WO1999058647A2

WO1999058647A2 - Human deadenylating nuclease, its production and its use

Info

Publication number: WO1999058647A2
Application number: PCT/EP1999/003071
Authority: WO
Inventors: Christoph Hüls; Karl-Christian Gallert; Christof Körner; Elmar Wahle
Original assignee: Aventis Research & Technologies Gmbh & Co. Kg
Priority date: 1998-05-08
Filing date: 1999-05-05
Publication date: 1999-11-18
Also published as: KR20010043415A; AU758898B2; AU4258399A; CA2328492A1; NZ507993A; WO1999058647A3; JP2002514410A; DE19822122A1; PL345310A1; EP1084234A2; HUP0101805A2

Abstract

The invention relates to a nucleic acid coding for a human deadenylating nuclease (DAN) which has an amino acid sequence in accordance with SEQ 11 or one of its functional variants, and to parts thereof having at least 8 nucleotides.

Description

Human deadening nuclease, its production and use

description

The present invention relates to a human deadening nuclease (DAN), its coding nucleic acid and its production and use.

The intracellular concentration of mRNA appears to be controlled not only by the rate of production but also by the rate of degradation. Here, mRNAs do not seem to be degraded by a random nucleolytic event, but by specific mechanisms and by degradation rates that are specific for the respective RNA. There are currently two different types of degradation in which the poly (A) tails play a special role. In E. coli, poly (A) tails are attached to mRNAs or mRNA fragments that are generated by the RNAse E. The poly (A) tail appears to function as a relatively unstructured unit that is responsible for the attachment of a complex that, among other proteins, contains a 3 ^' exonuclease process, which is a polynucleotide phosphorylase, and an RNA-dependent one Contains ATPase, which helps the exonuclease to bypass inhibitory secondary structures in the mRNA. A similar mechanism appears to work in chloroplasts.

In eukaryotes, the exonucleolytic shortening of the poly (A) tail also initiates the breakdown of many, but not all, mRNAs. In contrast to the process in bacteria, the poly (A) degrading exonuclease does not appear to progress into the 3 ^' UTR and the coding sequence in its degradation. Instead, the eukaryotic exonuclease appears to continue after the poly (A) tail has been broken down. In S. cerevisiae, the second step in mRNA degradation involves removal of the 5 ^' cap structure by a specific pyrophosphatase. However, the CAP is only removed after the poly (A) tail has been shortened to approx. 10- 15 nucleotides instead. The removal of the CAP structure makes the mRNA accessible to 5 ^' exonucleases, the most important representative of which is encoded by the XRN1 gene.

Observing the initial deadenylation process in mammalian cells is relatively easy, while an examination of the further steps is made difficult by the speed of the subsequent degradation processes and the lack of analyzable intermediates. However, indirect evidence still suggests removal of the CAP structure in the second step. A mouse homolog has been described for the XRN1 gene. In general, stable mRNAs are slowly deadenylated and unstable mRNAs rapidly. The rapid degradation depends on the presence of certain destabilizing sequences in the 3 ^' UTR or in the coding sequence. Mutations in these sequences not only lead to stabilization of the mRNA, but also to a slowed down deadenylation. In contrast, inactivation of a stabilizing element of the α-globulin mRNA leads to instability and accelerated deadenylation. These data clearly indicate that mRNA degradation is controlled by the rate of deadenylation.

Deadenylation of certain mRNAs can also lead to inactivation of translation. This can be explained by the importance of the poly (A) tail for the initiation of translation. Deadenylation as a translation control mechanism plays a crucial role in oocyte maturation and early embryogenesis in many animal species. For example, in Drosophila the polarity of the embryo is regulated by the deadenylation of the so-called hunchback mRNA.

There are basically three types of deadenylation in vertebrates in oocyte maturation and early embryogenesis: 1. In immature oocytes, most mRNAs are stored in a translationally inactive form with short poly (A) tails. An example is the mRNA for tPA (tissue plasminogen activator) in the mouse. First, this mRNA receives a long poly (A) tail in the normal polyadenylation reaction, which is then shortened into an oligo (A) tail by deadenylation. This shortening is controlled by sequences in the 3 ^' UTR. 2. When oocytes mature, deadenylation is used to inactivate certain mRNAs that originally had long poly (A) tails and were active in early egg development. Deadenylation is not dependent on specific sequences in the mRNA. All mRNAs are deadenylated unless they are protected by an active adenylation process. 3. During early embryogenesis, certain mRNAs are deadenylated in a specific reaction that also requires specific sequences in the 3 ^' UTR.

All three deadenylation reactions take place in the cytoplasm. In contrast to somatic cells, however, the oligoadenylated or deadenylated mRNAs remain stable in oocytes and are re-adenylated or only broken down in later development stages.

