KR20010043415A - Human deadenylating nuclease, its production and its use - Google Patents

Abstract

The present invention relates to human deadenylation nucleases (DANs) having an amino acid sequence according to SEQ ID NO: 11 or functional variants thereof encoding nucleic acids and portions thereof having at least 8 nucleotides.

Description

Human deenylating nuclease, its production and its use

The present invention relates to human deadenylation nucleases (DANs), nucleic acids encoding them, methods of making and uses thereof.

Intracellular concentrations of mRNA appear to be regulated by their rate of degradation and production. In this regard, mRNA appears to be degraded by specific mechanisms and degradation rates specific for a given RNA, rather than by random nucleic acid degradation reactions. Currently, two different degradation pathways are known in which the poly (A) tail plays an important role. this. In E. coli, the poly (A) tail is attached to mRNA fragments produced by mRNA or RNAase E. The poly (A) tail includes not only other proteins but also advanced 3′-exonuclease which is a polynucleotide phosphorylase, and an RNA-dependent ATPase that helps the exonuclease to overcome inhibitory secondary structures in mRNA. It appears to function as a relatively unstructured unit involved in the attachment of the complex. Similar mechanisms appear to work on chloroplasts.

In eukaryotic cells, exonucleolytic cleavage of poly (A) tails likewise initiates the degradation of many, but not all, mRNAs. In contrast to the process in bacteria, poly (A) -degrading exonucleases do not appear to proceed with the 3′-UTR and coding sequence in carrying out their degradation. Instead, after the degradation of the poly (A) tail, the eukaryotic exonuclease appears to stop. s. In S. cerevisiae, the second step of mRNA digestion involves the 5 'cap structure being removed by specific pyrophosphatase. However, the cap is only removed after the poly (A) tail is shortened to about 10 to 15 nucleotides in length. Removal of the cap structure makes the mRNA susceptible to 5 ′ exonuclease, an important representative example of which is encoded by the XRN1 gene.

While it is relatively easy to observe the initiation of deadenylation in mammalian cells, the study of additional steps is made more difficult because the subsequent degradation process is rapid and there are no analytical intermediates. Indirect evidence, however, suggests that the cap structure is removed in the second step. Homologs of the XRN1 gene were identified in mice. In general, stable mRNA is slowly deadenylation and unstable mRNA is rapidly deadenylation. Rapid degradation depends on the presence of certain destabilizing sequences within the 3'-UTR or coding sequence. In addition, mutations in these sequences not only stabilize the mRNA but also cause deadenylation to occur slowly. In contrast, inactivation of the stabilizing component in the α-globulin mRNA destabilizes and accelerates deadenylation. These data clearly support that degradation of mRNA is regulated by the rate of deadenylation.

Deadenylation of certain mRNAs can also inactivate translation. This can be explained by the fact that the poly (A) tail plays an important role in initiation of detoxification. Deadenylation as a mechanism for controlling detoxification plays a critical role in the maturation and early embryonic formation of oocytes in many animal species. For example, in Drosophila, the arrangement position of the embryo is regulated by deadenylation of the so-called hunchback mRNA.

In vertebrates, three deadenylation reactions can in principle be clearly distinguished in oocyte maturation and early embryogenicity:

1. In immature oocytes, most mRNAs are stored in a detoxically inactive form with short poly (A) tails. An example of this is mRNA for tPA (tissue flaminogen inactivation factor) in mice. These mRNAs initially have long poly (A) tails in normal polyadenylation reactions which are then cleaved by deadenylation to become oligo (A) tails. This cleavage is regulated by sequences in the 3'-UTR.

2. During maturation of oocytes, deadenylation is used to inactivate certain mRNAs that originally had long poly (A) tails and were active in early egg development. Deadenylation does not depend on specific sequences in mRNA. All mRNAs are deadenylation unless protected by an active adenylation process.

3. During early embryonic formation, specific mRNAs are also deadenylation in specific reactions requiring specific sequences within the 3'UTR.

All three deadenylation reactions occur in the cytoplasm. However, contrary to the situation in somatic cells, oligoadenylation or deadenylation mRNA remains stable in oocytes and is once again adenylated or only degraded in subsequent developmental stages.

Enzymes involved in these reactions have not been clearly identified so far. In yeast, it is shown that the degradation of poly (A) depends directly or indirectly on poly (A) -binding protein (PAB1). PAB1-dependent poly (A) -nuclease (PAN) was purified [see Sachs, A.B. & Deardorff (1992) Cell, 70, 961; Lowell, J. E et al., (1992) Genes Dev., 6, 2088] only related genes (PAN 2 and PAN 3) [Boeck, R. et. Al. (1996) 271 (1), 432; Brown, C. et al. (1996) 16 (10) 5744] can identify very few defects in deadenylation in mutations.

See Korner, Ch. G. & Wahle, E. (1997) J. Biol. Chem., 272, 10448, No. 16] describes an Mg ²⁺ -dependent poly (A) -specific 3′-exoribonuclease of calf thymus origin, which is 74 kDa in molecular weight and also referred to as deadenylation nuclease (DAN). The calf thymus DAN described has limited reaction conditions [Korner, Chr. & Wahle, E. (1997), supra, is stimulated by cytoplasmic poly (A) -binding protein I (PAB I) and poly (A), which is preferred as its substrate.

It is an object of the present invention to make human poly (A) -specific 3'-exoribonucleases useful.

Surprisingly, the human deadenylation nuclease (human DAN) according to the present invention, which has not been characterized in detail and has only sequenced terminal portions, is currently retrieved from the genetic library.

Accordingly, the present invention provides nucleic acids encoding human DANs or functional variants thereof having the amino acid sequence set forth in SEQ ID NO: 11 and at least 8, preferably at least 15 or 20 nucleotides, in particular at least 100 nucleotides, more particularly 300 It relates to a part thereof having at least two nucleotides (hereinafter referred to as nucleic acids according to the present invention).

The complete nucleic acid encodes a protein having 639 amino acids and a molecular weight of 73.5 kDa. this. Nucleic acids in E. coli are described in Korner, Ch. G & Wahle, E. (1997), supra, are expressed as proteins exhibiting enzymatic activity similar to the enzymatic activity seen by the DAN described above. Another experiment conducted in accordance with the present invention confirms that the nucleic acid is a nucleic acid encoding a human DAN. Nucleic acid according to the present invention is dated March 25, 1998, accession no. Deposited in the GmbH.

In a preferred embodiment, the nucleic acid according to the invention is DNA or RNA, preferably double-stranded DNA and in particular DNA having a nucleic acid sequence from position 58 to position 1997 as shown in SEQ ID NO: 12. The two positions determine the start and end of the crypto area according to the invention.

According to the invention, the term "functional variant" is understood as being functionally associated with human DAN-encoding nucleic acid and in particular meaning nucleic acid of human origin. Examples of related nucleic acids are nucleic acids that originate from variants of different human cells or tissues or alleles. Likewise, the invention encompasses variants of nucleic acids that can be derived from different human individuals.

In a broad sense, the term “variant” is in accordance with the invention about 60%, preferably about 75%. In particular, it is understood as meaning a nucleic acid that exhibits about 90% and more particularly about 95% sequence homology.

Some of the nucleic acids according to the present invention can be used to prepare each epitope, for example, as a probe or antisense nucleic acid to identify another functional variant. For example, nucleic acids consisting of nucleotides of about 8 or more in length are suitable for use as antisense nucleic acids, nucleic acids consisting of about 15 or more nucleotides in length are suitable for use as primers in PCR methods, and Nucleic acids consisting of about 20 or more nucleotides are suitable for identifying additional variants, and nucleic acids consisting of about 100 or more nucleotides in length are suitable for use as probes.

