indicated in bold and underlined in the figures. However, while the PRO polypeptides disclosed in the accompanying figures herein are shown to begin with methionine residues referred to in amino acid position 1 in the figures, other methionine residues located above or below amino acid position 1 in the figures are starting amino acids for the PRO polypeptide. It is conceivable and possible that it can be used as a residue.

An “extracellular domain” or “ECD” of a PRO polypeptide refers to a form of PRO polypeptide that is essentially free of transmembrane and cytoplasmic domains. Typically, the PRO polypeptide ECD comprises less than 1% of the transmembrane and / or cytoplasmic domains, preferably less than 0.5% of these domains. It will be appreciated that any transmembrane domain identified in the PRO polypeptide of the present invention has been identified according to criteria commonly used to identify hydrophobic domain types in the art. The exact boundaries of the transmembrane domain may vary, but most are only present at about 5 amino acids at the end of the domain originally identified herein. Thus, the extracellular domain of a PRO polypeptide may optionally contain up to about 5 amino acids on either side of the transmembrane domain / extracellular domain boundary identified in the Examples and the specification, with or without a linked signal peptide. Polypeptides and nucleic acids encoding them are included in the present invention.

The approximate location of the “signal peptides” of the various PRO polypeptides disclosed herein are shown in the detailed description and / or accompanying drawings of the invention. However, it should be noted that although the C-terminal boundary of the signal peptide may be different, most are only about 5 amino acids on either side of the C-terminal boundary of the signal peptide first identified herein, where the C- Terminal boundaries can be identified according to criteria commonly used to identify the type of amino acid sequence element in the art (eg, Nielsen et al ., Prot. Eng. 10: 1-6 (1997) and von Heinje et al. Nucl. Acids. Res. 14: 4683-4690 (1986)]. In addition, it should be noted that in some cases the cleavage of the signal sequence in the secreted polypeptide is not entirely identical, resulting in more than one secreted polypeptide. Polypeptides in which the signal peptide is cleaved only at about 5 amino acids on either side of the C-terminal boundary of the signal peptide identified herein, and polynucleotides encoding them, are included in the present invention.

A "PRO polypeptide variant" refers to a full length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence without a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without signal peptide as disclosed herein, or By active PRO polypeptide as defined above or below, having at least about 80% amino acid sequence identity with any other fragment of the disclosed full length PRO polypeptide sequence. Such PRO polypeptide variants include, for example, PRO polypeptides having one or more amino acid residues added or deleted at the N-terminus or C-terminus of the full-length natural amino acid sequence. Typically, a PRO polypeptide variant is a full length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence without a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without signal peptide as disclosed herein, or At least about 80%, preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, of amino acid sequence identity with any other specifically defined fragment of the disclosed full length PRO polypeptide sequence, More preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88%, more preferably about At least 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least 92%, more preferably at least about 93%, More preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at least about 98%, most preferably about More than 99%. Typically, PRO variant polypeptides are at least about 10 amino acids in length, often at least about 20 amino acids, more often at least about 30 amino acids, more often at least about 40 amino acids, more often at least about 50 amino acids, More often at least about 60 amino acids, more often at least about 70 amino acids, more often at least about 80 amino acids, more often at least about 90 amino acids, more often at least about 100 amino acids, more often about 150 At least about amino acids, more often at least about 200 amino acids, more often at least about 300 amino acids or more.

"% Amino acid sequence identity" for a PRO polypeptide sequence as disclosed herein aligns a candidate sequence with the same PRO polypeptide sequence and amino acid residues thereof, and introduces a gap if necessary to obtain a maximum of sequence identity ratio, No conservative substitutions are defined as the proportion of amino acid residues in a candidate sequence that are identical to amino acid residues in a particular PRO polypeptide sequence, without regard to the same sequence portion. Alignment to determine amino acid sequence identity ratios can be accomplished using various methods in the art, for example, publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. One skilled in the art can determine suitable parameters for measuring alignment, including any algorithms needed to maximally align over the entire length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values are obtained using the sequence comparison computer program ALIGN-2, where the complete source code for the ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc., and the source code shown in Table 1 is stored as a user document of the U.S. Copyright Office (20559 Washington, DC). Is registered under US Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc. (South San Francisco, Calif.) Or can be edited from the source code described in Table 1 below. The ALIGN-2 program can be edited and used on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

When ALIGN-2 is used to compare amino acid sequences, the amino acid sequence identity (%) of a given amino acid sequence A to a given amino acid sequence B, relative to a given amino acid sequence B, or to a given amino acid sequence B (which is a given amino acid sequence B) For a given amino acid sequence B, or having some% amino acid sequence identity relative to a given amino acid sequence B, or otherwise represented by a given amino acid sequence A), is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues recorded by the sequence alignment program ALIGN-2 as equally matched in the program alignment of A and B, and Y is the total number of amino acid residues of B. Of course, when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity of A to B is not equal to the amino acid sequence identity of B to A to A. As an example of calculating the amino acid sequence identity (%) using this method, Tables 2 and 3 below calculate the amino acid sequence identity (%) of the amino acid sequence referred to as the "comparative protein" to the amino acid sequence referred to as "PRO". Method, wherein "PRO" represents the amino acid sequence of the putative PRO polypeptide and "comparative protein" represents the amino acid sequence of the polypeptide with which the "PRO" polypeptide is compared, and "X," "Y" and "Z." Each represents a different putative amino acid residue.

Unless specifically stated otherwise, all percent amino acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph. However, amino acid sequence identity values (%) may also be obtained using the WU-BLAST-2 computer program (Melts in Enzymology 266: 460-480 (1996)) as described below. have. Most of the WU-BLAST-2 search parameters are set to their default values. Those not set to the default values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is used, the amino acid sequence identity value (%) is determined by (a) the amino acid sequence of the PRO polypeptide having a sequence derived from the native PRO polypeptide and the comparative amino acid sequence (ie, the PRO polypeptide is compared). The resulting sequence may be obtained by determining by WU-BLAST-2 the number of identical amino acid residues that match between the PRO variant polypeptides) and (b) divided by the total number of amino acid residues of the PRO polypeptide. For example, the term "polypeptide comprising amino acid sequence A having at least 80% amino acid sequence identity with amino acid sequence B", wherein amino acid sequence A is the comparative amino acid sequence and amino acid sequence B is the amino acid sequence of the PRO polypeptide.

Amino acid sequence identity (%) can also be calculated using the sequence comparison program NCBI-BLAST2 [Altschul et al. Nucleic Acids Res. 25: 3389-3402 (1997). The NCBI-BLAST2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.). NCBI-BLAST2 uses several search parameters, for example unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for multi All search parameters including -pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62 are set to default values.

When NCBI-BLAST2 is used for amino acid sequence comparison, the amino acid sequence identity (%) of a given amino acid sequence A with a given amino acid sequence B or with respect to a given amino acid sequence B relative to a given amino acid sequence B (or a given amino acid sequence) For B, which may be represented by a given amino acid sequence A having or comprising some% amino acid sequence identity (%) relative to a given amino acid sequence B or relative to a given amino acid sequence B) is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues recorded by the sequence alignment program NCBI-BLAST2 as equally matched in the program alignment of A and B, and Y is the total number of amino acid residues of B. Of course, when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity of A to B is not equal to the amino acid sequence identity of B to A to A.

A “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is a nucleic acid molecule encoding an active PRO polypeptide as defined below, which is a full length native sequence PRO polypeptide sequence disclosed herein, full length native without a signal peptide as disclosed herein. About 80% nucleic acid sequence identity with a nucleic acid sequence encoding a sequence PRO polypeptide sequence, an extracellular domain of a PRO polypeptide with or without a signal sequence as disclosed herein, or any other fragment of the full length PRO polypeptide sequence disclosed herein The above is a nucleic acid molecule. Typically, the PRO variant polynucleotide is a full length native sequence PRO polypeptide sequence disclosed herein, full length native sequence PRO polypeptide sequence without signal peptide as disclosed herein, extracellular of a PRO polypeptide with or without signal sequence as disclosed herein. At least about 80%, more preferably at least about 81%, more preferably at least about 82%, more preferably at least about 80% nucleic acid sequence with a nucleic acid sequence encoding a domain, or any other fragment of the full-length PRO polypeptide sequence disclosed herein Preferably at least about 83%, more preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, more preferably at least about 87%, more preferably at least about 88% At least about 89%, more preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, more Preferably at least about 93%, more preferably at least about 94%, more preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, more preferably at about 98 At least%, most preferably at least about 99%. Variants do not include native nucleotide sequences.

Typically, PRO variant polynucleotides are at least about 30 nucleotides in length, often at least about 60 nucleotides, more often at least about 90 nucleotides, more often at least about 120 nucleotides, more often at least about 150 nucleotides Nucleotides, more often at least about 180 nucleotides, more often at least about 210 nucleotides, more often at least about 240 nucleotides, more often at least about 270 nucleotides, more often at least about 300 nucleotides, more often About 450 or more nucleotides, more often about 600 or more nucleotides, more often about 900 or more nucleotides, or more.

The "% nucleic acid sequence identity" for a PRO-encoding nucleic acid sequence identified herein refers to the PRO nucleic acid sequence after aligning the PRO nucleic acid sequence with the candidate sequence and introducing a gap if necessary to obtain a maximum of sequence identity. It is defined as the ratio of nucleotides of the same candidate sequence as nucleotides of. Alignment to determine percent nucleic acid sequence identity can be accomplished using a variety of methods known to those skilled in the art, for example, publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. have. However, for purposes herein,% nucleic acid sequence identity values can be obtained using the sequence comparison computer program ALIGN-2, where the complete source code for the ALIGN-2 program is described in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc., and the source code shown in Table 1 is kept as a user document of the U.S. Copyright Office (20559 Washington, DC), which code is U.S. Copyright No. It is registered as a call. The ALIGN-2 program is publicly available through Genentech, Inc. (South San Francisco, Calif.) Or can be compiled from the source code described in Table 1 below. The ALIGN-2 program can be edited and used on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

When ALIGN-2 is used for nucleic acid sequence comparison, the nucleic acid sequence identity (%) of a given nucleic acid sequence C relative to a given nucleic acid sequence D or with respect to a given nucleic acid sequence D (or a given nucleic acid) For sequence D, which can be expressed with a given nucleic acid sequence C having or including some% nucleic acid sequence identity to a given nucleic acid sequence D or relative to a given nucleic acid sequence D, is calculated as follows:

W / Z × 100

Where W is the number of nucleotides recorded as identical matches in the program alignment of C and D by the sequence alignment program ALIGN-2, and Z is the total number of nucleotides of D. Of course, if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, then the percent nucleic acid sequence identity of C to D is not equal to the percent nucleic acid sequence identity of D to C. As an example of nucleic acid sequence identity (%) calculations, Tables 4 and 5 below show methods for calculating nucleic acid sequence identity (%) of nucleic acid sequences referred to as "comparative DNA" and nucleic acid sequences referred to as "PRO-DNA". Wherein “PRO-DNA” refers to the putative PRO-coding nucleic acid sequence, “comparative DNA” refers to the nucleotide sequence of the nucleic acid molecule to which the “PRO-DNA” nucleic acid molecule is compared, and “N,” “L "And" V "each represent a different putative nucleotide.

Unless specifically stated otherwise, all percent nucleic acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph. However,% nucleic acid sequence identity values can also be obtained using the WU-BLAST-2 computer program as described below (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). . Most of the WU-BLAST-2 search parameters are set to default values. Those not set to the default values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is used, the percent nucleic acid sequence identity value is (a) of the PRO polypeptide-encoding nucleic acid molecule having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid by WU-BLAST-2. Determine the number of identical nucleotides that match between the nucleic acid sequence and the comparative nucleic acid molecule (ie, the sequence to which the PRO polypeptide-encoding nucleic acid molecule is compared may be a variant PRO polynucleotide), and (b) the PRO polypeptide- Determine by dividing by the total number of nucleotides of the coding nucleic acid molecule. For example, in the term “isolated nucleic acid molecule comprising nucleic acid sequence A having at least 80% nucleic acid sequence identity with nucleic acid sequence B”, nucleic acid sequence A is the comparative nucleic acid sequence and nucleic acid sequence B is the PRO polypeptide-coding Nucleic acid sequence of a nucleic acid molecule.

Nucleic acid sequence identity (%) can also be calculated using the sequence comparison program NCBI-BLAST2 [Altschul et al. Nucleic Acids Res. 25: 3389-3402 (1997)]. The NCBI-BLAST2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.). NCBI-BLAST2 uses several search parameters, for example unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for multi- All search parameters including pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62 are set to default values.

When NCBI-BLAST2 is used for sequence comparison, the nucleic acid sequence identity (%) of a given nucleic acid sequence C relative to a given nucleic acid sequence D, or relative to a given nucleic acid sequence D (or given nucleic acid sequence D) Can be expressed as a given nucleic acid sequence C having or comprising some% nucleic acid sequence identity to a given nucleic acid sequence D or relative to a given nucleic acid sequence D, as follows:

W / Z × 100

Where W is the number of nucleotides recorded by the sequence alignment program NCBI-BLAST2 to match identically in the program alignment of C and D, and Z is the total number of nucleotides of D. Of course, if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the nucleic acid sequence identity (C) of C for D is not the same as the nucleic acid sequence identity (D) of D for C.

In other embodiments, the PRO variant polynucleotide is a nucleic acid molecule encoding an active PRO polypeptide that can hybridize (preferably under stringent hybridization conditions and wash conditions) with the nucleotide sequence encoding the full length PRO polypeptide disclosed herein. The PRO variant polypeptide may be one encoded by a PRO variant polynucleotide.

The term "positive" with respect to sequence comparisons performed as described above is meant to include residues of the compared sequences that are not identical but have similar properties (e.g., see Table 6 below as a result of conservative substitutions). ). To achieve the object herein, a positive value (%) is determined between (a) the corresponding PRO polypeptide amino acid sequence having a sequence derived from the native PRO polypeptide sequence and the comparative amino acid sequence (ie, the amino acid sequence with which the PRO polypeptide sequence is compared). The number of amino acid residues having a positive value at is determined in the BLOSUM 62 matrix of WU-BLAST-2, which is then divided by (b) the total number of amino acid residues of the PRO polypeptide.

Unless specifically stated otherwise, the positive values (%) are calculated as described in the immediately preceding paragraph. However, comparisons of amino acid sequence identity performed as described for ALIGN-2 and NCBI-BLAST2 above include amino acid residues of the compared sequences that are identical as well as having similar properties. An amino acid residue that records a positive value for that amino acid residue is a residue that is the same residue as the amino acid residue or a preferred substituent of that amino acid residue (described in Table 6 below).

For amino acid sequence comparisons using ALIGN-2 or NCBI-BLAST2, the positive value (%) of a given amino acid sequence A relative to a given amino acid sequence B, or a given amino acid sequence B, for a given amino acid sequence B (given amino acid sequence) For B, which may be expressed differently by a given amino acid sequence A having or including some positive value (%) with or relative to B), is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues that record the positive values defined above in the program alignment of A and B by the sequence alignment program ALIGN-2 or NCBI-BLAST2, and Y is the total number of amino acid residues of B. Of course, if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the positive value (%) of A for B is not equal to the positive value (%) of B for A.

“Isolated,” as used to describe the various polypeptides disclosed herein, means polypeptides that have been identified, isolated, and / or recovered from their natural environmental elements. Contaminant elements of the polypeptide's natural environment are typically substances that interfere with the diagnostic or therapeutic use of the polypeptide, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is purified to a sufficient amount to (1) obtain at least 15 residues of the N-terminal or internal amino acid sequence using a spinning cup sequencer, or (2) Coomassie blue or preferred. Preferably, silver staining is used to purify the bands in SDS-PAGE under non-reducing or reducing conditions. Since at least one element of the PRO polypeptide will not be present in the natural environment, an isolated polypeptide includes a polypeptide present in a recombinant cell. However, isolated polypeptide will typically be obtained by one or more purification steps.

An “isolated” PRO polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid is a nucleic acid molecule that has been identified and separated from one or more contaminating nucleic acid molecules, typically associated with a PRO polypeptide nucleic acid of natural origin. Isolated polypeptide nucleic acid molecules are different from the forms or conditions found in nature. Thus, an isolated polypeptide-encoding nucleic acid molecule is distinguished from certain polypeptide-encoding nucleic acid molecules present in natural cells. However, isolated polypeptide-encoding nucleic acid molecules include, for example, polypeptide-encoding nucleic acid molecules that are at different chromosomal positions from chromosomes of natural cells and are typically contained in cells expressing such polypeptides.

The term "regulatory sequence" is a DNA sequence necessary for the expression of a coding sequence operably linked in a particular host organism. Suitable control sequences for prokaryotes include, for example, promoters, optionally operator sequences, and ribosomal binding sites. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

A nucleic acid is "operably linked" when placed in a functional relationship with another nucleic acid sequence. For example, the DNA for a presequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a preprotein that participates in the secretion of the polypeptide, and the promoter or enhancer If he affects the transcription of the coding sequence, it is operably linked to the coding sequence, and the ribosomal binding site is operably linked to the coding sequence if he is placed to facilitate translation. In general, "operably linked" means that the DNA sequences to be linked are contiguous, and in the case of a secretory leader, they are located contiguously and within the reading site. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adapters or linkers are used in accordance with conventional practice.

The term “antibody” is used in its broadest sense and specifically includes, for example, one anti-PRO monoclonal antibody (including agonists, antagonists and neutralizing antibodies), anti-PRO antibody compositions with polyepitope specificity, single chain Anti-PRO antibodies, and anti-PRO antibody fragments (see below). As used herein, the term “monoclonal antibody” means in fact an antibody obtained from a population of homologous antibodies, ie individual antibodies that make up a population, except for possible natural mutations that may be present in small amounts.

The "stringency" of the hybridization reaction can be readily determined by one skilled in the art and is generally an experimental calculation that depends on probe length, wash temperature, salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. In general, hybridization is dependent on the reanimation ability of the denatured DNA when the complementary strand is present in an environment below its melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature available. As a result, at higher relative temperatures the reaction conditions are more stringent, while at lower relative temperatures the reaction conditions are less stringent. For more detailed information and explanations on the stringency of the hybridization reaction, see Ausubel et al. Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995).

As defined herein, "strict conditions" or "high stringency conditions" means (1) 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl alcohol at low ionic concentration and high temperature at washing, for example at 50 ° C. Conditions using pate, (2) 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 with 750 mM sodium chloride, 75 mM sodium citrate, for example at 42 ° C. during hybridization conditions using a denaturant such as 50% (v / v) formamide with mM sodium phosphate buffer (pH 6.5), or (3) 50% formamide at 42 ° C., 5 × SSC (0.75 M NaCl, 0.075 M citric acid) Sodium), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfonate Pate using 0.2 × SSC (sodium chloride / sodium citrate) at 42 ° C. and 50% form at 55 ° C. And washed in the following imide, EDTA containing 0.1 x SSC at 55 to ℃ - to perform a rigorous cleaning.

"Medium stringent conditions" are those described in Sambrook et al., Molecular Cloning: A Laboratory Manual , New York: Cold Spring Harbor Press 1989, and are less stringent than wash solutions and hybridization conditions (above). For example, use of temperature, ion concentration and% SDS). Examples of medium stringency conditions include 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt solution, 10% dextran And incubating overnight at 37 ° C. in a solution containing 20 mg / ml of pate and denatured truncated salmon sperm DNA, followed by washing the filter with 1 × SSC at about 37-50 ° C. Those skilled in the art will know how to adjust the temperature, ion concentration, and the like necessary to match factors such as probe length and the like.

As used herein, the term “epitope tagged” refers to a chimeric polypeptide comprising a PRO polypeptide fused with a “tag polypeptide”. The tag polypeptide has enough residues to provide an epitope that allows the antibody to be made but is short enough that it does not interfere with the activity of the polypeptide to which it is fused. It is also desirable that the tag polypeptide is very specific so that the antibody against it does not actually cross react with other epitopes. Suitable tag polypeptides generally have six or more amino acid residues, and typically have about 8-50 amino acid residues (preferably about 10-20 amino acid residues).

The term “immunoadhesin” as used herein refers to an antibody-like molecule that combines the effector function of an immunoglobulin constant domain and the binding specificity of a heterologous protein (adhesin). Structurally, immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with an amino acid sequence having a predetermined binding specificity that is not (ie heterologous) the antigen recognition site and binding site of the antibody. The adhesin portion of an immunoadhesin molecule is typically a contiguous amino acid sequence comprising at least the binding site of a receptor or ligand. Immunoglobulin constant domain sequences of immunoadhesin may be IgG-1, IgG-2, IgG-3 or IgG-4 subtypes, such as IgA (including IgA-1 and IgA-2), IgE, IgD or IgM Obtainable from any immunoglobulin.

As used herein, the term "active" or "activity" refers to a form of a PRO polypeptide that retains the biological and / or immunological activity of a natural or naturally-occurring PRO, wherein "biological" activity refers to natural or A "immunological" activity refers to a biological function (inhibition or facilitation function) induced by a natural or naturally-occurring PRO, but not the ability to induce the production of an antibody against the antigenic epitope possessed by the naturally-occurring PRO. Or the ability to induce the production of antibodies to antigenic epitopes possessed by naturally occurring PRO.

The term “antagonist” is used in its broadest sense and includes any molecule that partially or completely blocks, inhibits or neutralizes the biological activity of the native PRO polypeptides disclosed herein. Likewise, the term "agonist" is used in its broadest sense and includes any molecule that mimics the biological activity of the native PRO polypeptides disclosed herein. Suitable agonist or antagonist molecules include, in particular, agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native PRO polypeptides, peptides, antisense oligonucleotides, small organic molecules and the like. Methods for identifying an agonist or antagonist of a PRO polypeptide may include contacting the PRO polypeptide with a candidate agonist molecule or a candidate antagonist molecule and measuring a detectable change in one or more biological activities, typically associated with the PRO polypeptide.

"Treatment" means a therapeutic treatment and a preventive or preventive measure carried out for the purpose of preventing or slowing (mitigating) a pathological condition or disease in a subject. Subjects in need of treatment include those already afflicted with the disease, as well as those susceptible to disease or those seeking to prevent the disease.

"Chronic" administration refers to the administration of the substance in a continuous manner as opposed to the acute manner, to maintain the initial therapeutic effect (activity) for a long time. "Intermittent" administration refers to treatment that is actually performed periodically, rather than continuing without interruption.

“Mammals” for treatment are mammals, including humans, livestock and breeding animals, and zoo, competition or pet animals such as dogs, cats, cattle, horses, sheep, pigs, goats, and rabbits, and the like. Refers to any animal classified as. Preferred mammals are humans.

“Combined” administration with one or more other therapeutic agents includes simultaneous (in conjunction) administration or continuous administration in any order.

As used herein, “carrier” includes pharmaceutically acceptable carriers, excipients or stabilizers which are nontoxic to the cell or mammal being exposed to the dosages and concentrations employed. Physiologically acceptable carriers are often pH buffered aqueous solutions. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate and other organic acids; Antioxidants including ascorbic acid; Low molecular weight (less than about 10 residues) polypeptide; Proteins such as serum albumin, gelatin or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, arginine or lysine; Monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Salt-forming counterions such as sodium; And / or nonionic surfactants such as TWEEN, polyethylene glycol (PEG) and PLURONICS®.

"Antibody fragments" include portions of intact antibodies, preferably antigen binding regions or variable regions of intact antibodies. Examples of antibody fragments include Fab, Fab ', F (ab') ₂ and Fv fragments, diabodies, linear antibodies [Zapata et al., Protein Eng. 8 (10): 1057-1062 (1995)], single chain antibody molecules, and multispecific antibodies formed from antibody fragments.

Papain digestion of the antibody results in two identical antigen binding fragments, a "Fab" fragment with a single antigen-binding site, and the remaining "Fc" fragment, named for its ability to readily crystallize. Treatment with pepsin produces an F (ab ') ₂ fragment that has two antigen binding sites and may cross-link antigen.

"Fv" is the minimum antibody fragment that includes a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy chain variable domain and one light chain variable domain that is tightly covalently bonded. In this form three CDRs of each variable domain interact to form an antigen-binding site on the surface of the V _H -V _L dimer. In conclusion, six CDRs confer antigen-binding specificity to antibodies. However, even a single variable domain (or half of the Fv comprising only three CDRs specific for the antigen), although less affinity than the entire binding site, has the ability to recognize and bind the antigen.