So far, the enzymes responsible for these reactions have not been clearly identified. It was shown in yeast that the breakdown of poly (A) depends directly or indirectly on the poly (A) binding protein (PAB1). Although a PAB1-dependent poly (A) nuclease (PAN) has been purified (Sachs, AB & Deardorff (1992) Cell, 70, 961; Lowell, JE et al. (1992) Genes Dev., 6, 2088) only slight defects in the deadenylation are found in mutants of the genes in question (PAN2 and PAN3) (Boeck, R. et al. (1996) 271 (1), 432; Brown, C. et al. (1996) 16 (10) 5744).

Körner, Ch.G. & Wahl, E. (1997) J. Biol. Chem., 272, 10448, No. 16 describe a Mg ²⁺ -dependent poly (A) -specific 3'-exoribonuclease from calf thymus with a molecular weight of 74 kDa, which was also referred to as deadening nuclease (DAN). The described DAN from calf thymus is activated by the cytoplasmic poly (A) -binding protein I (PAB I) under certain reaction conditions. conditions stimulated (Körner, Chr. & Wahl, E. (1997), supra) and preferably as substrate Poly (A).

The object of the present invention was to provide a human poly (A) -specific 3'-exoribonuclease.

A gene bank has now surprisingly found an unspecified and only sequenced clone which, according to the present invention, codes for a human deadening nuclease (human DAN).

The present invention therefore relates to a nucleic acid coding for a human DAN with an amino acid sequence according to SEQ 11 or a functional variant thereof, and parts thereof with at least 8 nucleotides, preferably with at least 15 or 20 nucleotides, in particular with at least 100 nucleotides, especially with at least 300 nucleotides (hereinafter referred to as “nucleic acid according to the invention”).

The complete nucleic acid encodes a protein with 639 amino acids and a molecular mass of 73.5 kDa. Expression of the nucleic acid in E. coli resulted in a protein that has similar enzymatic activities to that of Körner, Ch.G. & Wahl, E. (1997, supra) shows DAN. Further experiments according to the present invention confirmed that the nucleic acid is a nucleic acid which codes for a human DAN. The nucleic acid according to the invention was deposited on March 25, 1998 with the DSMZ-German Collection of Microorganisms and Cell Cultures GmbH, Mascheroder Weg 1b, 38124 Braunschweig under the number DSM 12075.

In a preferred embodiment, the nucleic acid according to the invention is a DNA or RNA, preferably a double-stranded DNA, and in particular a DNA with a nucleic acid sequence according to SEQ 12 from item 58 to item 1977. The two positions determine the start and the end according to the present invention of the coding area. According to the present invention, the term “functional variant” is understood to mean a nucleic acid that is functionally related to the human DAN-coding nucleic acid and in particular of human origin. Examples of related nucleic acids are, for example, nucleic acids from different human cells or tissues or allelic variants The present invention also encompasses variants of nucleic acids that can be derived from different human individuals.

In a broader sense, the term "variants" according to the present invention means nucleic acids which have a homology, in particular a sequence identity of approximately 60%, preferably approximately 75%, in particular approximately 90% and above all approximately Have 95%.

The parts of the nucleic acid according to the invention can be used, for example, for producing individual epitopes, as probes for identifying further functional variants or as antisense nucleic acids. For example, a nucleic acid composed of at least approx. 8 nucleotides is suitable as an antisense nucleic acid, a nucleic acid composed of at least approx. 15 nucleotides as a primer in the PCR method, a nucleic acid composed of at least approx. 20 nucleotides for the identification of further variants and a nucleic acid at least about 100 nucleotides as a probe.

In a further preferred embodiment, the nucleic acid according to the invention contains one or more non-coding sequences and / or a poly (A) sequence. The non-coding sequences are, for example, intron sequences or regulatory sequences, such as promoter or enhancer sequences, for the controlled expression of the human DAN coding gene.

In a further embodiment, the nucleic acid according to the invention is therefore contained in a vector, preferably in an expression vector or vector which is active in gene therapy. The expression vectors can be, for example, prokaryotic or eukaryotic expression vectors. Examples of prokaryotic expression vectors for expression in E. coli are, for example, the T7 expression vector pGM10 (Martin, 1996), which codes for an N-terminal Met-Ala-His6 tag, which advantageously cleans the expressed protein via a Ni ²⁺ -NTA-Säuie enables. Examples of suitable eukaryotic expression vectors for expression in Saccharomyces cerevisiae are the vectors p426Met25 or p426GAL1 (Mumberg et al. (1994) Nucl. Acids Res., 22, 5767), for expression in insect cells, for example bacuiovirus vectors as in EP-B1 -0127839 or EP-B1 -0549721, and for expression in mammalian cells, for example SV40 vectors, which are generally available.