In another preferred embodiment, the nucleic acid according to the invention comprises one or more non-coding sequences and / or poly (A) sequences. Non-coding sequences are, for example, regulatory sequences (eg, promoter or enhancer sequences) for regulating the expression of intron sequences or human DAN-encoding genes.

In another embodiment, the nucleic acid according to the invention is thus introduced into a vector, preferably into an expression vector or a vector effective for gene therapy.

The expression vector can be, for example, a prokaryotic or eukaryotic expression vector. this. An example of a prokaryotic expression vector for expression in E. coli is the T7 expression vector pGM10 encoding the N-terminal Met-Ala-His6 tag, which allows the expressed protein to be advantageously purified by the method of a Ni ²⁺ -NTA column. Martin, 1996]. Examples of eukaryotic expression vectors suitable for expression in Saccharomyces cerevisiae include the vectors p426Met25 and p426GAL1 (Mumberg et al., (1994) Nucl. Acids Res., 22, 5767, whereas examples of such vectors suitable for expression in insect cells are baculoviruses as described in EP-B1 0127839 or EP-B1 0549721. Vectors that are suitable for expression in mammals are SV40 vectors, and these vectors are generally useful.

In general, expression vectors are also E. coli. Trp promoter for expression in E. coli (EP-B1 054133), ADH-2 promoter for expression in yeast (Russel et al., (1983), J. Biol. Chem. 258, 2674], baculovirus polyhedrin promoter (EP-B1 0127839) or MMTV [mouse breast tumor virus; See Lee et al. (1981) Nature, 214, 228; and regulatory sequences suitable for host cells, such as the early SV40 promoter or LTR promoter of origin.

Examples of vectors effective for gene therapy include viral vectors, preferably adenovirus vectors, in particular replication-defective adenovirus vectors or adeno-associated virus vectors, eg, consisting of only two inserted terminal repeat unit (ITR) sequences. Adeno union virus vector.

Examples of suitable adenovirus vectors are described in McGrory, W.J. et al. (1998) Virol. 163, 614; Gluzman, Y. et al. (1982) in "Eukaryotic Viral Vectors" (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Harbor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S. et al. (1986) EMBO J., 5, 2377 or WO 95/00655.

Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; WO 95/23867; Samulski, R. J. (1989) J. Virol. 63, 3822; WO 95/23867; Chioroni, J.A. et al. (1995) Human Gene Therapy 6, 1531 or Kotin, R. M. (1994) Human Gene Therapy 5, 793.

Vectors effective for gene therapy can also be obtained by allowing the nucleic acids according to the invention to complex with liposomes. See Felgner, P.L. et al. (1987) Proc. Natl. Acad. Sci, USA 84, 7413; Behr, J.P. et al. (1989) Proc. Natl. Acad. Sci. USA 86, 6982; Felgner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 or Gao, X. & Huang, L. (1991) Biochim. Biophys. Lipid mixtures as described in Acta 1189, 195 are suitable for this purpose. When liposomes are prepared, the DNA ionically binds to the surface of the liposomes at a rate where a positive basic charge is maintained and the DNA is fully complexed by the liposomes.

Nucleic acids according to the invention are for example based on the sequence described in SEQ ID NO: 12 or on the peptide sequence described in SEQ ID NO: 11 and using genetic codes. Uhlman, E. & Peyman , A. (1990) Chemical Reviews, 90, 543, No 4]. Another possible method for obtaining nucleic acids according to the present invention is suitable probes. See Sambrook, J. et al. (1989) Molecular Cloning. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York. Examples of suitable probes are single-stranded DNA fragments whose length is from about 100 to 1000 nucleotides, preferably from about 200 to 500 nucleotides, in particular from about 300 to 400 nucleotides, whose sequence is derived from the nucleic acid sequence set forth in SEQ ID NO: 12. Can be.

In addition, the present invention also relates to a polypeptide having an amino acid sequence as set forth in SEQ ID NO: 11 or a functional variant thereof and at least about 6 amino acids, preferably at least 12 amino acids, in particular at least 65 amino acids and very particularly 638 amino acids. (Hereinafter referred to as “polypeptides according to the invention”). For example, a polypeptide of about 6-12 amino acids in length, preferably about 8 amino acids in length, may be coupled with a carrier and then linked to a specific polyclonal or monoclonal antibody [see US Pat. No. 5,656,435 in this regard]. May comprise an epitope that can be used to make. Polypeptides of at least about 65 amino acids in length can also be used directly to prepare polyclonal or monoclonal antibodies without any carrier.

In the sense of the present invention, the term “functional variant” refers to, for example, poly (A) -specific 3′-exoribonuclease activity functionally associated with a peptide according to the invention and preferably comprises two different reactions. It is understood as referring to a polypeptide that is active under conditions. In the first reaction condition, the activity is dependent on the presence of spermidene in the absence of salt. In contrast, the activity of the enzyme depends on the salt concentration in the absence of spermidine. In addition, when PAB 1 is present, one can observe the staged degradation of the poly (A) tail under defined reaction conditions. Korner, Chr. G. & Wahle, E. (1997)]. In particular, the length of major degradation products differs by about 30 nucleotides. Variants are also understood as meaning allelic variants or polypeptides derived from other human cells or tissues. These are also understood as meaning polypeptides derived from different human individuals.

In a broad sense, they also mean polypeptides having a sequence homology of about 70%, preferably about 80%, in particular about 90%, more particularly about 95%, with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 11. I understand. In addition they also comprise polypeptides which are about 1 to 60, preferably about 1 to 30, in particular about 1 to 15, more particularly 1 to 5 amino acids deleted. For example, the first amino acid, ie methionine, can be deleted without causing a significant change in the function of the polypeptide. In addition they can also comprise fusion proteins comprising said polypeptides according to the invention and the fusion proteins themselves already have the function of human DNA or can acquire specific functions after the fusion residues have been removed. More particularly, they include in particular fusion proteins having an extrahuman sequence of about 1 to 200, preferably about 1 to 150, in particular about 1 to 100, very particularly about 1 to 50 amino acids. Examples of non-human peptide sequences are described, for example, in E. coli. Prokaryotic peptide sequences originating from E. coli galactosidase or so-called histidine tags, such as the Met-Ala-His6 tag. Fusion proteins comprising so-called histidine tags are particularly advantageous for purifying expressed proteins by metal ion-containing columns such as Ni ²⁺ -NTA columns. "NTA" represents nitrilotriacetic acid (Qiagen GmbH, Hilden), a chelating agent.

Some of the polypeptides according to the invention provide for example epitopes that can be specifically recognized by antibodies.

Compared with known nucleases, it has been found that the polypeptides according to the invention are members of the RNase D family. 4 shows the conserved amino acids of the Exo I, Exo II and Exo III motifs characteristic of this class of exonucleases. Another conserved amino acid is shown on a gray background. Three acidic amino acid side chains, for example two in the Exo I domain and one in the Exo III domain, are directly involved in binding two Mg ²⁺ involved in enzymatic hydrolysis. The third acidic amino acid side chain, located in the Exo II domain, is bound to one of the metal ions by a hydrogen binding molecule. All these amino acid residues are highly conserved in the family and are also found in the human DAN according to the present invention. Thus, the polypeptides according to the invention can be described as being poly (A) -specific 3′-exoribonucleases belonging to the RNase D family.

