KR20010047310A - Gene coding for nitrile hydratase from Rhodococcus rhodochrous M33 VKM Ac-1515D and transformant containing the same - Google Patents

Abstract

PURPOSE: A nitrile hydratase gene derived from Rhodococcus rhodochrous M33 VKMAc-1515D, transformants containing the same and a method for producing amides using the transformants are provided, thereby amides can be mass produced from nitrile. CONSTITUTION: The nitrile hydratase gene represented by sequence ID No. 13 described as in the description is separated by the following steps of: incubating Rhodococcus rhodochrous M33, collecting the cells, crushing the cells, and developing the cell crushed solution on SDS-electrophoresis to isolate beta-subunit of nitrile hydratase. The transformants containing the nitrile hydratase gene is prepared by the steps of: preparing primers for amplifying the nitrile hydratase gene; amplifying the nitrile hydratase gene isolated from Rhodococcus rhodochrous M33 by PCR using the primers; cleaving the amplified nitrile hydratase gene; preparing plasmids pSH1, pSH4, pGEX-1, pREX-1 and p8-47; transforming E. coli with the plasmids to produce Rhodococcus rhodochrous pEK-5.8. The amides is produced by incubating the transformant Rhodococcus rhodochrous pEK-5.8 in an appropriate medium.

Description

Gene coding for nitrile hydratases derived from Rhodococcus rhodochrose M33 VM Ac-1515D and transformants containing these genes from Rhodococcus rhodochrous M33 VK transformant 15-15 same}

The present invention relates to a novel gene, and more particularly to a novel gene encoding a nitrile hydratase enzyme, a transformant containing the same and a method for preparing amides from nitriles using the transformant. .

The nitrile hydratase enzyme is an enzyme that promotes the conversion of nitrile to amide, and the biological manufacturing process using nitrile hydratase has a high conversion rate of acrylamide from acrylamide (99.9) compared with the chemical process using copper as a catalyst. %) No process for separating unreacted acrylonitrile is required, and it does not require high temperature, high pressure or inert atmosphere, so the device is simple and the operation stability is high.

And microorganisms having an activity of nitrile hydratase may vary, Bacillus (Bacillus), bacteria Stadium in (Bacteridium), micro nose kusu in (Micrococcus) and Brevibacterium genus (Brevibacterium) (U.S. Patent 4,001,081 call; Korea Pat. Publication No. 91-7850), the genus Corynebacterium (Corynebacterium) or in no-carboxylic Dia (Norcardia) (U.S. Pat. No. 4,248,968), genus Rhodococcus (Rhodococcus) (U.S. Pat. No. 5,334,519), Pseudomonas species (Pseudomonas) (US Patent 4,880,739 and the like are representatively used.

An important point in the method for producing amides using the nitrile hydratase is the activity and stability of the nitrile hydratase, which is an important factor in determining the economics of the process. Therefore, in order to develop an economical enzymatic process, it is important to develop a strain having high activity of nitrile hydratase.

Recently, in order to obtain a strain having increased nitrile hydratase activity, a gene encoding a nitrile hydratase was isolated using a genetic engineering technique, a recombinant vector was prepared, and a transformant having increased nitrile hydratase activity was produced. Much research has been conducted on the preparation of amides from nitriles.

A microorganism identified the nucleotide sequence of the gene encoding amino acids of the polypeptide sequence as it has an activity of hydratase nitrile so far Rhodococcus genus (Rhodococcus) N774 (U.S. Patent 5,130,235), Pseudomonas species (Pseudomonas) B23 (EP 444 639) Rhodococcus rhodochrous J1 (European Patent 445,646), Rhizobium (European Patent 579,907), and the like.

From the obtained results and the technical main point, the polypeptide having the activity of nitrile hydratase closest to the present invention and the gene fragment encoding the same are nitrile hydratase contained in the Rhodococcus Rhodocrose J1 (European Patent 445,646) strain. The similarity between the amino acid sequence and the nucleotide sequence of nitrile hydratase of Caucus Rhodocrose M33 is at least 93%. However, in the case of nitrile hydratase of J1 strain, the enzyme is expressed by the inducer, whereas in the case of the M33 nitrile hydratase, the enzyme is expressed in the absence of the inducer. This may be due to the difference in the gene encoding the enzyme in (Korean Patent Publication 131,276). In addition, European Patent 445,646 has cloned the gene encoding the nitrile hydratase in Escherichia coli, and the enzyme activity is also very low, so there is a problem that can not actually be used in industry.

Accordingly, the present inventors have studied extensively to develop a stable, high-nitrile hydratase-activated transformant and thereby provide a method for mass production of amide from nitrile. As a result, we have encoded a nitrile hydratase from Rhodococcus Rhodocrose M33. By using a gene recombination technique, a recombinant vector having high expression activity of nitrile hydratase was prepared and cloned into Escherichia coli to confirm its expression, and the recombinant vector was transferred back to the original Rhodococcus Rhodocross M33. The present invention has been found to be capable of developing transformants with increased activity of nitrile hydratase and to complete the present invention.

1 is a SDS-electrophoresis photograph of nitrile hydratase isolated from Rhodococcus rhodochrous M33.

Figure 2 is an electrophoresis picture of 0.7kb β-subunit gene amplified by polymerase chain reaction.

3 is a restriction map of recombinant plasmid pSH-1 comprising a 0.7 kb β-subunit gene.

4 is a restriction map of recombinant plasmid pSH-4 comprising a 2.0 kb nitrile hydratase gene.

5 is a restriction map of recombinant plasmid pGEX-1 comprising a 1.6 kb nitrile hydratase gene.

6 is a restriction map of recombinant plasmid pREX-1 comprising a 1.6 kb nitrile hydratase gene.

7 is a restriction map of recombinant plasmid p8-47 comprising a 5.8 kb nitrile hydratase gene.

8 is a photograph analyzed by Western blotting after addition of IPTG to the growth medium of recombinant E. coli prepared by introducing the recombinant plasmid pREX-1 to express nitrile hydratase.