In general, the expression vectors also contain suitable regulatory sequences for the host cell, e.g. the trp promoter for expression in E. coli (see, for example, EP-B1-0154133), the ADH-2 promoter for expression in yeast (Rüssel et al. (1983), J. Biol. Chem. 258, 2674) , the baculovirus polyhedrin promoter for expression in insect cells (see, for example, EP-B1-0127839) or the early SV40 promoter or LTR promoters, for example by MMTV (Mouse Mammary Tumor Virus; Lee et al. (1981) Nature, 214, 228).

Examples of vectors which are active in gene therapy are virus vectors, preferably adenovirus vectors, in particular replication-deficient adenovirus vectors, or adeno-associated virus vectors, e.g. an adeno-associated virus vector consisting exclusively of two inserted terminal repeat sequences (ITR).

Suitable adenovirus vectors are described, for example, in McGrory, WJ et al. (1988) Virol. 163, 614; Gluzman, Y. et al. (1982) in "Eukaryotic Viral Vectors" (Gluzman, Y. ed.) 187, Cold Spring Harbor Press, Cold Spring Habor, New York; Chroboczek, J. et al. (1992) Virol. 186, 280; Karlsson, S et al. (1986) EMBO J. 5, 2377 or WO95 / 00655. Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr. Top. Microbiol. Immunol. 158, 97; WO95 / 23867; Samulski, RJ (1989) J. Virol, 63, 3822; WO95 / 23867; Chiorini, JA et al. (1995) Human Gene Therapy 6, 1531 or Kotin, RM (1994) Human Gene Therapy 5, 793.

Vectors with gene therapy effects can also be obtained by complexing the nucleic acid according to the invention with liposomes. Lipid mixtures such as those from Feigner, P.L. et al. (1987) Proc. Natl. Acad. Sei, USA 84, 7413; Behr, J.P. et al. (1989) Proc. Natl. Acad. Be. USA 86, 6982; Feigner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 or Gao, X. & Huang, L. (1991) Biochim. Biophys. Acta 1189, 195. In the preparation of the liposomes, the DNA is ionically bound to the surface of the liposomes in such a ratio that a positive net charge remains and the DNA is completely complexed by the liposomes.

The nucleic acid according to the invention can for example be chemically based on the sequence disclosed in SEQ 12 or on the basis of the peptide sequence disclosed in SEQ 11 using the genetic code e.g. can be synthesized according to the phosphotriester method (see e.g. Uhlman, E. & Peyman, A. (1990) Chemical Reviews, 90, 543, No. 4). Another way of getting hold of the nucleic acid according to the invention is to isolate it from a suitable gene bank, for example from a human gene bank, using a suitable probe (see, for example, Sambrook, J. et al. (1989) Molecular Cloning. A laboratory manual. 2nd Edition, Cold Spring Harbor, New York). Suitable as probes are, for example, single-stranded DNA fragments with a length of approximately 100 to 1000 nucleotides, preferably with a length of approximately 200 to 500 nucleotides, in particular with a length of approximately 300 to 400 nucleotides, the sequence of which from the Nucleic acid sequence can be derived according to SEQ 12.

Another object of the present invention is also the polypeptide itself with an amino acid sequence according to SEQ 11 or a functional variant thereof, and parts thereof with at least six amino acids, preferably with minor at least 12 amino acids, in particular with at least 65 amino acids and above all with 638 amino acids (hereinafter referred to as "inventive polypeptide"). For example, an approximately 6-12, preferably approximately 8 amino acid long polypeptide may contain an epitope which, after coupling to an Carrier for the production of specific poly- or monoclonal antibodies is used (see, for example, US

5,656,435). Polypeptides with a length of at least approx. 65 amino acids can also be used directly without a carrier for the production of poly- or monoclonal antibodies.

The term “functional variant” in the sense of the present invention means polypeptides which are functionally related to the peptide according to the invention, ie have a poly (A) -specific 3'-exoribonuclease activity and are preferably active under two different reaction conditions. In the first In the absence of salt, the activity is completely dependent on the presence of spermidine. In contrast, in the absence of spermidine, the activity of the enzyme is dependent on the salt concentration. In addition, under certain reaction conditions, gradual degradation of the poly (A) Tail (see also Körner, Chr. G. & Wahl, E. (1997), supra). In particular, the foreseen degradation products differ in length by about 30 nucleotides. Variants are also understood to mean allelic variants or Polypeptides derived from other human cells or tissues. It also means polypeptides that come from different human individuals.