Polypeptides according to the invention are prepared by expressing a nucleic acid according to the invention in a suitable expression system as described above, for example, using methods well known to those skilled in the art. Examples of suitable host cells are E. coli. E. coli strains DH5, HB101 and BL21, yeast strain Saccharomyces cerevisiae, insect cell line Lepidopteran such as Spodoptera frugiperda or animal cells such as COS , Vero, 293 and Hela cells and all of which are generally useful.

In particular, some of the polypeptides may also be synthesized by typical peptide synthesis (Maryfield technology). These are particularly suitable for obtaining antisera that can be used to screen suitable gene expression libraries for the purpose of obtaining an approach to another functional variant of the polytide according to the invention.

Thus, the present invention also relates to a method for producing a polypeptide according to the invention wherein the nucleic acid according to the invention is expressed in a suitable host cell and optionally separated.

In addition, the present invention also relates to an antibody that specifically reacts with a polypeptide according to the invention and some of the above mentioned polypeptides may themselves be immunogenic or immunogenic or for example bovine serum albumin. Immunogenicity can be increased by coupling to a suitable carrier, such as.

The antibody is polyclonal or monoclonal. Its preparation, which is part of the object of the present invention, is widely used to immunize mammals, for example rabbits, with the polypeptide or part thereof according to the invention, optionally in the presence of, for example, a puruntic adjuvant and / or aluminum hydroxide gel. Achieved in accordance with known methods. Diamond, BA et al. (1991) The New England Journal of Medicine, 1344. Polyclonal antibodies produced by immunological reactions can then be easily separated from blood using well known methods and purified for example by column chromatography. Purification of the antibody by affinity chromatography is preferred, where, for example, the C-terminal DAN fragment is coupled to an NHS-activated HiTrap column.

Monoclonal antibodies can be prepared, for example, by known methods (Winter & Milstein (Winter, G. & Milstein, C. (1991) Nature, 349, 293).

In addition, the present invention also provides a pharmaceutical and cancer, autoimmune disease, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergy especially comprising a nucleic acid according to the invention or a polypeptide according to the invention and optionally a suitable additive or adjuvant To treat neurodermatitis, allergic type I or allergy type IV, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes, and / or particularly metabolism of cells, particularly associated with transplantation, associated with immunosuppression A method for the preparation of a medicament for the treatment of a medicament, wherein the medicament comprising a nucleic acid according to the invention, for example an antisense nucleic acid or a polypeptide according to the invention, together with a pharmaceutically acceptable additive and / or adjuvant Formulated.

A medicament comprising the nucleic acid according to the invention in the form of one of the above-described vectors or complexed with liposomes effective in exposed form or gene therapy is very particularly suitable for the application of gene therapy in humans.

Examples of suitable additives and / or auxiliaries are physiological sodium chloride solutions, stabilizers, proteinase inhibitors, nuclease inhibitors and the like.

In addition, the present invention also provides diagnostic agents and cancers, autoimmune diseases, in particular multiple sclerosis, comprising nucleic acids according to the invention, polypeptides according to the invention or antibodies according to the invention and optionally suitable additives and / or adjuvants. Or diagnose rheumatoid arthritis, Alzheimer's disease, allergies, especially neurodermatitis, type I allergy or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes, and / or particularly, immune conditions, very In particular, it relates to a method for preparing a diagnostic agent for analyzing metabolism of cells associated with transplantation, wherein the additive is suitable for a diagnostic agent comprising a nucleic acid according to the invention, a polypeptide according to the invention or an antibody according to the invention and And / or adjuvant is added.

For example, according to the present invention, nucleic acids according to the present invention are based on polymerase chain reaction (PCR diagnosis as described in EP 0200362) or on Northern blots as described in more detail in Example 5. It can be used to prepare diagnostics. These tests are based on the specific hybridization of nucleic acids according to the invention, usually with complementary opposite strands of corresponding mRNAs. In this regard, the nucleic acids according to the invention can also be modified as described, for example, in EP 0063879. Fragments of DNA according to the invention can be labeled, using well known methods, radioactively with a suitable reagent, for example α-P ³² -dATP, or non-radioactively with biotin, for example cellulose or nylon. It is preferred to incubate with the isolated RNA preferably bound to a suitable membrane consisting of: In addition, it is advantageous to fractionate RNA separated by size, for example, by agarose gel electrophoresis before binding to the membrane. In this method, the amount of mRNA specifically labeled by a probe can be determined if the amount of RNA irradiated from each tissue sample is the same.

Still other diagnostic agents include polypeptides according to the invention or portions thereof which are immunogenic as described in more detail above. For example, a polypeptide, or a portion thereof, that is preferably bound to a solid phase consisting of nitrocellulose or nylon may be contacted with a body fluid, eg, blood to be irradiated, for example, in vitro, for example with an autoimmune antibody. Allow it to respond. Antibody-peptide complexes can then be detected using, for example, labeled anti-human IgG or anti-human IgM antibodies. The label is an enzyme such as, for example, a peroxidase that catalyzes the color reaction. The presence of autoimmune antibodies and the amount of these antibodies present can be detected easily and quickly by color reaction as a result.

Another diagnostic agent comprises the antibody itself according to the invention. These antibodies can be used to easily and quickly examine human tissue samples, for example, to determine if a polypeptide in question exists. In this case, the antibody according to the invention is labeled, for example, with an enzyme as already described above. Specific antibody-peptide complexes can thereby be detected easily and quickly by enzymatic color reaction.

The present invention also tests for identifying functional interaction factors such as inhibitors or stimulants, comprising nucleic acids according to the invention, polypeptides according to the invention or antibodies according to the invention and optionally suitable additives and / or adjuvants. It is about.

An example of a suitable test for identifying functional interaction factors is the so-called two-hybrid system (Fields, S & Sternglanz, R. (1984) Trends in Genetics, 10, 286). In this test, the cells, for example yeast cells, comprise a polypeptide according to the invention and for example E. coli. Expressing a fusion protein comprising a DNA-binding domain of known protein origin from E. coli Gal4 or LexA and / or transferring an unknown polypeptide and a transcription-activating domain originating from eg Gal4, herpes virus VP16 or B42 Transformed or transfected with one or more expression vectors that express the fusion protein comprising the same. In addition, the cells may be regulated by regulatory sequences such as LexA promoters / actors or by reporter genes such as E. E. coli LacZ gene, “green fluorescent protein” or yeast amino acid biosynthesis gene His3 or Leu2. Unknown polypeptides are encoded, for example, by DNA fragments derived from genetic libraries, eg, human gene libraries. Normally, the expression vectors described above are used to establish a cDNA gene library directly in yeast so that testing can be performed immediately thereafter.

For example, a nucleic acid according to the present invention is cloned into a yeast expression vector on a nucleic acid encoding a LexA-DNA-binding domain as a functional unit, and the transformed yeast consists of the polypeptide and LexA DNA-binding domain according to the present invention. To express a fusion protein. In another yeast expression vector, a cDNA fragment derived from the cDNA gene library is cloned onto a nucleic acid encoding a Gal4 transcription-activation domain as a functional unit so that the transformed yeast consists of an unknown polypeptide and a Gal4 transcription-activation domain. Allow expression of the fusion protein. Yeasts transformed with two expression vectors and for example Leu2 ⁻ phosphorus yeast further comprise nucleic acids encoding Leu2 and regulated by the LexA promoter / effector. In the event of a functional interaction between a polypeptide according to the invention and an unknown polypeptide, the Gal4 transcription-activation domain binds to the LexA promoter / effector via the LexA DNA-binding domain and the latter is activated to express the Leu2 gene. . This in turn allows Leu2 ^- yeast to grow on minimal medium that does not contain any leucine.