The Fab fragment also comprises the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab fragments differ from Fab 'fragments by the addition of several residues at the carboxy terminus of the CH1 domain of the heavy chain, including one or more cysteines from the hinge region of the antibody. Fab'-SH herein refers to Fab 'in which the cysteine residues of the constant domains bear free thiol groups. F (ab ') ₂ antibody fragments were originally produced as a pair of Fab' fragments with hinge cysteines between them. In addition, other chemical couplings of antibody fragments are known.

The “light chain” of an antibody (immunoglobulin) from any vertebrate species can belong to one of two distinctly different types called kappa (κ) and lambda (λ) based on the amino acid sequence of its constant domain. .

Immunoglobulins can belong to different groups depending on the amino acid sequence of the constant domain of their heavy chains. There are five main groups of immunoglobulins: IgA, IgD, IgE, IgG and IgM, some of which can be further classified into subgroups (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA and IgA2. Can be.

"Single-chain Fv" or "sFv" antibody fragments comprise the V _H and V _L domains of an antibody present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the V _H and V _L domains that allows the sFv to form the structure required for binding of the antigen. For sFv, see Pluckthan's [ The Pharmacology of Monoclonal Antibodies , vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994).

The term "diabody" refers to a small antibody fragment having two antigen binding sites, comprising a heavy chain variable domain (V _H ) linked to a light chain variable domain (V _L ) within the same polypeptide chain (V _H -V _L ). Say Linkers that are too short to link two domains on the same chain are used to create two antigen-binding sites by linking the domains with complementary domains of the other chain. Diabodies are described, for example, in EP 404,097, WO 93/11611 and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

An “isolated” antibody is an antibody identified, isolated and / or recovered from elements of its natural environment. Antibody contaminating elements of the natural environment are substances that interfere with the diagnostic or therapeutic use of the antibody and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) greater than 95% by weight, most preferably at least 99% by weight, as determined by the Lowry method, and (2) using a spinning cup sequencer. Sufficient to obtain at least 15 residues of the N-terminal or internal amino acid, or (3) one band by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or preferably silver staining. Will be purified. Isolated antibody includes the antibody in recombinant cells since at least one antibody component will not be present in the natural environment. However, isolated antibodies will typically be prepared by one or more purification steps.

As used herein, the term "label" refers to a detectable compound or composition that is complexed directly or indirectly with an antibody to produce a "labeled" antibody. The label can be detected by itself (eg, a radioisotope label or fluorescent label) or, if it is an enzyme label, can promote chemical modification of the detectable substrate compound or composition.

"Solid phase" means a non-aqueous matrix to which an antibody of the invention may be attached. Examples of solid phases included herein include those formed partially or entirely of glass (eg, controlled pore glass), polysaccharides (eg, agarose), polyacrylamide, polystyrene, polyvinyl alcohol, and silicone. Included. In some embodiments, depending on the circumstances, the solid phase may comprise the wells of an assay plate, and in other embodiments the solid phase is a purification column (eg, an affinity chromatography column). The term also encompasses discrete particles of a discontinuous solid phase, such as those described in US Pat. No. 4,275,149.

A "liposome" is a small vesicle composed of various forms of lipids, phospholipids, and / or surfactants useful for delivering a drug (eg, a PRO polypeptide or antibody thereto) to a mammal. Liposomal components are typically arranged in bilayer form, similar to the lipid arrangement of biological membranes.

A "small molecule" is defined herein as having a molecular weight of less than about 500 Daltons.

II. Compositions and Methods of the Invention

A. Full Length PRO Polypeptide

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO polypeptides. In particular, cDNA encoding various PRO polypeptides were identified and isolated as described in more detail in the Examples below. The PRO number of proteins produced in separate rounds of expression may vary but the UNQ number is specific to any given DNA and protein encoded therefrom and will not change. However, herein, simply, proteins encoded by the full-length natural nucleic acid molecules disclosed herein, and other natural homologs and variants of PRO included in the above definitions, are referred to as "PRO / number" regardless of their origin and manner of preparation. Will be mentioned.

As described in the Examples below, various cDNA clones were deposited with the ATCC. One skilled in the art can readily determine the actual nucleotide sequence of the clone by analyzing the sequence of the deposited clone using conventional methods in the art. General techniques can be used to determine the expected amino acid sequence from the nucleotide sequence. In the case of the PRO polypeptides described herein and the nucleic acids encoding them, the inventors have identified what is considered to be the best identifying frame using sequence information available at the time.

1.Full Length PRO1800 Polypeptide

The inventors have used WU-BLAST2 sequence alignment computer program to find that some of the full-length native sequence PRO1800 (shown in Figure 2 and SEQ ID NO: 2) has some amino acid sequence identity with human Hep27 protein (HE27_HUMAN). Thus, the PRO1800 disclosed herein is a newly identified Hep27 homologue and is currently believed to have the typical activity of this protein.

2. Full Length PRO539 Polypeptide

Using the WU-BLAST2 sequence alignment computer program, the inventors used a portion of the full-length native sequence PRO539 (shown in FIGS. 4 and 7) to a portion of the kinesin-based protein (AF019250_1) of the drosophila melanogasster and to some extent an amino acid sequence. It turns out that there is an identity. Thus, the PRO539 disclosed herein is a newly identified member of the protein family of the Hedgehog signaling pathway and is currently believed to have the typical activity of the Drosophila Coastal-2 protein.

3. Full Length PRO982 Polypeptide

As is known, the DNA57700-1408 sequence encodes a new secretion factor referred to herein as PRO982. The use of the WU-BLAST2 sequence alignment computer program revealed some sequence identity with known proteins.

4. Full Length PRO1434 Polypeptide

The inventors have used WU-BLAST2 sequence alignment computer program to reveal that some of the full-length native sequence PRO1434 (shown in FIGS. 10 and 13) has some amino acid sequence identity with the mouse nel protein precursor (NEL_MOUSE). Came out. Thus, it is presently believed that the PRO1434 disclosed herein is a newly identified Nell homologue and may have the typical activity of the Nell protein family.

5. Full Length PRO1863 Polypeptide

DNA59847-2510 clones were isolated from human prostate tissue library. As is known, the DNA59847-2510 sequence encodes a new factor referred to herein as PRO1863, and the results of using the WU-BLAST2 sequence alignment computer program revealed that the sequence identity with any known protein is not large.

6. Full Length PRO1917 Polypeptide

Using a WU-BLAST2 sequence alignment computer program, the inventors found that amino acids 41-487 of PRO1917 (shown in Figure 14 and SEQ ID NO: 20) have some amino acid sequence identity to inositol phosphatase, referred to as "AF012714_1" in the Dayhof database. Found out. Thus, it is presently believed that the PRO1917 disclosed herein is a newly identified member of the inositol phosphatase family and may have the typical enzymatic activity of inositol phosphatase.

7. Full Length PRO1868 Polypeptide

The inventors have used WU-BLAST2 sequence alignment computer program to find that some of the full-length native sequence PRO1868 (shown in Figure 16 and SEQ ID NO: 28) has some amino acid sequence identity with human A33 antigen protein (P_W14146). Thus, PRO1868 disclosed herein is currently believed to be a newly identified A33 antigen homologue that may have a typical activity and / or expression pattern of the A33 antigen protein. The PRO1868 polypeptide can be used for the therapeutic treatment of inflammatory diseases and colorectal cancer as described above.

8. Full Length PRO3434 Polypeptide

DNA77631-2537 clones were isolated from a library of human aortic tissue using a trapping technique to select nucleotide sequences encoding secretory proteins. As is known, the DNA77631-2537 sequence encodes a new factor referred to herein as PRO3434 and, using the WU-BLAST2 sequence alignment computer program, revealed that the sequence identity with any known protein is not large.

9. Full Length PRO1927 Polypeptide

The inventors have used the WU-BLAST2 sequence alignment computer program to show that the full length native sequence PRO1927 (FIG. 20, SEQ ID NO: 26) has some amino acid sequence identity to the amino acid sequence of the protein referred to as "AB000628_1" in the Dayhof database. Revealed. Thus, it is presently believed that the PRO1927 disclosed herein is a newly identified member of the glycosyltransferase protein family and may have glycosylation activity.

B. PRO Polypeptide Variants

In addition to the full-length native sequence PRO polypeptides described herein, it is contemplated that PRO variants may be prepared. PRO variants can be prepared by introducing suitable nucleotide changes into PRO DNA and / or synthesizing the desired PRO polypeptide. Those skilled in the art will appreciate that amino acid changes, such as altering the number or location of glycosylation sites or changing membrane anchoring properties, can alter the post-translational processing of RPO.

Variations in the various domains of the full-length native sequence PRO or PRO described herein can be prepared using any technique and guidance for conservative and non-conservative mutations, eg, disclosed in US Pat. No. 5,364,934. The variation may be a substitution, deletion or insertion of one or more codons encoding the PRO that change the amino acid sequence of the PRO as compared to the native sequence PRO. In some cases, the mutation is created by substituting any other amino acid for one or more amino acids in one or more domains of the PRO. Amino acid residues that can be inserted, substituted or deleted without adversely affecting the desired activity compare the sequence of PRO to the sequence of known homologous protein molecules and minimize the number of amino acid sequence changes generated in regions of high homology. You can decide. Amino acid substitutions may be the result of substitution of one amino acid with another amino acid having similar structural and / or chemical properties, eg, replacement of leucine with serine, ie, conservative substitution of amino acids. Insertion or deletion may optionally occur at about 1-5 amino acids. Acceptable variations can be determined by systematically inserting, deleting or replacing amino acids in the sequence and testing the activity of the resulting variants represented by the full length or mature native sequence.

The application provides PRO polypeptide fragments. For example, when compared to full-length natural proteins, these fragments may be truncated at the N-terminus or C-terminus or missing internal residues. Some fragments lack amino acid residues that are not essential for the desired biological activity of the PRO polypeptides of the invention.

PRO fragments can be prepared by any of a number of conventional techniques. Desired peptide fragments can be synthesized chemically. Other methods include enzymatic digestion methods, such as generating a PRO fragment by treating the protein with an enzyme known to cut the protein at a site defined by a particular amino acid residue, or by cutting the DNA with a suitable restriction enzyme and Isolating the desired fragment. Yet another suitable technique includes isolating and amplifying a DNA fragment encoding a desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are used as 5 'and 3' primers in PCR. Preferably, the PRO polypeptide fragment shares one or more biological and / or immunological activities with the native PRO polypeptide disclosed herein.

In specific embodiments, conservative substitutions of the target are shown in Table 6 under the heading of preferred substitutions. When the biological activity is changed by such substitutions, more substantial changes, named as substitutions in Table 6 below or described in more detail below with respect to amino acid species, were introduced and the products were screened.

Original residues Substitution example Preferred Substitution Ala (A) val, leu, ile val Arg (R) lys, gln, asn lys Asn (N) gln, his, lys, arg gln Asp (D) glu glu Cys (C) ser ser Gln (Q) asn asn Glu (E) asp asp Gly (G) pro, ala ala His (H) asn, gln, lys, arg arg Ile (I) leu, val, met, ala, phe, norleucine leu Leu (L) norleucine, ile, val, met, ala, phe ile Lys (K) arg, gln, asn arg Met (M) leu, phe, ile leu Phe (F) leu, val, ile, ala, tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr, phe tyr Tyr (Y) trp, phe, thr, ser phe Val (V) ile, leu, met, phe, ala, norleucine leu

Substantial modifications of the function or immunological identity of the PRO polypeptides may include (a) maintaining the structure of the polypeptide backbone at the substitution region, for example in sheet or helix form, or (b) maintaining the charge or hydrophobicity of the molecule at the target site. Or (c) selecting a substitution that significantly alters its effect of retaining most of the side chains. Natural residues are divided into the following groups according to common side chain properties:

(1) hydrophobic: norleucine, met, ala, val, leu, ile;

(2) neutral hydrophilic: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gln, his, lys, arg;

(5) residues affecting chain orientation: gly, pro; And

(6) aromatic; trp, tyr, phe.

Non-conservative substitutions will replace said one type of component with another type. In addition, the residues so substituted may be introduced at conservative substitution sites or more preferably at the remaining (non-conserved) sites.

Variations can be made using methods known in the art such as oligonucleotide-mediated (position-directed) mutagenesis, alanine scanning and PCR mutagenesis. Site-directed mutagenesis [Carter et al. Nucl. Acids Res. , 13 : 4331 (1986), Zoller et al., Nucl. Acids Res. , 10 : 6487 (1987)], cassette mutagenesis [Wells et al., Gene , 34 : 315 (1985)], restriction selection mutagenesis [Wells et al ., Philos. Trans. R. Soc. London SerA , 317 : 415 (1986)] or other known techniques can be performed on cloned DNA to produce the PRO variant DNA of the present invention.

Scanning amino acid assays can also be used to identify one or more amino acids along adjacent sequences. Preferred scanning amino acids are relatively small neutral amino acids. Such amino acids include alanine, glycine, serine and cysteine. Typically, alanine is a preferred scanning amino acid because it is less likely to remove side chains outside the beta-carbon and alter the backbone arrangement of the variants (Cunningham and Wells, Science , 244 : 1081-1085 (1989). )]]. Alanine is also preferred because it is usually the most common amino acid. In addition, alanine is frequently found both in buried and exposed locations (Creighton, The Proteins , (WH Freeman & Co., NY)); And Chothia, J. Mol. Biol. , 150 : 1 (1976)]. If alanine substitutions do not produce adequate amounts of variants, isotopic amino acids can be used.

C. variant of PRO

Covalent modifications of PRO are included within the scope of the present invention. One form of covalent modification involves reacting a target amino acid residue of a PRO polypeptide with an organic derivatizing agent capable of reacting with a selected side chain of PRO, or an N-terminal or C-terminal residue. Derivatization with a bifunctional agent is useful for crosslinking PRO to a water-insoluble support matrix or surface, or vice versa, for example for use in anti-PRO antibody purification methods. Commonly used crosslinkers include, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example esters with 4-azidosalicylic acid, Homo-functional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis (succinimidylpropionate), difunctional maleimides such as bis-N-maleimido-1,8-octane and Substances such as methyl-3 [(p-azidophenyl) dithio] propioimidate.

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, lysine, Methylation of alpha-amino groups of arginine and histidine side chains [TE Creighton, Proteins: Structure and Molecular Properties , WH Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of N-terminal amines and amidation of C-terminal carboxyl groups.

Other types of covalent modifications of PRO polypeptides within the scope of the present invention include changes in the natural glycosylation pattern of the polypeptide. “A change in natural glycosylation pattern” refers to the deletion of one or more carbohydrate residues found in the native sequence PRO (either by removing potential glycosylation sites or by deleting chemical glycosylation by chemical and / or enzymatic methods) and / or ) Addition of one or more glycosylation sites that are not present in native sequence PRO. The term also encompasses qualitative changes in glycosylation of natural proteins, including changes in the properties and proportions of the various carbohydrate residues present.

The addition of glycosylation sites to the PRO polypeptide can be accomplished by changing the amino acid sequence. The change can be made, for example, by the addition or substitution of one or more serine or threonine residues in the native sequence PRO (for O-linked glycosylation sites). The PRO amino acid sequence can be optionally altered through a change in the DNA level by mutating DNA encoding the PRO polypeptide at a preselected base to produce a codon that is translated into the desired amino acid.

Another means of increasing the number of carbohydrate residues on the PRO polypeptide is to couple the glycoside chemically or enzymatically to the polypeptide. Such methods are described, for example, in WO 87/05330 published September 11, 1987 and in Aplin and Wriston, CRC Crit. Rev. Biochem. , pp. 259-306 (1981).

Removal of carbohydrate residues present in a PRO polypeptide can be accomplished chemically or by substitution by mutation of a codon encoding an amino acid residue that functions by enzyme or as a glycosylation target. Chemical deglycosylation techniques are known in the art and are described, for example, in Hakimuddin et al ., Arch. Biochem. Biophys. , 259 : 52 (1987) and by Edge et al ., Anal. Biochem. , 118 : 131 (1981). Enzymatic cleavage of carbohydrate residues on polypeptides can be accomplished using a variety of endoglycosidases and exoglycosidases [Thotakura et al . Meth. Enzymol. , 138 : 350 (1987)].

Other types of covalent modifications of PRO include various nonproteinaceous polymers, eg, in the manner described in US Pat. Nos. 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791,192 or 4,179,337. For example connecting the PRO polypeptide to one of polyethylene glycol (PEG), polypropylene glycol or polyoxyalkylene.

In addition, the PRO of the present invention may be modified in such a way as to form chimeric molecules comprising PRO fused to other heterologous polypeptide or amino acid sequences.

In one embodiment, such chimeric molecules comprise a fusion of PRO with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. Epitope tags are generally located at the amino or carboxyl terminus of PRO. The presence of the PRO in the form with the epitope tag can be detected using an antibody against the tag polypeptide. In addition, the introduction of epitope tags allows for easy purification of PRO by affinity purification using anti-tag antibodies or other types of affinity matrices that bind to epitope tags. Various tag polypeptides and their respective antibodies are known in the art. Examples include poly-histidine or poly-histidine-glycine tags, flu HA tag polypeptides and antibodies thereof 12CA5 [Field et al ., Mol. Cell. Biol. , 8 : 2159-2165 (1988)], c-myc tags and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies [Evan et al., Molecular and Cellular Biology , 5 : 3610-3616] (1985)], and herpes simplex virus glycoprotein D (gD) tag and its antibodies [Paborsky et al., Protein Engineering , 3 (6): 547-553 (1990)]. have. Other tag polypeptides include Flag-peptides (Hopp et al., BioTechnology , 6 : 1204-1210 (1988)), KT3 epitope peptides [Martin et al., Science , 255 : 192-194 (1992). )]], Alpha-tubulin epitope peptide [Skinner et al ., J. Biol. Chem. , 266 : 15163-15166 (1991)] and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al ., Proc. Natl. Acad. Sci. USA , 87 : 6393-6397 (1990)].

In other embodiments, the chimeric molecule comprises a fusion of PRO with an immunoglobulin or a specific region of immunoglobulins. For the divalent form of the chimeric molecule (also referred to as "immunoadhesin"), the fusion may be the Fc region of an IgG molecule. This Ig fusion preferably comprises the substitution of a site of one or more variable regions in the Ig molecule with a soluble (deleted or inactivated transmembrane domain) form of the PRO polypeptide. In a particularly preferred embodiment, the immunoglobulin fusions comprise the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of the IgG1 molecule. For a method of producing immunoglobulin fusions, see US Pat. No. 5,428,130, issued June 27, 1995.

D. Manufacture of PRO

The content described below relates primarily to methods of making PRO by culturing cells transformed or transfected with the vector containing the PRO nucleic acid. Of course, the PRO may be prepared using other methods known in the art. For example, PRO sequences or fragments thereof can be prepared by direct peptide synthesis using solid phase techniques [Stewart et al., Solid-Phase Peptide Synthesis , WH Freeman Co., San Francisco, CA ( 1969) and Merrifield, J. Am. Chem. Soc. , 85 : 2149-2154 (1963). In vitro protein synthesis can be performed by manual or automated methods. Automated synthesis can be performed using, for example, Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. The full length PRO can be prepared by chemically synthesizing the various parts of the PRO separately and combining them using chemical or enzymatic methods.

1. Isolation of DNA Encoding PRO

DNA encoding PRO may be obtained from a cDNA library prepared from tissues that are thought to retain PRO mRNA and express it at detectable levels. Thus, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue as described in the Examples. PRO coding genes can also be obtained from genomic libraries or by known synthetic methods (eg, automated nucleic acid synthesis methods).

Libraries can be screened using probes designed to identify a gene of interest or a protein encoded by the gene (eg, an antibody to PRO or an oligonucleotide consisting of about 20 to 80 or more bases). Screening of cDNAs or genomic libraries using selected probes uses standard methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Haror Laboratory Press, 1989). Can be performed. Other means for isolating the gene encoding PRO is to use PCR method [the literature, such as fountain Brook (Sambrook); Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Haror Laboratory Press, 1995).

The following examples illustrate techniques for screening cDNA libraries. Oligonucleotide sequences selected as probes should be sufficiently long and sufficiently clear to minimize false positive results. Oligonucleotides are preferably labeled so that they can be detected when hybridized with DNA in the library being screened. Labeling methods are known in the art and include the use of radiolabels, biotinylation or enzyme labels, such as ³² P-labeled ATP. Hybridization conditions, including moderate stringency and high stringency is provided in the described supra, such as literature Sam Brook, (Sambrook).

The sequences identified in the library screening method can be aligned in comparison to other known sequences that are deposited and available in public databases such as GenBank or other proprietary sequence databases. Sequence identity (at the amino acid or nucleotide level) within a defined region of the molecule or across the full length sequence can be determined using known methods of the prior art and the methods described herein.

Nucleic acid having protein coding sequence is the first use of the estimated amino acid sequence disclosed herein, et al., Sam Brook (Sambrook) to detect the precursor, if necessary, using conventional primer extension method described in [supra selected cDNA or Genomic libraries can be obtained by screening and processing intermediates of mRNA that are not reverse transcribed into cDNA.

2. Selection and Transformation of Host Cells

Host cells are conventional nutrient media transfected or transformed with the expression or cloning vectors described herein for PRO production and modified to be suitable for induction of a promoter, selection of a transformant or amplification of a gene encoding a sequence of interest. In culture. Those skilled in the art can select culture conditions such as medium, temperature and pH without undue experimentation. In general, the principles, protocols, and techniques employed to maximize productivity of cell cultures are described in Mammalian Cell Biotechnology: a Practical Approach , M. Butler, ed. Can be found in (IRL Press, 1991)] and Sam Brook et al., (Sambrook) [supra].

Eukaryotic cell transfection methods and prokaryotic transformation methods such as CaCl ₂ , CaPO ₄ , liposome-mediated methods and electroporation are known to those skilled in the art. Depending on the host cell used, transformation is carried out using standard techniques suitable for the cell. Sam Brook (Sambrook) described supra, or electroporation, calcium treatment using calcium chloride method described in, such as is generally used for prokaryotes. Infection with Agrobacterium tumefaciens has been described in particular plants as described in Shaw et al., Gene , 23 : 315 (1983) and WO 89/05859 published June 29, 1989. Used for cell transformation. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology , 52 : 456-457 (1978) can be used. General features of transfection of mammalian cell host systems are described in US Pat. No. 4,399,216. Transformation into yeast is generally described by Van Solingen et al., J. Bact. , 130 : 946 (1977) and Hsiao et al ., Proc. Natl. Acad. Sci. (USA) , 76 : 3829 (1979)]. However, other methods of introducing DNA into cells, such as intranuclear microinjection, electroporation, fusion of circular cells with bacterial protoplasts, or polycations such as polybrene, polyornithine can also be used. . For various techniques for transformation of mammalian cells, see Keown et al., Methods in Enzymology , 185: 527-537 (1990) and Mansour et al . Nature , 336: 348-352 (1988).

Suitable host cells for cloning or expressing DNA in a vector herein include prokaryotic, yeast or higher eukaryotic cells. Suitable prokaryotic cells are sedative bacteria, for example Gram negative or Gram positive organisms, for example Enterobacteriaceae, for example E. coli. Coli, including but not limited to. A variety of teeth. E. coli strains, for example E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537). E. coli strains W3110 (ATCC 27,325) and K5 772 (ATCC 53,635) are readily available. Other suitable prokaryotic host cells are Escherichia, such as E. coli. Coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, for example Salmonella typhimurium, Sererratia, for example For example Serratia marcescans and Shigella, and Bacillus, for example B. Subtilis and b. Licheniformis (e.g. B. licheniformis 41P described in DD 266,710, published April 12, 1989), Pseudomonas, for example p. Aeruginosa and Streptomyces. This example is illustrative only and is not limited thereto. Strain W3110 is a particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentation. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W3110 can be modified to result in mutation of the gene encoding the endogenous protein of the host, an example of such a host is E. coli with the complete genotype tonA . E. coli W3110 strain 1A2, E. coli with the complete genotype tonA ptr3 . E. coli W3110 strain 9E4, E. coli with the full genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT kan ^r . E. coli W3110 strain 27C7 (ATCC 55,244), E. coli with the complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degPOmpT rbs7 ilvG kan ^r . E. coli W3110 strain 37D6, strain 37D6 with a non-kanamycin resistant degP deletion mutation. E. coli W3110 strain 40B4 and E. coli with the Periplasm protease variant disclosed in US Pat. No. 4,946,783, issued Aug. 7, 1990. E. coli strains. Alternatively, in vitro cloning methods such as PCR or other nucleic acid polymerase reactions are suitable.