In a broader sense, this also includes polypeptides which have a sequence homology, in particular a sequence identity of approximately 70%, preferably approximately 80%, in particular approximately 90%, in particular approximately 95%, of the polypeptide with the amino acid sequence Have SEQ 11. Furthermore, this also includes deletion of the polypeptide in the range from about 1-60, preferably from about 1-30, in particular from about 1-15, especially from about 1-5 amino acids. For example, the first amino acid methionine may be absent without significantly changing the function of the polypeptide. In addition, this also includes fusion proteins that contain described polypeptides according to the invention, the fusion proteins themselves already having the function of a human DAN or being able to get the specific function only after the fusion portion has been split off. Above all, this includes fusion proteins with a proportion of in particular non-human sequences of approximately 1 to 200, preferably approximately 1 to 150, in particular approximately 1 to 100, especially approximately 1 to 50 amino acids. Examples of non-human peptide sequences are prokaryotic peptide sequences, for example from the galactosidase from E. coli, or a so-called histidine tag, for example a Met-Ala-His ₆ tag. A fusion protein with a so-called histidine tag is particularly advantageous for purifying the expressed protein via columns containing metal ions, for example via a Ni ²⁺ - NTA column. "NTA" stands for the chelator "nitrilot acetic acid" (Qiagen GmbH, Hilden).

The parts of the polypeptide according to the invention represent, for example, epitopes that can be specifically recognized by antibodies.

By comparison with known nucleases, it was found that the polypeptide according to the invention is a member of the so-called RNaseD family. Figure 4 shows the conserved amino acids of the Exo I, Exo II and Exo III motifs which are characteristic of this class of exonucleases. Other conserved amino acids have a gray background. The three acidic amino acid side chains, two in the Exo I domain and one in the Exo III domain, are directly involved in the binding of the two Mg ²⁺ ions that are involved in the enzymatic hydrolysis. A third acidic amino acid side chain, located in the Exo II domain, binds one of the metal ions via water bridge molecules. All of these amino acid residues are highly conserved within the family and are also found in the human DAN according to the invention. The polypeptide according to the invention can therefore be referred to as a poly (A) -specific 3'-exoribonuclease of the RNaseD family.

The polypeptide according to the invention is produced, for example, by expression of the nucleic acid according to the invention in a suitable expression system, as already described above, using methods which are generally known to the person skilled in the art. poses. Suitable host cells are, for example, the E. coli strains DH5, HB101 or BL21, the yeast strain Saccharomyces cerevisiae, the insect cell line Lepidopteran, for example from Spodoptera Frugiperda, or animal cells such as COS, Vero, 293 and HeLa, all of which are generally available.

In particular, the parts of the polypeptide mentioned can also be synthesized with the aid of classic peptide synthesis (Merrifield technique). They are particularly suitable for obtaining antisera, with the aid of which suitable gene expression banks can be searched in order to arrive at further functional variants of the polypeptide according to the invention.

Another object of the present invention therefore relates to a method for producing a polypeptide according to the invention, wherein a nucleic acid according to the invention is expressed in a suitable host cell and optionally isolated.

Another object of the present invention also relates to antibodies which react specifically with the polypeptide according to the invention, the above-mentioned parts of the polypeptide either being themselves immunogenic or by coupling to suitable carriers, such as e.g. bovine serum albumin, immunogenic or can be increased in their immunogenicity.

The antibodies are either polyclonal or monoclonal. The preparation, which is also an object of the present invention, is carried out, for example, by generally known methods by immunizing a mammal, for example a rabbit, with the polypeptide according to the invention or the parts thereof, optionally in the presence of, for example, Freund's adjuvant and / or aluminum hydroxide gels (see, for example, Diamond, BA et al. (1981) The New England Journal of Medicine, 1344). The polyclonal antibodies produced in the animal as a result of an immunological reaction can then be easily isolated from the blood by generally known methods and purified, for example, by column chromatography. Preference is given to affinity purification of the antibodies, in which for example, the C-terminal DAN fragment was coupled to an NHS-activated HiTrap column.

Monoclonal antibodies can be produced, for example, by the known method from Winter & Milstein (Winter, G. & Milstein, C. (1991) Nature, 349, 293).

Another object of the present invention is also a medicament which contains a nucleic acid or a polypeptide according to the invention and optionally suitable additives or auxiliaries and a method for producing a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's Disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for influencing cell metabolism, in particular in immunosuppression, especially in transplants, in one nucleic acid according to the invention, for example a so-called antisense nucleic acid, or a polypeptide according to the invention is formulated with pharmaceutically acceptable additives and / or auxiliaries.

A drug is particularly suitable for gene therapy use in humans which contains the nucleic acid according to the invention in naked form or in the form of one of the above-described gene therapy-effective vectors or in a form complexed with liposomes.

Suitable additives and / or auxiliary substances are e.g. a physiological saline, stabilizers, proteinase inhibitors, nuclease inhibitors etc.

Another object of the present invention is also a diagnostic agent containing a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention and optionally suitable additives and / or auxiliary substances and a method for producing a diagnostic agent for the diagnosis of Cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for analysis of the cell meta- bolism, in particular of the immune status, especially in transplantations in which a nucleic acid according to the invention, a polypeptide according to the invention or antibodies according to the invention are mixed with suitable additives and / or auxiliaries.