When the LacZ reporter gene or the green fluorescent protein reporter gene is used in place of the amino acid biosynthetic gene, activation of transcription can be detected by the formation of blue- or green fluorescent colonies. Blue or fluorescent colors can then be easily quantified with a spectrometer at 585 nM, for example blue.

In this method, gene expression libraries can be screened easily and quickly for polypeptides that interact with the polypeptides according to the invention. The new polypeptide found can then be isolated and further characterized.

Another possibility in applying a two-hybrid system is to use another substance, such as a chemical compound, to influence the interaction of the polypeptides according to the invention with known or unknown polypeptides. In this method, it is also possible to find new, valuable and chemically synthesized active compounds that can be used as therapeutic agents. The present invention therefore not only relates to a method for searching for a polypeptide-type interaction factor but also includes a method for searching for a substance capable of interacting with the protein-protein complex described above. Thus, within the meaning of the present invention, the peptide-type interaction factor and also the chemical interaction factor are therefore designated functional interaction factors which may have an inhibitory or stimulatory effect.

Another possible application of the polypeptides according to the invention is poly (A) -specific nucleic acid digests, in particular mRNA. Poly (A) -specific nucleic acid lysates can be used in particular in research laboratories.

The following drawings and examples are intended to clarify the invention without limiting the invention.

Description of Drawings and Most Important Sequences

SEQ ID NO: 11 shows amino acid sequence of human DAN comprising domains for Exo I (ADFFAIDGEFSGIS), Exo II (LVIGHNMLLDVMHTVH) and Exo III (SEQLHEAGYDAYITGLC).

SEQ ID NO: 12 shows the nucleic acid sequence of a human DAN comprising an initiation codon (position 58) and an end codon (position 1977) followed by a 3′-UTR.

1 shows the dissolution profiles of human DAN on MonoQ (FIG. 3A) and SDS-PAGEs (FIGS. 1B and 1C).

2 shows western blots of recombinant human DAN and native bovine DAN.

Figure 3 shows the deadenylation of mRNA, the accumulation of deadenylation RNA and the effect of PABI.

4 compares a human DAN according to the present invention with known nucleases.

Example

1. Identification of Human DAN cDNA Clone

Bovine DAN is purified as described in Korner, G. & Wahle, E. (1997) as follows:

All purification steps are performed at 4 ° C. Samples are frozen at −80 ° C. in liquid nitrogen between purification steps. The following basic buffers are used: 50 mM Tris / HCl, 1 mM EDTA, 10% (v / v) glycerol, 1 mM dithiothreitol, leupetin hemisulfate / ml 0.4 μg, pepstatin / ml 0.7 μg, 0.5 mM phenylmethyl Sulfonyl fluoride, 0.02% (v / v) Nonidet P-40, pH 7.9. Different concentrations of KCl are added to the basic buffer in various purification steps as described below.

New calf thymus are obtained from local slaughterhouses and transported on ice to store at -80 ° C. 1 kg is thawed in 2 L of basic buffer containing 50 mM KCl and milled initially at low speed and then at medium speed and finally at maximum speed with a Waring blender grinder. The grinding was centrifuged at 16000 x g for 1 hour and the supernatant was discarded by tilting through a wide-mesh gauge (Wahle, E., J. Biol. Chem., 266, 1991].

This calf thymus extract is loaded onto a DEAE-Sepharose FF column (column volume 4 l) and eluted from the column at a flow rate of 3 l / h using 600 mM KCl at a salt concentration gradient of 50 to a volume 2.5 times the column volume. The active fraction is eluted from the column in the portion where the salt concentration is between 75 and 200 mM KCl. Fractions are collected, combined and treated with ammonium sulfate to give 30% saturated solution and stirred on ice for 1.5 hours. After centrifugation (10800 x g for 30 minutes, which applies to all centrifugation steps mentioned below), the supernatant is adjusted to 50% saturation with ammonium sulfate and again stirred on ice and centrifuged. The precipitate is resuspended in 400 ml of basic buffer containing 50 mM KCl and dialyzed against 2 x 4.5 L of basic buffer for 10 hours. This is then centrifuged again. 1.4 L Sepharose-Blue column (7 × 36 cm) is equilibrated with basic buffer containing 50 mM KCl and the dialyzed extract is loaded onto the column. The column is washed with 1.5 bed volume of basic buffer containing 250 mM KCl and eluted with 1 bed volume of basic buffer containing 1M KCl (flow rate 2 L / h).

In each case the active fractions for the two preparations prepared from calf thymus are combined and precipitated with ammonium sulfate (60% saturation). After precipitation, the precipitate is dissolved in 200 ml of basic buffer containing 50 mM KCl, dialyzed for 3 hours for 3 x 4 l of the same buffer and divided into two portions and loaded onto a heparin-sepharose column (2.5 x 37 cm). The column is washed with 1.5 bed volumes of basic buffer containing 50 mM KCl and then eluted using 10 bed volumes with a concentration gradient below KCl 500 mM. DAN activity elutes at 80-150 mM KCl. The active fractions are combined and dialyzed for 4 hours against basic buffer containing 30 mM KCl. The dialysate is centrifuged and chromatographed in two portions on a MonoQ FPLC column (bed volume 8 ml). The column is washed with two bed volumes of basic buffer containing 50 mM KCl and then eluted from the column with a 320 ml concentration gradient (final concentration 500 mM KCl, flow rate: 2.5 ml / h) with increasing salt concentration. DAN actives elute at about KCl 160 mM. The active fractions (40 ml) are combined and dialyzed for 4 hours against 2 l of basic buffer containing 30 mM KCl, centrifuged and loaded into an additional MonoQ column (1 ml bed volume, flow rate: 0.9 ml / h). DAN activity bound to the column was eluted with basic buffer containing 500 mM KCl and divided into 4 portions and equilibrated with a Superdex HR 10/30 FPLC column (basic buffer containing 300 mM KCl; flow rate 0.15 ml / h) [ See: Korner, Ch. G. & Wahle, E. (1997).

Different fractions eluting from the Superdex column and having DAN activity are collected and fractionated via a phenyl superrose column (Korner, G & Wahle, E. (1997)). The active fractions were collected and buffered [50 mM Tris HCl, pH 7.9, 1 mM EDTA, 10% (v / v) glycerol, 1 mM dithiothritol, 0.4 mg of leupetin hemisulfate / ml, 0.7 mg pepstatin / ml, 0.5 mM phenylmethylsulfonate (PMSF), 0.02% (v / v) nonidet p-40, 50 mM KCl]. After centrifugation the dialysate is loaded into a 100 ml Smart MonoQ (PC 1.6 / 5) column. The column is then washed with 200 ml of buffer. The bound protein is eluted with a concentration gradient with increasing concentration of salt (final concentration 500 mM KCl) and with a concentration gradient equal to 40 column bed volumes. Fractions positive for DAN activity elute at a concentration of approximately KCl 200 mM. Two fractions with the highest DAN activity are analyzed by SDS polyacrylamide gel electrophoresis. It is then hydrolyzed in situ using the protease Lys-C, fractionated by HPLC and the peptides are sequenced. The following sequence was found:

1. KSFNFYVFPK,

2.KPFNRSSPD (V / K) K,

3. KYAESYWIQTYADYVG and also

4. A mixture consisting of KEQEELNDA and KLFLMRVMD.

The N-terminal sequence of the purified bovine DAN could not be determined.

The EST (expressed sequence tag) database is then examined using the BLAST program (NCBI). Identifies the following clones:

I.M.A.G.E. for Peptides 1 and 2. Consortium Clone ID 645295

I.M.A.G.E. for Peptide 3 Consortium Clone ID 301901

The clones identified are fully sequenced with an AB1373A sequencing device using an ABI Dye Terminator Cycle sequencing kit.