In addition to prokaryotic cells, eukaryotic microorganisms such as fibrous fungi or yeast are suitable as cloning or expression hosts for PRO-coding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Other microorganisms include Shichizosaccharomyces pombe (Beach and Nurse, Nature , 290: 140 [1981]); European Patent No. 139,383, published May 2, 1985; Kluyveromyces hosts (US Pat. No. 4,943,529; Fler et al., Bio / Technology , 9: 968-975 (1991), for example K. et al. Lactis [MW98-8C, CBS683, CBS4574; Louvencourt et al ., J. Bacteriol. , 154 (2): 737-742 [1983], k. Fragilis (ATCC 12,424), k. Bulgaricus (ATCC 16,045), K. Wickeramii (ATCC 24,178), K. Waltii (ATCC 56,500), K. Drosophilarum [ATCC 36,906; Van den Berg et al., Bio / Technology , 8: 135 (1990), K. Thermotolerans and K. Marxianus; Yarrowia (European Patent No. 402,226); Pichia pastoris (European Patent 183,070); Sreekrishna et al ., J. Basic Microbiol. , 28: 265-278 [1988]; Candida; Trichoderma reesia (European Patent No. 244,234); Neurospora crassa [Case et al . Proc. Natl. Acad. Sci. USA , 76: 5259-5263 [1979]; Schwanniomyces, such as, for example, occidentalis (European Patent No. 394,538, published October 31, 1990); And fibrous fungi such as neurospora, penicillium, tolypocladium (WO 91/00357 published January 10, 1991) and Aspergillus hosts, for example Listen a. Nidulans (Ballance et al., Biochem. Biophys. Res. Commun. , 112: 284-289 [1983]; Tilburn et al., Gene , 26: 205-221 [1983]; Yelton et al ., Proc. Natl. Acad. Sci. USA , 81: 1470-1474 [1984] and A. Niger (Kelly and Hynes, EMBO J. , 4: 475-479 [1985]). Methyltrophic yeast is suitable and consists of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis and Rhodotorula Yeast capable of growing on methanol, selected from, but not limited to. A list of specific species that are examples of these types of yeast is described in C. Anthony of The Biochemistry of Methylotrophs , 269 (1982).

Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms. Examples of invertebrate cells include insect cells and plant cells, such as Drosophila S2 and Spodoptera Sf9. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) cells and COS cells. More specific examples include monkey kidney CV1 cell lines transformed with SV40 (COS-7, ATCC CRL 1651), kidney cell lines of human embryos (293 cells or 293 cells subcloned for growth in suspension culture, Graham et al. J. Gen Virol. , 36:59 (1997)), Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA , 77: 4216 ( 1980)), mouse sertoli cells (TM4, Marter, Biol. Reprod. , 23: 243-251 (1980)), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065) and mice Breast tumors (MMT 060562, ATCC CCL 51). One skilled in the art can readily select suitable host cells.

3. Selection and use of replicable vectors

Nucleic acid encoding a PRO (eg cDNA or genomic DNA) is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors can be easily obtained. For example, the vector may be in the form of plasmids, cosmids, viral particles or phages. Suitable nucleic acid sequences can be inserted into the vector by various methods. In general, DNA is inserted into a suitable restriction endonuclease site using techniques known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer components, promoters and transcription termination sequences. The preparation of suitable vectors comprising one or more such components uses standard ligation techniques known to those skilled in the art.

PRO can be produced not only by direct recombination methods but also as a fusion polypeptide with a heterologous polypeptide that can be a mature protein or other polypeptide or signal sequence having a specific cleavage site at the N terminus of the polypeptide. In general, the signal sequence may be a component of the vector or part of a PRO-encoding DNA inserted into the vector. The signal sequence can be for example a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leader. For yeast secretion, the signal sequence can be, for example, a yeast invertase leader, an α factor leader (Saccharomyces and Kluyveromyces α-factor leader (described in US Pat. No. 5,010,182)) or an acid phosphatase leader, C. . C. albicans glucoamylase leader (EP 362,179 published April 4, 1990) or a signal described in WO 90/13646 published November 15, 1990. In mammalian cell expression, mammalian signal sequences, such as signal sequences from secretory polypeptides of the same or related species, and viral secretion leaders can be used to direct the secretion of proteins.

Both expression and cloning vectors contain nucleic acid sequences that allow the vector to replicate in one or more selected host cells. Such sequences are known for various bacteria, yeasts and viruses. The origin of replication of plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Do.

Expression and cloning vectors will typically contain a selection gene, also called a selectable marker. Representative selection genes, eg, genes encoding D-alanine racemases for Bacillus, may comprise (a) proteins that confer resistance to antibiotics or other toxins such as ampicillin, neomycin, methotrexate, or tetracycline, (b) Encode proteins that complement nutritional deficiencies or (c) provide important nutrients that are not available from complex media.

Examples of selectable markers suitable for mammalian cells are markers that allow identification of cells capable of receiving PRO-encoding nucleic acids, for example DHFR or thymidine kinase. When wild type DHFR is used, a suitable host cell is a CHO cell line lacking DHFR activity, and Urlaub et al ., Proc. Natl. Acad. Sci. USA , 77: 4216 (1980)]. Suitable selection genes for use in yeast are the trp1 gene present in yeast plasmid YRp7 (Stinchcomb et al. , Nature , 282: 39 (1979)); Kingsman et al., Gene , 7: 141 (1979); Tschemper et al., Gene , 10: 157 (1980). trp1 gene provides a selection marker for variant strains of yeast that cannot grow using tryptophan (eg, ATCC 44076 or PEP4-1) [Jones, Genetics , 85: 12 (1977)] .

Expression and cloning vectors contain a promoter operably linked to a PRO coding nucleic acid sequence that directs mRNA synthesis. Promoters recognized by various potential host cells are known. Suitable promoters for use in prokaryotic hosts include the β-lactamase and lactose promoter systems (Chang et al. , Nature , 275: 615 (1978)); Goeddel et al. , Nature , 281: 544 (1979), alkaline phosphatase, tryptophan (trp) promoter system [Goeddel, Nucleic Acid Res. , 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter (deBoer et al ., Proc. Natl. Acad. Sci. USA , 80: 21-25 (1983)]. In addition, promoters used in bacterial systems will contain a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding the PRO.

Examples of promoter sequences suitable for use in yeast hosts include 3-phosphoglycerate kinases [Hitzeman et al . J. Biol. Chem. , 255: 2073 (1980)] or other relevant enzymes (Hess et al ., J. Adv. Enzyme Reg. , 7: 149 (1968); Holland, Biochemistry , 17: 4900 (1978)]], for example enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose- Promoters for 6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosphosphate isomerase, phosphoglucose isomerase and glucokinase.

Other yeast promoters, which are inducible promoters with the additional advantage of transcription controlled by growth conditions, include alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes involved in nitrogen metabolism, metallothionein, glyceraldehyde Promoter region for 3-phosphate dehydrogenase, and enzymes that act on maltose and galactose use. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.

Transcription of PRO from a vector in a mammalian host cell may include viruses such as polyoma virus, poultry virus (UK No. 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine Genomes of viruses such as papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and monkey virus 40 (SV40), heterologous mammalian promoters such as actin promoters or immunoglobulin promoters, and heat- It is regulated by a promoter that is compatible with the host cell system, obtained from the impact promoter.

Transcription of the DNA encoding PRO by higher eukaryotes can be increased by inserting an enhancer sequence into the vector. Enhancers are cis-functional components of DNA, generally about 10 to 300 bp, that act on the promoter to increase transcription. Currently, many enhancer sequences are known to be derived from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer derived from a virus of a eukaryotic cell. Examples include the SV40 enhancer (bp 100-270) later in the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer later in the origin of replication, and the adenovirus enhancer. The enhancer can be spliced into the vector at the 5 'or 3' position in the PRO coding sequence, but is preferably located at the 5 'site from the promoter.

In addition, expression vectors for use in eukaryotic host cells (multinuclear cells derived from yeast, fungi, insects, plants, animals, humans or other multicellular organisms) may comprise sequences necessary for transcription termination and mRNA stabilization. Such sequences are typically obtained from the 5 ', and optionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide fragments that are transcribed into polyadenylation fragments in the untranslated portion of the mRNA encoding PRO.

Other methods, vectors and host cells suitable for application to the synthesis of PRO in the culture of recombinant vertebrate cells are described in Getting et al. , Nature , 293: 620-625 (1981); Mantei et al. , Nature , 281: 40-46 (1979); European Patent No. 117,060 and European Patent No. 117,058.

4. Detection of Gene Amplification / Expression

Gene amplification and / or expression may be, for example, conventional Southern blotting, Northern blotting to quantify transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA , 77: 5201-5205 (1980)], dot blotting (DNA analysis) or by in situ hybridization using appropriately labeled probes based on the sequences provided herein. have. Alternatively, antibodies can be used that can recognize a particular double chain, including DNA double strands, RNA double strands, and DNA-RNA hybrid double strands or DNA-protein double strands. In other words, an assay can be performed that can label the antibody, bind the double chain to the surface, and detect the presence of the antibody bound to the double chain when the double chain is formed on the surface.

Alternatively, gene expression can be measured by immunological methods such as immunohistochemical staining of cells or tissue sections and analysis of cell culture or body fluids for direct quantification of expression of gene products. Antibodies useful for immunohistochemical staining and / or analysis of sample fluids can be monoclonal or polyclonal antibodies and can be prepared in any mammal. Conveniently, antibodies to exogenous sequences that are fused to native sequence PRO polypeptides or synthetic peptides based on the DNA sequences provided herein or to PRO DNA and that encode specific antibody epitopes can be prepared.

5. Purification of Polypeptides

The form of PRO may be recovered from culture medium or from host cell lysate. When bound to the membrane, it can be released from the membrane using a suitable detergent solution (eg Triton-X 100) or by cleavage of the enzyme. Cells used for expression of PRO may be pulverized by various physical or chemical means such as freeze-thaw cycles, sonication, mechanical grinding or cell lysates.

It may be desirable to purify PRO from recombinant cell proteins or polypeptides. Examples of suitable purification methods are fractionation on ion exchange columns, ethanol precipitation, reverse phase HPLC, silica or cation exchange resins, for example chromatography on DEAE, chromatographic focusing, SDS-PAGE, ammonium sulfate precipitation, for example Sephadex Gel filtration using G-75, Protein A Sepharose column to remove contaminants such as IgG, and metal chelating column to bind epitope tagged forms of PRO. Various protein purification methods can be used, and such methods are known in the art and are described, for example, in Deutscher, Methods in Enzymology , 182 (1990); Scopes, Protein Purification: Principles and Practice , Springer-Verlag, New York (1982). The purification step (s) selected will depend, for example, on the production method used and the properties of the particular PRO produced.

E. Use of PRO

Nucleotide sequences (or complements thereof) that encode PRO have a variety of uses in the field of molecular biology, including their use as hybridization probes, in chromosome and gene mapping, and in the production of antisense RNAs and DNA. PRO nucleic acids will also be useful for the production of PRO polypeptides by the recombinant techniques described herein.

The full length native sequence PRO gene or fragment thereof isolates a full length PRO cDNA or other cDNA (eg, a gene encoding a PRO from a native variant or other species of PRO) having the desired sequence identity with the native PRO sequence disclosed herein. It can be used as a hybridization probe for the cDNA library. Optionally, the probe will be about 20 to about 50 bases in length. Hybridization probes can be derived from at least a portion of a new region of the full-length native nucleotide sequence, where this region can be determined without undue experimentation, or from a genomic sequence comprising a promoter, enhancer component and intron of native sequence PRO. For example, the screening method will include isolating the coding region of the PRO gene using known DNA sequences to synthesize selected probes of about 40 bases. Hybridization probes can be labeled with a variety of labels, including radioactive nucleotides such as ³² P or ³⁵ S, or enzymatic labels such as alkaline phosphatase linked to the probe via an avidin / biotin linkage system. Labeled probes having sequences complementary to those of the PRO genes of the invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine the members of the library that the probe hybridizes to. Hybridization techniques are described in more detail in the Examples below.

Any EST sequence disclosed herein can similarly be used as a probe using the methods described herein.

Other useful fragments of PRO nucleic acids include antisense or sense oligonucleotides comprising a single-stranded nucleic acid sequence (RNA or DNA) capable of binding to a target PRO mRNA (sense) or PRO DNA (antisense) sequence. Antisense or sense oligonucleotides according to the present invention comprise fragments of coding regions of PRO DNA. This fragment generally comprises at least about 14 nucleotides, preferably about 14 to 30 nucleotides. The ability to induce antisense or sense oligonucleotides based on cDNA sequences encoding a given protein is described, for example, in Stein and Cohen ( Cancer Res. 48: 2659, 1988) and van der Krol et al. ( BioTechniques 6: 958, 1988).

Combination of the antisense or sense oligonucleotide with the target nucleic acid sequence forms a double strand that blocks the transcription or translation of the target sequence by one of several or other methods, including enhanced digestion of the double strand, early termination of transcription or translation. . Thus, antisense oligonucleotides can be used to block the expression of the PRO protein. In addition, antisense or sense oligonucleotides include oligonucleotides having modified sugar-phosphodiester backbones (or other sugar chains, eg, sugar chains disclosed in WO 91/06629), wherein such sugar chains are internal Resistance to clease. Such oligonucleotides with resistant sugar chains are stable in vivo (ie, resistant to enzymatic degradation) but retain sequence specificity capable of binding to the target nucleotide sequence.

Other examples of sense or antisense oligonucleotides include organic residues such as those disclosed in WO 90/10048, and other residues that increase the affinity of the oligonucleotide for the target nucleic acid sequence, such as poly- (L-lysine). Oligonucleotides that are covalently linked with In addition, intercalating agents such as ellipsine, and alkylating agents or metal complexes can be linked to sense or antisense oligonucleotides to change the binding specificity of the antisense or sense oligonucleotides to the target nucleotide sequence.

Cells containing the target nucleic acid sequence, for example, by any gene delivery method, including CaPO ₄ -mediated DNA transfection, electroporation, or by using a gene delivery vector such as Epstein-Barr virus. Antisense or sense oligonucleotides can be introduced into. In a preferred method, antisense or sense oligonucleotides are inserted into a suitable retroviral vector. The cell comprising the target nucleic acid sequence is contacted with the recombinant retroviral vector in vivo or ex vivo. Suitable retroviral vectors include vectors derived from double copy vectors designated murine retroviruses M-MuLV, N2 (retrovirus derived from M-MuLV), or DCT5A, DCT5B and DCT5C (see WO 90/13641). Included but not limited to.

In addition, as disclosed in WO 91/04753, it is possible to introduce a sense or antisense oligonucleotide into a cell comprising a target nucleotide sequence by forming a complex with a ligand binding molecule. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the linkage of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to the corresponding molecule or receptor, nor does it block intracellular entry in the form of sense or antisense oligonucleotides or complexes thereof.

Alternatively, as disclosed in WO 90/10448, one can introduce a sense or antisense oligonucleotide into a cell comprising a target nucleic acid sequence by forming an oligonucleotide-lipid complex. Such sense or antisense oligonucleotide-lipid complexes are preferably separated by internal lipases within the cell.

Antisense or sense RNA or DNA molecules are generally about 5 bases, about 10 bases, about 15 bases, about 20 bases, about 25 bases, about 30 bases, about 35 bases, about 40 bases in length. Base, about 45 bases, about 50 bases, about 55 bases, about 60 bases, about 65 bases, about 70 bases, about 75 bases, about 80 bases, about 85 bases, about 90 bases Base, about 95 bases, about 100 bases or more.

Probes may also be used in PCR techniques to generate a group of sequences for identification of closely related PRO coding sequences.

In addition, nucleotide sequences encoding PRO can be used to prepare hybridization probes for mapping genes encoding PRO and for genetic analysis of individuals with genetic disorders. Nucleotide sequences provided herein can be mapped to specific regions of chromosomes and chromosomes using known techniques such as in situ hybridization, linkage analysis for known chromosomal markers, and hybridization screening using libraries.

If the coding sequence of a PRO encodes a protein that binds to another protein (eg where PRO is a receptor), the PRO can be used in an assay to identify other proteins or molecules involved in this binding interaction. By this method, inhibitors of receptor / ligand binding interactions can also be identified. In addition, proteins involved in such binding interactions can be used to screen for peptides or small molecule inhibitors or agonists of binding interactions. Receptor PRO can also be used to isolate similar ligands. Screening assays can be designed to find lead compounds that mimic the biological activity of a receptor for native PRO or PRO. Such screening assays include high throughput screening assays for chemical libraries and will be particularly suitable for identifying drug candidates that are small molecules. Small molecules include synthetic organic or inorganic compounds. Assays can be performed in a variety of formats including protein-protein binding assays, biochemical screening assays, immunoassays, and cell based assays that are characterized in the art.

Nucleic acids encoding PRO or variants thereof can also be used to generate transgenic or “knock out” animals useful for the development and screening of useful therapeutics. Transgenic animals (eg mice or rats) are animals that have cells that contain the transgenes, which are transgenic, such as at the embryonic stage or in the ancestors of those animals. Is introduced. The transgene is DNA that is integrated into the genome of a cell from which a transgenic animal develops. In one embodiment, a cDNA encoding a PRO can be used to clone genomic DNA encoding the PRO according to established techniques and to use the genomic sequence to transgene comprising cells expressing the DNA encoding the PRO. Animals can be produced. In particular, methods for producing transgenic animals such as mice or rats are common in the art and are described, for example, in US Pat. Nos. 4,736,866 and 4,870,009. Typically, specific cells are targeted for the introduction of a PRO transgene with a tissue specific enhancer. A transgenic animal comprising a copy of a transgenic gene encoding a PRO introduced into the germline of the animal at the embryonic stage may be used to investigate the effect of increasing the expression of the DNA encoding the PRO. Such animals can be used, for example, as test animals for reagents that are thought to protect from pathological symptoms associated with overexpression of PRO polypeptides. According to this aspect of the invention, treatment of the animal with the reagent results in a lower incidence of pathological symptoms than untreated animals carrying the transgene, indicating a potential therapeutic intervention in the pathological condition.

Alternatively, using a non-human homologue of PRO, having a defect or modified gene encoding PRO as a result of homologous recombination between the endogenous gene encoding PRO and the modified genomic DNA encoding PRO introduced into the animal's embryonic cells. You can make PRO "knock out" animals. For example, cDNA encoding PRO can be used to clone genomic DNA encoding PRO according to established techniques. Portions of genomic DNA encoding a PRO may be deleted or substituted with other genes, such as genes encoding selective markers that may be used to monitor integration. In general, thousands of bases of unmodified flanking DNA (at both the 5 'and 3' ends) are included in a vector (e.g., for homologous recombinant vectors, see Thomas and Capecchi, Cell , 51: 503). (1987)). This vector is introduced into a stem cell line (e.g., by electroporation), and cells in which homologous recombination of the introduced DNA and the endogenous DNA are selected (see, eg, Li et al., Cell , 69 : 915 (1992). Selected cells are then injected into blastocysts of animals (eg mice or rats) to form aggregated chimeras (see, eg, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987), pp. 113-152). The chimeric embryos were then transplanted into suitable fertility surrogate animals to produce "knock out" animals. Progeny carrying homologous recombinant DNA in germ cells can be identified using standard techniques and used to breed animals in which all cells of the animal contain homologous recombinant DNA. Knockout animals are characterized, for example, by the ability to defend against certain pathological symptoms and the development of pathological symptoms due to the absence of PRO polypeptides.

Nucleic acids encoding PRO polypeptides can also be used in gene therapy. When used in gene therapy, genes are introduced into cells to achieve in vivo synthesis of therapeutically effective gene products, for example to replace defective genes. “Gene therapy” includes both traditional gene therapy where a lasting effect is achieved by a single treatment and administration of gene therapy, including single or repeated administration of therapeutically effective DNA or mRNA. Antisense RNAs and DNAs can be used as therapeutic agents to block the expression of certain genes in vivo. Despite the low intracellular concentration of these oligonucleotides due to the limited uptake of short antisense oligonucleotides through the cell membrane, it has already been found that they can act as inhibitors when introduced into cells (Zamecnik et al., Proc. Natl. Acad). , Sci. USA 83, 4143-4146 (1986)). Such oligonucleotides can enhance the uptake of oligonucleotides by modification, for example by replacing their negatively charged phosphodiester groups with non-charged groups.

There are a variety of techniques that can be used to introduce nucleic acids into living cells. This technique depends on whether the nucleic acid is delivered to cells cultured in vitro or to cells of the desired host in vivo. Suitable techniques for delivering nucleic acids to mammalian cells in vitro include liposomes, electroporation, microinjection, cell fusion, DEAE-dextran and calcium phosphate precipitation and the like. Currently preferred for in vivo gene delivery techniques include transfection using viral (usually retroviral) vectors and viral coat protein-liposomal mediated transfection (Dzau et al., Trends in Biotechnology 11, 205-210 ( 1993). In some cases, it is desirable to provide nucleic acid sources with agents that target target cells, such as cell surface membrane proteins or antibodies specific for the target cell, ligands for receptors on the target cell, and the like. When liposomes are used, proteins that bind to cell surface membrane proteins involved in endocytosis can be used for targeting and / or promote uptake, such as proteins that are aromatic for certain cell types. Capsid proteins or fragments thereof, antibodies to proteins that experience internalization in circulation, and proteins that target intracellular locations and enhance intracellular half-life. Receptor mediated endocytosis techniques are described, for example, in Wu et al., J. Biol. Chem. 262, 4429-4432 (1987), and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410 -3414 (1990)). For a review of gene marking and gene therapy protocols, see Anderson et al., Science 256, 808-813 (1992).

The PRO polypeptides disclosed herein can also be used as molecular weight markers for protein electrophoresis, and the isolated nucleic acid sequences can be used to recombinantly express these markers.

Nucleic acid molecules or fragments thereof encoding the PRO polypeptides disclosed herein are useful for the identification of chromosomes. In this regard, there is a continuing need to identify new chromosomal markers because there are currently relatively few chromosomal marking reagents available based on actual sequence data. Each of the PRO nucleic acid molecules of the present invention can be used as a chromosome marker.

The PRO polypeptides and nucleic acid molecules of the invention can also be used for tissue typing, wherein the PRO polypeptides of the invention can be differentially expressed in one tissue compared to other tissues. PRO nucleic acid molecules will be used to generate probes for PCR, Northern analysis, Southern analysis and Western analysis.

The PRO polypeptides disclosed herein may also be used as therapeutic agents. Pharmaceutically useful compositions can be prepared by formulating the PRO polypeptides of the invention according to known methods, wherein the PRO product is combined with a pharmaceutically acceptable carrier vehicle. Therapeutic formulations are prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing the active ingredient with the desired purity with any physiologically acceptable carrier, excipient or stabilizer ( Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)). Acceptable carriers, excipients or stabilizers are nontoxic to the subject of administration at the dosages and concentrations employed, and include antioxidants such as phosphates, citrate and other organic acids, ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, serum Proteins such as albumin, gelatin or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins , Chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and / or nonionics such as Tween®, Pluronics® or PEG Surfactants and the like.

The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes before or after lyophilization and thawing.

Therapeutic compositions of the present disclosure may generally be contained in a container with a sterile access door, for example, in a stoppered vial that can be pierced by an intravenous solution bag or a hypodermic needle.

Routes of administration include known methods, for example by injection or infusion by intravenous, intraperitoneal, intracranial, intramuscular, intraocular, intraarterial or intralesional routes, topical administration, or sustained release.

Dosages and desired drug concentrations of the pharmaceutical compositions of the present invention may vary depending upon the particular intended use. Determination of the appropriate dosage and route of administration is well known to those skilled in the art. The results of animal experiments provide reliable guidance in determining dosages effective for human treatment. Scaling effective doses between species is described in Mordenti, J. and Chappell, W. "The use of interspecies scaling in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al., Eds., Pergamon Press, New York 1989, pp. 42-96).

When a PRO polypeptide or agonist or antagonist thereof is administered in vivo, the general dosage depends on the route of administration and is about 10 ng to 100 mg per kg body weight of the mammal, or preferably about 1 μg / day kg to 10 mg / kg. Guidance as to specific dosages and methods of delivery is provided in the literature, for example in US Pat. No. 4,657,760, 5,206,344 or 5,225,212. Other agents may be effective for other therapeutic compounds and other diseases, and administration targeting one organ or tissue is expected to require delivery in a different manner than, for example, administration to another organ or tissue. do.

If sustained release administration of a PRO polypeptide is required for an agent with release properties suitable for the treatment of a disease or disorder requiring administration of the PRO polypeptide, microencapsulation of the PRO polypeptide is contemplated. Microencapsulation of recombinant proteins for delayed release has been successfully performed using human growth hormone (rhGH), interferon (rhIFN), interleukin-2 and MN rgp120 (Johnson et al., Nat. Med. , 2: 795- 799 (1996); Yasuda, Biomed. Ther. , 27: 1221-1223 (1993); Hora et al., Bio / Technology , 8: 755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polyactide Polyglycolide Microsphere Systems, "in Vaccine Design: The Subunit and Adjuvant Approach , Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462: WO 97/03692, WO 96/40072, WO 96 / 07399 and US Pat. No. 5,654,010).