For example, in accordance with the present invention, a diagnostic agent based on the polymerase chain reaction (PCR diagnostics, for example in accordance with EP-0200362) or a Northern blot, as described in more detail in Example 5, can be produced using the nucleic acid according to the invention. These tests are based on the specific hybridization of the nucleic acid according to the invention with the complementary counter strand, usually the corresponding mRNA. The nucleic acid according to the invention can also be modified here, as described, for example, in EP0063879. A DNA fragment according to the invention is preferably labeled using suitable reagents, for example radioactive with α-P ³² -dATP or non-radioactive with biotin, according to generally known methods and with isolated RNA, which is preferably bound to suitable membranes made of, for example, cellulose or nylon was incubated. In addition, it is advantageous to separate the isolated RNA prior to hybridization and binding to a membrane, for example by means of agarose gel electrophoresis. With the same amount of RNA examined from each tissue sample, the amount of mRNA that was specifically labeled by the probe can thus be determined.

Another diagnostic agent contains the polypeptide according to the invention or the immunogenic parts thereof described in more detail above. The polypeptide or parts thereof, which are preferably bound to a solid phase, for example made of nitrocellulose or nylon, can for example be brought into contact with the body fluid to be examined, for example blood, in order to use autoimmune antibodies, for example. to be able to respond via The antibody-peptide complex can then be detected, for example, using labeled anti-human IgG or anti-human IgM antibodies. The label is, for example, an enzyme, such as peroxidase, that catalyzes a color reaction. The presence and the amount of autoimmune antibodies present can thus be easily and quickly detected via the color reaction.

Another diagnostic agent contains the antibodies according to the invention themselves. With the aid of these antibodies, for example, a tissue sample from humans can be easily and quickly examined to determine whether the polypeptide in question is present. In this case, the antibodies according to the invention are labeled, for example, with an enzyme, as already described above. The specific antibody-peptide complex can thus be detected easily and just as quickly via an enzymatic color reaction.

Another object of the present invention also relates to a test for the identification of functional interactors, such as e.g. Inhibitors or stimulators containing a nucleic acid according to the invention, a polypeptide according to the invention or the antibodies according to the invention and, if appropriate, suitable additives and / or auxiliaries.

A suitable test for identifying functional interactors is, for example, the so-called "two-hybrid system" (Fields, S. & Sternglanz, R. (1994) Trends in Geπetics, 10, 286). In this test, a cell, for example a yeast cell, transformed or transfected with one or more expression vectors which express a fusion protein which contains the polypeptide according to the invention and a DNA binding domain of a known protein, for example from Gal4 or LexA from E. coli, and / or express a fusion protein which contains an unknown polypeptide and contains a transcription activation domain, for example from Gal4, Herpesvirus VP16 or B42. The cell also contains a reporter gene, for example the LacZ gene from E. coli, "Green Fluorescence Protein" or the amino acid biosynthesis genes of the yeast His3 or Leu2 that is regulated by regulatory sequences, such as the lexA promoter / operator or is controlled by a so-called "upstream activation sequence" (UAS) of the yeast. The unknown polypeptide is encoded, for example, by a DNA fragment that is from a gene bank, for example from a human gene bank, Usually, a cDNA library is immediately produced in yeast using the expression vectors described, so that the test can be carried out immediately thereafter.

For example, in a yeast expression vector, the nucleic acid according to the invention is cloned in a functional unit to the nucleic acid coding for the lexA-DNA binding domain, so that a fusion protein from the polypeptide according to the invention and the LexA-DNA binding domain is expressed in the transformed yeast. In another yeast expression vector, cDNA fragments from a cDNA library are cloned in a functional unit to the nucleic acid coding for the Gal4 transcription activation domain, so that a fusion protein from an unknown polypeptide and the Gal4 transcription activation domain in the transformed yeast is expressed. The yeast transformed with both expression vectors, which is for example Leu2 ^" , additionally contains a nucleic acid which codes for Leu2 and is controlled by the LexA promoter / operator. In the event of a functional interaction between the polypeptide according to the invention and the unknown polypeptide, Gal4 binds Transcriptional activation domain via the LexA DNA binding domain to the LexA promoter / operator, thereby activating it and expressing the Leu2 gene, with the result that the Leu2 ^' yeast can grow on minimal medium containing no leucine .

When using the LacZ or "Green Fluorescence Protein" reporter gene instead of an amino acid biosynthetic gene, the activation of the transcription can be demonstrated by the formation of blue or green fluorescent colonies. However, the blue or fluorescent staining can also be done easily quantify in the spectrophotometer eg at 585 nM in the event of a blue color.

In this way, expression gene banks can be easily and quickly searched for polypeptides that interact with the polypeptide according to the invention. On- finally, the new polypeptides found can be isolated and further characterized.