Lines 1 and 2: Escherichia coli containing the recombinant plasmid pREX-1.

3-line: Escherichia coli containing plasmid pRSET-C.

4-line: E. coli without plasmid.

M line: size marker.

9 is a restriction map of recombinant plasmid pEK-NH prepared by inserting a 2.0 Kb nitrile hydratase gene into an E. coli- Rhodococcus shuttle vector pEK-SH.

10 is a restriction map of recombinant plasmid pEK-5.8 prepared by inserting a 5.8 Kb nitrile hydratase gene into the E. coli- Rhodococcus shuttle vector pEK-SH.

11 is a comparison of the activity of nitrile hydratase of transformants prepared by introducing recombinant plasmid pEK-NH into Rhodococcus rhodochrous ATCC 12674 without any activity of nitrile hydratase.

12 is a comparison of the specific activity of the nitrile hydratase of the Rhodococcus rhodochrous M33 strain and the recombinant Rhodococcus rhodochrous pEK-5.8 strain.

FIG. 13 shows a comparison of the activity of nitrile hydratase of transformants prepared by introducing recombinant plasmid pEK-5.8 into Rhodococcus rhodochrous ATCC 12674 having no activity of nitrile hydratase.

Accordingly, an object of the present invention is to provide a method for producing a high-nitrile amide transformant through the development of a nitrile hydratase high-transformant using a gene recombination technology for the novel nitrile hydratase.

In order to achieve the above object, the present invention provides a gene fragment encoding a novel nitrile hydratase derived from Rhodococcus Rhodocross M33.

The present invention also provides a recombinant plasmid comprising the gene fragment.

The present invention also provides a transformant comprising the recombinant plasmid.

The present invention also provides a method for efficiently producing amides from nitriles using the transformants.

Other objects, features and applications of the present invention will become apparent to those skilled in the art by the following detailed description.

Hereinafter, the present invention will be described in more detail.

In the present invention, in order to isolate the gene encoding the nitrile hydratase, after culturing the Rhodococcus Rhodocross M33, harvested and crushed cells, the cell-free coenzyme solution removed by centrifugation of the solids was analyzed by SDS-electrophoresis. The β-subunit of hydratase was isolated and analyzed for the N-terminal amino acid sequence, which was found to be exactly the same as Rhodococcus Rhodocross M8 VKPM S-926, the parent strain of Rhodococcus Rhodocross M33, and the N-terminal amino acid sequence. Based on this, several primers were first prepared for amplifying the nitrile hydratase-encoding gene through polymerase chain reaction.

Next, a polymerase chain reaction was carried out using the chromosomal DNA isolated from Rhodococcus Rhodocrose M33 and the primers prepared above, amplifying the entire gene encoding nitrile hydratase, cutting it with restriction enzymes, and recombining it into a vector, which is a gene carrier, pSH1. Recombinant plasmids such as, pSH4, pGEX-1, pREX-1, p8-47 were prepared and cloned into E. coli.

In the above method, E. coli, which is used as a gene carrier vector and a host cell, can be used without limitation those known in the art.

The prepared pREX-1 recombinant plasmid was first cloned into Escherichia coli, and the expression of nitrile hydratase was confirmed by Western blotting analysis. The expression level of nitrile hydratase in Escherichia coli is very low and there is a problem that nitrile hydratase remains in an inactive state due to aggregation in cells. Therefore, the recombinant plasmid prepared above was attempted to be introduced into the original Rhodococcus Rhodocrose M33, and as a result, the gene-containing recombinant plasmid of the present invention was applied to a nitrile hydratase-expressing Rhodococcus Rhodocrose strain such as Rhodococcus Rhodocrose M33. In the case of the introduction of nitrile hydratase can be produced in large quantities using the gene expression system of the host cell, and compared to Escherichia coli, it is confirmed that there is an economic advantage because a cheap medium can be used when culturing Rhodococcus Rhodocrose M33. Could.

Thus, the present inventors isolated the nitrile hydratase genes from the recombinant plasmids pSH4 and p8-47 and inserted them into the E. coli-Rhodococcus shuttle vector pEK-SH to prepare recombinant plasmids pEK-NH and pEK-5.8 (Fig. 9). 10) This was introduced into Rhodococcus Rhodocrose M33. Recombinant Rhodococcus Rhodocrose pEK-5.8 prepared in this way was about two times increased inactivity compared to the conventional Rhodococcus Rhodocrose M33 (Fig. 12).To demonstrate that this increase in activity was induced by recombinant plasmid pEK-5.8, the recombinant plasmid pEK-5.8 was cloned into a known Rhodococcus Rhodocrose ATCC 12674 without the activity of nitrile hydratase to transform T-4. , T-7, T-12, T-23, T-27 were produced, and these transformants were confirmed to possess the activity of nitrile hydratase (FIG. 12).

In order to prepare acrylamide from acrylonitrile using Rhodococcus Rhodocrose pEK-5.8 developed using genetic recombination technology, the same method as in the preparation method of acrylamide developed in accordance with the present invention (Korean Patent No. 169213). Hydration was carried out by the method to obtain 41% acrylamide in 9 hours (Example 9). In the preparation of amides by the hydration reaction of nitriles, when the hydration reaction is carried out while culturing the strain, when the concentration of amides in the culture medium is increased, the growth of the bacteria is inhibited and the medium component used in the culture is impurity. It is difficult to produce amides in reality because of its function. Therefore, after culturing the bacteria it is preferable to perform the hydration reaction by separating the cells or enzymes.

The method for producing acrylamide from acrylonitrile using the transformant containing the gene fragment of the present invention is not only the method described in Korean Patent No. 169213 described above, but also the conventional bioreaction proceeding using strain culture. It can be carried out using a method well known in the art. For example, the transformant may be used after it is immobilized on a carrier by a conventional method.