Sustained release preparations of these proteins have been developed using poly-lactic acid-co-glycolic acid (PLGA) polymers due to their biocompatibility and broad biodegradable properties. The degradation products of PLGA, lactic acid and glycolic acid, can be quickly removed from the human body. In addition, the resolution of the polymer can be adjusted from months to years depending on its molecular weight and composition (Lewis, "Controlled release of bioactive agents from lactide / glycolide polymer," in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41).

The invention includes methods for screening compounds to identify (antagonist) compounds that mimic PRO polypeptides or block the effects of (agonist) PRO polypeptides. Screening assays for antagonist drug candidates were designed to identify compounds that bind or complex with PRO polypeptides encoded by the genes identified herein or interfere with the interaction of the encoded polypeptide with other intracellular proteins. Such screening assays include assays capable of high throughput screening for chemical libraries, which would be particularly suitable for identifying small molecule drug candidates.

Such assays can be performed in a variety of formats including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays characterized in the art.

Common to all assays for antagonists is that the PRO polypeptide encoded by the nucleic acids identified herein and the candidate drug must be contacted under conditions and time sufficient to allow them to interact with each other.

In binding assays the interaction is binding and the complexes formed can be isolated or detected in the reaction mixture. In certain embodiments, a PRO polypeptide or drug candidate encoded by a gene identified herein is immobilized to a solid phase, eg, a microtiter plate, by covalent or non-covalent attachment. Non-covalent attachment is generally achieved by coating the solid surface with a solution of PRO polypeptide and drying. Alternatively, immobilized antibodies, such as monoclonal antibodies specific for immobilized PRO polypeptides, can be used to anchor them to a solid surface. This analysis is performed by adding an unfixed component that can be labeled by a detectable label to a coded surface comprising a fixed component, for example an anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and complexes anchored to the solid surface are detected. If the component that was not originally immobilized contained a detectable label, detection of the label immobilized on the surface indicates that a complexing reaction occurred. If a component that is not originally immobilized does not include a label, the complexing reaction can be detected, for example, using a labeled antibody that specifically binds to the immobilized complex.

If a candidate compound interacts with, but does not bind to, a particular PRO polypeptide encoded by a gene identified herein, the interaction of the candidate compound with that polypeptide can be analyzed by well known methods of detecting protein-protein interactions. . Such assays include conventional methods such as crosslinking, coimmunoprecipitation, and copurification via gradient or chromatography columns. Protein-protein interactions are also described in Fields and co-workers (Fields and Song, Nature (London) , 340: 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA , 88 : 9578-9582 (1991)) as discussed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA , 89: 5789-5793 (1991), can be used to monitor using the yeast-based gene system described. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA-binding domain and the other as a transcription-active domain. The yeast expression system described in this publication (generally referred to as "2-hybrid system") takes advantage of this property and uses two hybrid proteins, one of which is that the target protein is associated with the DNA-binding domain of GAL4. The other is a candidate active protein fused with an active domain. The expression of the GAL1-lacZ reporter gene under the control of the GAL4-activation promoter depends on the reconstitution of GAL4 activity through protein-protein interactions. Colonies containing the interacting polypeptide are detected using a pigment producing substrate for β-galactosidase. A complete kit (MATCHMAKER®), which identifies protein-protein interactions between two specific proteins using 2-hybrid technology, can be purchased from Clontech. In addition, the system can be extended to map protein domains involved in specific protein interactions, as well as to pinpoint the location of amino acid residues critical for such interactions.

In the following way, compounds which interfere with the interaction of genes encoding PRO polypeptides identified herein with other intracellular or extracellular components can be tested. A reaction mixture comprising the product of a gene encoding a PRO polypeptide and an intracellular or extracellular component was prepared under conditions and times that allow interaction and binding of the two products. To test the ability of the candidate compound to inhibit binding, the reaction was performed in the presence and absence of the test compound. In addition, placebo may be added to a third reaction mixture that serves as a positive control. The binding (complex formation) between the test compound and the intracellular or extracellular components present in the mixture was monitored as described above. The formation of a complex in the control reactant but no complex in the reaction mixture comprising the test compound indicates that the test compound interferes with the interaction of the test compound with its reaction counterpart.

To analyze the antagonist, the PRO polypeptide could be added to the cell along with the compound to screen for specific activity, and the ability of the compound to inhibit the desired activity in the presence of the PRO polypeptide indicated that the compound was an antagonist to the PRO polypeptide. Alternatively, the antagonist could be detected by binding the PRO polypeptide and potential antagonist with a membrane-bound PRO polypeptide receptor or recombinant receptor under appropriate conditions for a competitive inhibition assay. PRO polypeptides can be labeled with radioactive isotopes, for example, to determine the effect of potential antagonists using the number of PRO polypeptide molecules that bind to the receptor. Genes encoding receptors could be identified by several methods known to those of skill in the art, for example ligand panning and FACS classification (Coligan et al., Current Protocols in Immun. , 1 (2): Chapter 5 (1991)). . Preferably, expression cloning methods are used, wherein the polyadenylation RNA is prepared from cells reactive to the PRO polypeptide, and the cDNA library generated from this RNA is classified as pool and is non-responsive to the PRO polypeptide or It is used to transfect other cells. Transfected cells growing on glass slides are exposed to labeled PRO polypeptide. PRO polypeptides can be labeled by a variety of methods, including iodide or encapsulation of recognition sites for site-specific protein kinases. After immobilization and incubation, the slides were analyzed by autoradiography. Sub- pools were identified by identifying positive pools and transfected again using interactive sub- pooling and rescreening methods, resulting in a single clone encoding the putative receptor.

As an alternative method of identifying receptors, labeled PRO polypeptides could be photoaffinity-linked with extract samples expressing cell membranes or receptor molecules. The crosslinked material was analyzed by PAGE and exposed to X-ray film. Label complexes containing receptors can be cut and digested into peptide fragments for protein micro-sequencing. By designing a set of degenerate oligonucleotide probes using amino acid sequences obtained from micro-sequencing, one could screen cDNA libraries and identify genes encoding putative receptors.

In another antagonist assay method, mammalian cell or membrane samples expressing receptors in the presence of candidate compounds were incubated with labeled PRO polypeptide. Thereafter, the ability of the compound to enhance or block the interaction could be measured.

More specific examples of potential antagonists include oligonucleotides that bind to fusions of immunoglobulins with PRO polypeptides, and in particular poly- and monoclonal antibodies, and antibody fragments, side chain antibodies, anti-genetic antibodies, and such antibodies or fragments thereof. Chimeric or humanized forms of, and antibodies, including human antibodies and antibody fragments. Alternatively, the potential antagonist may be a modified form of a PRO polypeptide that recognizes but does not affect closely related proteins, such as receptors, and thus competitively inhibits the action of the PRO polypeptide.

Another potential PRO polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where the antisense RNA or DNA molecule acts to directly block the translation of the mRNA by hybridizing with the target mRNA to prevent protein translation. . Antisense techniques can be used to regulate gene expression via triple helix formation or antisense DNA or RNA, all of which are based on the binding of polynucleotides to DNA or RNA. For example, the 5 'coding portion of a polynucleotide sequence encoding a mature PRO polypeptide herein can be used to design antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of genes involved in transcription (Lee et al., Nucl. Acids Res. , 6: 3073 (1979); Cooney et al, Science , 241). : 456 (1988); Dervan et al., Science , 251: 1360 (1991))) transcription and production of PRO polypeptides. Antisense RNA oligonucleotides hybridized with their mRNAs in vivo to block the translation of mRNA molecules to PRO polypeptides (antisense-Okano, Neurochem. , 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988). In addition, the oligonucleotides described above could be delivered to cells to express antisense RNA or DNA in vivo to inhibit the production of PRO polypeptides. If antisense DNA is used, oligodeoxyribonucleotides derived from transcription-initiation sites, eg, between about -10 and +10 of the target gene nucleotide sequence, are preferred.

Potential antagonists include small molecules that bind to an active site, a receptor binding site, or small molecules that bind to a growth factor or other related binding site of a PRO polypeptide to block the normal biological activity of the PRO polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic bipeptidyl organic or inorganic compounds.

Ribozymes are enzyme RNA molecules that can catalyze specific cleavage of RNA. Ribozymes act by sequence-specific hybridization with complementary target RNAs followed by cleavage by endonucleases. Known techniques have been able to identify specific ribozyme cleavage sites within potential RNA targets. See, for example, Rossi, Current Biology , 4: 469-471 (1994) and PCT publication No. WO 97/33551 (published September 18, 1997).

The triple helix form of nucleic acid molecules used to inhibit transcription must be single-stranded and consist of deoxynucleotides. The base composition of such oligonucleotides is designed to facilitate triple helix formation via the Hoogsteen base pair rule, which typically requires significant size purine or pyrimidine stretch in one of the double chains. For further details see, for example, PCT publication No. WO 97/33551, supra.

The small molecules can be identified by any one or more of the screening assays described above and / or by any other screening technique well known to those skilled in the art.

F. Anti-PRO Antibodies

The invention further provides anti-PRO antibodies. Examples of antibodies include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies.

1. Polyclonal Antibodies

Anti-PRO antibodies can include polyclonal antibodies. Methods of making polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies can be produced in mammals, for example, by injecting one or more injections of an immunizing agent and, if necessary, an adjuvant. In general, the immunizing agent and / or adjuvant will be injected into the mammal by subcutaneous or intraperitoneal injection. Immunizing agents can include PRO polypeptides or fusion proteins thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine tyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that can be used include Freud's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicholinomycolate). Immunotreatment methods can be selected by one skilled in the art without undue experimentation.

2. Monoclonal Antibodies

The anti-PRO antibody may alternatively be a monoclonal antibody. Monoclonal antibodies can be prepared using hybridoma methods as described in Kohler and Milstein, Nature , 256 : 495 (1975). In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to induce lymphocytes capable of producing or producing antibodies that specifically bind to the immunizing agent. Alternatively, lymphocytes may be immunized in vitro.

Immunizing agents generally include PRO polypeptides or fusion proteins thereof. Generally, peripheral blood lymphocytes (“PBLs”) are used when cells of human origin are desired, but spleen cells or lymph node cells are used when a mammalian source other than human is desired. Then, a suitable fusion agent such as polyethylene glycol is used to fuse the lymphocytes with the immortalized cell line to form hybridoma cells. Monoclonal Antibodies: Principle and Practice , Academic Press, (1986) pp. 59-103]. Immortalized cell lines are largely transformed mammalian cells, especially myeloma cells of rodent, bovine and human origin. In general, rat or mouse myeloma cell lines are used. Hybridoma cells are preferably cultured in a suitable culture medium containing one or more substances that inhibit the proliferation or survival of unfused immortalized cells. For example, if the parent cell lacks hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT) enzymes, the culture medium for hybridomas ("HAT medium") typically includes hypoxanthine, aminopterin and thymidine. These substances will inhibit the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, maintain stable levels of antibody production by selected antibody-producing cells, and are susceptible to media such as HAT medium. More preferred immortalized cell lines are, for example, murine myeloma cell lines available from the Salk Institute Cell Distribution Center (San Diego, CA) and the American Type Culture Collection (Manassas, VA). . In addition, human myeloma cell lines and mouse-human heteromyeloma cell lines have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol., 133 : 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications , Marcel Dekker, Inc., New York, (1987) pp. 51-63.

Culture medium in which hybridoma cells are cultured can be assayed for the presence of monoclonal antibodies directed against PRO. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or in in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). Was measured. Such techniques and assays are known in the art. The binding affinity of monoclonal antibodies can be found in, for example, Scatchard analysis (Munson and Pollard, Anal. Biochem. , 107 : 220 (1980).

After identifying the desired hybridoma cells, clones were subcloned by restriction dilution procedures and cultured by standard methods (Goding, supra ). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, hybridoma cells can be cultured in vivo as ascites tumors in a mammal.

Monoclonal antibodies secreted by the subclones are for example by conventional immunoglobulin purification methods such as protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. It can be isolated and purified from culture medium or ascites fluid.

Monoclonal antibodies can also be prepared by recombinant DNA methods such as those described in US Pat. No. 4,816,567. The DNA encoding the monoclonal antibodies of the invention can be readily obtained using conventional methods (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of murine antibodies). It can be isolated and sequenced. The hybridoma cells of the present invention serve as a preferred source of such DNA. Once isolated, the DNA is placed in an expression vector and then transfected with an expression vector to host cells, such as monkey COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that otherwise do not produce immunoglobulin proteins. Monoclonal antibodies can be synthesized in recombinant host cells. In addition, DNA, for example, homologous replacing the murine sequence in the coding sequence for human heavy and light chain constant domain, or (U.S. Patent No. 4,816,567; Morrison (Morrison), etc., supra), or a non-immunoglobulin polypeptide All or part of the coding sequence for may be modified by covalently binding to an immunoglobulin coding sequence. Such non-immunoglobulin polypeptides can be substituted for the constant domains of the antibodies of the invention, or the variable domains of one antibody-binding site of the antibodies of the invention can be used to generate chimeric bivalent antibodies.

The antibody may be a monovalent antibody. Methods of making monovalent antibodies are known in the art. For example, one method involves recombinant expression of immunoglobulin light and modified heavy chains. The heavy chain is generally truncated at any point in the Fc region to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted or deleted with other amino acid residues to prevent crosslinking.

In vitro methods are also suitable for the preparation of monovalent antibodies. Degradation of the antibody to prepare antibody fragments, particularly Fab fragments, can be carried out using techniques commonly known in the art.

3. Human and Humanized Antibodies

In addition, the anti-PRO antibodies of the invention may comprise humanized antibodies or human antibodies. Humanized forms of non-human (eg murine) antibodies include immunoglobulin chains or fragments thereof comprising chimeric immunoglobulins, minimal sequences derived from non-human immunoglobulins or fragments thereof (eg, Fv, Fab, Fab ', F (ab') ₂ or other antigen binding small sequence of the antibody). A humanized antibody is a human immunono that replaces residues in the complementarity determining regions (CDRs) of the receptor with residues from CDRs of species other than the human (donating antibody) such as mouse, rat or rabbit having the desired specificity, affinity and ability. Globulin (receptive antibody). In some cases, the Fv framework residues of human immunoglobulins are replaced by corresponding non-human residues. Humanized antibodies may also include residues that are not present in the recipient antibody or in the CDR or framework sequences to be introduced. In general, humanized antibodies will comprise substantially all of one or more, generally two or more variable domains, wherein all or substantially all CDR regions correspond to regions of non-human immunoglobulins, and all or substantially all FRs. The region corresponds to the region of the human immunoglobulin consensus sequence. In addition, humanized antibodies will comprise at least a portion of an immunoglobulin constant region (Fc), typically a portion of a human immunoglobulin region (Jones et al. , Nature , 321 : 522-525 (1986)). ; Riechmann et al. , Nature , 332 : 323-329 (1988); And Presta, Curr. Op. Struct. Biol. 2 : 593-596 (1992)].

Methods of humanizing nonhuman antibodies are well known in the art. In general, humanized antibodies have one or more amino acid residues introduced thereto from a non-human source. These non-human amino acid residues are often referred to as "import" residues and are typically obtained from an "import" variable domain. Humanization consists essentially of methods such as Winter et al. ( Nature , 321 : 522-525 (1986)) by replacing the corresponding sequences of human antibodies with rodent CDRs or CDR sequences. Riechmann et al. , Nature , 332 : 323-327 (1988); It may be carried out according to Verhoeyen et al., Science , 239 : 1534-1536 (1988). Thus, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) in which substantially fewer intact human variable domains have been replaced by corresponding sequences from non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues of similar sites in rodent antibodies.

Human antibodies can also be prepared using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, J., Mol. Biol. 227 : 381 (1991); Marks et al ., J. Mol. Bio. , 222 : 581 (1991)]. In addition, techniques such as Kohl et al. And Boerner can also be used for the production of human monoclonal antibodies [Cole et al. Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol. , 147 (1) : 86-95 (1991)]. Likewise, human antibodies can be prepared by introducing human immunoglobulin loci into a transgenic animal, eg, a mouse, wherein the internal immunoglobulin genes are partially or fully inactivated. After challenge, human antibody production was observed, which was very similar to the antibodies observed in humans in all respects, including gene rearrangement, assembly and antibody listing. This is described, for example, in US Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,661,016, and in scientific publications [Marks et al. Bio / Technology 10 , 779-783 (1992); Lonberg et al. , Nature 368 , 856-859 (1994), Morrison, Nature 368 , 812-13 (1994); Fishwild et al. , Nature Biotechnology 14 , 845-51 (1996); Neuberger, Nature Biotechnology 14 , 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

4. Bispecific Antibodies

Bispecific antibodies are monoclonal, preferably human or humanized antibodies with binding specificities for at least two different antigens. In this case, one of the binding specificities is for PRO and the other is for any other antigen, preferably for cell surface proteins or receptors or receptor subunits.

Methods of making bispecific antibodies are known in the art. Typically, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain / light chain-heavy chain pairs, where the two heavy chains have different specificities [Millstein and Quello Cuello, Nature , 305 : 537-539 (1983). Due to the random classification of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce possible mixtures of 10 different antibody molecules, only one of which has an accurate bispecific structure. Purification of the correct molecule is generally carried out by affinity chromatography steps. Similar methods are described in WO 93/08829 (published May 13, 1993) and Traunecker et al., EMBO J. , 10: 3655-3659 (1991).

The variable domain (antibody-antigen binding site) of an antibody with the desired binding specificity can be fused to an immunoglobulin constant domain sequence. This fusion is preferably fused with an immunoglobulin heavy chain constant domain comprising at least a portion of the hinge, CH2 and CH3 regions. It is preferred that a first heavy chain constant region (CH1) comprising a site necessary for light chain binding is present in at least one of the fusions. Immunoglobulin heavy chain fusions, and, if desired, DNAs encoding immunoglobulin light chains are inserted into separate expression vectors and co-transfected into suitable host organisms. For further details for producing bispecific antibodies, see, for example, Suresh et al. , Methods in Enzymmology , 121 : 210 (1986).

According to another method disclosed in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the proportion of heterodimer recovered from recombinant cell culture. Preferred interfaces comprise at least a portion of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule were replaced with larger side chains (eg tyrosine or tryptophan). Replacement of large amino acid side chains with small amino acid side chains (eg, alanine or threonine) created a supplemental "cavity" of the same or similar size as the large side chain at the interface of the second antibody molecule. This provides a mechanism to increase the yield of heterodimers above the yield of other unwanted end-products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg, F (ab ') ₂ bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments are described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science 229: 81 (1985), describe a method of cleaving intact antibodies by proteolysis to generate F (ab ') ₂ fragments. These fragments are reduced in the presence of the dithiol composite material sodium arsenite to stabilize nearby dithiols and prevent the formation of disulfides in the bonsai. The resulting Fab 'fragment was then converted to thionitrobenzoate (TNB) derivatives. Thereafter, one of the Fab'-TNB derivatives was reconverted to Fab'-thiol by reduction with mercaptoethylamine and mixed with equimolar amounts of other Fab'-TNB derivatives to form bispecific antibodies. The resulting bispecific antibodies can be used as substances for the selective immobilization of enzymes.

this. Bispecific antibodies were formed by directly recovering Fab 'fragments from E. coli and chemically linking them. Shalaby et al ., J. Exp. Med. 175: 217-225 (1992) discloses fully humanized bispecific antibody F (ab ') ₂ molecules. Each Fab 'fragment was secreted separately from this coli and linked by the in vitro chemical method indicated to form a bispecific antibody. The bispecific antibody thus formed was able to bind cells overexpressing the ErbB2 receptor and normal human T cells, as well as initiate the lytic activity of human cytotoxic lymphocytes against human breast cancer targets.

In addition, several techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture are disclosed. For example, bispecific antibodies were prepared using leucine zippers (Kostelny et al ., J. Immunol . 148 (5): 1547-1553 (1992)]. By gene fusion, leucine zipper peptides from Fos and Jun proteins were linked to the Fab 'portion of two different antibodies. The hinge region of the antibody homodimer was reduced to form a monomer and then reoxidized to form an antibody heterodimer. This method can also be used as a method for producing antibody homodimers. Hollinger et al ., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993) provides a different mechanism for making bispecific antibody fragments. This fragment comprises a heavy chain variable domain (V _H ) linked by a linker to the light chain variable domain (V _L ), which is too short to pair the two domains with the same chain. Therefore, V _H and V _L domains of one fragment are formed complementary to the V _H and V _L domains pair with the other fragment, the two antigen-binding sites are formed. Another strategy for making bispecific antibody fragments using single-chain Fv (sFv) dimers has been reported (see Gruber et al., J. Immunol. 152: 5368 (1994)). Antibodies having the above valences are also considered, for example, trispecific antibodies can be made (Tutt et al., J. Immunol. 147: 60 (1991)).

Typical bispecific antibodies may bind to two different epitopes of the PRO polypeptides provided herein. Alternatively, to focus on intracellular defense mechanisms against cells expressing a particular PRO polypeptide, an anti-PRO polypeptide arm can be selected from a starting molecule on leukocytes, such as a T-cell receptor molecule (eg, CD2, CD3, CD28 or B7), or an arm that binds to an Fc receptor (FcγR) of IgG, for example FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16). In addition, bispecific antibodies can be used to localize cytotoxic agents to cells that express particular PRO polypeptides. Such antibodies have a PRO-binding arm and an arm that binds to a cytotoxic substance or radionuclide chelating agent such as EOTUBE, DPTA, DOTA or TETA. Another bispecific antibody of interest binds to the PRO polypeptide and further binds to tissue factor (TF).

5. Heteroconjugate Antibodies

Heteroconjugate antibodies are also included within the scope of the present invention. Heteroconjugate antibodies consist of two covalently bound antibodies. Such antibodies can be used, for example, to target immune system cells to unwanted cells (US Pat. No. 4,676,980), and for the treatment of HIV infection (WO 91/00360, US 92/200373, and EP 03089). Ho) proposed. It is contemplated that heterozygous antibodies can be prepared in vitro using methods known in synthetic protein chemistry, including methods involving crosslinking agents. For example, immunotoxins can be prepared by forming disulfide exchange reactions or thioether bonds. Suitable reagents for this purpose include iminothiolates and methyl-4-mercaptobutyrimidate and the reagents disclosed in US Pat. No. 4,676,980.

6. Effector function operation

It may be desirable to modify the antibodies of the invention to effector function to enhance the effectiveness of the antibodies, for example in the treatment of cancer. For example, cysteine residues may be introduced into the Fc region to form disulfide bonds between the chains within this region. Homodimeric antibodies thus produced enhance internalization capacity and / or enhance complement-mediated cell death and antibody-dependent intracellular cytotoxicity (ADCC) [Caron et al ., J. Exp Med. , 176: 1191-1195 (1992) and Shopes, J. Immunol. , 148: 2918-2922 (1992). In addition, the heterodifunctional cross-links described in Wolf et al., Cancer Research, 53 : 2560-2565 (1993) can be used to prepare homodimeric antibodies with enhanced anti-tumor activity. Alternatively, antibodies with double Fc regions can be engineered to enhance complement lytic and ADCC capabilities (see Stevenson et al., Anti-Cancer Drug Design , 3: 219-230 (1989)). ].

7. Immune Complex

The invention also relates to cytotoxic substances such as chemotherapeutic agents, toxins (eg, enzymatically active bacteria, fungi, plant or animal toxins, or fragments thereof) or radioactive isotopes (ie, radiocomplexes). It relates to an immunocomplex comprising an antibody coupled with.

Chemotherapeutic agents useful in the production of such immunocomplexes are described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chains, unbound active fragments of diphtheria toxins, exotoxin A chains (from Pseudomonas aeruginosa), lysine A chains, abrin A chains, modede Shin A chain, alpha-sarsine, Aleurites fordii protein, diantine protein, Phytolaca americana protein (PAPI, PAPII and PAP-S), bitter melon (momordica charantia) inhibitor, Curcin, crotin, sapaonaria officinalis inhibitors, gelonin, mitogelin, restritocin, phenomycin, enomycin, and tricotessenes. Several radionuclides can be used for the preparation of radiocomplex antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re.