In this regard, the I.M.A.G.E consortium clone ID 301901 encodes the 176 C-terminal amino acid sequences of the DAN and the entire 3'-UTR, while the I.M.A.G.E. Consortium clone ID 645295 encodes the entire ORF and 5'UTR and 3'UTR corresponding to a protein consisting of 639 amino acids and having a molecular weight of 73.5 kDa (SEQ ID NO: 11). The 57 nucleotides located upstream of the first AUG codon do not contain any end codon in the reading frame. The sequence surrounding the AUG codon (AGAAUGG) is in accordance with the so-called Kozak rules (Kozak, 1991, which describes preferred starting sequences for initiation of translation). 0.7 kB of 3′-UTR is present in cDNA clone 645 295 and poly (A) tail is present at the end of cDNA clone 301901. The poly (A) tail precedes upstream of the little polyadenylation signal AUUAAA (SEQ ID NO: 12).

2. Construction of Expression Vectors

Plasmid pGMMCS was constructed by the following method.

T7 expression vector pGM10 (Martin, 1996) comprising a PABII cDNA sequence with N-terminal Met-Ala-His6 tag (Nemeth, 1996) was digested with Xho I and BamH I and a fragment comprising the 3 'residue of PAB II Is replaced with Xho I / BamH I fragments from multiple cloning sites of the pBluescript KS (+/−) plasmid. The resulting plasmid contains a 5 'residue and a multiple cloning site of PAB II followed by a sequence regulated by the T7 promoter and starting with Met-Ala His6. The NDE I cleavage site is located between His6 tag and PAB II sequences and used with multiple cloning sites to replace the remaining PAB II sequence with any coding sequence.

Plasmid pGMMCS301901 was constructed by the following method.

Portions of a sequence of human DAN clones comprising 176 C-terminal amino acids are amplified from clone 301901 using PCR using the following conditions:

15 cycles: 45 sec at 94 ° C., 45 sec at 54 ° C. and 3.5 min at 72 ° C., Pfu polymerase and primer Nde I 301901; CCATATCCATATGCTTTTCAGTGCCTTTCCTAAC and Xho I 301901: AGTACTCGAGTTACAATGTGTCAGG. The cDNA fragments obtained after digestion with Nde I and Xoh I are purified using the Qia-Ex kit (Qiagen GmbH, Hilden) and integrated into Nde-I and Xho I-digested pGMMCS vectors. Sequence is confirmed by sequencing.

Plasmid pGMMCS645295 was constructed as follows.

The coding sequence of human DAN clones is amplified from clone 645295 using PCR using the following conditions:

20 cycles: 45 seconds at 94 ° C., 45 seconds at 54 ° C. and 3.5 minutes at 72 ° C .. Pfu polymerase and primers Nde I 645295: AGTGTCGCATATGGAGATAATCAGGAGCA and Xho I 645295: AGTACTCAGCGGTTTGCTGCCCTCA. The obtained product is cloned into vector pCR2.1 using TA cloning kit (InVitrogen ^R ). The cDNA fragments obtained after digestion with Nde I and Xho I are purified using Qia-Ex kit (Qiagen) and incorporated into Nde I- and Xho I-digested pGMMCS vectors. Most of the PCR-synthesized sequences are digested with Dra III and BstE II to remove and replaced with the corresponding fragments of the original clone. The new sequence is confirmed by sequencing.

3. Preparation of Antibodies

Antibodies directed against the C-terminal residue of the human DAN are prepared as follows:

Plasmid pGMMCS301901 is used to transform BL21 (pLysC). Incubate the cells at 37 ° C. until the OD600 reaches 1.9 in SOB medium containing 200 mg of carbenicelin. 200 mM of isopropyl-bD-thiogalactoside is added and the mixture is incubated for an additional 5 hours. Cells are harvested and suspended in Buffer A (100 mM NaH ₂ PO ₄ , 10 mM Tris, 8M urea, pH 7.9). Cells are lysed by sonication and the lysates centrifuged and incubated with 3 ml of Ni NTA column material for 2 hours at room temperature. The column material is charged to the column and washed with 70 ml of Buffer A, pH 6.3. It is then washed with 15 ml of Buffer B (300 mM NaCl, 10% (v / v) glycerol, 50 mM Tris, 0.01% (v / v) Nonidet-P40, 80M urea, pH 7.9). Refold the protein on the column by reducing the urea content with 2 concentration gradients (45 ml / h, concentration gradient 1: buffer B containing 8 to 4 M urea, room temperature, concentration gradient II: containing 4 to 0 M urea, 4 ° C.). . The protein is eluted from the column with Buffer B containing 50 mM imidazole and dialyzed against Buffer B without urea and then used to immunize rabbits.

Anti-DAN antibodies are purified with affinity as follows: C-terminal DAN fragments are coupled to NHS-activated HiTrap columns (1 ml volume, Pharmacia, Freiberg) according to the manufacturer's instructions. 3 ml of serum is loaded into the column and eluted according to the manufacturer's instructions. 300 mg of BSA / ml and 0.02% (w / v) NaN ₃ are added to the fractions and the buffer is replaced by dialysis.

4. Expression and Purification of Human DAN

As a fusion protein having an N-terminal His tag (Met-Ala-His ₆ tag) in the following manner. Expression of human DAN in E. coli:

Plasmid pGMMCS645295 is used to transform BL21 (pLysC). In 50 ml of LB medium containing 100 mg of carbenicelin / ml and 24 mg of chloroamphenicol, the cells are incubated at 37 ° C. and then transferred to 500 ml of culture without chloroamphenicol and further incubated at 33 ° C. After OD600 reaches 1.3, 100 mM of isopropyl-bD-thiogalactoside is added and incubated for an additional hour. The cells are harvested and suspended in Buffer A (50mM Tris, 300mM KCl, 0.1mM MgAc, 1mM b-mercaptoethanol, 0.4mg of leupetin / ml, 0.7mg of pepstatin / ml, 5.0mM PMSF, pH 7.9). . Cells are lysed by sonication and the lysates are centrifuged and incubated with 2 ml of Ni ²⁺ -NTA column material at 4 ° C. for 2 hours. The column material is charged to the column and washed with 25 ml of buffer A followed by 20 ml of buffer B (buffer A and 10% (v / v) glycerol, 0.02% (v / v) nonidet-P40, no magnesium, pH 6.3) Wash with. The protein is then eluted with 5 ml of Buffer C (Buffer B with 500 mM imidazole). It is then dialyzed against Buffer D (500 mM Tris, 20 mM KCl, 1 mM EDTA, 5 mM PMSF, 10% (v / v) glycerol, 0., 02 (v / v) Nonidet-P40, pH 7.9). The formulation is centrifuged and loaded on a MonoQ column (1 ml bed volume). The column is then washed with 5 bed volumes of buffer containing 50 mM KCl and eluted with a concentration gradient with a volume equal to 40 bed volume and a final concentration of KCl of 500 mM. DAN actives elute with sharp peaks at approximately 190 mM KCl (FIG. 1A).

Purification yields a protein that is a substantially homogeneous formulation with the expected molecular weight (FIGS. 1B and 1C). The protein exhibits 3'-exoribonuclease activity specific to poly (A) (see Example 6). This revealed that the cDNA encodes a human DAN.