Meanwhile, a nitrile hydratase is produced by culturing the transformed strain containing the gene fragment of the present invention in an appropriate culture medium to produce and accumulate nitrile hydratase in cells and culture medium, and recovering this enzyme from the cells and culture medium. can do. In this case, E. coli can be exemplified as a suitable transgenic host cell. At this time, the culture medium and culture conditions, the number of times of separation of enzymes, etc. may be appropriately selected within the technical scope well known to those skilled in the art.

Hereinafter, the present invention will be described in more detail with reference to various examples, but the present invention is not limited to these examples.

Example 1 Isolation, Purification of Nitrile Hydratease and Amino Acid Sequence Analysis of β-Subunit.

After culturing Rhodococcus Rhodocross M33 at 30 ° C using a medium consisting of the composition of Table 1, the cells were recovered and crushed. The lysate was centrifuged (4,000 rpm), and then the supernatant was prepared as a sample. Samples were buffered (6M urea, 2.5% sodium dodecyl sulfate, 5% (w / v) β-mercaptoethanol, 0.01M tris-hydrochloric acid (pH 6.8), 10% (w / v) glycerol, 0.002% bromo) Phenol blue) and the same amount, and the water bath in boiling water for 15 minutes, followed by electrophoresis. The electrophoresis gel was stained with a dye (0.05% Coomassie Brilliant Blue R-250) and bleached with a bleach (50% methanol, 10% acetic acid). The results of analysis by SDS-electrophoresis are shown in FIG. 1 and the α-subunit and β-subunit bands of the nitrile hydratase enzymes were identified at positions of about 29KDa and 34KDa.

Furtherance Volume (g / L) Potassium phosphate (KH ₂ PO ₄ ) Potassium phosphate (K ₂ HPO ₄ ) Cobalt chloride (CoCl ₂ 6H ₂ O) Ferric sulfate (FeSO ₄ 7H ₂ O) Glucose (urea) Magnesium sulfate (MgSO ₄ 7H) ₂ O) 0.50.40.0180.005207.51.2

The electrophoretic β-subunit band was transferred to a Hybond-PVDF membrane using Hoefer's TE Series Transphor Electrophoresis Unit and analyzed for the N-terminal amino acid sequence of the β-subunit. Glu-His-Val-Asn-Lys- Tyr-Thr-Glu-Tyr-Glu-Ala-Arg-Thr (SEQ. ID. NO. 1).

Example 2 Preparation of a primer for amplifying the nitrile hydratase gene.

4 primers of DR-F1, DR-B, NH 5, NH 3 based on the N-terminal amino acid sequence of β-subunit analyzed in Example 1, Mixed primers of NHB1 and NHB2 were prepared. The location of cleavage site by restriction enzyme of each base sequence and primer is as follows.

DR-F1: 5 'ATGGATGGTATCCACGACACAGGCGGCATGACC 3' (SEQ.ID.NO. 2)

DR-B: 5 'TTATCATACGATCACTTCCTGCGGTGTGAGCGC 3' (SEQ.ID.NO. 3)

NH 5: 5 ' CTGCAG CTCGAACATCGAAGGGTGGGAGCCGAG 3' (SEQ.ID.NO. 4)

Pst Ⅰ

NH 3: 5 ' GTCGAC CACGCTGGCCTCGAGCGCCTTTGTCCAG 3' (SEQ.ID.NO. 5)

Sal Ⅰ

NHB1: 5 'ATGGATGGTGTACATGATCTGCCGGA 3' (SEQ.ID.NO. 6)

5 'ATGGACGGCGTGCACGACCTCCAGGC 3' (SEQ. ID. NO. 7)

5 'ATGGATGGAGTCCATGATCTTCCGGT 3' (SEQ.ID. NO. 8)

5 'ATGGATGGGGTACATGATCTGCCGGA 3' (SEQ.ID.NO. 9)

NHB2: 5 'TCACGCAGGCTCCAGGTACGGTTCGAAGAGATCGAC 3' (SEQ.ID.NO. 10)

5 'TCAGGCGGGTTCGAGGTAGGGCTCGAACAGGTCTAC 3' (SEQ. ID. NO. 11)

5 'TCACGCCGGCTCAAGGTAAGGTTCGAAAAGATCCAC 3' (SEQ.ID.NO. 12)

[Example 3] Amplification of nitrile hydratase gene by polymerase chain reaction and plasmid preparation.

In order to amplify the β-subunit of nitrile hydratase enzyme (0,7 kb) and the gene encoding α- and β-subunit (1.6 kb), NHB1, NHB2 and DR-F1 of the 6 primers were 0.7 kb of β. -Used to amplify the gene encoding the subunit, DR-F1 and NH3 was used to specifically amplify the 3 'flanking portion and the gene encoding the α- and β-subunit (1.6kb) . To amplify the β-subunit for the first time, the amplification of 0.7-kb β-subunit was confirmed using NHB1 and NHB2 mixed primers based on the N-terminal amino acid sequence analysis of the β-subunit. After amplification was confirmed, DR-F1 and NH3 were used to amplify a 1.6 kb gene containing the 3 'flanking portion from the beginning of the β-subunit. As a result of amplification, the restriction enzyme map of the gene was confirmed to be similar to the gene structure of the known Rhodococcus Rhodocrose J1, and from this, the flanking portions of the α, β-subunit and 5 'and 3' using primers NH3 and NH5 were obtained. The entire gene fragment of 2.0 kb coding for was specifically amplified. The 5 ′ flanking portion containing the promoter was amplified together to allow expression upon transduction with Rhodococcus rhodoxrose M33.

1. Amplification and Plasmid Construction of 0.7 Kb β-subunit Gene .

DR-F1 (SEQ. ID. NO. 2) and DR-B (specifically amplified only genes encoding β-subunits based on the N-terminal amino acid sequence of the β-subunit of nitrile hydratase) SEQ. ID.NO. 3) 5 units / μl of Taq DNA polymerase was added to 10 μl of the reaction solution consisting of 20 pmole of primer, 25 mM of magnesium chloride, 2.5 mM of dNTP's mix, 2.5 mM of DNA containing nitrile hydratase gene, and the like. The polymerase chain reaction was performed using a DNA thermal cycler. The result of electrophoresis of 0.7 Kb β-subunit gene amplified by polymerase chain reaction on 1% agarose gel is shown in FIG. 2.