Another possible application of the "two-hybrid system" is to influence the interaction between the polypeptide according to the invention and a known or unknown polypeptide by other substances, such as chemical compounds. In this way, new valuable chemically synthesizable active substances can also be found easily The present invention is therefore not only intended for a method for finding polypeptide-like interactors, but also extends for a method for finding substances which can interact with the protein-protein complex described above. Such peptide-like as well as chemical interactors are therefore referred to in the sense of the present invention as functional interactors which can have an inhibiting or a stimulating effect.

Another possible application of the polypeptide according to the invention is the poly (A) -specific degradation of nucleic acids, in particular of mRNA. The poly (A) -specific degradation of nucleic acids can be used in particular in research laboratories.

The following figures and examples are intended to explain the invention in more detail without restricting it.

Description of the figures and the most important sequences

SEQ 11 shows the amino acid sequence of the human DAN with domains for Exo (ADFFAIDGEFSGIS), Exo II LVIGHNMLLDVMHTVH) and Exo III (SEQLHEAGYDAYITGLC). SEQ 12 shows the nucleic acid sequence of the human DAN including start (pos. 58) and stop codon (pos. 1977) with subsequent 3'UTR.

Fig. 1 shows the elution profile of the human DAN on MonoQ (Fig. 3A) and SDS-PAGEs (Fig. 1 B and 1 C)

FIG. 2 shows a Western blot of recombinant human DAN and native bovine DAN. FIG. 3 shows the deadenylation of mRNA, the accumulation of deadenylated RNA and the influence of PABI. FIG. 4 shows a comparison of known nucleases with the human DAN according to the invention .

Examples

1. Identification of human DAN cDNA clones

The purification of bovine DAN was carried out as described in Körner, G. & Wahl, E. (1997), supra, as follows:

All cleaning steps were carried out at 4 ° C. Between the cleaning steps, the samples were frozen in liquid nitrogen and frozen at -80 ° C. The following basic buffer was used: 50 mM Tris / HCl, 1 mM EDTA, 10% (v / v) glycerol, 1 mM dithiothreitol, 0.4 μg / ml leupeptin hemisulfate, 0.7 μg / ml pepstatin, 0.5 mM phenylmethylsulfonyl fluoride, 0.02% (v / v) Nonidet P-40, pH 7.9. In the different cleaning steps, different concentrations of KCI were added to this basic buffer as described below.

Fresh calf thymus was obtained from a local slaughterhouse, transported on ice and stored at -80 ° C. One kg was thawed in 2 l of basic buffer with 50 mM KCI and homogenized in a Waring Blendar homogenizer first with a small, then with a medium and finally with the highest speed. The ho mogenisat was centrifuged at 16,000 xg for 1 h and the supernatant decanted through a wide-mesh gauze (Wahl, E., J. Biol. Chem., 266, 1991).

This extract from calf thymus was applied to a DEAE-Sepharose FF column (column volume 4 l) and with a salt gradient over 2.5 times the column volume of 50 to 600 mM KCI from the column at a flow rate of 3 l / h elu - iert. Active fractions were eluted from the column at a salt concentration between 75 and 200 mM KCI. The fractions were collected, combined, ammonium sulfate was added to a 30% saturated solution and the mixture was stirred on ice for 1.5 hours. After centrifugation (30 min, 10800 x g, applies to all centrifugation steps mentioned below), the supernatant was adjusted to 50% saturation with ammonium sulfate, stirred again on ice and centrifuged. The sediment was resuspended in 400 ml base buffer with 50 mM KCI and dialyzed against 2 x 4.5 l base buffer for 10 h and centrifuged again. A 1.4 I Sepharose-Blue column (7 x 36 cm) was equilibrated with basic buffer with 50 mM KCI and the dialyzed extract was applied to the column. The column was washed with 1.5 bed volumes of base buffer with 250 mM KCI and eluted with a bed volume of base buffer with 1 M KCI (flow rate 2 l / h).

The active fractions of two preparations, each of 1.2 kg calf thymus, were combined and precipitated with ammonium sulfate (60% saturation). After centrifugation, the sediment was taken up in 200 ml of base buffer with 50 mM KCI, dialyzed against 3 × 4 l of the same buffer for 12 h and applied in two portions to a heparin-Sepharose column (2.5 × 37 cm). The column was washed with 1.5 bed volumes of base buffer with 50 mM KCI and then eluted with 10 bed volumes in a gradient up to 500 mM KCI (flow rate: 145 ml / h). DAN activity eluted between 80 and 150 mM KCI. The active fractions were pooled and dialyzed against base buffer with 30 mM KCI for 4 h. The dialysate was centrifuged off and chromatographed in two portions on a MonoQ FPLC column (bed volume 8 ml). The column was washed with two bed volumes of basic buffer with 50 mM KCI and then with a gradient over 320 ml with an increasing salt concentration (final concentration: 500 mM KCI, Flow rate: 2.5 ml / h) eluted from the column. DAN activity eluted at approximately 160 mM KCI. The active fractions (40 ml) were combined and dialyzed for 4 h against 2 I base buffer with 30 mM KCI, centrifuged and applied to a further MonoQ column (1 ml bed volume, flow rate: 0.9 ml / h). The DAN activity bound to the column was eluted with basic buffer with 500 mM KCI and applied in four portions to a Superdex HR 10/30 FPLC column (equilibrated with basic buffer with 300 mM KCI, flow rate: 0.15 ml / h) (granules , Ch. G. & Wahl, E. (1997), supra)