5. Northern blot analysis

See Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162, 156.] is used to isolate RNA from Hela cells. See Sambrook, J. et al. (1989) Molecular Cloning. Purify poly (A) mRNA using oligo (dT) cellulose according to the method described in A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. The obtained RNA was fractionated on a 1% agarose formaldehyde gel and transferred to a high bond N + membrane (Amersham Buchler, Brunswick) by capillary blotting and immobilized on the membrane by incubation at 80 ° C. for 2 hours. Sequences encoding human DAN are amplified by PCR and labeled with α- ³² P-dATP by random priming and used as probes. As described (Ausubel) hybridization and membranes are washed under high stringency. Northern blot analysis using HeLa cell poly (A) ⁺ RNA shows that the 3.1 kB fragment alone hybridizes with the DAN probe. The size matches well with the cDNA clone.

6. DAN activation test

Assays for DAN activity are performed as described in Korner, Chr G. & Wahle, E. (1997), supra. SDS polyacrylamide gel electrophoresis (SDS-PAGE) is performed as described in Laemmli, U.K. (1'970) Nature 227, 680.

Like bovine enzymes, recombinant DANs are active under two different reaction conditions upon neutralization of phosphate charge. In the absence of salts, its activity depends completely on the presence or absence of spermidine at an optimal concentration of 1 mM. Under these conditions, the inactivation of recombinant DAN (79,000 U / mg) is not very different from the activity of purified bovine DAN (110 000 U / mg). In the presence of spermidine, the activity of DAN is inhibited by salts. In the absence of spermidine the activity of the enzyme depends on the salt and the optimal concentration is 150 mM potassium acetate. Small DANs behave in a similar manner under these conditions. However, the inactivity of the recombinant protein (960 U / mg) is lower than the activity of the enzyme purified from the bovine thymus (8070 U / mg) under these conditions. This difference can be explained by post-translational modifications or contamination of proteins present in the preparation of bovine enzymes.

When the capped polyadenylation RNA is incubated with the DAN agent in the presence of a salt, the poly (A) tail is degraded and the temporary deadenylated RNA is temporarily accumulated (FIG. 3). If the assay is performed in the presence of PABI, the activity is partially inhibited and the staged degradation product of the poly (A) tail is observed. The length of the major degradation products differs by approximately 30 nucleotides, which is apparently due to PABI binding. These results are consistent with studies performed on bovine proteins. Korner, Chr. & Wahle, E. (1997). The synthesis of all these results demonstrates that the recombinant protein is a poly (A) -specific 3′-exoribonuclease.

7. Western blot analysis

Western blot analysis is performed as follows: Proteins are fractionated by SDS-PAGE and transferred to nitrocellulose membrane using a semi-drying method (Kyse-Andersen, 1984). Blots are incubated in TNT buffer (20 mM Tris-HCl, 150 mM NaCl, 0.05% (v / v) Tween 20, pH 7.5) containing 5% (w / v) dried scheme milk. The same buffer is used for antiserum and incubation and also in the wash step. Blots are incubated with antibody for 2-3 hours at room temperature and then washed. Peroxidase-linked pig anti-rabbit antibody-bound antibodies (DAKO, Glostrup, Denmark) and chemiluminescent staining (SuperSignal kit, Pierce) are used to detect bound antibodies.

The analysis demonstrates that rabbit antibodies generated against the C-terminal fragment of DAN can precipitate DAN from partially purified fractions. Antibodies recognize bovine and human DANs in western blots (FIG. 4). In this experiment, the recombinant DAN appears to be somewhat larger than the enzyme in the SDS lysate obtained from HeLa cells, which can be explained by introducing a tag (1004 Da) into the sequence. If the first AUG of the cDNA sequence is not the start codon used, the native DAN originating from HeLa cells must be at least 1260 Da larger than the tagged recombinant protein. These results also confirm that the first AUG sequence in the cDNA clone is used as initiation codon in vivo.