The amplified 0.7 Kb nitrile hydratase β-subunit gene and pGEM-T Easy plasmid (Promega Co.) were purified using a T / A cloning kit using 20 mM Tris-HCl (pH7.6), 5 mM magnesium chloride, 5 mM Dithio A recombinant plasmid was prepared by dissolving in a buffer consisting of tracerol, 50 μg / ml bovine serum albumin and 0.5 mM ATP, adjusting the final volume to 20 μl with distilled water, and reacting for 12 hours at 16 ° C. with T4 DNA ligase. This was named pSH1. The restriction enzyme map prepared by electrophoresis on 1% agarose gel after hydrolysis using the restriction enzymes Pst I and Eco RI is shown in FIG. 3.

2. Amplification and Plasmid Construction of the 2.0 Kb Nitrile Hydratase Gene.

Primer NH 3 (SEQ. ID. NO. 5 to specifically amplify a 2.0 kb α-, β-subunit of nitrile hydratase and a 2.0 kb whole gene fragment encoding the flanking portions of 5 ′ and 3 ′. ) And NH 5 (SEQ. ID. NO. 4), except that the gene was amplified under the same polymerase chain reaction conditions as the method of 1 above.

The entire amplified 2.0Kb nitrile hydratase gene was inserted into pGEM-T Easy plasmid (Promega Co.) in the same manner as described above to make a recombinant plasmid, which was named pSH4. The restriction enzyme map prepared by electrophoresis on 1% agarose gel after hydrolysis using the restriction enzymes Pst I, Sal I, Xho I and Eco R I is shown in FIG. 4.

3. Amplification and Plasmid Construction of the 1.6 Kb Nitrile Hydratase Gene.

Primers DR-F1 (SEQ. ID. NO. 2) and NH 3 (SEQ. ID. NO. 2) to specifically amplify the 1.6 kb gene fragment from which the 5 ′ flanking portion was removed from the 2.0 kb total gene of nitrile hydratase. 5) was used to amplify the gene under the same polymerase chain reaction conditions as in the method of 1 above.

The amplified 1.6Kb nitrile hydratase gene was inserted into the pGEM-T Easy plasmid in the same manner as described above to prepare a recombinant plasmid, which was named pGEX-1. The restriction enzyme map prepared by electrophoresis on 1% agarose gel after hydrolysis using the restriction enzymes Sal I and Eco RI is shown in FIG. 5.

In the recombinant plasmid pGEX-1, a 1.6 Kb nitrile hydratase gene was hydrolyzed with Eco RI, a restriction enzyme, and recovered by electroelution. This was inserted into pRSET-C (Invitrogen Co.), which is an expression plasmid in Escherichia coli, to prepare a recombinant plasmid pREX-1. pREX-1 is expressed under the control of the T7 promoter and confirmed that the recombinant plasmid contains the nitrile hydratase gene using restriction enzymes Eco R I, Pvu I, Sac I, Xho I, and in 1% agarose gel. The restriction map prepared by electrophoresis is shown in FIG.

4. Isolation and Plasmid Construction of the 5.8 Kb nitrile hydratase gene.

The chromosomal DNA of Rhodococcus rhodochrous M33 was hydrolyzed using restriction enzymes Kpn I and Sac I to isolate a whole family of nitrile hydratase genes, including regulatory genes that regulate the expression of nitrile hydratase. Each DNA fragment was inserted into a pBluescript KS (+) plasmid and introduced into E. coli TOP10F '(Invitrogen Co.) to prepare a transformant. Among these transformants, Southern blot analysis was performed using a 0.7 kb β-subunit gene of nitrile hydratase as a probe to select a transformant containing a recombinant plasmid carrying a nitrile hydratase gene. It was. Southern blotting was performed using the DIG DNA labeling and detection kit (Boehringer Mannheim Co.), the DIG-labeled DNA probe used the 0.7 Kb gene of recombinant plasmid pSH1 and 2.0 Kb gene of pSH4, and random primed labeling. According to the labeling method, the crenov fragment was added and used. After lysing the chromosomal DNA of Rhodococcus rhodochrous M33 with several restriction enzymes, electrophoresis was performed on an agarose gel, followed by denaturation and neutralization, and the DNA was transferred to a nylon membrane. After fixing the nylon membrane with DNA attached at 80 ℃, the DIG-labeled DNA probe was added and reacted at 58 ℃ for 12 hours. Anti-DIG-AP conjugate (conjugate) was added to the nylon membrane and reacted, followed by color development with a coloring solution to select a transformant containing the recombinant plasmid.

The selected recombinant plasmid was named p8-47, and the recombinant plasmid was hydrolyzed using various restriction enzymes, followed by electrophoresis on a 1% agarose gel to 5.8 kb containing nitrile hydratase α, β-subunit. It was confirmed that the gene contains, restriction map is shown in FIG.

Example 4 Transformation in Escherichia Coli

In order to introduce the recombinant plasmid pREX-1 containing the 1.6 kb nitrile hydratase gene of Example 3 into Escherichia coli, E. coli GJ1158 was cultured in an LB-medium, and the cells were recovered, and then added with 100 mM calcium chloride for 15 minutes at 0 ° C. After standing, the cells were recovered by centrifugation again. The cells were again suspended in 100 mM calcium chloride solution, left at 0 ° C. for 5 minutes, and then placed in a pREX-1 plasmid, left at 0 ° C. for 1 hour, subjected to thermal shock at 42 ° C. for 90 seconds, and then left at 0 ° C. for 5 minutes. After 1 ml of LB medium was added, LB medium containing ampicillin (50 µg / ml) was incubated at 37 ° C.