Different fractions of a Superdex column containing the DAN activity were collected and separated on a phenyl-Superose column (Körner, G. & Wahl, E. (1997), supra). The active fractions were pooled and buffered (50 mM Tris HCl, pH 7.9, 1 mM EDTA, 10% (v / v) glycerol, 1 mM dithiothreitol, 0.4 ug / ml leupeptin hemisulfate, 0.7 ug / ml pepstatin, 0.5 mM phenylmethylsulfonate (PMSF), 0.02% (v / v) nonidet p-40, 50 mM KCI) dialyzed. After centrifugation, the dialysate was applied to a 100 μl Smart MonoQ (PC 1.6 / 5) column. It was then washed with 200 μl buffer. The bound proteins were eluted in a gradient with an increasing salt concentration (final concentration 500 mM KCI) over a volume of 40 column bed volumes. The fractions that were positive for DAN activity eluted at a KCI concentration of approximately 200 mM KCI. The two fractions with the highest DAN activity were analyzed by SDS-polyacrylamide gel electrophoresis. This was followed by in situ hydrolysis by the protease Lys-C, separation by HPLC and sequencing of the peptides. The following sequences were found: 1. KSFNFYVFPK,

2. KPFNRSSPD (V / K) K,

3. KYAESYWIQTYADYVG as well

4. a mixture of: KEQEELNDA and KLFLMRVMD.

The N-terminal sequence of the purified bovine DAN could not be determined. Subsequently, EST (expressed sequence tags) database searches were carried out using the BLAST program (NCBI). The following clones were identified:

IMAGE. -Consortium clone ID 645295 by peptides 1 and 2 and I.MAG.E.-consortium clone ID 301901 by peptide 3.

The complete cloning of the clones found was carried out on an ABI373A sequencer with the ABI Dye Terminator Cycle SequencingKit.

It was found that the IMAGE consortium clone ID 301901 codes for the 176 C-terminal amino acids of DAN and the entire 3 ^' UTR, while IMAGE consortium clone ID 645295 codes the entire ORF and the 5 ^' UTR and part of the 3rd ^' -UTR encodes, which corresponds to a protein of 639 amino acids with a molecular mass of 73.5 kDa (SEQ 11). The 57 nucleotides upstream of the first AUG codon do not contain a stop codon in the reading frame. The sequences surrounding this AUG codon (AGAAUGG) correspond to the so-called Kozak rules (Kozak, 1991), which describe preferred start sequences for the translation start. A 3 ^' UTR of 0.7 kB is found in cDNA clone 645 295 and a poly (A) tail is found at the end of cDNA clone 301901. The poly (A) tail is preceded by the rare polyadenylation signal AUUAAA upstream. (SEQ 12)

2. Production of expression vectors

The plasmid pGMMCS was constructed in the following way:

The T7 expression vector pGM10 (Martin, 1996), which contained the PABII cDNA sequence (Nemeth, 1996) with an N-terminal Met-Ala-His6 tag, was digested with Xho I and BamH I and the fragment which corresponds to the 3rd ^' Part of the PAB II was replaced by an Xho I / BamH I fragment from the multiple cloning site from the pBluescript KS (+/-) plasmid. The resulting plasmid contains a sequence controlled by the T7 promoter, which begins with Met-AlaHis ₆ and through the 5 ^' part of PAB II and a multi cloning site is followed. An Nde I interface lies between the Hise Tag and the PAB II sequence and can be used together with the Multi Cloning Site to replace the remaining PAB II sequence with any coding sequence. The plasmid pGMMCS301901 was prepared in the following way:

Part of the sequence of the human DAN clone, which contained the 176 C-terminal amino acids, was amplified by means of PCR from clone 301901 with the following conditions: 15 cycles: 45 s at 94 ° C., 45 s at 54 ° C. and 3.5 min at 72 ° C. Pfu polymerase and the primers Nde 1301901: CCATATCCATATGCTTTTCAGTGCCTTTCCTAAC and Xho l 301901: AGTACTCGAGTTACAATGTGTCAGG. After digestion with Nde I and Xho I, the resulting cDNA fragments were purified with the Qia-Ex kit (Qiagen GmbH, Hilden) and integrated into the pGMMCS vector digested with Nde I and Xho I. The sequence was confirmed using sequencing.