<110> AVENTIS RESEARCH & TECHNOLOGIES GMBH & CO. KG

<120> human deadenylating nuclease, its production and its use

<130> 5-1999-013496-1

<150> DE 198 22 122.3

<151> 1998-05-08

<160> 29

<170> KOPATIN 1.5

<210> 1

<211> 10

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 1

Lys Ser Phe Asn Phe Tyr Val Phe Pro Lys

1 5 10

<210> 2

<211> 11

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 2

Lys Pro Phe Asn Arg Ser Ser Pro Asp Val Lys

1 5 10

<210> 3

<211> 11

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 3

Lys Pro Phe Asn Arg Ser Ser Pro Asp Lys Lys

1 5 10

<210> 4

<211> 16

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 4

Lys Tyr Ala Glu Ser Tyr Trp Ile Gln Thr Tyr Ala Asp Tyr Val Gly

1 5 10 15

<210> 5

<211> 8

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 5

Lys Glu Gln Glu Glu Leu Asn Asp Ala

1 5

<210> 6

<211> 9

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 6

Lys Leu Phe Leu Met Arg Val Met Asp

1 5

<210> 7

<211> 34

<212> DNA

<213> Unknown

<220>

<223> single, linear, miscellaneous nucleic acid: Primer DNA

<400> 7

ccatatccat atgcttttca gtgcctttcc taac 34

<210> 8

<211> 25

<212> DNA

<213> Unknown

<220>

<223> single, linear, miscellaneous nucleic acid: Primer DNA

<400> 8

agtactcgag ttacaatgtg tcagg 25

<210> 9

<211> 29

<212> DNA

<213> Unknown

<220>

<223> single, linear, miscellaneous nucleic acid: Primer DNA

<400> 9

agtgtcgcat atggagataa tcaggagca 29

<210> 10

<211> 25

<212> DNA

<213> Unknown

<220>

<223> single, linear, miscellaneous nucleic acid: Primer DNA

<400> 10

agtactcagc ggtttgctgc cctca 25

<210> 11

<211> 639

<212> PRT

<213> Unknown

<220>

<223> single, linear, protein, N Terminus

<400> 11

Met Glu Ile Ile Arg Ser Asn Phe Lys Ser Asn Leu His Lys Val Tyr

1 5 10 15

Gln Ala Ile Glu Glu Ala Asp Phe Phe Ala Ile Asp Gly Glu Phe Ser

20 25 30

Gly Ile Ser Asp Gly Pro Ser Val Ser Ala Leu Thr Asn Gly Phe Asp

35 40 45

Thr Pro Glu Glu Arg Tyr Gln Lys Leu Lys Lys His Ser Met Asp Phe

50 55 60

Leu Leu Phe Gln Phe Gly Leu Cys Thr Phe Lys Tyr Asp Tyr Thr Asp

65 70 75 80

Ser Lys Tyr Ile Thr Lys Ser Phe Asn Phe Tyr Val Phe Pro Lys Pro

85 90 95

Phe Asn Arg Ser Ser Pro Asp Val Lys Phe Val Cys Gln Ser Ser Ser

100 105 110

Ile Asp Phe Leu Ala Ser Gln Gly Phe Asp Phe Asn Lys Val Phe Arg

115 120 125

Asn Gly Ile Pro Tyr Leu Asn Gln Glu Glu Glu Arg Gln Leu Arg Glu

130 135 140

Gln Tyr Asp Glu Lys Arg Ser Gln Ala Asn Gly Ala Gly Ala Leu Ser

145 150 155 160

Tyr Val Ser Pro Asn Thr Ser Lys Cys Pro Val Thr Ile Pro Glu Asp

165 170 175

Gln Lys Lys Phe Ile Asp Gln Val Val Glu Lys Ile Glu Asp Leu Leu

180 185 190

Gln Ser Glu Glu Asn Lys Asn Leu Asp Leu Glu Pro Cys Thr Gly Phe

195 200 205

Gln Arg Lys Leu Ile Tyr Gln Thr Leu Ser Trp Lys Tyr Pro Lys Gly

210 215 220

Ile His Val Glu Thr Leu Glu Thr Glu Lys Lys Glu Arg Tyr Ile Val

225 230 235 240

Ile Ser Lys Val Asp Glu Glu Glu Arg Lys Arg Arg Glu Gln Gln Lys

245 250 255

His Ala Lys Glu Gln Glu Glu Leu Asn Asp Ala Val Gly Phe Ser Arg

260 265 270

Val Ile His Ala Ile Ala Asn Ser Gly Lys Leu Val Ile Gly His Asn

275 280 285

Met Leu Leu Asp Val Met His Thr Val His Gln Phe Tyr Cys Pro Leu

290 295 300

Pro Ala Asp Leu Ser Glu Phe Lys Glu Met Thr Thr Cys Val Phe Pro

305 310 315 320

Arg Leu Leu Asp Thr Lys Leu Met Ala Ser Thr Gln Pro Phe Lys Asp

325 330 335

Ile Ile Asn Asn Thr Ser Leu Ala Glu Leu Glu Lys Arg Leu Lys Glu

340 345 350

Thr Pro Phe Asn Pro Pro Lys Val Glu Ser Ala Glu Gly Phe Pro Ser

355 360 365

Tyr Asp Thr Ala Ser Glu Gln Leu His Glu Ala Gly Tyr Asp Ala Tyr

370 375 380

Ile Thr Gly Leu Cys Phe Ile Ser Met Ala Asn Tyr Leu Gly Ser Phe

385 390 395 400

Leu Ser Pro Pro Lys Ile His Val Ser Ala Arg Ser Lys Leu Ile Glu

405 410 415

Pro Phe Phe Asn Lys Leu Phe Leu Met Arg Val Met Asp Ile Pro Tyr

420 425 430

Leu Asn Leu Glu Gly Pro Asp Leu Gln Pro Lys Arg Asp His Val Leu

435 440 445

His Val Thr Phe Pro Lys Glu Trp Lys Thr Ser Asp Leu Tyr Gln Leu

450 455 460

Phe Ser Ala Phe Gly Asn Ile Gln Ile Ser Trp Ile Asp Asp Thr Ser

465 470 475 480

Ala Phe Val Ser Leu Ser Gln Pro Glu Gln Val Lys Ile Ala Val Asn

485 490 495

Thr Ser Lys Tyr Ala Glu Ser Tyr Arg Ile Gln Thr Tyr Ala Glu Tyr

500 505 510

Met Gly Arg Lys Gln Glu Glu Lys Gln Ile Lys Arg Lys Trp Thr Glu

515 520 525

Asp Ser Trp Lys Glu Ala Asp Ser Lys Arg Leu Asn Pro Gln Cys Ile

530 535 540

Pro Tyr Thr Leu Gln Asn His Tyr Tyr Arg Asn Asn Ser Phe Thr Ala

545 550 555 560

Pro Ser Thr Val Gly Lys Arg Asn Leu Ser Pro Ser Gln Glu Glu Ala

565 570 575

Gly Leu Glu Asp Gly Val Ser Gly Glu Ile Ser Asp Thr Glu Leu Glu

580 585 590

Gln Thr Asp Ser Cys Ala Glu Pro Leu Ser Glu Gly Arg Lys Lys Ala

595 600 605

Lys Lys Leu Lys Arg Met Lys Lys Glu Leu Ser Pro Ala Gly Ser Ile

610 615 620

Ser Lys Asn Ser Pro Ala Thr Leu Phe Glu Val Pro Asp Thr Trp

625 630 635

<210> 12

<211> 2941

<212> DNA

<213> Unknown

<220>

<223> double, linear, cDNA for mRNA

<400> 12

gaaccgctga ggcgggcgcg ggcccgggtg gggccaaggt tccggccact ctgcagaatg 60

gagataatca ggagcaattt taagagtaat cttcacaaag tgtaccaggc catagaggag 120

gccgacttct tcgccatcga tggggagttt tcaggaatca gtgatggacc ttcagtctct 180

gcattaacaa atggttttga cactccagaa gagaggtatc agaagcttaa aaagcattcc 240

atggactttt tgctatttca gtttggcctt tgcactttta agtatgacta cacagattca 300

aagtatataa cgaagtcatt taacttctat gttttcccga aacccttcaa tagatcctca 360

ccagatgtca aatttgtttg tcagagctcc agcattgact ttctagcaag ccagggattt 420

gattttaata aagtttttcg aaatggaatt ccatatttaa atcaggaaga agaaagacag 480

ttaagagagc agtatgatga aaaacgttca caggcgaatg gtgcaggagc tctgtcctat 540

gtatctccta acacttcaaa atgtcctgtc acgattcctg aggatcaaaa gaagtttatt 600

gaccaagtgg tagagaaaat agaggattta ttacaaagtg aagaaaacaa gaacttggat 660

ttagagccat gtaccgggtt ccaaagaaaa ctaatttatc agactttgag ctggaagtat 720

ccgaaaggca ttcatgttga gactttagaa actgaaaaga aggagcgata tatagttatc 780

agcaaagtag atgaagaaga acgcaaaaga agagagcagc agaaacatgc caaagaacag 840

gaggagctga atgatgctgt gggattttct agagtcattc acgccattgc taattcggga 900

aaacttgtta ttggacacaa tatgctcttg gacgtcatgc acacagttca tcagttctac 960

tgccctctgc ctgcggactt aagtgagttt aaagagatga caacatgtgt tttccccaga 1020

ctcttggata ctaaattgat ggccagcaca caacctttta aggatatcat taacaacaca 1080

tcccttgcgg aattggaaaa gcggttaaaa gagacacctt tcaaccctcc taaagttgaa 1140

agtgccgaag gttttccaag ttatgacaca gcctctgaac aactccacga ggcaggctac 1200

gatgcctaca tcacagggct gtgcttcatc tccatggcca attacctagg ttcttttctc 1260

agccctccaa aaattcatgt gtctgccaga tcaaaactca ttgaaccttt ttttaacaag 1320

ttatttctta tgagggtcat ggatatcccc tatctaaact tggaaggacc agacttgcag 1380

cctaaacgtg atcatgttct ccatgtgaca ttccccaaag aatggaaaac cagcgacctt 1440

taccagcttt tcagtgcctt tggtaacatt cagatatcct ggattgatga cacatcagca 1500

tttgtttccc ttagccagcc cgagcaagta aagattgctg tcaataccag caaatatgca 1560

gaaagctatc ggatccaaac ctatgctgaa tatatgggga gaaaacagga agagaagcag 1620

atcaaaagaa agtggactga agatagctgg aaggaggctg acagcaaacg gttaaacccc 1680

cagtgcatac cctacaccct gcagaatcac tattaccgca acaatagttt tacagctccc 1740

agcacagtag gaaagagaaa tttgagtcct agtcaagagg aagctggcct ggaggacgga 1800

gtgtcagggg agatttccga cactgagctt gagcagaccg attcctgtgc agagcccctc 1860

tcagagggaa ggaaaaaggc caagaaatta aaaagaatga agaaggagct ttctccagca 1920

ggaagcatct cgaagaacag ccctgccaca ctctttgaag ttcctgacac atggtaacca 1980

agacctgagg gcagcaaacc gctggtgctg tcgctgtgag caagagccgg ctggcacatt 2040

tggaagccgc actgtattta acttaatcaa atgtggtatg ggaggggttg gaaaccaagt 2100