Difunctional derivatives of various difunctional protein-linking materials, such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), imidoesters (e.g. Dimethyl adipimidate HCL), active esters (e.g. disuccinimidyl suverate), aldehydes (e.g. glutaraldehyde), bis-azido compounds (e.g. bis (p- Azidobenzoyl) hexanediamine), bis-diazonium derivatives (eg, bis- (p-diazoniumbenzoyl) -ethylenediamine), diisocyanates (eg tolyene 2,6-diisocyanate), and Bis-active fluorine compounds (eg, 1,5-difluoro-2,4-dinitrobenzene) can be used to make complexes of antibodies with cytotoxic substances. For example, lysine immunotoxins can be prepared as described in Vitta et al., Science , 238 : 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is a typical chelating agent linking radionucleotides with antibodies (see WO 94/11026). do).

In another embodiment, the antibody can be linked to a "receptor" (eg, streptavidin) used for tumor pretargeting, wherein the antibody-receptor complex is administered to the subject and then circulated using a chelating agent. The unbound complex is removed from and an "ligand" (eg, avidin) that binds to a cytotoxic substance (eg, radionucleotide) is administered.

8. Immunoliposomes

The antibodies disclosed herein may also be formulated with immunoliposomes. Liposomes comprising this antibody are described in methods known in the art, such as, for example, Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA, 77: 4030 (1980); And US Pat. Nos. 4,485,045 and 4,544,545. Liposomes with increased circulation time are disclosed in US Pat. No. 5,013,556.

Particularly useful liposomes can be produced by reverse phase evaporation using lipid compositions containing phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes were pushed through filters of defined pore size to yield liposomes with the desired diameter. Martin et al ., J. Biol. Chem. , 257 : 286-288 (1982), can be linked to liposomes via Fab 'fragments of the antibodies of the invention via disulfide-interchange reactions. Chemotherapeutic agents (eg, Doxorubicin) are optionally included in liposomes (Gabizon et al ., J. National Cancer Inst. , 81 (19): 1484 (1989).

9. Antibody Pharmaceutical Compositions

To treat a variety of diseases, antibodies that specifically bind to the PRO polypeptides identified herein and other molecules identified by the screening assays described above can be administered in the form of pharmaceutical compositions.

Internalized antibodies are preferred if the PRO polypeptide is intracellular and all of the antibody is used as an inhibitor. However, lipofection or liposomes can also be used to deliver the antibody or antibody fragment intracellularly. If antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based on the sequence of the variable-region of an antibody, peptide molecules can be designed that have the ability to bind to the sequence of the target protein. Such peptides can be synthesized chemically and / or prepared by recombinant DNA techniques (eg, Marasco et al ., Proc. Natl. Acad. Sci. USA , 90: 7889-7893 (1993). In addition, the formulations herein may include one or more active compounds, preferably compounds with complementary activities that do not adversely affect each other, as needed for the particular condition to be treated. Alternatively, or in addition, the composition may include substances that enhance their function, such as cytotoxic substances, cytokines, chemotherapeutic agents, or growth-inhibiting agents. Such molecules are suitably formulated in amounts that are effective for the purpose intended.

The active ingredient is for example a coacervation technique or interfacial polymerization, for example in a colloidal drug delivery system (e.g. liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or macroemulsions respectively, For example, it can be contained in microcapsules prepared by hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacrylate) microcapsules, respectively. This technique is disclosed in Remington's Pharmaceutical Sciences , supra.

The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

Sustained release formulations may also be prepared. Suitable examples of sustained-release preparations include shaped articles of solid hydrophobic polymers containing the antibody, for example semipermeable matrices in the form of films or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (eg, poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactide (US Pat. No. 3,773,919), L-glutamic acid Injection consisting of a copolymer of γ ethyl-L-glutamate, a non-degradable ethylene-vinyl acetate, a degradable lactic acid-glycolic acid copolymer, for example LUPRON DEPOT® (lactic acid-glycolic acid copolymer and leuprolide acetate) Possible microspheres), and poly-D-(-)-3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid release molecules for more than 100 days, while some hydrogels release proteins for shorter periods of time. If the encapsulated antibody remains in the body for a long time, it may be denatured or aggregated as a result of exposure to moisture at 37 ° C., resulting in a decrease in biological activity resulting in a change in immunogenicity. For stabilization, rational strategies can be designed according to the mechanism involved. For example, if the coagulation mechanism is found to be the formation of SS bonds in bonsai via thio-disulfide interchange, modification of sulfhydryl residues, lyophilization from acidic solutions, control of moisture content, use of appropriate additives and Stabilization can be achieved by the development of specific polymer matrix compositions.

G. Uses of Anti-PRO Antibodies

Anti-PRO antibodies of the invention have a variety of utility. For example, anti-PRO antibodies can be used for diagnostic assays for PRO, eg, for detecting expression of PRO in specific cells, tissues or serum. Various diagnostic assay techniques known in the art, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays performed on heterologous or homologous phases [Zola's Monoclonal Antibodies: A Manual of Techniques , CRC Press , Inc. (1987) pp. 147-158]. Antibodies used in diagnostic assays can be labeled with detectable residues. Detectable residues must be able to generate a detectable signal either directly or indirectly. For example, the detectable moiety can be a radioactive isotope such as ³ H, ¹⁴ C, ³² P, ³⁵ S or ¹²⁵ I, fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine or Luciferin, or an enzyme such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Hunter et al. , Nature , 144 : 945 (1962); David et al., Biochemistry , 13 : 1014 (1974); Pine et al., J. Immunol. Meth. , 40 : 219 (1981); And Nygren, J. Histochem. and Cytochem. , 30 : 407 (1982), including any method known in the art for binding antibodies and detectable moieties.

In addition, anti-PRO antibodies are useful for affinity purification of PRO from recombinant cell culture or natural sources. In this process, the antibody to PRO is immobilized to a suitable support such as Sephadex resin or filter paper using methods known in the art. Thereafter, the immobilized antibody is contacted with a sample containing PRO to be purified and then washed with a suitable solvent that substantially removes all material in the sample except PRO bound to the immobilized antibody. Finally, the support is washed with other suitable solvent to release the PRO polypeptide from the antibody.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

All patents and documents cited in this specification are herein incorporated by reference in their entirety.

Commercial reagents mentioned in the examples were used according to the manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC accession number throughout the following examples and specification is the American Type Culture Collection (Rockville, Maryland).

Example 1 Extracellular Domain Homology Screening to Identify Novel Polypeptides and cDNAs Encoding It

The extracellular domain (ECD) sequence of about 950 known secretory proteins obtained from the Swiss-Prot co-database (including the secretory signal sequence, if present) is used to construct the EST database. Investigate. The EST database includes both public databases (e.g. Dayhoff, GenBank) and proprietary databases (e.g. LIFESEQ ™ (IncytePharmaceuticals, Palo Alto, CA)). A six frame translation of the EST sequence and a search for comparison of the ECD protein sequence are performed using the computer programs BLAST or BLAST-2 [ Methods in Enzymology 266: 460-480 (1996)]. Comparables showing a blast score of at least 70 (or in some cases 90) that do not encode known proteins were collected and using the program "phrap" (Phil Green, Seattle, University of Washington, Seattle) Assembled with consensus DNA sequence.

Using the homology screens of these extracellular domains, consensus DNA sequences were assembled for other identified EST sequences using phrap. In addition, often (but not always) the EST sequence source discussed above was used to extend the consensus DNA sequence obtained using repeated cycles of BLAST or BLAST-2 and phrap to extend the consensus sequence as long as possible.

Subsequently, based on the consensus sequence obtained as described above, oligonucleotides were synthesized and used to identify cDNA libraries containing the desired sequences by PCR and as probes to isolate clones of full-length coding sequences for PRO polypeptides. . Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to provide PCR products of about 100 to 1000 bp in length. The length of the probe sequence is typically 40 to 55 bp. Optionally, if the consensus sequence is longer than about 1 to 1.5 kbp, additional oligonucleotides are synthesized. To screen several libraries for full-length clones, DNA was screened from the libraries by PCR amplification using PCR primer pairs according to Ausubel et al. Current Protocols in Molecular Biology . The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotide and primer pairs.

The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents such as those purchased from Invitrogen (San Diego, CA). The cDNAs were primed with oligo dT containing the NotI site, ligated to the hemikinased SalI adapter, cleaved with NotI, appropriately sized by gel electrophoresis and then subjected to appropriate cloning vectors [e.g. For example, vectors such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain a SfiI site; Cloning in a direction determined to a single XhoI and NotI sites in Holmes et al., Science , 253 : 1278-1280 (1991).

Example 2: Isolation of cDNA Clones by Amylase Screening

1. Preparation of oligo dT primed cDNA libraries

MRNA was isolated from subject human tissue using Invitrogen (San Diego, Calif.) Reagents and protocols (Fast Track 2). The RNA was used to generate oligo dT primed cDNA libraries in vector pRK5D using reagents and protocols from Life Technologies, Gettysburg, Maryland (Super Script Plasmid System). In this process, the size of the double stranded cDNA was chosen to be greater than 1000 bp and SalI / NotI linked cDNA was cloned into the XhoI / NotI cleavage vector. pRK5D is a cloning vector comprising a sp6 transcription initiation site, a SfiI restriction enzyme site, and a XhoI / NotI cDNA cloning site in that order.

2. Preparation of Random Primed cDNA Libraries

Secondary cDNA libraries were generated to preferentially provide the 5 'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (as described above) and randomly primed cDNA libraries in vector pSST-AMY.0 using Life Technologies' reagents and protocols (Super Script Plasmid System, as described above). The RNA was used to. In this process, double-stranded cDNAs were made 500-1000 bp in size, ligated to the NotI adapter to the blunt ends, cleaved with SfiI and cloned into the SfiI / NotI cleavage vector. pSST-AMY.0 is a cloning vector comprising a yeast alcohol dehydrogenase promoter, a cDNA cloning site and a mouse amylase sequence (mature sequence, no secretion signal), a yeast alcohol dehydrogenase transcription terminator. Thus, cDNA cloned into the vector, fused with amylase sequence in frame, secretes amylase from suitably transfected yeast colonies.

3. Transformation and detection

The DNA from the library described in paragraph 2 above was ice cooled and 20 ml of electrocompetent DH10B bacteria (Life Technologies) was added thereto. The bacterial and vector mixtures were then electroporated as recommended by the manufacturer. Then 1 ml SOC medium (Life Technologies) was added and the mixture was incubated at 37 ° C. for 30 minutes. The transformants were then plated into 20 ampicillin containing standard 150 mm LB plates and incubated at 37 ° C. for 16 hours. Positive colonies were separated from the plates and DNA was isolated from bacterial pellets using standard protocols (eg, CsCl-gradient method). Purified DNA was used in the yeast protocol as follows.

The yeast method is divided into three parts: 1) transformation of yeast using a plasmid / cDNA combination vector, 2) detection and isolation of yeast clones secreting amylase, and 3) PCR amplification and sequencing of inserts directly from yeast colonies. DNA purification for analysis and further analysis.

The yeast used was HD56-5A (ATCC-90785). This strain has a genotype of MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast variants with defective post-translational pathways can be used. Such variants may have a missing allele due to translocation at sec71, sec72, sec62, with sec71 truncated most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that interfere with the normal functioning of the gene, other proteins involved in the post-translational pathway (eg SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p or SSA1p-4p) Or it may be desirable to use complex forms of these proteins with amylase-expressing yeast.

Transformation is described by Gietz et al., Nucl. Acid. Res., 20 : 1425 (1992). The transformed cells were then inoculated from agar into 100 ml of YEPD complex medium broth and incubated overnight at 30 ° C. YEPD broths are described in Kaiser et al., Methods in Yeast Genetics , Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). Overnight cultures were diluted to about 2 x 10 ⁶ cells / ml (about OD ₆₀₀ = 0.1) in 500 ml of fresh YEPD broth and cultured to about 1 x 10 ⁷ cells / ml (about OD ₆₀₀ = 0.4-0.5) It was.

The cells were recovered, then transferred to the GS3 rotor bottle of the Sorval GS3 rotor, centrifuged at 5,000 rpm for 5 minutes, discarded the supernatant and resuspended in sterile water to 50 ml Falcon tubes at 3,500 rpm in a Beckman GS-6KR centrifuge. Recentrifugation at. Discard the supernatant, transform cells by washing with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH7.5, 100 mM Li ₂ OOCCH ₃ ) and then resuspending in LiAc / TE (2.5 ml). Was prepared.

Transformation was performed by mixing 100 μl of cells prepared in microcentrifuge tubes with freshly denatured single stranded salmon testis DNA (Lofstrand Lab, Gettysburg, Md.) And 1 μg of transformed DNA (vol <10 μl). After the mixture was briefly mixed by vortexing, 600 μl of 40% PEG / TE (40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. The mixture was slowly mixed and incubated at 30 ° C. with stirring for 30 minutes. The cells were then subjected to heat shock at 42 ° C. for 15 minutes and the reaction vessel was centrifuged at 12,000 rpm for 5-10 seconds with a microcentrifuge to discard the supernatant and 500 μl of TE (10 mM Tris-HCl, 1 mM EDTA pH7. 5) and then recentrifuged. Cells were diluted in 1 ml of TE and 200 μl aliquots were plated onto preselected medium in 150 mm growth plates (VWR).

Alternatively, transformation was performed by one large scale reaction with increasing reagent volume instead of several small scale reactions.

Selection media used are described in Kaiser et al., Methods in Yeast Genetics , Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994), a synthetic complete dextrose agar (SCD-Ura) lacking uracil. Transformants were incubated at 30 ° C. for 2-3 days.

Detection of colonies secreting amylase was performed by adding red starch in selective culture medium. Biely et al., Anal. Biochem. , 172 : 176-179 (1988), was used to link starch with a red dye (reactive Red-120, Sigma). Starch linked red dye was added to the SCD-Ura agar plate at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).

Positive colonies were selected and streaked in fresh selection medium (150 mm plates) to yield well isolated single identifiable colonies. Red starch was added directly to buffered SCD-Ura agar to detect well isolated single colonies positive for amylase secretion. Positive colonies were determined by their ability to degrade starch to produce a transparent halo visible directly to the eye around the positive colonies.

4. Isolation of DNA by PCR Amplification

When isolated positive colonies were removed with a toothpick and diluted in 30 μl of sterile water in a 96 well plate. At this time, positive colonies were frozen and stored for subsequent analysis or immediately amplified. 5 μl aliquots of cells were used as templates, 0.5 μl Klentaq (Clontech, Palo Alto, Calif.), 4.0 μl 10 mM dNTP (Perkin Elmer-Cetus), 2.5 μl Kentaq buffer (Clontech), omnidirectional oligonucleotide- PCR reactions were carried out in a 25 μl volume containing 1 0.25 μl, reverse oligonucleotide-2 0.25 μl, distilled water 12.5 μl. The sequence of forward oligonucleotide-1 is as follows:

5'-tgtaaaacgacggccagt taaatagacctgcaattattaatct -3 '(SEQ ID NO: 25)

The sequence of reverse oligonucleotide-2 is as follows:

5'-caggaaacagctatgacc acctgcacacctgcaaatccatt -3 '(SEQ ID NO: 26)

Then, PCR was performed as follows.

a. Denaturation at 92 ° C. for 5 minutes,

b. Denatured at 92 ° C. for 30 seconds, annealing at 59 ° C. for 30 seconds, and extended three times at 72 ° C. for 60 seconds,

c. Denature for 30 seconds at 92 ℃, annealing for 30 seconds at 57 ℃, extended for 60 seconds at 72 ℃, three times,

d. 25 cycles of denaturation at 92 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and extension at 72 ° C. for 60 seconds,

e. Maintained at 4 ° C.

The underlined regions of the oligonucleotides were annealed to the ADH promoter region and the amylase region, respectively, and the 307 bp region was amplified from the vector pSST-AMY.O in the absence of an insert. Typically, the first 18 nucleotides of the 5 'end of the oligonucleotide contained an annealing site for sequencing primers. Thus, the total product of the PCR reaction from the empty vector was 343 bp. However, cDNAs fused with signal sequences produced fairly long nucleotide sequences.

After the PCR, an aliquot of 5 ㎕ of the reaction solution literature using a Tris-Borate-EDTA (TBE) buffering system as described in [Sambrook et al., Supra by agarose gel electrophoresis in a 1% agarose gel Investigate. Clones resulting in one strong PCR product larger than 400 bp were purified on a 96 Qiaquick PCR cleanup column (Qiagen Inc., Chasworth, CA) and further analyzed by DNA sequencing.

Example 3: Isolation of cDNA Clone Using Signal Algorithm Analysis

Using proprietary signal sequence retrieval algorithms developed by Genentech, Inc., South San Franscisco, CA, public (e.g., Genbank) and / or proprietary (LIFESEQ®, Nucleic acid sequences encoding various polypeptides were identified in the EST and dense assembled EST fragments from the Incyte Pharmaceuticals, Inc., Palo Alto, CA) database. The signal sequence algorithm calculated secretion signal scores based on the properties of the DNA nucleotides around the first and optionally second methionine codons (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotide following the first ATG must encode at least 35 distinct amino acids without any stop codon. If the first ATG had a given amino acid, the second ATG was not investigated. If this requirement is not met, the score of the candidate sequence was not calculated. To determine if the EST sequence contains a clear signal sequence, one set of seven sensors (evaluation parameters) known to be associated with the secretion signal was used to score the amino acid sequence around the DNA and the corresponding ATG codon. This algorithm was used to identify many polypeptide-encoding nucleic acid sequences.

Example 4: Isolation of cDNA Clone Encoding Human PRO1800

Consensus DNA sequences for other EST sequences were assembled using phraps as described in Example 1 above. This consensus sequence is referred to herein as DNA30934. Based on the DNA30934 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the desired sequence by PCR, and 2) clone a full length coding sequence for PRO1800 using as a probe.

PCR primers (forward and reverse) were synthesized.

Omnidirectional PCR primer (30934.f1) 5'-gcataatggatgtcactgagg-3 '(SEQ ID NO: 3)

Reverse PCR primer (30934.r1) 5'-agaacaatcctgctgaaagctag-3 '(SEQ ID NO: 4)

In addition, synthetic oligonucleotide hybridization probes were made from the consensus DNA30934 sequence having the following nucleotide sequence.

Hybridization Probe (30934.p1)

5'-gaaacgaggaggcggctcagtggtgatcgtgtcttccatagcagcc-3 '(SEQ ID NO: 5)

RNA for making cDNA libraries was isolated from liver tissue of human fetuses. DNA sequencing of the clones isolated as described above revealed the full length DNA sequence for PRO1800 (named herein DNA35672-2508 (FIG. 1, SEQ ID NO: 1)) and putative protein sequence for PRO1800.

The full nucleotide sequence of DNA35672-2508 is shown in FIG. 1 (SEQ ID NO: 1). Clone DNA35672-2508 has a single open reading frame (FIG. 1) with a clear translation initiation site at nucleotide positions 36 to 38 and ending with a stop codon of nucleotides 870 to 872. The expected polypeptide precursor is 278 amino acids long (FIG. 2). The estimated molecular weight of the full-length PRO1800 protein shown in FIG. 2 is about 29,537 Daltons and the estimated pI is about 8.97. Analysis of the full length PRO1800 sequence shown in FIG. 2 (SEQ ID NO: 2) shows a signal peptide of about amino acid 1 to about amino acid 15, a potential N-glycosylation site of about amino acid 183 to about amino acid 186, about amino acid 43 to about amino acid 48, A potential N-myristoylation site of about amino acid 80 to about amino acid 85, about amino acid 191 to about amino acid 196, about amino acid 213 to about amino acid 218, and about amino acid 272 to about amino acid 277 and about amino acid 276 to about amino acid 278 The presence of microsomal C-terminal targeting signal is demonstrated. The clone DNA35672-2508 was deposited with the ATCC on December 15, 1998 to be assigned ATCC accession number 203538.

Analysis of the dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. Significant homology between UCPA_ECOLI, F69868, Y4LA_RHISN, DHK2_STRVN, and DHG1_BACME was demonstrated.

Example 5: Isolation of cDNA Clone Encoding Human PRO539

Consensus DNA sequences were assembled for other EST sequences using the wrap as described in Example 1 above. This consensus sequence is named DNA41882 herein. Based on the DNA41882 consensus sequence shown, oligonucleotides were synthesized to 1) identify a cDNA library containing the desired sequence by PCR, and 2) clone as a probe the full length coding sequence for PRO539.

RNA to make cDNA library was isolated from kidney tissue of human fetus. DNA sequencing of the clones isolated as described above revealed the full-length DNA sequence for PRO539 (named herein DNA47465-1561 (FIG. 3, SEQ ID NO: 6)) and putative protein sequence for PRO539.

The full nucleotide sequence of DNA47465-1561 is shown in FIG. 3 (SEQ ID NO: 6). Clone DNA47465-1561 contains a single open reading frame (FIG. 3) having a clear translation initiation site at nucleotide positions 186 to 188 and ending with a stop codon at nucleotide positions 2676 to 2678. The expected polypeptide precursor is 830 amino acids long (FIG. 4). The estimated molecular weight of the full-length PRO539 protein shown in FIG. 4 is about 95,029 Daltons and the estimated pI is about 8.26. Analysis of the full length PRO539 sequence shown in FIG. 4 (SEQ ID NO: 7) shows a leucine zipper pattern sequence of about amino acids 557 to about amino acids 578, and about amino acids 794 to about amino acids 815, about amino acids 133 to about amino acids 136, and about amino acids 383 to The potential N-glycosylation site of about amino acid 386 and the coil-coil domain of the kinesin-based protein Kif-4 of about amino acids 231 to about amino acid 672. The clone DNA47465-1561 was deposited with the ATCC on February 9, 1999 and was assigned ATCC Accession No. 203661.

Analysis of the dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. The homology between MYSP_HUMAN, AF041382_1, A45592, HS125H2_1 and HS68O2_2 was demonstrated.

Example 6: Isolation of cDNA Clone Encoding Human PRO982

The signal sequence algorithm described in Example 3 can be used to identify a single Incyte EST sequence named herein Incyte EST Cluster SEQ ID NO: 43715. The EST sequences are present in comparison to various EST databases, including public EST databases (eg, Genbank) and proprietary EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). Homology was confirmed. Homology investigations were performed using the computer programs BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with a BLAST score of at least 70 (in some cases 90), which do not encode known proteins, were collected and sorted into the program "phrap" (Phil Green, University of Washington, Seattle, Washington) to obtain consensus DNA sequences. The consensus sequence thus obtained was named DNA56095.

In view of the observed sequence homology between DNA56095 and Merck EST AA024389, Merck EST clone AA024389 was obtained and sequenced. This sequence, designated DNA57700-1408 (SEQ ID NO: 8), is shown in FIG. This sequence is the full length DNA sequence for PRO982.

The full length clone shown in FIG. 5 includes a single open reading frame (SEQ ID NO: 8) with a clear translation initiation site at nucleotide positions 26-28 and ending with a stop codon at nucleotide positions 401-403. The expected polypeptide precursor has a length of 125 amino acids, the theoretical molecular weight is about 14,198 Daltons and the estimated pI is about 9.01. Analysis of the full length PRO982 sequence shown in FIG. 6 (SEQ ID NO: 9) demonstrates the presence of a signal peptide of about amino acid 1 to about amino acid 21, and a potential anaphylatoxin domain of about amino acid 50 to about amino acid 59. Analysis of the Dayhof database (version 35.45 SwissProt 35) demonstrated homology between the PRO982 amino acid sequence and the Dayhof sequences RNTMDCV_1, A48151, WAP_RAT, S24596, A53640, MT4_HUMAN, U93486_1, SYNBILGFG_1, P_R49917 and P_R41880. The clone DNA57700-1408 was deposited with the ATCC on January 12, 1999 and was assigned ATCC accession No. 203583.

Example 7: Isolation of cDNA Clones Encoding Human PRO1434

Consensus DNA sequences were assembled for other EST sequences using the flaps as described in Example 1 above. This consensus sequence is named DNA54187 herein. Based on the DNA54187 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the desired sequence by PCR and 2) to clone a full length coding sequence for PRO1434 using as a probe.

PCR primers (forward and reverse) were synthesized.

Omnidirectional PCR primer 5'-gaggtgtcgctgtgaagccaacgg-3 '(SEQ ID NO: 12)

Reverse PCR primer 5'-cgctcgattctccatgtgccttcc-3 '(SEQ ID NO: 13)

In addition, synthetic oligonucleotide hybridization probes were made from the consensus DNA54187 sequence having the following nucleotide sequence.

Hybridization probe

5'-gacggagtgtgtggaccctgtgtacgagcctgatcagtgctgtcc-3 '(SEQ ID NO: 14)

RNA for making cDNA libraries was isolated from human retinal tissue (LIB94). DNA sequencing of the clones isolated as described above revealed the full-length DNA sequence for PRO1434 (named herein DNA68818-2536 (FIG. 7, SEQ ID NO: 7)) and putative protein sequence for PRO1434.