Example 5 Nitrile hydratase expression and confirmation in E. coli

To determine the expression of the nitrile hydratase gene in E. coli, E. coli containing the recombinant plasmid pREX-1 Nitrile hydratase expression was induced by adding 1 mM IPTG while culturing BL21 in LB-media containing ampicillin (100 μg / ml). After culturing, the cells were recovered by centrifugation and Western blotting analysis was performed using an Express blot-system kit (Promega Co.). The first antibody used a mouse Anti-Xpress antibody and the second antibody used an anti-mouse IgG conjugated with alkaline phosphatase. The proteins on the electrophoretic SDS-PAGE were transferred to a polyvinylidene di pulliode (PVDF) membrane, which was then transferred to TBST containing 1% bovine serum albumin (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween 20). After standing in solution for 30 minutes, the first antibody was added and reacted for 1 hour. After washing three times with TBST solution, the second antibody was added to the TBST solution containing 1% bovine serum albumin, and then reacted for 1 hour, washed three times with TBST solution, and then alkaline phosphatase It was developed with a substrate solution for. As a result, about 40 KDa fused nitrile hydratase β-subunit was identified from E. coli containing the recombinant plasmid pREX-1, and the results are shown in FIG. 8.

Example 6 Nucleotide Sequence Analysis of Nitrile Hydratease Gene

Four subclones pSQ0.3, pSQ0.4, pSQ0.7, and pSQ4.3 were prepared from the 2.0 Kb nitrile hydratase gene of the recombinant plasmid pSH-4, and these plasmids were isolated and separated by the dideoxychain termination method. The sequence was analyzed and hydrolyzed using various restriction enzymes. The base sequence of the 2.0 kb gene of nitrile hydratase derived from Rhodococcus Rhodocross M33 and its estimated amino acid sequence are shown in SEQ ID NO: 6, and the amino acid sequences of the α- and β-subunits are shown in SEQ ID NOs: 7 and 8, respectively. It was.

Example 7 Transformation in Rhodococcus Rhodocross.

In order to introduce the nitrile hydratase gene into Rhodococcus Rhodocrose M33, a 2.0 Kb gene fragment obtained by cleaving the recombinant plasmid pSH4 with the restriction enzyme Eco RI was inserted into the E. coli-Rodococcus shuttle vector pEK-SH to insert the recombinant plasmid pEK-NH. The restriction map was shown in FIG. In addition, the restriction map of the insert of about 5.8Kb gene fragment obtained by cutting recombinant plasmid p8-47 with a restriction enzyme Kpn Ⅰ and Sac Ⅰ the same pEK-SH was produced with the recombinant plasmid pEK-5.8 in Fig. 10 Indicated.

Two recombinant plasmids pEK-NH and pEK-5.8 were transformed into Rhodococcus Rhodocrose M33, respectively, by electroporation. After culturing the M33 strain in LB medium, the cells were recovered by centrifugation (4000 rpm, 10 min, 4 ° C.), suspended in the same amount of 1 mM HEPES solution, then centrifuged under the same conditions, and washed twice with sterile distilled water. . This was centrifuged under the same conditions and resuspended in 10% glycerol, followed by centrifugation and finally suspended in 1/50 volume of 10% glycerol. Dispense 100 μl each, add the recombinant plasmid, put it in a 0.2 cm cuvette, and give an electric shock at 2,500V, 50㎌, 200Ω using GENE PULSER II (Bio-Rad Co.), and then add 1ml of LB-medium. After incubation at 30 ℃ was selected in agar medium containing 50㎍ / ㎖ kanamycin.

Recombinant plasmids pEK-5.8 and pEK-NH were also introduced into Rhodococcus Rhodocrose ATCC12674 without any nitrile hydratase activity, and transformants were selected using agar medium containing 300 µg / ml of kanamycin.

[Example 8] Nitrile hydratase expression in Rhodococcus Rhodocross transformants

Rhodococcus transformants transformed with the recombinant plasmids pEK-NH and pEK-5.8 were screened, these recombinant plasmids were isolated from the selected transformants, and hydrolyzed with various restriction enzymes, followed by electrophoresis on 1% agarose gel. As a result, it was confirmed that the recombinant plasmid isolated from the Rhodococcus transformant and the recombinant plasmid isolated from Escherichia coli were hydrolyzed by restriction enzymes in the same manner.

The inactivation of nitrile hydratase was measured by culturing recombinant Rhodococcus transformants transformed with the recombinant plasmid pEK-NH. The method for measuring inactivity of nitrile hydratase is as follows. That is, 1 ml of a solution consisting of 10 mM phosphate buffer solution at pH 7.6 and 2% (w / v) acrylonitrile was mixed with 1 ml of a suspension of microbial cells consisting of 0.04 mg of dry weight, stirred at 20 ° C. for 10 minutes, and concentrated. The reaction was stopped by adding 30 μl of HCl. The concentration of acrylamide formed was analyzed by gas chromatography.

Nitrile hydratase activity is expressed in the following units. One unit is defined as the amount of enzyme required to produce acrylamide in acrylonitrile at a rate of 1 M / min under the conditions described above, and the specific activity is μM acrylamide / min / cell dry weight (mg cells) or units / It is expressed in mg cells.

The transformant of the recombinant Rhodococcus Rhodocrose M33 transformed with the recombinant plasmid pEK-NH showed no significant difference in the nitrile hydratase activity compared to the Rhodococcus Rhodocrose M33 strain. This is because the small production increase did not show the effect. The above experiments cannot confirm the increase of nitrile hydratase activity according to pEK-NH. Therefore, we tried to prove the inactivation of nitrile hydratase of 2.0 kb. When the recombinant plasmid pEK-NH was introduced into Rhodococcus Rhodocross ATCC 2674, which had no nitrile hydratase activity, the transformant showed the activity of nitrile hydratase and the maximum specific activity was about 13 units / mg cells. The results are shown in FIG. The transformant of Rhodococcus Rhodocrose ATCC 12674 containing this recombinant plasmid pEK-NH was named Rhodococcus Rhodocrose Tn-4.