tgtctcctgg gggggagaaa acaggtttta tttttgtggc tgtggttttt tccccttttt 2160

aatctaactg cctgttgaca ttgacactca tcacggttgt aggctgtcat gaatgtgtac 2220

gtgcttaacc agtgaattcc gtgttgctct tgtgaggcct ttcctgtcat gacccagtgt 2280

gcttaagaac ctgcctgatg gggagtgtcg gctgtgaaat ctgcaaaaag agctgacatt 2340

ccagctgctg tgatcatgaa tttgggggtg tactgtcctg cctgtgcatc ttctcgcact 2400

gagattttga ggcagttgca gccctcggtt agtctcccag tggaaaaatc ggttgtgcct 2460

ccctgcttcc caccatagct gcctgaaaac atgacgctct caagcttgtc cttccttcag 2520

gaagatgtcc actcatgccc acccatgaga gggcttgccg tatgccctgg cctttgggca 2580

tatttatgta gagttccttt ctcctaagac gtgagtttct catgggggat gtacgagtaa 2640

aaaggttaac ttctgttctt atgcgtggcg ctgtgttcac tttccagagt ctctgttcgt 2700

ttgtttggat ggcggtctcg gggtacggca gcgtgtgtgc gtacgtgtct gtgtgtgtgt 2760

gtgtgtgtgt gtgtgtgtgt gtgtgtgtga aatcgtgcaa atctacaaca tgtcccagcc 2820

cattctccgt tgaaacagat cacagcaacg acaaacgctc atggcgctgc tttgctccac 2880

ccgcttcaga tagatcattg ttagatattt cacatttttg tatggtggaa ataaaaatga 2940

aaaatgtatt tccaaaagat gaaaattaaa aacattttca taggaaaaaa aaaaaaaaaa 3000

aa 3002

<210> 13

<211> 12

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 13

Ala Asp Phe Phe Ala Ile Gly Phe Ser Gly Ile Ser

1 5 10

<210> 14

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 14

Leu Val Ile Gly His Asn Met Leu Leu Val Met His Thr Val His

1 5 10 15

<210> 14

<211> 16

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 14

Ser Glu Gln Leu His Glu Ala Gly Tyr Ala Tyr Ile Thr Gly Leu Cys

1 5 10 15

<210> 15

<211> 12

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 15

Cys Asp Phe Val Ala Ile Phe Ple Leu Gly Leu Asp

1 5 10

<210> 16

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 16

Leu Val Val Gly His Asn Ser Leu Leu Ala Met Tyr Met Tyr His

1 5 10 15

<210> 17

<211> 16

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 17

Glu Asn Val Tyr His Asn Ala Gly Phe Ser Tyr Val Thr Gly Glu Val

1 5 10 15

<210> 18

<211> 12

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 18

Ala Asp Phe Val Ala Ile Leu Met Thr Gly Val Thr

1 5 10

<210> 19

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 19

Leu Ile Val Gly His Asn Cys Phe Leu Ile Ala His Val Tyr Ser

1 5 10 15

<210> 20

<211> 16

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 20

Ala Gly Gly Lys His Glu Ala Gly Tyr Ala Phe Met Thr Gly Cys Ile

1 5 10 15

<210> 21

<211> 12

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 21

Gly Thr Leu Val Ala Ile Ala Phe Val Ser Leu Gln

1 5 10

<210> 22

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 22

Val Phe Val Gly His Gly Leu Asn Asn Phe Lys His Ile Asn Ile

1 5 10 15

<210> 23

<211> 16

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 23

Gln Glu Gly Asn His Asp Ser Ile Glu Ala His Thr Ala Leu Ile Leu

1 5 10 15

<210> 24

<211> 12

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 24

Phe Pro Ala Ile Ala Leu Thr Phe Val Arg Thr Arg

1 5 10

<210> 25

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 25

Thr Lys Phe Leu His Ala Gly Ser Glu Leu Glu Val Phe Leu Asn

1 5 10 15

<210> 26

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 26

Glu Arg Gln Glu Trp Ala Ala Ala Val Trp Tyr Leu Leu Pro Ile

1 5 10 15

<210> 27

<211> 12

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 27

Ala Pro Val Phe Ala Phe Thr Thr Asp Ser Leu Asp

1 5 10

<210> 28

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide internal fragments

<400> 28

Leu Lys Val Gly Gln Asn Leu Lys Tyr Arg Gly Ile Leu Ala Asn

1 5 10 15

<210> 29

<211> 15

<212> PRT

<213> Unknown

<220>

<223> single, linear, peptide, internal fragment

<400> 29

Glu Glu Ala Gly Arg Ala Ala Glu Ala Asp Val Thr Leu Gln Leu

1 5 10 15

Claims (18)

A nucleic acid encoding a human deadenylation nuclease (DAN) having an amino acid as shown in SEQ ID NO: 11 or a functional variant thereof, and a portion thereof having eight or more nucleotides. The nucleic acid according to claim 1, wherein the nucleic acid is DNA or RNA, preferably double stranded DNA. The nucleic acid according to claim 1 or 2 which is DNA having a nucleic acid sequence of positions 58 to 1977 in SEQ ID NO: 12. The nucleic acid of claim 3 comprising one or more non-coding sequences and / or poly A sequences. The nucleic acid according to any one of claims 1 to 4, which is contained in a vector, preferably an expression vector or a vector effective for gene therapy. The method of producing a nucleic acid according to any one of claims 1 to 4, wherein the nucleic acid is chemically synthesized or isolated from a gene library using a probe. A polypeptide having an amino acid sequence as shown in SEQ ID NO: 11 or a functional variant thereof, and a portion thereof having six or more amino acids. A method for preparing a polypeptide according to claim 7, wherein the nucleic acid according to any one of claims 1 to 5 is expressed in a suitable host cell. An antibody directed against the polypeptide according to claim 7. The method of producing an antibody according to claim 9, wherein the mammal is immunized with the polypeptide according to claim 7 and the antibody produced is optionally isolated. A medicament comprising a nucleic acid according to any one of claims 1 to 5 or a polypeptide according to claim 7 and optionally a pharmaceutically acceptable additive and / or adjuvant. Cancer, autoimmune disease, wherein the nucleic acid according to any one of claims 1 to 5 or the polypeptide according to claim 7 or the antibody according to claim 9 is formulated with a pharmaceutically acceptable additive and / or adjuvant. Treat, in particular, multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, especially neurodermatitis, type I allergy or type IV allergy, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes, A method for the manufacture of a medicament for influencing metabolism of cells associated with immunosuppression, in particular associated with transplantation. A diagnostic agent comprising a nucleic acid according to any one of claims 1 to 5 or a polypeptide according to claim 7 or an antibody according to claim 9 and optionally a suitable additive and / or adjuvant. Cancer, autoimmune diseases, in particular multiple sclerosis or rheumatism, wherein a pharmaceutically acceptable excipient is added to the nucleic acid according to any one of claims 1 to 5 or the polypeptide according to claim 7 or the antibody according to claim 9. Very particularly in the diagnosis of arthritis, Alzheimer's disease, allergies, especially neurodermatitis, type I allergy or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes, and in particular associated with immunosuppression How to prepare a diagnostic for analyzing metabolism of cells associated with transplantation A test for identifying a functional interaction factor comprising a nucleic acid according to any one of claims 1 to 5 or a polypeptide according to claim 7 or an antibody according to claim 9 and optionally suitable additives and / or adjuvants. water. Use of a nucleic acid according to any one of claims 1 to 5 or a polypeptide according to claim 7 for identifying functional interaction factors. Use of a nucleic acid according to any one of claims 1 to 5 for screening gene libraries and isolating the variants identified to identify variants of human DAN. Use of a polypeptide according to claim 7 for poly (A) -specific degradation of nucleic acids, in particular mRNA.