The full nucleotide sequence of DNA68818-2536 is shown in Figure 7 (SEQ ID NO: 10). Clones DNA68818-2536 have a single open reading frame (FIG. 7) having a clear translation initiation site at nucleotide positions 581-583 and ending with a stop codon of nucleotides 1556-1558. The expected polypeptide precursor is 325 amino acids long (Figure 8). The estimated molecular weight of the full-length PRO1434 protein shown in FIG. 8 is about 35,296 daltons and the estimated pI is about 5.37. Analysis of the full length PRO1434 sequence shown in FIG. 8 (SEQ ID NO: 11) demonstrates the presence of several important protein domains shown in FIG. 8. The clone DNA68818-2536 was deposited with the ATCC on February 9, 1999 and was assigned ATCC Accession No. 203657.

Results of analysis of the dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. Significant homology between P_W37500, NEL2_HUMAN, MMU010792_1, D86983_1 and 10MUCS_BOVIN was demonstrated.

Example 8: Isolation of cDNA Clone Encoding Human PRO1863

The signal sequence algorithm described in Example 3 above can be used to identify the EST cluster sequence from the Incyte database, designated Incyte EST cluster SEQ ID NO: 82468. Thereafter, the EST cluster sequences were tagged with various expressed sequence tags, including a common EST database (eg, Genbank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.). (EST) The homology present was confirmed as compared to the database. Homology investigations were performed using the computer programs BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with a BLAST score of at least 70 (in some cases 90), which do not encode known proteins, were collected and sorted into the program "phrap" (Phil Green, University of Washington, Seattle, Washington) to obtain consensus DNA sequences. The consensus sequence thus obtained was named DNA56029 herein.

In view of sequence homology between the DNA56029 sequence and the EST sequences contained in Incyte EST clone number 2186536, Incyte EST clone number 2186536 was purchased to obtain a cDNA insert and sequenced. The sequence of this cDNA insert is shown in FIG. 9 and named DNA59847-2510 herein.

Clone DNA59847-2510 contains a single open reading frame (FIG. 9) that has a clear translation initiation site at nucleotide positions 17-19 and ends with a stop codon at nucleotide positions 1328-1330. The expected polypeptide precursor has a length of 437 amino acids (FIG. 10). The estimated molecular weight of the full-length PRO1863 protein shown in FIG. 10 is about 46,363 Daltons and the estimated pI is about 6.22. Analysis of the full length PRO1863 sequence shown in FIG. 10 (SEQ ID NO: 16) shows a signal peptide of about amino acid 1 to about amino acid 15, the transmembrane domain of about amino acid 243 to about amino acid 260, about amino acid 46 to about amino acid 49, about amino acid 189 to about Glycosaminoglycan attachment sites of amino acids 192, and potential N-glycosylation sites of about amino acids 382 to about amino acids 385, about amino acids 51 to about amino acids 54, and about amino acids 359 to about amino acids 362, and about amino acids 54 to About amino acids 59, about amino acids 75 to about amino acids 80, about amino acids 141 to about amino acids 146, about amino acids 154 to about amino acids 159, about amino acids 168 to about amino acids 173, about amino acids 169 to about amino acids 174, about amino acids 198 to about amino acids 203, about amino acid 254 to about amino acid 259, about amino acid 261 to about amino acid 266, about Amino acids 269 to about amino acids 274, about amino acids 284 to about amino acids 289, about amino acids 333 to about amino acids 338, about amino acids 347 to about amino acids 352, about amino acids 360 to about amino acids 365, about amino acids 361 to about amino acids 366, about amino acids 388 To the presence of potential N-myristoylation sites of from about amino acid 393, about amino acid 408 to about amino acid 413, and about amino acid 419 to about amino acid 424. The clone DNA59847-2510 was deposited with the ATCC on January 12, 1999 and was assigned ATCC Accession No. 203576.

Analysis of the dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. Homology between CAHX_FLABR, S61882, AB007899_1, CAH1_FLALI and P_W13386 was demonstrated.

Example 9: Isolation of cDNA Clone Encoding Human PRO1917

The EST cluster sequence (named EST cluster number 85496) could be identified from the LIFESEQ® database using the signal sequence algorithm described in Example 3 above. The EST cluster sequence was then compared to the EST database described above to confirm the homology present. Homology investigations were performed using the computer programs BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with a BLAST score of at least 70 (in some cases 90), which do not encode known proteins, were collected and organized into the program "phrap" (Phil Green, University of Washington, Seattle, Washington) to obtain consensus DNA sequences. The consensus sequence thus obtained was named DNA56415 herein.

Considering sequence homology between the DNA56415 sequence and the EST sequence contained in EST No. 3255033, an EST clone from the ovarian cancer library was purchased to obtain a cDNA insert and sequenced. The sequence of this cDNA insert is shown in FIG. 11 and named herein DNA76400-2528.

The full length clones shown in FIG. 11 include a single open reading frame (FIG. 11, SEQ ID NO: 17) having a clear translation initiation site at nucleotide positions 6-9 and ending with a stop codon at nucleotide positions 1467-1469. The expected polypeptide precursor (FIG. 12, SEQ ID NO: 18) has a length of 487 amino acids. The theoretical molecular weight of PRO1917 is about 55,051 Daltons and the estimated pI is about 8.14. Additional features include signal peptides from about amino acids 1 to about amino acid 30, about amino acids 242 to about amino acids 245, and potential N-glycosylation sites of about amino acids 481 to about amino acids 484, about amino acids 95 to about amino acids 97, about amino acids 182 to about amino acid 184, and protein kinase C phosphorylation site of about amino acid 427 to about amino acid 429, about amino acid 107 to about amino acid 112, about amino acid 113 to about amino acid 118, about amino acid 117 to about amino acid 122, about amino acid 118 to about Amino acid 123, and an N-myristoylation site of about amino acid 128 to about amino acid 133, and an endoplasmic reticulum targeting sequence of about amino acid 484 to about amino acid 487.

Analysis of the Dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. 12 (SEQ ID NO: 18) demonstrated significant homology between the PRO1917 amino acid sequence and the Dayhof sequence AF012714_1. In addition, homology was found between the PRO1917 amino acid sequence and the chondrocyte protein sequence (named "P_W52286" in the Dayhof database) reported to be involved in the conversion of chondrocytes from hyperplasia to hypertrophy (international patent application). Publication WO9801468-A1). In addition, homology between the PRO1917 amino acid sequence and other Dayhof sequences P_W52286, GGU59420_1, P_R25597, PPA3_YEAST, PPA1_SCHPO, PPA2_SCHPO, A46783_1, DMC165H7_1, and AST8_DROME was revealed.

The clone DNA76400-2528 was deposited with the ATCC on January 12, 1999 and was assigned ATCC accession No. 203573.

Example 10 Isolation of cDNA Clones Encoding Human PRO1868

Consensus DNA sequences were assembled for other EST sequences using the wrap as described in Example 1 above. This consensus sequence is named DNA49803 herein. Based on the observed homology between the DNA49803 consensus sequence and the EST sequence contained within Incyte EST clone number 2994689, Incyte EST clone number 2994689 was purchased to obtain an insert thereof and sequenced. The sequence of this insert is shown in Figure 13 and named herein DNA77624-2515.

The full nucleotide sequence of DNA77624-2515 is shown in Figure 13 (SEQ ID NO: 19). Clone DNA77624-2515 has a single open reading frame (FIG. 13) having a clear translation initiation site at nucleotide positions 51-53 and ending with a stop codon at nucleotide positions 981-983. The expected polypeptide precursor is 310 amino acids long (FIG. 14). The estimated molecular weight of the full-length PRO1868 protein shown in FIG. 14 is about 35,020 Daltons and the estimated pI is about 7.90. Analysis of the full length PRO1868 sequence shown in FIG. 14 (SEQ ID NO: 20) shows a signal sequence of about amino acid 1 to about amino acid 30, a transmembrane domain of about amino acid 243 to about amino acid 263, about amino acid 104 to about amino acid 107, and about amino acid 192 Potential N-glycosylation sites of from about amino acids 195, cAMP- and cGMP-dependent protein kinase phosphorylation sites of about amino acids 107 to about amino acids 110, casein of about amino acids 106 to about amino acids 109, and about amino acids 296 to about amino acids 299 Kinase II phosphorylation site, tyrosine kinase phosphorylation site of about amino acid 69 to about amino acid 77, and about amino acid 26 to about amino acid 31, about amino acid 215 to about amino acid 220, about amino acid 226 to about amino acid 231, about amino acid 243 to about amino acid 248 , About amino acid 244 to about amino acid 249, and about amino acid 262 to about amino The potential of acid N- 267 advance prove the existence of a dwelling anecdotes area. The clone DNA77624-2515 was deposited with ATCC on Dec. 22, 1998 and assigned ATCC accession No. 203553.

Results of analysis of the dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. Significant homology between AMAL_DROME, P_R77437, I38346, NCM2_HUMAN and PTPD_HUMAN was demonstrated.

Example 11: Isolation of cDNA Clone Encoding Human PRO3434

The signal sequence algorithm described in Example 3 can be used to confirm the EST cluster sequence from the Incyte database. Thereafter, the EST cluster sequences were tagged with various expressed sequence tags, including a common EST database (eg, Genbank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, Calif.). (EST) The homology present was confirmed as compared to the database. Homology investigations were performed using the computer programs BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with a BLAST score of at least 70 (in some cases 90), which do not encode known proteins, were collected and sorted into the program "phrap" (Phil Green, University of Washington, Seattle, Washington) to obtain consensus DNA sequences. The consensus sequence thus obtained was named DNA56009 herein.

In view of sequence homology between the DNA56009 sequence and the EST sequence contained in Incyte EST clone number 3327089, Incyte EST clone number 3327089 was purchased to obtain a cDNA insert and sequenced. The sequence of this cDNA insert is shown in FIG. 15 and named herein DNA77631-2537.

Clone DNA77631-2537 contains a single open reading frame (FIG. 15) having a clear translation initiation site at nucleotide positions 46-48 and ending with a stop codon at nucleotide positions 3133-3135. The expected polypeptide precursor has a length of 1029 amino acids (FIG. 16). The estimated molecular weight of the full-length PRO3434 protein shown in FIG. 16 is about 114,213 Daltons and the estimated pI is about 6.42. Analysis of the full length PRO3434 sequence shown in FIG. 16 (SEQ ID NO: 22) demonstrates the presence of a very important polypeptide domain as shown in FIG. The clone DNA77631-2537 was deposited with the ATCC on February 9, 1999 and was assigned ATCC Accession No. 203651.

Analysis of the dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. The homology between IBDVPIV_1, VE7_HPV11, GEN14220, MUTS_THETH and COAC_CHICK was demonstrated.

Example 12 Isolation of cDNA Clone Encoding Human PRO1927

The EST cluster sequence (named EST cluster number 1913) could be identified from the LIFESEQ® database using the signal sequence algorithm described in Example 3. Thereafter, the EST cluster sequences are compared to the various expressed sequence tag (EST) databases, including those described above, including other proprietary EST DNA databases (Genentech, South San Francisco, CA). It was confirmed. Homology investigations were performed using the computer programs BLAST or BLAST2 (Altshul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with a BLAST score of at least 70 (in some cases 90), which do not encode known proteins, were collected and organized into the program "phrap" (Phil Green, University of Washington, Seattle, Washington) to obtain consensus DNA sequences. The consensus sequence thus obtained was named DNA73896 herein.

In view of sequence homology between the DNA73896 sequence and the EST sequence contained in EST No. 3326981H1, EST clone No. 3326981H1 obtained from a library made from RNA isolated from aortic tissue was purchased to obtain a cDNA insert and sequenced. The sequence of this cDNA insert is shown in FIG. 17 and named DNA82307-2531 herein.

The full length clones shown in FIG. 17 include a single open reading frame (FIG. 17, SEQ ID NO: 23) having a clear translation initiation site at nucleotide positions 51-53 and ending with a stop codon at nucleotide positions 1695-1697. The expected polypeptide precursor (FIG. 18, SEQ ID NO: 24) has a length of 548 amino acids. The theoretical molecular weight of PRO1927 is about 63,198 Daltons and the estimated pI is about 8.10. Other features include a signal peptide of about amino acid 1 to about amino acid 23, an estimated transmembrane domain of about amino acid 6 to about amino acid 25, about amino acid 5 to about amino acid 8, about amino acid 87 to about amino acid 90, about amino acid 103 to about amino acid 106, and potential N-glycosylation sites of about amino acids 465 to about amino acids 469, about amino acids 6 to about amino acids 11, about amino acids 136 to about amino acids 141, about amino acids 370 to about amino acids 375, and about amino acids 509 to about amino acids 514 potential N-myristoylation sites are included.

Analysis of the Dayhof database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG. 18 (SEQ ID NO: 24) revealed significant homology between the PRO1927 amino acid sequence and the Dayhof sequence AB000628_1. In addition, homology between the PRO1927 amino acid sequence and other Dayhof sequences HGS_A251, HGS_A197, CELC50H11_2, CPXM_BACSU, VF03_VACCC, VF03_VACCV, DYHA_CHLRE, C69084 and A64315 was also found.

The clone DNA82307-2531 was deposited with ATCC on December 15, 1998 and assigned ATCC accession no. 203537.

Example 13: Inhibitory Activity Assay in Mixed Lymphocyte Response (MLR) Assay (Analysis 67)

This example shows that one or more of the polypeptides of the invention are active as inhibitors of proliferation of stimulated T-lymphocytes. Where it is advantageous to suppress the immune response, compounds which inhibit the proliferation of lymphocytes are useful in the treatment.

The basic protocol for this analysis is described in Current Protocols in Immunology, unit 3.12; edited by JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W Strober, National Insitutes of Health, Published by John Wiley & Sons, Inc. It is.

More specifically, in one modified assay, peripheral blood mononuclear cells (PBMCs) are isolated via leukopheresis from a mammalian subject, such as a human volunteer (one donor will supply a stimulating PBMC and the other donor). Will supply reactive PBMC). If necessary, these cells are isolated and frozen in fetal bovine serum and DMSO. Frozen cells were thawed overnight in assay medium (37 ° C., 5% CO ₂ ) and then washed and washed with assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% ratio). Essential amino acid, 1% pyruvate), may be resuspended at 3 × 10 ⁶ cells / ml. Stimulating PBMCs were prepared by irradiating the cells with about 3000 Rad.

This assay is prepared by plating a mixture of test sample 100: 1, irritated irritant cells 50: 1 and reactive PBMC diluted in 1% or 0.1% in 3 bee wells.

As a control, 100 μl of cell culture medium or 100 μl of CD4-IgG is used. The wells are then incubated at 37 ° C., 5% CO ₂ for 4 days. On day 5 tritiated thymidine (1.0 mC / well, Amersham) is added to each well. After 6 hours, cells are washed three times, and then the amount of uptake of this label is measured.

In another variation of this assay, PBMCs are isolated from the spleen of Balb / c mice and C57B6 mice. These cells are removed from freshly harvested spleen in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% essential amino acids, 1% pyruvate, and PBMC Place on Lympholyte M (Organon Teknika) and collect by centrifugation at 2000 rpm for 20 minutes and isolate mononuclear cell layers by washing in assay medium and resuspending these cells at 1 × 10 ⁷ cells / ml in assay medium. This analysis is then performed as described above.

A decrease below the control is considered a positive result for the inhibitory compound, with a decrease of preferably 80% or less. However, values below the control indicate any value of the inhibitory effect of the test protein.

In this analysis, the tested PRO1917 and PRO1868 were positive.

Example 14 Permeability Analysis of Skin Veins (Analysis 64)

This analysis indicates that certain polypeptides of the present invention stimulate inflammation and induce inflammation by inducing mononuclear cells, eosinophils, and PMN infiltration at the injection site of a subject animal. Where it is beneficial to stimulate an immune response, compounds that stimulate the immune response are useful in therapy. Permeability analysis of skin vessels was performed as follows. Ketamine (75-80 mg / kg) and xylazine 5 mg / kg were intramuscularly injected (IM) to anesthetize hairless guinea pigs weighing 350 g or more. Purified polypeptide samples or conditioned medium test samples of the invention were injected intradermally into the back of test animals in an amount of 100 μl per injection site. It can be injected at about 10-30, preferably about 16-24 sites per subject animal. 1 μl of Evans blue dye (1% in physiological buffered saline) was injected intracardiac. Subsequently, the diameter (mm) of the injury site due to the injection was measured 1 to 6 hours after the injection. Animals were slaughtered 6 hours after injection. Each injection site of the skin was biopsied and fixed in formalin. Thereafter, skin was prepared for histopathological evaluation. Infiltration of inflammatory cells into the skin at each site was assessed. Visible areas of inflammation in inflammatory cells were recorded positively. Inflammatory cells may be neutrophils, eosinophils, monocytes or lymphocytes. Any infiltrations around the blood vessels at the injection site were recorded positively, and no infiltrations at the injection site were recorded negatively.

The PRO1434 polypeptide tested was positive in this assay.

Example 15: Proliferation of follicular support cells in rats (assay 54)

This analysis indicates that certain polypeptides of the invention are useful for inducing regeneration of auditory hair cells and treating hearing loss in mammals by acting as potent mitogens for inner ear support cells, the origin of hearing hair cells. This analysis is performed as follows. Rat UEC-4 follicular epithelial cells were aliquoted into 200 μl serum containing medium at 33 ° C. at a density of 3000 cells per well in 96 well plates. The cells were incubated overnight and then transferred to serum-free medium at 37 ° C. Subsequently, various concentrations of the diluted PRO polypeptide (or the control does not contain this polypeptide) were added to the culture and the cells were incubated for 24 hours. After 24 hours of incubation, ³ H-thymidine (1 μCi / well) was added and the cells were further incubated for 24 hours. Thereafter, the cultures were washed to remove unincorporated radiolabels and cells were harvested to determine Cpm per well. In this assay, it was considered positive that the Cpm of the culture treated with the PRO polypeptide was 30% or more higher than the control culture.

The PRO982 polypeptide tested was positive in this assay.

Example 16: Gene Amplification

This example shows that the genes encoding PRO1800, PRO539, PRO3434 and PRO1927 are amplified in the genomes of certain human lung cancers, colon cancers and / or breast cancers and / or cell lines. Amplification is associated with overexpression of gene products, which means that the polypeptides are useful targets for treating and determining the presence of certain cancers, such as colon cancer, lung cancer, breast cancer and other cancers. The therapeutic agent may take the form of an antagonist of a PRO1800, PRO539, PRO3434 or PRO1927 polypeptide, eg, a murine-human chimeric antibody, humanized antibody or human antibody against a PRO1800, PRO539, PRO3434 or PRO1927 polypeptide.

The starting material for screening was genomic DNA isolated from several cancers. This DNA is accurately quantified, for example, by fluorometry. As negative control, DNA was isolated from 10 healthy healthy cells selected and used as analytical control for gene copy of healthy people (results not shown). 5 'nuclease assay (e.g. TaqMan ^TM ) and real-time quantitative PCR (e.g. ABI Prizm 7700 Sequence Detection System ^TM (Perkin Elmer, Applied Biosystems Division, Foster City, CA)) I found a gene that could be amplified. The results were used to determine whether the DNA encoding PRO1800, PRO539, PRO3434 or PRO1927 was excessive in screened primary lung or colon cancer, or cancer cell lines or breast cancer cell lines. Primary lung cancers were obtained from subjects with tumors of the types and stages shown in Table 6a. A description of the abbreviations used to refer to the primary tumors listed in Table 6a and the primary tumors and cell lines named throughout this example are given below.

The results of TaqMan ^™ are shown in delta (Δ) Ct units. One unit corresponds to one cycle of PCR or approximately two times amplification compared to normal, two units correspond to four times and three units to eight times amplification. For quantification, primers derived from genes encoding PRO1800, PRO539, PRO3434 or PRO1927 and TaqMan ^™ fluorescent probes were used. The region most likely to contain a unique nucleic acid sequence of the PRO1800, PRO539, PRO3434 or PRO1927 region and the least likely to have been spliced in the intron (eg 3 'untranslated region) is preferred for induction of primers and probes. . The sequences of the primers and probes (forward, reverse primers and probes) used for the PRO1800, PRO539, PRO3434 or PRO1927 gene amplification assay are as follows.

PRO1800 (DNA35672-2508)

Omnidirectional 5'-actcgggattcctgctgtt-3 '(SEQ ID NO: 27)

Probe 5'-aggcctttacccaaggccacaac-3 '(SEQ ID NO: 28)

Reverse 5'-ggcctgtcctgtgttctca-3 '(SEQ ID NO: 29)

PRO539 (DNA47465-1561)

Omnidirectional 5'-tcccaccacttacttccatgaa-3 '(SEQ ID NO: 30)

Probe 5'-ctgtggtacccaattgccgccttgt-3 '(SEQ ID NO: 31)

Reverse 5'-attgtcctgagattcgagcaaga-3 '(SEQ ID NO: 32)

PRO3434 (DNA77631-2537)

Omnidirectional 5'-gtccagcaagccctcatt-3 '(SEQ ID NO: 33)

Probe 5'-cttctgggccacagccctgc-3 '(SEQ ID NO: 34)

Reverse 5'-cagttcaggtcgtttcattca-3 '(SEQ ID NO: 35)

PRO1927 (DNA82307-2531)

Omnidirectional 5'-ccagtcaggccgttttaga-3 '(SEQ ID NO: 36)

Probe 5'-cgggcgcccaagtaaaagctc-3 '(SEQ ID NO: 37)

Reverse 5'-cataaagtagtatatgcattccagtgtt-3 '(SEQ ID NO: 38)

The 5 'nuclease assay reaction is a fluorescent PCR based technique that monitors amplification in real time using the 5' exonuclease activity of Taq DNA polymerase. Two oligonucleotide primers are used to generate amplicons conventional for PCR reactions. The third oligonucleotide or probe is designed to detect a nucleotide sequence located between two PCR primers. Probes cannot be extended by Taq DNA polymerase and are labeled with reporter fluorescent dyes and quencher fluorescent dyes. Release from the laser induced reporter dye is quenched by the quenching dye when the two dyes are placed close together on the probe. During the amplification reaction, Taq DNA polymerase cleaves the probe in a template-dependent manner. The probe fragment thus produced is separated in solution and the signal from the released reporter dye is not affected by the quenching of the second fluorophore. One reporter dye molecule is released for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.

The 5 'nuclease method is performed with a real-time quantitative PCR device such as the ABI Prism 7700 ™ Sequence Detector. The system consists of a periodic heater, a laser, a charge-coupled device (CCD) camera and a computer. The system amplifies the sample in a 96 well format in a periodic heater. During amplification, laser induced fluorescence signals are collected in real time via fiber optic cables for all 96 wells and detected at the CCD. The system includes software for operating the device and analyzing the data.

5 ′ nuclease assay data is initially expressed in Ct or threshold cycle. This is defined as the cycle at which the reporter signal accumulates above the background level of fluorescence. The ΔCt value is used as a quantitative measure of the relative starting copy number of a particular target sequence in a nucleic acid sample when comparing cancer DNA results with normal human DNA results.

Table 6a describes the stages, stages T and N of the various primary tumors used to screen the PRO1800, PRO539, PRO3434 and PRO1927 compounds of the present invention.

DNA Purification

DNA was purified from cultured cell lines, primary tumors, normal human blood. This DNA isolation was performed using the purification kit, buffer set and protease from Qiagen, according to the manufacturer's instructions and as described below.

Cell Culture Lysis:

Cells were washed to treat trypsin at a concentration of 7.5 × 10 ⁸ per tip, pelleted by centrifugation at 1000 rpm at 4 ° C. for 5 minutes, and then recentrifuged by washing again with 1/2 volume of PBS. . The pellet was washed a third time, the suspended cells were collected and washed twice with PBS. The cells were then suspended in 10 ml of PBS. Buffer C1 was equilibrated at 4 ° C. Qiagen protease # 19155 was diluted to 6.25 ml of cold ddH ₂ O to a final concentration of 20 mg / ml and equilibrated at 4 ° C. 10 ml of G2 buffer was prepared by diluting Qiagen RNAse A stock solution (100 mg / ml) to a final concentration of 200 μg / ml.