From the above results, it is assumed that the smallest unit of gene capable of expressing nitrile hydratase is a 2.0 kb gene.

The inactivation of nitrile hydratase was investigated by culturing recombinant Rhodococcus transformants transformed with recombinant plasmid pEK-5.8.

The transformant of the recombinant Rhodococcus Rhodocrose M33 transformed with the recombinant plasmid pEK-5.8 increased about 2 times the specific activity of nitrile hydratase compared to the Rhodococcus Rhodocrose M33 strain, and the results are shown in FIG. 12.

The transformant of Rhodococcus Rhodocrose M33 containing this recombinant plasmid pEK-5.8 was named Rhodococcus Rhodocrose pEK-5.8.

In order to prove that the increase of enzymatic activity was induced by plasmid pEK-5.8, recombinant plasmid pEK-5.8 was introduced into Rhodococcus Rhodocrose ATCC 12674 without nitrile hydratase activity. The hydratase activity was shown and the maximum specific activity was about 30 units / mg cells. The results are shown in FIG.

The transformants of Rhodococcus Rhodocrose ATCC 12674 containing this recombinant plasmid pEK-5.8 were named Rhodococcus Rhodocrose T-4, T-7, T-12, T-23, and T-27, respectively.

Example 9 Production of nitrile hydratase by a transformant and conversion of nitrile to amide using nitrile hydratase.

100 ml of the medium consisting of the composition of Table 1 was put into a 500 ml shaking Erlenmeyer flask, sterilized and cooled, and then 50 ㎍ / ml of kanamycin was added thereto, followed by inoculation of Rhodococcus rhodochrose pEK-5.8 with a shaker of 30 ° C. and 500 rpm. After incubating for 30 hours in a shaker), the culture medium was inoculated into a fermenter containing 3 liters of the medium having the composition shown in Table 1 and incubated at pH 7.2 and 30 ° C. for 40 hours. After incubation, centrifugation, the supernatant was discarded and washed twice with distilled water. The cells were then suspended in distilled water and used as a source of whole cell enzyme.

800 ml of distilled water was added to a 1.5 L reactor, and the temperature was adjusted to 20-25 ° C. while stirring, and 0.4 g of the dry weight of the Rhodococcus Rhodocrose pEK-5.8 strain cultured above was added to the reactor and resuspended. The acrylonitrile concentration of the reaction solution was added to the reaction mixture while controlling the injection rate of pure acrylonitrile so as not to exceed 0.2%. A total of 370 g of acrylonitrile were all added to the reactor in 7 hours, and after 9 hours 40% acrylamide solution was obtained. In this case, unreacted acrylonitrile was detected at 100 ppm or less, and by-product acrylic acid was detected at about 50 ppm.

The nitrile hydratase-coding gene provided according to the method of the present invention, unlike the conventional nitrile hydratase-coding gene, which is an induction gene, exhibits a consistently high level of expression without the presence of an inducer as a structural gene. A strain transformed with a vector, in particular, a nitro hydratase-producing ability, containing the gene of the present invention, can be effectively used to convert nitriles to amides.

<110> Tong Suh Petrochemical Corp., Ltd.

<120> Gene coding for nitrile hydratase from Phodococcus rhodochrous M3

3 VKM Ac-1515D and transformant containing the same

<130> PA99172

<160> 15

<170> KOPATIN 1.5

<210> 1

<211> 13

<212> PRT

<213> Rhodococcus rhodochrous

<400> 1

Glu His Val Asn Lys Tyr Thr Glu Tyr Glu Ala Arg Thr

1 5 10

<210> 2

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer DR-F1 for amplifying nitrile hydratase gene

<400> 2

atggatggta tccacgacac aggcggcatg acc 33

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer DR-B for amplifying nitrile hydratase gene

<400> 3

ttatcatacg atcacttcct gcggtgtgag cgc 33

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NH-5 for amplifying nitrile hydratase gene

<400> 4

ctgcagctcg aacatcgaag ggtgggagcc gag 33

<210> 5

<211> 34

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NH 3 for amplifying nitrile hydratase gene

<400> 5

gtcgaccacg ctggcctcga gcgcctttgt ccag 34

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB1 for amplifying nitrile hydratase gene

<400> 6

atggatggtg tacatgatct gccgga 26

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB1 for amplifying nitrile hydratase gene

<400> 7

atggacggcg tgcacgacct ccaggc 26

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB1 for amplifying nitrile hydratase gene

<400> 8

atggatggag tccatgatct tccggt 26

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB1 for amplifying nitrile hydratase gene

<400> 9

atggatgggg tacatgatct gccgga 26

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB2 for amplifying nitrile hydratase gene

<400> 10

tcacgcaggc tccaggtacg gttcgaagag atcgac 36

<210> 11

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB2 for amplifying nitrile hydratase gene

<400> 11

tcaggcgggt tcgaggtagg gctcgaacag gtctac 36

<210> 12

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer NHB2 for amplifying nitrile hydratase gene

<400> 12

tcacgccggc tcaaggtaag gttcgaaaag atccac 36

<210> 13

<211> 1970

<212> DNA

<213> Rhodococcus rhodochrous

<220>

<221> CDS

(222) (408) .. (1094)

<220>

<221> CDS

(1111) .. (1719)

<400> 13

ctgcagctcg aacatcgaag ggtgggagcc gagagatcgg agacgcagac acccggaggg 60

aacctagcct cccggaccga tgcgtgtcct ggcaacgcct caagattcag cgcaagcgat 120

tcaatcttgt tacttccaga accgaatcac gtccccgtag tgtgcgggga gagcgcccga 180

acgcagggat ggtatccatg cgccccttct cttttcgaac gagaaccggc cgctacagcc 240

gacccggaga cactgtgacg ccgttcaacg attgttgtgc tgtgaaggat tcactcaagc 300

caactgatat cgccattccg ttgccggaac atttgacacc ttctccctac gagtagaagc 360

cagctggacc cctctttgag cccagctccg atgaaaggaa tgaggaa atg gat ggt 416

Met asp gly

One

atc cac gac aca ggc ggc atg acc gga tac gga ccg gtc ccc tat cag 464

Ile His Asp Thr Gly Gly Met Thr Gly Tyr Gly Pro Val Pro Tyr Gln

5 10 15

aag gac gag ccc ttc ttc cac tac gag tgg gag ggt cgg acc ctg tcg 512

Lys Asp Glu Pro Phe Phe His Tyr Glu Trp Glu Gly Arg Thr Leu Ser

20 25 30 35

att ctg acc tgg atg cat ctc aag ggc atg tcg tgg tgg gac aag tcg 560

Ile Leu Thr Trp Met His Leu Lys Gly Met Ser Trp Trp Asp Lys Ser

40 45 50

cgg ttc ttc cgg gag tcg atg ggg aac gaa aac tac gtc aac gag att 608

Arg Phe Phe Arg Glu Ser Met Gly Asn Glu Asn Tyr Val Asn Glu Ile

55 60 65

cgc aac tcg tac tac acc cac tgg ctg agt gcg gca gaa cgt atc ctc 656

Arg Asn Ser Tyr Tyr Thr His Trp Leu Ser Ala Ala Glu Arg Ile Leu

70 75 80

gtc gcc gac aag atc atc acc gaa gaa gag cga aag cac cgt gtg cag 704

Val Ala Asp Lys Ile Ile Thr Glu Glu Glu Arg Lys His Arg Val Gln

85 90 95

gag atc ctc gag ggt cgg tac acg gac agg aac ccg tcg cga aag ttc 752

Glu Ile Leu Glu Gly Arg Tyr Thr Asp Arg Asn Pro Ser Arg Lys Phe

100 105 110 115

gat ccg gcc gag atc gag aag gcg atc gaa cgg ctt tac gag ccc cac 800

Asp Pro Ala Glu Ile Glu Lys Ala Ile Glu Arg Leu Tyr Glu Pro His

120 125 130

tcc cta gca ctt cca gga gcg gag ccg agt ttc tcc ctc ggt gac aag 848

Ser Leu Ala Leu Pro Gly Ala Glu Pro Ser Phe Ser Leu Gly Asp Lys

135 140 145

gtc aaa gtg aag aat atg aac ccg ctg gga cac aca cgg tgc ccg aaa 896

Val Lys Val Lys Asn Met Asn Pro Leu Gly His Thr Arg Cys Pro Lys

150 155 160

tat gtg cgg aac aag atc ggg gaa atc gtc acc tcc cac ggc tgc cag 944

Tyr Val Arg Asn Lys Ile Gly Glu Ile Val Thr Ser His Gly Cys Gln

165 170 175

atc tat ccc gag agc agc tcc gcc ggc ctc ggc gac gat ccc cgc ccg 992

Ile Tyr Pro Glu Ser Ser Ser Ala Gly Leu Gly Asp Asp Pro Arg Pro

180 185 190 195

ctc tac acg gtc gcg ttt tcc gcc cag gaa ctg tgg ggc gac gac gga 1040

Leu Tyr Thr Val Ala Phe Ser Ala Gln Glu Leu Trp Gly Asp Asp Gly

200 205 210

aac ggg aaa ggc gta gtg tgc gtc gat ctc tgg gaa ccg tac ctg atc 1088

Asn Gly Lys Gly Val Val Cys Val Asp Leu Trp Glu Pro Tyr Leu Ile

215 220 225

tct gcg tgaaag gaatacgata gtg agc gag cac gtc aat aag tac 1134

Ser Ala Val Ser Glu His Val Asn Lys Tyr

1 5

acg gag tac gag gca cgt acc aag gca atc gaa act ttc ctg tac gag 1182

Thr Glu Tyr Glu Ala Arg Thr Lys Ala Ile Glu Thr Phe Leu Tyr Glu

10 15 20

cga ggg ctc atc acg ccc gcc gcg gtc gac cga gtc gtt tcg tac tac 1230

Arg Gly Leu Ile Thr Pro Ala Ala Val Asp Arg Val Val Ser Tyr Tyr

25 30 35 40

gag aac gag atc ggc ccg atg ggc ggt gcc aag gtc gtg gcg aag tcc 1278

Glu Asn Glu Ile Gly Pro Met Gly Gly Ala Lys Val Val Ala Lys Ser

45 50 55

tgg gtg gac cct gag tac cgg cag tgg ctc gaa gag gac gcg acg ggc 1326

Trp Val Asp Pro Glu Tyr Arg Gln Trp Leu Glu Glu Asp Ala Thr Gly

60 65 70

gcg atg gcg tca ttg ggc tat gcc ggt gag cag gca cac caa att tcg 1374

Ala Met Ala Ser Leu Gly Tyr Ala Gly Glu Gln Ala His Gln Ile Ser

75 80 85

gcg gtc ttc aac gac tcc caa acg cat cac gtg gtg gtg tgc act ctg 1422

Ala Val Phe Asn Asp Ser Gln Thr His His Val Val Val Cys Thr Leu

90 95 100

tgt tcg tgc tat ccg tgg ccg gag ctt ggt ctc ccg ccc gcc tgg tac 1470

Cys Ser Cys Tyr Pro Trp Pro Glu Leu Gly Leu Pro Pro Ala Trp Tyr

105 110 115 120

aag agc atg gag tac cgg tcc cga gtg gta gca gac cct cgt gga gtg 1518

Lys Ser Met Glu Tyr Arg Ser Arg Val Val Ala Asp Pro Arg Gly Val

125 130 135

ctc aag cgc gat ttc ggt ttc gac atc ccc gat gag gtg gag gtc agg 1566

Leu Lys Arg Asp Phe Gly Phe Asp Ile Pro Asp Glu Val Glu Val Arg

140 145 150

gtt tgg gac agc agc tcc gaa atc cgc tac atc gtc atc ccg gaa cgg 1614

Val Trp Asp Ser Ser Ser Glu Ile Arg Tyr Ile Val Ile Pro Glu Arg