Buffer C1 (10 ml, 4 ° C.) and ddH ₂ O (40 ml, 4 ° C.) were then added to 10 ml of the cell suspension, mixed upside down and incubated on ice for 10 minutes. Cell nuclei were pelleted by centrifugation at 2500 rpm for 15 minutes at 4 ° C. with a Beckman swing bucket rotor. The supernatant was decanted and vortexed to suspend nuclei in 2 ml buffer C1 (4 ° C.) and 6 ml ddH ₂ O, followed by a second centrifugation at 2500 rpm for 15 minutes at 4 ° C. The nuclei were then resuspended in 200 μl per tip in residual buffer. The suspension was slowly vortexed with the addition of G2 buffer (10 ml). After completing the buffer addition, it was vigorously vortexed for 30 seconds. Qiagen protease (200 μl, prepared above) was added and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation were repeated until the lysate became clear (e.g., incubated for another 30 to 60 minutes and pelleted at 3000 xg for 10 minutes at 4 ° C).

Preparation and Dissolution of Human Fibrotic Tumor Samples:

Tumor samples were weighed and placed in 50 ml conical tubes on ice. Treatment was limited to not more than 250 mg of tissue in a single preparation (one tip / 1 preparation). The protease solution was freshly prepared by diluting to a final concentration of 20 mg / ml in 6.25 ml of cold ddH ₂ O and stored at 4 ° C. DNAse A was diluted to a final concentration of 200 mg / ml (diluted from 100 mg / ml of the mother solution) to prepare G2 buffer (20 ml). Tumor tissue was homogenized for 60 seconds in 19 ml of G2 buffer and left at room temperature using a large polytron tip in a Lamina-Flow TC hood to prevent inhalation of the aerosol. The polytrons were washed by spinning twice for 30 seconds in ddH ₂ O 2 L between samples and between them, followed by washing with G2 buffer (50 ml). For tissue remaining on the generator tip, the instrument was disassembled and removed.

Qiagen protease (prepared as above, 1.0 ml) was added followed by vortexing and incubation at 50 ° C. for 3 hours. Incubation and centrifugation were repeated until the lysate became clear (e.g. 30 to 60 minutes more incubation and pelleted at 3000 x g for 10 minutes at 4 ° C).

Preparation and Dissolution of Human Blood:

Blood from healthy volunteers was collected using standard infectious material protocols and citric acid treated with 10 ml of sample per tip. The Qiagen protease was freshly prepared by diluting to a final concentration of 20 mg / ml in 6.25 ml of cold ddH2O and stored at 4 ° C. G2 buffer was prepared by diluting 100 mg / ml RNAse A stock solution to a final concentration of 200 μg / ml. Blood (10 ml) was placed in a 50 ml conical tube and 10 ml C1 buffer and 30 ml ddH ₂ O (both equilibrated to 4 ° C. in advance) were inverted to mix the ingredients and left on ice for 10 minutes. The nuclei were pelleted and decanted by centrifugation at 2500 rpm for 15 minutes at 4 ° C. with a Beckman swing bucket rotor. The vortex was suspended in nuclei in 2 ml C1 buffer (4 ° C.) and 6 ml ddH ₂ O (4 ° C.). The vortexing was repeated until the pellets turned white. The nuclei were then resuspended in residual buffer using a 200 μl tip. G2 buffer (10 ml) was slowly vortexed with addition to the suspended nuclei and then vigorously vortexed for 30 seconds. Qiagen protease (200 μl) was added and incubated at 50 ° C. for 60 minutes. Incubation and centrifugation were repeated until the lysate became clear (e.g., 30 to 60 minutes further incubated and pelleted at 3000 xg for 10 minutes at 4 ° C).

Purification of Transparent Melt:

(1) Isolation of Genomic DNA

Genomic DNA was equilibrated with 10 ml QBT buffer (1 sample preparation per maximal tip). QF elution buffer was equilibrated at 50 ° C. Samples were vortexed for 30 seconds, then loaded into equilibrated tips and drained using gravity. The tip was washed twice with 15 ml QC buffer. DNA was eluted using 15 ml QF buffer (50 ° C.) to obtain 30 ml silanized autoclaved 30 ml Corex tubes. Isopropanol (10.5 ml) was added to each sample and the tubes were covered with paraffin and the mixture was mixed inverted repeatedly until DNA precipitated. The sample was pelleted by centrifugation at 15,000 rpm for 10 minutes at 4 ° C. with an SS-34 rotor. The pellet position was marked and the supernatant decanted and 10 ml of 70% ethanol (4 ° C.) was added. The sample was repellet by centrifugation at 10,000 rpm for 10 minutes at 4 ° C. with an SS-34 rotor. The pellet position was marked and the supernatant was decanted. These tubes were again placed in a drying rack and dried at 37 ° C. for 10 minutes, taking care not to overdry the samples.

After drying, the pellets were dissolved in 1.0 ml TE (pH 8.5) and placed at 50 ° C. for 1-2 hours. The sample was left overnight at 4 ° C. with continued dissolution. The DNA solution was then transferred to a 1.5 ml tube using a tuberculin syringe with a 26 gauge needle. This DNA solution transfer was repeated five times to remove the DNA. The sample was then placed at 50 ° C. for 1-2 hours.

(2) Preparation for Quantitative and Gene Amplification Analysis of Genomic DNA

DNA levels in each tube were quantified for 1:20 dilutions (5 μl DNA + 95 μl ddH ₂ O) using standard A ₂₆₀ , A ₂₈₀ spectrophotometry using 0.1 ml quartz cuvettes in a Beckman DU640 spectrophotometer. . The A ₂₆₀ / A ₂₈₀ ratio ranged from 1.8 to 1.9. Each DNA sample was then further diluted to a concentration of about 200 ng / ml in TE (pH 8.5). If the original material was highly concentrated (about 700 ng / μl), the material was left at 50 ° C. for several hours until resuspended.

Next, DNA quantitation by fluorometry was performed on the diluted material (20-600 ng / ml) using the manufacturer's instructions modified as follows. This was done by warming up the Hoeffer DyNA Quant 200 fluorometer for about 15 minutes. Hoechst dye treatment solution (# H33258, 10 μl, prepared within 12 hours before use) was diluted in 100 ml of 1 × TNE buffer. A 2 ml cuvette was filled with the solution for the fluorometer, placed in the fluorometer, and the machine was set to zero. pGEM 3Zf (+) (2 μl, lot # 360851026) was added to 2 ml of the solution for the fluorometer and measured at 200 units. Thereafter, 2 μl of other pGEM 3Zf (+) DNA was tested and the measurement results were confirmed at 400 +/- 10 units. Each sample was then measured at least three times. When the samples were measured three times and the results were within 10% of each other, the averages of these samples were obtained and this value was used as a quantitative value.

Each sample was diluted to 10 ng / μl in ddH ₂ O using the concentration determined by fluorometry. For a single TaqMan plate assay, the dilution was performed simultaneously for all template samples, and the material was sufficient to perform 500 to 1000 assays. Three tests were performed using probes for both B-actin and GAPDH on a single plate with Taqman ^™ primers, and normal human DNA template control. Diluted samples were used if the CT value of normal human DNA minus the test DNA was +/- 1 Ct. Diluted genomic DNAs labeled and stored were stored at −80 ° C. in 1.0 ml portions. Aliquots for later use in gene amplification assays were stored at 4 ° C. Each 1 ml of aliquot was sufficient for use on 8-9 plates or for 64 tests.

Gene Amplification Assay:

The PRO1800, PRO539, PRO3434 and PRO1927 compounds of the present invention were screened in the following primary tumors, and the resulting ΔCt values of at least 1.0 are shown in Table 7 below.

Example 17: Induction of Proliferation of Interest β-Progenitor Cells (Analysis 117)

This analysis indicates that certain polypeptides of the invention are useful for the treatment of various insulin deficiency symptoms, including diabetes, in mammals because they induce an increase in the number of progenitor cells of interest β-cells. The analysis is performed as follows. The analysis utilizes primary cultures of interest cells from mouse embryos, and the primary readings show that the expression of markers representing β-progenitor cells or mature β-cells is altered. Expression of the marker is measured by real time quantitative PCR (RTQ-PCR), where the marker measured is a transcription factor called Pdx1.

Interest was excised from E14 embryos (CD1 mice). This was then digested by treatment with collagenase / dispase in F12 / DMEM for 40-60 minutes at 37 ° C. (collagenase / dispase, 1.37 mg / ml, Boehringer Mannheim, # 1097113). Thereafter, the same volume of 5% BSA was used to neutralize the digest and the cells were washed once with RPMI1640. On day 1, cells were seeded in 12-well tissue culture plates (pre-coated with 20 μg / ml laminin in PBS, Boehringer Mannheim, # 124317). Cells from interest of 1-2 embryos were distributed per well. The culture medium for this primary culture was 14F / 1640. On day 2, the medium was removed and the adhered cells were washed out using RPMI / 1640. In addition to the protein to be tested, a minimum of 2 ml of medium was added. On day 4, the media was removed and RNA was prepared from the cells to analyze the expression of markers by real time quantitative RT-PCR. In this assay, the protein was considered to be active when the protein increased the expression of related β-cell markers as compared to the untreated control.

14F / 1640 added the following component to RPMI1640 (Gibco).

Group A 1: 1000

Group B 1: 1000

10 μg / ml recombinant human insulin

Aprotinin (50 μg / ml) 1: 2000 (Boehringer Mannheim # 981532)

60 ㎍ / ml bovine pituitary extract (BPE)

Gentamicin 100 ng / ml

Group A: (in 10 ml PBS)

Transferrin, 100 mg (Sigma T2252)

Epidermal growth factor, 100 μg (BRL 100004)

10 μl of 5 × ^10-6 M triiodothyronine (Sigma T5516)

100 μl 10 ⁻¹ M ethanolamine (Sigma E0135)

100 μl 10 ⁻¹ M phosphoethanolamine (Sigma P0503)

4 μl of 10 ^-1 M selenium (Aesar # 12574)

Group C: (in 10 ml of 100% ethanol)

2 μl of 5 × 10 ⁻³ M hydrocortisone (Sigma # H0135)

100 μl of 1 × ^10-3 M progesterone (Sigma # P6149)

20 500 μl of mM forskolin (calbiochem # 344270)

Minimum badge:

RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).

Restricted Badges:

RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml) and aprotinin (50 μg / ml).

The PRO1868 polypeptide was positive in this assay.

Example 18: Induction of differentiation of interest β-progenitor cells (analysis 89)

This analysis shows that certain polypeptides of the present invention are useful in the treatment of various insulin deficiency symptoms, including diabetes, in mammals because they act to induce differentiation of the interest β-cells into mature and β-cells. The analysis is performed as follows. The analysis utilizes primary cultures of interest cells from mouse embryos, and the primary readings show that the expression of markers representing β-progenitor cells or mature β-cells is altered. Expression of the marker is measured by real time quantitative PCR (RTQ-PCR), where the marker measured is insulin.

Interest was excised from E14 embryos (CD1 mice). This was then digested by treatment with collagenase / dispase in F12 / DMEM for 40-60 minutes at 37 ° C. (collagenase / dispase, 1.37 mg / ml, Boehringer Mannheim, # 1097113). Thereafter, the same volume of 5% BSA was used to neutralize the digest and the cells were washed once with RPMI1640. On day 1, cells were seeded in 12-well tissue culture plates (pre-coated with 20 μg / ml laminin in PBS, Boehringer Mannheim, # 124317). Cells from interest of 1-2 embryos were distributed per well. The culture medium for this primary culture was 14F / 1640. On day 2, the medium was removed and the adhered cells were washed out using RPMI / 1640. In addition to the protein to be tested, a minimum of 2 ml of medium was added. On day 4, the media was removed and RNA was prepared from the cells to analyze the expression of markers by real time quantitative RT-PCR. In this assay, the protein was considered to be active when the protein increased the expression of related β-cell markers as compared to the untreated control.

14F / 1640 added the following component to RPMI1640 (Gibco).

Group A 1: 1000

Group B 1: 1000

10 μg / ml recombinant human insulin

Aprotinin (50 μg / ml) 1: 2000 (Boehringer Mannheim # 981532)

60 ㎍ / ml bovine pituitary extract (BPE)

Gentamicin 100 ng / ml

Group A: (in 10 ml PBS)

Transferrin, 100 mg (Sigma T2252)

Epidermal growth factor, 100 μg (BRL 100004)

10 μl of 5 × ^10-6 M triiodothyronine (Sigma T5516)

100 μl 10 ⁻¹ M ethanolamine (Sigma E0135)

100 μl 10 ⁻¹ M phosphoethanolamine (Sigma P0503)

4 μl of 10 ^-1 M selenium (Aesar # 12574)

Group C: (in 10 ml of 100% ethanol)

2 μl of 5 × 10 ⁻³ M hydrocortisone (Sigma # H0135)

100 μl of 1 × ^10-3 M progesterone (Sigma # P6149)

20 500 μl of mM forskolin (calbiochem # 344270)

Minimum badge:

RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml), aprotinin (50 μg / ml) and BPE (15 μg / ml).

Restricted Badges:

RPMI 1640, and transferrin (10 μg / ml), insulin (1 μg / ml), gentamycin (100 ng / ml) and aprotinin (50 μg / ml).

In this assay, the PRO1863 polypeptide was positive.

Example 19: Analysis of proliferation of hemangioblasts of mouse kidney (analysis 92)

This assay suggests that Berger's disease, Schöleinlein-Henoch purpura, Chronic Digestive Disorder, and Herpes, because certain polypeptides of the invention act to induce proliferation of hepatic stem cells in mammalian kidneys. It is shown to be useful for treating renal disease associated with impaired function of hepatic stem cells such as sexual dermatitis or other neuropathy associated with Crohn's disease. The analysis is performed as follows. On day 1, hepatic stem cells from mouse kidneys were grown in 96-well plates with a 3: 1 mixture of Dulbecco's modified Eagle's medium and Ham's F12 medium, 95% fetal bovine serum, and 5% 14 supplemented with mM HEPES] and incubated overnight. On day 2, PRO polypeptide was diluted to two concentrations (1% and 0.1%) in serum-free medium and added to the cells. The control sample is serum-free medium alone. On day 4, Cell Titer 96 Aqueous One-Component Solution Reagent (Promega) was added to each well and the color reaction was allowed to proceed for 2 hours. Then, absorbance (OD) was measured at 490 nm. Positives in this assay are those with absorbance values that are at least 15% higher than the control readings.

The PRO1917 polypeptide tested in this assay was positive.

Example 20: Fibroblast (BHK-21) Proliferation (assay 98)

This analysis indicates that certain polypeptides of the invention act as useful growth factors in the mammalian system because they act to induce the proliferation of mammalian fibroblasts in culture. The analysis is performed as follows. BHK-21 fibroblasts were plated in a standard growth medium with a total volume of 100 μl at 2500 cells per well. The total volume was then made 200 μl by adding PRO polypeptide or β-FGF (positive control) or none (negative control) to the wells in the presence of 1 μl / ml of heparin. Cells were then incubated at 37 ° C. for 6-7 days. After incubation, the medium was removed and the cells washed with PBS, followed by addition of the acid phosphatase substrate reaction mixture (100 μl per well). Next, cells were incubated at 37 ° C. for 2 hours. The acid phosphatase reaction was then stopped by adding 10 μl of 1 N NaOH per well. The plate was then read at OD 405 nm. In this assay, the positive acid acid phosphatase activity is at least 50% higher than the negative control.

The PRO982 polypeptide tested in this assay was positive.

Example 21: Chondrocyte Regeneration Analysis (Analysis 110)

This analysis indicates that certain polypeptides of the present invention are thought to be useful in the treatment of various bone and / or cartilage diseases such as, for example, sports injury and arthritis because they act to induce differentiation of chondrocytes. The analysis is performed as follows. Porcine chondrocytes were isolated by digesting the articular cartilage of the metacarpal joints of sows 4-6 months of age with collagenase overnight. Isolated cells were then seeded at 25,000 cells / cm ² in Ham F-12 containing 10% FBS and 4 μg / ml of gentamycin. Culture medium was exchanged every 3 days and cells were seeded at 5,000 cells per well in 100 μl of the same medium without serum in 96 well plates and tested PRO polypeptide, sturosporin (positive control) or medium alone (negative) 100 μl of control) was added to make a total volume of 200 μl per well. After incubation at 37 ° C. for 5 days, photographs of each well were taken to determine the differentiation state of chondrocytes. In this analysis, the positive differentiation of chondrocytes was determined to be more similar in the positive control than in the negative control.

The PRO1863 polypeptide tested in this assay was positive.

Example 22 Use of PRO as Hybridization Probe

The following method describes the use of hybridization probes of nucleotide sequences encoding PRO.

Homologous DNA (eg, encoding native variants of PRO) in a human tissue cDNA library or human tissue genome library using DNA comprising the coding sequence of full length or mature PRO as described herein as a probe Screened.

Hybridization and washing of the filter comprising each library DNA was performed under the following high stringency conditions. Hybridization of the radiolabeled PRO-derived probe with the filter was performed using 50% formamide, 5 × SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2 × Denhardt's solution and 10% The solution was performed at 42 ° C. for 20 hours in a solution of dextran sulfate. The filter was washed in an aqueous solution of 0.1 x SSC and 0.1% SDS at 42 ° C.

The DNA encoding the full length native sequence PRO and the DNA having the desired sequence identity were then identified by standard methods known in the art.

Example 23: a. Expression of PRO in E. coli

In this embodiment, A method for producing a non-glycosylated form of PRO by recombinant expression in E. coli is described.

First, DNA sequences encoding PRO were amplified using the selected PCR primers. The primer should include a restriction enzyme site corresponding to the restriction enzyme site on the selected expression vector. Various expression vectors can be used. Examples of suitable vectors include pBR322, which comprises ampicillin and tetracycline resistance genes. Derived from E. coli, Bolivar et al., (Bolivar) [Gene, 2: 95 (1977)]] a. This vector was digested with restriction enzymes and dephosphorylated. PCR amplified sequences were then ligated to the vector. The vector preferably encodes an antibiotic resistance gene, a trp promoter, a poly-his leader (including the first six STII codons, a poly-his sequence and an enterokinase cleavage site), a PRO coding region, a lambda transcription terminator and an argU gene. Will comprise the sequence.

Subsequently, the ligation mixture was used to select E. coli by the method described in Sambrook et al., Supra. E. coli strains were transformed. After confirming that the transformants can grow on LB plates, colonies with antibiotic resistance were selected. Plasmid DNA was isolated and confirmed by restriction analysis and DNA sequencing.

Selected clones were incubated overnight in liquid culture medium such as LB broth supplemented with antibiotics. This culture was used to inoculate larger scale cultures. The cells were then incubated to the desired optical density, during which the expression promoter was activated.

After culturing the cells for several hours or more, the cells could be recovered by centrifugation. Cell pellets obtained by centrifugation can be lysed using various reagents known in the art, and the solubilized PRO protein can be purified under conditions that bind proteins tightly using metal chelating columns.

Here's how to do this. It was expressed in E. coli in poly-His tagged form. First, the DNA encoding the PRO was amplified using the selected PCR primers. The primers included restriction enzyme sites corresponding to the restriction enzyme sites on the selected expression vector, and other useful sequences that provide efficient and reliable initiation of translation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. PCR-amplified poly-His tagged sequences were then ligated to the expression vectors, which were used to determine E. coli based on strain 52. E. coli host (W3110fuhA (tonA) lon galE rpoHts (htpRts) clpP (lacIq) was transformed firstly, transformants were transformed until LOD600 reached 3-5 at 50 mg / ml carbenicillin containing LB. Shake culture was performed at 30 ° C. The culture medium was then cultured with CRAP medium (3.57 g of (NH ₄ ) ₂ SO _{4 in} 500 ml of water, 0.71 g of sodium citrate.2H ₂ O, 1.07 g of KCl, 5.36 g of Difco yeast extract, Sheffield Hicaze. (Sheffield hycase) SF 5.36 g, prepared by mixing 110 mM MPOS (pH 7.3), 0.55% (w / v) glucose and 7 mM MgSO ₄ ) at 50 to 100-fold and about 20 to 30 at 30 ° C. Shake incubation for hours Samples were taken to confirm expression by SDS-PAGE analysis, the cells were pelleted by centrifugation of the bulk culture, and the cell pellet was frozen until purification and refolding.

E. obtained from 0.5-1 L fermentation broth. E. coli paste (pellets 6-10 g) was resuspended in 10-fold volume (w / v) of 7 M guanidine, 20 mM Tris buffer (pH 8). Solid sodium sulfite and sodium sationate were added to bring the final concentrations to 0.1 M and 0.02 M, respectively, and the solution was stirred at 4 ° C. overnight. At this stage, desulphation produced a denatured protein that blocked all cysteine residues. This solution was centrifuged for 30 minutes at 40,000 rpm with a Beckman ultracentrifuge. The supernatant was diluted with 3 to 5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and clarified by filtration with a 0.22 micron filter. The clarified extracts were loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated in metal chelate column buffer. The column was washed with another buffer (Calbiochem, Utrol grade) containing 50 mM imidazole (pH 7.4). The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were collected and stored at 4 ° C. Protein concentration was measured by absorbance at 280 nm using the extinction coefficient calculated on the basis of the amino acid sequence.

The protein was refolded by slowly diluting the sample in freshly prepared refolding buffer consisting of 20 mM Tris (pH 8.6), 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. The refolding volume was chosen such that the final protein concentration was between 50 and 100 μg / ml. The refolding solution was stirred slowly at 4 ° C. for 12-36 hours. The refolding reaction was stopped by adding TFA to a final concentration of 0.4% (about pH 3). Prior to further purification of the protein, the solution was filtered through a 0.22 micron filter and acetonitrile was added to bring the final concentration to 2-10%. The refolded protein was chromatographed by eluting with acetonitrile concentration gradient from 10% to 80% in a Poros R1 / H reversed phase column using 0.1% TFA transfer buffer. Aliquots of fractions showing A ₂₈₀ absorbance were analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein were collected. In general, most protein species that are properly refolded are eluted at the lowest acetonitrile concentration because they contain the hydrophobic interior that is protected from interaction with the reversed phase resin and are the most dense. Aggregated proteins are usually eluted at higher acetonitrile concentrations. In the reverse phase, the desired type of protein is not only separated from the misfolded protein, but also endotoxin is removed from the sample.

Fractions containing the desired folded PRO polypeptide were pooled and a nitrogen stream was slowly added to the solution to remove acetonitrile. Proteins were combined and sterile filtered in 20 mM Hepes (pH 6.8) containing 0.14 M sodium chloride and 4% mannitol by dialysis or gel filtration using G25 Superfine, Pharmacia resin equilibrated with formulation buffer. .

Example 24 Expression of PRO in Mammalian Cells

This example describes a method for producing a potentially glycosylated form of PRO by recombinant expression in mammalian cells.

Vector pRK5 (see European Patent No. 307,247 published March 15, 1989) was used as the expression vector. Optionally, using the ligation method described by Sambrook et al., Supra, PRO DNA was ligated to pRK5 using a selected restriction enzyme to insert PRO DNA. The resulting vector is called pRK5-PRO polypeptide.

In one embodiment, 293 cells can be selected as the host cell. Human 293 cells (ATCC CCL 1573) were incubated in tissue culture plates in medium such as fetal calf serum and optionally DMEM supplemented with nutrients and / or antibiotics. About 10 μg of pRK5-PRO DNA is mixed with about 1 μg of DNA encoding a VA RNA gene (Timmmappaya et al., Cell , 31 : 543 (1982)), and 500 μl of 1 mM Tris- It was dissolved in HCl, 0.1 mM EDTA and 0.227 M CaCl ₂ . 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added dropwise to the mixture to form a precipitate at 25 ° C. for 10 minutes. The precipitate was suspended and added to 293 cells and left at 37 ° C. for about 4 hours. The culture medium was aspirated off and 2 ml of 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum free medium, fresh medium was added and the cells incubated for about 5 days.

Transfection approximately 24 hours to remove the culture media and replaced with culture medium containing a culture medium (alone) or 200 μCi / ㎖ ³⁵ S- cysteine and 200 μCi / ㎖ ³⁵ S- methionine. After 12 hours of incubation, the conditioned medium was recovered, concentrated in a rotary filter and loaded onto a 15% SDS gel. The treated gel was dried and exposed to the film for a period of time to confirm the presence of the PRO polypeptide. Cultures containing the transfected cells were further incubated (in serum free medium) and the medium was tested by the chosen bioassay.

Other techniques include Somparyrac et al ., Proc. Natl. Acad. Sci. , 12 : 7575 (1981), can be used to temporarily introduce PRO into 293 cells using the dextran sulfate method. 293 cells were cultured to a maximum density in a spinner flask and 700 μg of pRK5-PRO DNA was added. Cells were first concentrated from spinner flasks by centrifugation and washed with PBS. DNA-dextran precipitate was incubated for 4 hours in cell pellet. Cells were treated with 20% glycerol for 90 seconds and washed with tissue culture medium and then placed back into the spinner flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days the conditioned media was centrifuged and filtered to remove cells and debris. Samples containing the expressed PRO were concentrated and purified by any selected method such as dialysis and / or column chromatography.