155 160 165

ccg gcc ggc acc gac ggt tgg tcc gag gac gag ctg gcg aag ctg gtg 1662

Pro Ala Gly Thr Asp Gly Trp Ser Glu Asp Glu Leu Ala Lys Leu Val

170 175 180

agt cgg gac tcg atg atc ggt gtc agt aat gcg ccc aca ccc cag gaa 1710

Ser Arg Asp Ser Met Ile Gly Val Ser Asn Ala Pro Thr Pro Gln Glu

185 190 195 200

gtg atc gta t gagtgaagac acactcactg atcggctccc ggcgactggg 1760

Val Ile Val

accgccgcac cgccccgcga caatggcgag cttgtattca ccgagccttg ggaagcaacg 1820

gcattcgggg tcgccatcgc gctttcggat cagaagtcgt acgaatggga gttcttccga 1880

cagcgtctca ttcactccat cgctgaggcc aacggttgcg aggcatacta cgagagctgg 1940

acaaaggcgc tcgaggccag cgtggtcgac 1970

<210> 14

<211> 229

<212> PRT

<213> Rhodococcus rhodochrous

<400> 14

Met Asp Gly Ile His Asp Thr Gly Gly Met Thr Gly Tyr Gly Pro Val

1 5 10 15

Pro Tyr Gln Lys Asp Glu Pro Phe Phe His Tyr Glu Trp Glu Gly Arg

20 25 30

Thr Leu Ser Ile Leu Thr Trp Met His Leu Lys Gly Met Ser Trp Trp

35 40 45

Asp Lys Ser Arg Phe Phe Arg Glu Ser Met Gly Asn Glu Asn Tyr Val

50 55 60

Asn Glu Ile Arg Asn Ser Tyr Tyr Thr His Trp Leu Ser Ala Ala Glu

65 70 75 80

Arg Ile Leu Val Ala Asp Lys Ile Ile Thr Glu Glu Glu Arg Lys His

85 90 95

Arg Val Gln Glu Ile Leu Glu Gly Arg Tyr Thr Asp Arg Asn Pro Ser

100 105 110

Arg Lys Phe Asp Pro Ala Glu Ile Glu Lys Ala Ile Glu Arg Leu Tyr

115 120 125

Glu Pro His Ser Leu Ala Leu Pro Gly Ala Glu Pro Ser Phe Ser Leu

130 135 140

Gly Asp Lys Val Lys Val Lys Asn Met Asn Pro Leu Gly His Thr Arg

145 150 155 160

Cys Pro Lys Tyr Val Arg Asn Lys Ile Gly Glu Ile Val Thr Ser His

165 170 175

Gly Cys Gln Ile Tyr Pro Glu Ser Ser Ser Ala Gly Leu Gly Asp Asp

180 185 190

Pro Arg Pro Leu Tyr Thr Val Ala Phe Ser Ala Gln Glu Leu Trp Gly

195 200 205

Asp Asp Gly Asn Gly Lys Gly Val Val Cys Val Asp Leu Trp Glu Pro

210 215 220

Tyr Leu Ile Ser Ala

225

<210> 15

<211> 203

<212> PRT

<213> Rhodococcus rhodochrous

<400> 15

Met Ser Glu His Val Asn Lys Tyr Thr Glu Tyr Glu Ala Arg Thr Lys

1 5 10 15

Ala Ile Glu Thr Phe Leu Tyr Glu Arg Gly Leu Ile Thr Pro Ala Ala

20 25 30

Val Asp Arg Val Val Ser Tyr Tyr Glu Asn Glu Ile Gly Pro Met Gly

35 40 45

Gly Ala Lys Val Val Ala Lys Ser Trp Val Asp Pro Glu Tyr Arg Gln

50 55 60

Trp Leu Glu Glu Asp Ala Thr Gly Ala Met Ala Ser Leu Gly Tyr Ala

65 70 75 80

Gly Glu Gln Ala His Gln Ile Ser Ala Val Phe Asn Asp Ser Gln Thr

85 90 95

His His Val Val Val Cys Thr Leu Cys Ser Cys Tyr Pro Trp Pro Glu

100 105 110

Leu Gly Leu Pro Pro Ala Trp Tyr Lys Ser Met Glu Tyr Arg Ser Arg

115 120 125

Val Val Ala Asp Pro Arg Gly Val Leu Lys Arg Asp Phe Gly Phe Asp

130 135 140

Ile Pro Asp Glu Val Glu Val Arg Val Trp Asp Ser Ser Ser Glu Ile

145 150 155 160

Arg Tyr Ile Val Ile Pro Glu Arg Pro Ala Gly Thr Asp Gly Trp Ser

165 170 175

Glu Asp Glu Leu Ala Lys Leu Val Ser Arg Asp Ser Met Ile Gly Val

180 185 190

Ser Asn Ala Pro Thr Pro Gln Glu Val Ile Val

195 200

Claims (9)

A gene fragment comprising the nucleotide sequence shown as SEQ ID NO: 13 (SEQ. ID. NO. 13). Recombinant vector comprising the gene fragment of claim 1. A transformed host cell comprising the recombinant vector of claim 2. The method of claim 3, wherein the transformed host cell is E. coli or Rhodococcus also cross (Rhodococcus rhodochrous) transformed host cell characterized in that. Preparing a transformed host cell of claim 3; Culturing the host cell in a culture medium to produce and accumulate nitrile hydratase in cells and in beneax; And Separating and recovering nitrile hydratase from the cells and culture medium Nitrile hydratase production method characterized in that it comprises a. The method of claim 5, wherein the host cell is E. coli. A method for converting nitriles to amides using a strain having the ability to convert nitriles to amides, wherein the transformed host cell of claim 3 is used as said strain. According to claim 7, characterized in that the cross (Rhodococcus rhodochrous) also the host cell is Rhodococcus sp. 9. The method according to claim 8, wherein the Rhodococcus rhodoprose is a strain having nitrile hydratase production even before transformation.