In another embodiment, PRO can be expressed in CHO cells. pRK5-PRO can be transfected into CHO cells using known reagents such as CaPO ₄ or DEAE-dextran. As mentioned above, the cell cultures were incubated and the medium was replaced with culture medium (alone) or with a medium containing radiolabels such as ³⁵ S-methionine. After confirming the presence of the PRO polypeptide, the culture medium can be replaced with a serum free medium. Preferably, the cultures were incubated for about 6 days and then the conditioned medium was recovered. The medium containing the expressed PRO can then be concentrated and purified by any chosen method.

Epitope-tagged PRO could also be expressed in host CHO cells. PRO polypeptide is subcloned from the pRK5 vector. The subclonal insert is fused in-frame to the baculovirus expression vector with a selected epitope tag such as a poly-his tag by PCR. Poly-his tagged PRO inserts are subcloned into SV40 induction vectors containing selection markers such as DHFR to select stable clones. Finally, CHO cells can be transfected with SV40 induction vectors (as above). Labeling may be performed in the same manner as above to confirm expression. The culture medium containing the expressed poly-His tagged PRO is then concentrated and purified by any selected method such as Ni ²⁺ -chelate affinity chromatography.

PRO may be expressed in CHO and / or COS cells by transient expression methods or in CHO cells by other stable expression methods.

The following method was used to stably express in CHO cells. A protein is an IgG construct (immunoadhesine) in which the coding sequence of the soluble form of each protein (eg, extracellular domain) is fused to the sequence of an IgG1 constant region comprising a hinge, CH2 and CH2 domain, and (Or) expressed as a poly-His tagged form.

Following PCR amplification, each DNA was subcloned into a CHO expression vector using standard methods described in Ausubel et al., Current Protocols of Molecular Biology , Unit 3.16, John Wiley and Sons (1997). CHO expression vectors are constructed to have restriction sites suitable for 5 'and 3' of the DNA so that cDNA can be conveniently shuttled. Vectors used for expression in CHO cells are described by Lucas et al. Nucl. Acids Res. 24 : 9, 1774-1779 (1996), using the SV40 early promoter / enhancer to express the cDNA and dihydrofolate reductase (DHFR). DHFR expression allowed selection of plasmids that remained stable after transfection.

12 μg of the target plasmid DNA was prepared using a commercially available transfection reagent Superfect® (Qiagen), Dosper® or Fugene® (Boehringer Mannheim). It was introduced into 10,000 CHO cells. Cells were cultured according to the method described by Lucas et al., Supra. About 3 × 10 ⁻⁷ cells were frozen in ampoules according to the following method for culturing and producing cells later.

Ampoules containing the plasmid DNA were dissolved in a water bath and vortexed and mixed. The contents were pipetted into a centrifuge tube containing 10 ml of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant was aspirated and the cells resuspended in 10 ml of selection medium (0.2 μm filtered PS20 containing 5% fetal bovine serum with 0.2 μm diafiltration). Cells were dispensed into 100 ml spinners containing 90 ml of selection medium. After 1-2 days, cells were transferred to 250 ml spinner containing 150 ml of selective culture medium and incubated at 37 ° C. After 2-3 days 3 × 10 ⁵ cells / ml were seeded in 250 ml, 500 ml and 2000 ml spinners. Cell medium was centrifuged, exchanged with fresh medium and resuspended in production medium. Any suitable CHO medium may be used and in practice the production medium described in US Pat. No. 5,122,469 (June 16, 1992) was used. Three liters of production spinners were seeded at 1.2 × 10 ⁶ cells / ml. On day 0, cell number and pH were measured. On day 1, samples were taken from the spinner and sprayed with filtered air. On day 2, sample was taken from the spinner and the temperature was changed to 33 ° C. and 30 ml of 500 g / l glucose and 0.6 ml of 10% antifoam (e.g. 35% polydimethyl siloxane emulsion, Dow Corning 365 pharmaceutical grade emulsion) ) Was added. Throughout the production process, the pH should be maintained at about 7.2. After 10 days or when viability dropped below 70%, the cell culture was recovered by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C. or immediately loaded into the column for purification.

For poly-his tagged constructs, proteins were purified using a Ni-NTA column (Qiagen). Imidazole was added to the conditioned medium at a concentration of 5 mM before purification. The conditioned medium was pumped to a 6 ml Ni-NTA column equilibrated in 20 mM Hepes buffer (pH 7.4) containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml / min at 4 ° C. After loading, the column was further washed with equilibration buffer and protein was eluted with equilibration buffer containing 0.25 M imidazole. This highly purified protein was then desalted in storage buffer (pH 6.8) containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol using a 25 ml G25 Superfine (Pharmacia) column and at -80 ° C. Stored.

The immunoadhesin (Fc-containing) constructs were purified from the conditioned media as follows. The conditioned medium was pumped to a 5 ml Protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed thoroughly with equilibration buffer and eluted with 100 mM citric acid (pH 3.5). The eluted protein was collected in 1 ml fractions and immediately neutralized in a tube containing 275 μl of 1 M Tris buffer (pH 9). The highly purified protein was then removed from the storage buffer by the method described above for the poly-His tagged protein. Uniformity was evaluated by N-terminal amino acid sequencing by SDS-polyacrylamide gel and Edman digestion.

Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 25 Expression of PRO in Yeast

The following method is a description of recombinant expression of PRO in yeast.

First, yeast expression vectors were constructed for intracellular production or secretion of PRO from the ADH2 / GAPDH promoter. The DNA encoding the PRO and the promoter were inserted into a suitable restriction enzyme site of the plasmid selected for intracellular expression of PRO. In the case of secretion, the DNA encoding PRO is used for expression of the ADH2 / GAPDH promoter, the native PRO signal peptide or other mammalian signal sequence, or for example the yeast alpha-factor or invertase secretion signal / leader sequence, and PRO. The linker sequence (if needed) can be cloned into a selected plasmid with DNA encoding it.

Yeast cells, for example yeast strain AB110, can be transformed with the above expression plasmids and cultured in selected fermentation medium. Transformed yeast supernatants can be precipitated with 10% trichloroacetic acid, separated by SDS-PAGE and analyzed by staining the gel with Coomassie Blue.

Thereafter, the yeast cells can be removed from the fermentation medium by centrifugation, and the medium can be concentrated using the cartridge filter of choice to isolate and purify the recombinant PRO. The concentrate containing PRO can be further purified using selected column chromatography resins.

Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 26 Expression of PRO in Baculovirus-Infected Insect Cells

The following method is a description of recombinant expression of PRO in baculovirus-infected insect cells.

The sequence encoding the PRO was fused upstream of the epitope tag included in the baculovirus expression vector. The epitope tag includes a poly-his tag and an immunoglobulin tag (similar to the Fc region of IgG). Several plasmids can be used, including plasmids commercially available, for example plasmids derived from pVL1393 (Novagen). In short, a sequence encoding a PRO or a desired portion of a sequence encoding a PRO (eg, a sequence encoding an extracellular domain of a transmembrane protein, or a sequence encoding a mature protein if the protein is an extracellular protein) is 5 PCR was amplified using primers complementary to the 'and 3' regions. The 5 'primer may comprise a (selected) restriction enzyme site adjacent to both sides. The product was then cleaved with the selected restriction enzymes and subcloned into the expression vector.

Recombinant baculoviruses were purified using lipofectin (GIBCO-BRL) to plasmid and baculogold virus DNA (Pharmingen), Spodoptera frugiperda ("Sf9"). Produced by co-transfection into cells (ATCC CRL 1711). After 4-5 days incubation at 28 ° C., the released virus was recovered and used for subsequent amplification. Viral infection and protein expression were performed as described in O'Reilley et al., Baculovirus Expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994).

The expressed poly-his tagged PRO can then be purified, for example by Ni ²⁺ -chelate affinity chromatography. Extracts are prepared from recombinant virus-infected Sf9 cells as described by Rupert et al., Nature, 362: 175-179 (1993). In sum, Sf9 cells were washed and resuspended in sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M KCl) and placed on ice for 20 seconds. Sonication was in turn. The sonicate was removed by centrifugation and the supernatant diluted 50-fold in loading buffer (50 mM phosphoric acid, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. A Ni ²⁺ -NTA agarose column (commercially available from Quiiagen) was prepared with a 5 ml fill volume, washed with 25 ml of water and equilibrated with 25 ml of loading buffer. The filtered cell extracts were loaded into the column at 0.5 ml per minute. The column was washed with loading buffer to A ₂₈₀ baseline, at which point fraction recovery was started. Next, the column was washed with secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) to elute nonspecifically bound proteins. Again, the A ₂₈₀ baseline was reached and the column developed using an imidazole gradient from 0 to 500 mM in secondary wash buffer. 1 ml fractions were recovered and analyzed by SDS-PAGE and silver staining or by Western blotting with Ni ²⁺ -NTA (Qiagen) combined with alkaline phosphatase. Fractions containing eluted His ₁₀ -tagged PRO were pooled and dialyzed with loading buffer.

Alternatively, purification of IgG tagged (or Fc tagged) PRO can be performed using known chromatography techniques such as Protein A or Protein G column chromatography.

Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 27 Preparation of Antibodies Binding to PRO

This example describes a method of making a monoclonal antibody that can specifically bind a PRO polypeptide.

Techniques for producing monoclonal antibodies are known in the art and are described, for example, in Godding, supra. Immunogens that can be used include purified PRO, fusion proteins comprising PRO and cells expressing recombinant PRO on the cell surface. Those skilled in the art can select immunogens without undue experimentation.

Mice, eg Balb / c, were immunized by subcutaneous or intraperitoneal injection of emulsified PRO immunogen in an Freund's complete adjuvant in an amount of 1-100 μg. Alternatively, immunogens were emulsified in MPL-TDM supplements (Ribi Immunochemical Research, Hamilton, Montana, USA) and injected into the hind paws of animals. Immunized mice were then further antigen-promoted with additional immunogens emulsified in selected adjuvants after 10-12 days. Thereafter, mice can be further antigen-promoted for several weeks with additional immunoinjection. Blood samples were collected periodically from the orbital region, and serum samples were periodically taken from the mice, and anti-PRO antibodies were detected by ELISA assay.

Once a suitable antibody titer was detected, PRO was given intravenously to animals that were "positive" to the antibody. After 3-4 days, the mice were sacrificed to recover spleen cells. The spleen cells were then fused with P3X63AgU.1 available from selected murine myeloma cell lines, eg ATCC No. CRL 1597 (using 35% polyethylene glycol). With this fusion, hybridoma cells that can be plated in 96 well tissue culture plates containing HAT (hypoxanthine, aminopterin and thymidine) media that inhibit the proliferation of non-fusion cells, myeloma hybrids and splenocyte hybrids. Was created.

The reactivity of these hybridoma cells to PRO can be screened by ELISA. Methods of determining "positive" hybridoma cells that secrete the desired monoclonal antibodies to PRO are well known to those skilled in the art.

Positive hybridoma cells can be injected intraperitoneally such that syngeneic Balb / c mice produce ascites containing anti-PRO monoclonal antibodies. Alternatively, hybridoma cells can be cultured in tissue culture flasks or roller bottles. Monoclonal antibodies produced in the ascites can be purified using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the binding of the antibody to protein A or protein G may be used.

Example 28 Purification of PRO Polypeptides Using Specific Antibodies

Natural or recombinant PRO polypeptides can be purified by various standard techniques in the field of protein purification. For example, pro-PRO polypeptides, mature PRO polypeptides, or pre-PRO polypeptides are purified by immunoaffinity chromatography using antibodies specific for the desired PRO polypeptide. In general, immunoaffinity columns are constructed by coupling anti-PRO polypeptide antibodies to the activated chromatography resin by covalent bonds.

Polyclonal immunoglobulins were prepared by precipitating with ammonium sulfate from immune serum or by purification on immobilized protein A (Pharmacia LKB Biotechnology, Fitzkataway, NJ). Similarly, monoclonal antibodies were prepared by ammonium sulfate precipitation or chromatography on immobilized Protein A from mouse ascites. Partially purified immunoglobulin was covalently attached to a chromatography resin, such as CnBr-activated SEPHAROSE® (Pharmacia LKB Biotechnology). The antibody was coupled to the resin, the resin was blocked, and the derived resin was washed according to the manufacturer's instructions.

Such immunoaffinity columns are used for purification of PRO polypeptide by preparing fractions containing the PRO polypeptide in soluble form from the cells. Prepared by the addition of detergent or by the solubilization of the cell fraction obtained through solubilization or differential centrifugation of whole cells by other methods well known in the art. Alternatively, soluble PRO polypeptides comprising signal sequences may be secreted in useful amounts into the medium in which the cells are cultured.

Soluble PRO polypeptide-containing preparations were passed through an immunoaffinity column and the columns were washed under conditions that allow preferential absorption of the PRO polypeptide (eg, high ion concentration buffer in the presence of detergent). The column is then eluted under conditions that disrupt antibody / PRO polypeptide binding (e.g., low pH buffers such as about pH 2-3 or high concentrations of urea or chaotrope such as thiocyanate ions), PRO polypeptide was recovered.

Example 29 Drug Screening

The present invention is particularly useful for screening compounds with any of various drug screening techniques using PRO polypeptides or binding fragments thereof. The PRO polypeptide or fragment thereof used in this test may be free in solution, fixed to a solid support, retained on the cell surface, or located within the cell. One method of drug screening utilizes eukaryotic or prokaryotic host cells stably transformed with recombinant nucleic acids expressing a PRO polypeptide or fragment thereof. Drugs were screened for the transformed cells in a competitive binding assay. The cells, whether viable or fixed, can be used for standard binding assays. For example, the formation of a complex between a PRO polypeptide or fragment thereof and a test substance can be measured. Alternatively, a decrease in complex formation between the PRO polypeptide and its target cells or target receptors caused by the test substance may be examined.

As such, the present invention provides a method for screening a drug or any other substance that may affect a PRO polypeptide-related disease or disorder. These methods include contacting such a substance with a PRO polypeptide or fragment thereof, and methods well known in the art, including (i) the presence of a complex between the substance and the PRO polypeptide or fragment thereof, or (ii) the PRO polypeptide or fragment thereof. Analysis for the presence of complexes between cells. In this competitive binding assay, the PRO polypeptide or fragment thereof is usually labeled. After suitable incubation, the free PRO polypeptide or fragment thereof is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular substance to bind to or inhibit the PRO polypeptide / cell complex. do.

Another drug screening technique is a high-volume screening method for compounds having a suitable binding affinity with a polypeptide, which is described in detail in WO84 / 03564 (published Sep. 13, 1984). In sum, many different small peptide test compounds are synthesized on solid substrates such as plastic pins or some other surface. As with the PRO polypeptide, the peptide test compound is reacted with and washed with the PRO polypeptide. Bound PRO polypeptides are detected by methods well known in the art. Purified PRO polypeptides may also be coated directly onto the plates used in the aforementioned drug screening techniques. Non-neutralizing antibodies can also be used to capture peptides and immobilize them on a solid support.

The present invention also encompasses the use of screening assays of competing drugs for which neutralizing antibodies capable of binding a PRO polypeptide specifically compete with the test compound for binding to the PRO polypeptide or fragment thereof. In this way, antibodies can be used to detect the presence of any peptide that shares one or more antigenic determinants with the PRO polypeptide.

Example 30 Rational Drug Design

The goal of rational drug design is to produce structural polypeptides of biological activity target polypeptides (ie PRO polypeptides) or small molecules that interact with them, such as agonists, antagonists or inhibitors. Any of these examples can be used to make drugs that are more active or more stable forms of PRO polypeptides, or drugs that enhance or inhibit the function of PRO polypeptides in vivo (Hodgson, Bio ). / Technology , 9 : 19-21 (1991)].

In one method, the three-dimensional structure of a PRO polypeptide or PRO polypeptide-inhibitor complex is determined by x-ray crystallography, computer modeling or most commonly a combination of the two methods. In order to elucidate the structure of the molecule and determine the active site, both the form and the charge of the PRO polypeptide must be identified. Although less frequent, useful information about the structure of a PRO polypeptide can also be obtained by modeling based on the structure of the homologous protein. In both cases, relevant structural information is used to design cognate PRO polypeptide-like molecules or to identify effective inhibitors. Useful examples of rational drug design include molecules that enhance activity or stability, as shown by Braxton and Wells ( Biochemistry, 31 : 7796-7801 (1992)), or Athauda et al. In J. Biochem. , 113 : 742-746 (1993), molecules that act as inhibitors, agonists or antagonists of natural peptides.

In addition, a target-specific antibody selected by functional analysis may be isolated as described above and then its crystal structure analyzed. In principle, this method provides a pharmacore that can be the basis of subsequent drug design. Protein determination can also be omitted by producing anti-genetic antibodies (anti-ids) against functional pharmacologically active antibodies. In the mirror image, the binding site of the anti-id is thought to be the homologue of the original receptor. Anti-ids can then be used to identify and isolate peptides from chemically or biologically produced peptide banks. The isolated peptide is then used as Pharmacore.

With the present invention, a sufficient amount of PRO polypeptide has been made available to perform analytical studies such as x-ray crystallography. In addition, the amino acid sequence information of the PRO polypeptides provided herein will provide guidance in using computer modeling techniques in place of or in addition to x-ray determination.

Deposit of matter

The following materials have been deposited with the American Type Culture Collection (ATCC), Rockville Parklow Drive 12301, Maryland, USA.

matter ATCC Deposit Number Deposit date

DNA35672-2508 203538 December 15, 1998

DNA47465-1561 203661 February 9, 1999

DNA57700-1408 203583 January 12, 1999

DNA68818-2536 203657 February 9, 1999

DNA59847-2510 203576 12 January 1999

DNA76400-2528 203573 January 12, 1999

DNA77624-2515 203553 December 22, 1998

DNA77631-2537 203651 February 9, 1999

DNA82307-2531 203537 Dec 15, 1998

These deposits were made under the provisions of the Budapest Treaty and its rules (Budapest Treaty) on the international approval of microbial deposits under the patent procedure. This ensures maintenance of the viable culture of the deposit for 30 years from the date of deposit. The deposits will be distributed from ATCC under the Convention of the Budapest Treaty in accordance with the agreement between Genentech Inc and ATCC, which shall be deposited with the public upon the granting of the relevant US patent or upon publication of the US or foreign patent application, whichever comes first. To ensure the permanent and non-limiting distribution of water culture progeny, and to the US Patent and Trademark Commissioner in 35 USC §122 and the rules of the US Patent and Trademark Commissioner (including 37 CFR §1.14, in particular see 886 OG 638). Progenie's sale is assured to those who have the right to do so.

The assignee of the present application agrees that upon incubation under appropriate conditions, if the culture of the deposited material is killed, lost or damaged, the material will be replaced immediately with another identical material upon notification. The sale of deposited materials should not be construed as an authorization of the governments to carry out the invention in violation of the rights granted under the patent law.

The foregoing description is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not limited to the scope of the deposited structure as the deposited embodiment is intended as an illustration of certain aspects of the present invention, and any structure that is functionally equivalent is within the scope of the present invention. The deposit of a substance herein does not mean that the disclosure contained herein is inappropriate for carrying out any aspect, including the best mode of the invention, and is intended to limit the scope of the claims to the specific description set forth in the specification. It should not be interpreted. Indeed, various modifications of the invention in addition to those shown and described herein above are apparent to those skilled in the art and will be within the scope of the appended claims.

Claims (21)

Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), Figure 12 (SEQ ID NO: 18), Figure 14 (SEQ ID NO: 20), and FIG. An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence encoding an amino acid sequence selected from the group consisting of the amino acid sequences shown in 16 (SEQ ID NO: 22) and FIG. 18 (SEQ ID NO: 24). Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 6), Figure 5 (SEQ ID NO: 8), Figure 7 (SEQ ID NO: 10), Figure 9 (SEQ ID NO: 15), Figure 11 (SEQ ID NO: 17), Figure 13 (SEQ ID NO: 19), and FIG. An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of nucleotide sequences shown in 15 (SEQ ID NO: 21) and FIG. 17 (SEQ ID NO: 23). Figure 1 (SEQ ID NO: 1), Figure 3 (SEQ ID NO: 6), Figure 5 (SEQ ID NO: 8), Figure 7 (SEQ ID NO: 10), Figure 9 (SEQ ID NO: 15), Figure 11 (SEQ ID NO: 17), Figure 13 (SEQ ID NO: 19), and FIG. An isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of full length coding sequences of the nucleotide sequences shown in 15 (SEQ ID NO: 21) and 17 (SEQ ID NO: 23). Nucleic acid sequence identity with the full-length coding sequence of DNA deposited under ATCC Accession Nos. 203538, 203661, 203583, 203657, 203576, 203573, 203553, 203651, and 203537. An isolated nucleic acid that is at least 80%. A vector comprising the nucleic acid of any one of claims 1 to 4. The vector of claim 5, wherein said vector is operably linked with regulatory sequences recognized by said host cell transformed with said vector. A host cell comprising the vector of claim 5. 8. The host cell of claim 7, wherein said cell is a CHO cell. 8. The host cell of claim 7, wherein said cell is E. coli . 8. The host cell of claim 7, wherein said cell is a yeast cell. A method for producing a PRO polypeptide comprising culturing the host cell of claim 7 under conditions suitable for expression of the PRO polypeptide. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), Figure 12 (SEQ ID NO: 18), Figure 14 (SEQ ID NO: 20), and FIG. An isolated polypeptide having at least 80% amino acid sequence identity with an amino acid sequence selected from the group consisting of amino acid sequences shown in 16 (SEQ ID NO: 22) and FIG. 18 (SEQ ID NO: 24). Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), Figure 12 (SEQ ID NO: 18), Figure 14 (SEQ ID NO: 20), and FIG. An isolated polypeptide wherein at least 80% is recorded as positive when compared with an amino acid sequence selected from the group consisting of amino acid sequences shown in 16 (SEQ ID NO: 22) and FIG. 18 (SEQ ID NO: 24). Amino acids encoded by the full-length coding sequences of DNA deposited under ATCC Accession Nos. 203538, 203661, 203583, 203657, 203576, 203573, 203553, 203651, and 203537. An isolated polypeptide having at least 80% amino acid sequence identity with the sequence. A chimeric molecule comprising the polypeptide of claim 12 fused with a heterologous amino acid sequence. The chimeric molecule of claim 15, wherein the heterologous amino acid sequence is an epitope tag sequence. The chimeric molecule of claim 15, wherein said heterologous amino acid sequence is an Fc region of an immunoglobulin. An antibody that specifically binds to a polypeptide of any one of claims 12-14. The antibody of claim 18, wherein said antibody is a monoclonal antibody, humanized antibody or single chain antibody. (a) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), and Figure 12 (SEQ ID NO: 18). ), Nucleotide sequence encoding the polypeptide shown in Figure 14 (SEQ ID NO: 20), Figure 16 (SEQ ID NO: 22) or Figure 18 (SEQ ID NO: 24), (b) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), and Figure 12 (SEQ ID NO: 18). , A nucleotide sequence encoding the extracellular domain of the polypeptide shown in FIG. 14 (SEQ ID NO: 20), 16 (SEQ ID NO: 22), or FIG. 18 (SEQ ID NO: 24), or (c) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), and Figure 12 (SEQ ID NO: 18). ), Nucleotide sequence encoding the extracellular domain of the polypeptide shown in Figure 14 (SEQ ID NO: 20), Figure 16 (SEQ ID NO: 22) or Figure 18 (SEQ ID NO: 24). An isolated nucleic acid having at least 80% nucleic acid sequence identity with a. (a) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), and Figure 12 (SEQ ID NO: 18). ), FIG. 14 (SEQ ID NO: 20), FIG. 16 (SEQ ID NO: 22), or FIG. 18 (SEQ ID NO: 24), (b) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), and Figure 12 (SEQ ID NO: 18). , The extracellular domain of the polypeptide shown in FIG. 14 (SEQ ID NO: 20), FIG. 16 (SEQ ID NO: 22), or FIG. 18 (SEQ ID NO: 24), or (c) Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 7), Figure 6 (SEQ ID NO: 9), Figure 8 (SEQ ID NO: 11), Figure 10 (SEQ ID NO: 16), and Figure 12 (SEQ ID NO: 18). ), The extracellular domain of the polypeptide shown in FIG. 14 (SEQ ID NO: 20), FIG. 16 (SEQ ID NO: 22), or FIG. 18 (SEQ ID NO: 24). An isolated polypeptide having an amino acid sequence identity of at least 80%.