The plasmid pGMMCS645295 was prepared as follows:

The coding sequence of the human DAN clone was amplified by means of PCR from clone 645295 under the following conditions:

20 cycles: 45 s at 94 ° C, 45 s at 54 ° C and 3.5 min at 72 ° C. Pfu polymerase and the primers Nde 1645295: AGTGTCGCATATGGAGATAATCAGGAGCA and Xho I 645295: AGTACTCAGCGGTTTGCTGCCCTCA. The resulting product was cloned into the vector pCR2.1 using the TA cloning kit (InVitrogen ®). After digestion with Nde I and Xho I, the resulting cDNA fragments were purified with the Qia-Ex-Kit (Qiagen) and integrated into the pGMMCS vector digested with Nde I and Xho I. The major part of the sequence generated by PCR was then removed using a digestion with Dra III and BstE II and replaced by the corresponding fragment of the original clone. The new sequence was confirmed using sequencing. 3. Production of antibodies

Antibodies against the C-terminal part of human DAN were produced as follows: The plasmid pGMMCS301901 was transformed into BL21 (pLysC). The cells were incubated at 37 ° C. in SOB medium with 200 μg / ml carbenicellin up to an OD600 of 1.9. Then 200 μM isopropyl-β-D-thiogalactoside was added and incubated for a further 5 h. The cells were harvested and taken up in buffer A (100 mM NaH ₂ PO ₄ , 10 mM Tris, 8M urea, pH 7.9). The cells were lysed with ultrasound, the lysate centrifuged and incubated with 3 ml of Ni-NTA column material for 2 h at room temperature. The column material was packed into a column and washed with 70 ml of buffer A, pH 6.3. The mixture was then washed with 15 ml of buffer B (300 mM NaCl, 10% (v / v) Glyceπn, 50 mM Tris, 0.01% (v / v) Nonidet-P40, 8M urea, pH 7.9). The protein was refolded on the column by reducing the urea content with two gradients (45 ml / h, gradient 1: buffer B from 8 to 4 M urea at room temperature, gradient 2: from 4 to 0 M urea at 4 ° C.) . the protein was eluted from the column with Buffer B containing 500 mM imidazoles, dialyzed against Buffer B without urea and used to immunize rabbits.

The affinity purification of anti-DAN antibody was carried out as follows: The C-terminal DAN fragment was coupled to an NHS-activated HiTrap column (1 ml volume, Pharmacia, Freiburg) according to the manufacturer's instructions. 3 ml of serum were applied to the column and eluted according to the manufacturer's instructions. 300 μg / ml BSA and 0.02% (w / v) NaN ₃ were added to the fractions and the buffer was exchanged by dialysis.

4. Expression and purification of human DAN

Human DAN was expressed in E. coli as a fusion protein with an N-terminal His tag (Met-Ala-His ₆ tag) as follows: The plasmid pGMMCS645295 was transformed into BL21 (pLysC). The cells were grown in 50 ml LB medium with 100 μg / ml carbenicellin and 24 μg / ml chloramphenicol at 37 ° C. and then transferred to a 500 ml culture without chloramphenicol and incubated further at 33 ° C. After an OD600 of 1.3 was reached, 100 μM isopropyl-β-D-thiogalactoside was added and the culture was incubated for a further hour. The cells were harvested and in buffer A (50 mM Tris, 300 mM KCI, 0.1 mM MgAc, 1 mM β-mercaptoethanol, 0.4 μg / ml leupeptin, 0.7 mg / ml pepstatin, 0.5 mM PMSF , pH 7.9). The cells were lysed with ultrasound, the lysate centrifuged and incubated with 2 ml of Ni ²⁺ -NTA column material for 2 h at 4 ° C. The column material was packed into a column and with 25 ml of buffer A and then with 20 ml of buffer B (buffer A and 10% (v / v) glycerol, 0.02% (v / v) nonidet-P40, without magnesium, pH 6.3) washed. The protein was then eluted with 5 ml of buffer C (buffer B with 500 mM imidazole). This was followed by dialysis against buffer D (50 mM Tris, 20 mM KCI, 1 mM EDTA, 5 mM PMSF, 10% (v / v) glycerol, 0.02 (v / v) Nonidet-P40, pH 7.9). . The preparation was centrifuged and applied to a MonoQ column (1 ml bed volume). The column was then washed with 5 bed volumes of buffer with 50 mM KCI and the column eluted with a gradient over 40 bed volumes with a final concentration of 500 mM KCI. DAN activity eluted in a sharp peak at approximately 190 mM KCI (Fig. 1A).

The purification led to an almost homogeneous preparation of a protein with the expected molecular mass (Fig. 1 B and 1 C). The protein has a poly (A) -specific 3'-exoribonuclease activity (see Example 6). It follows that the cDNA clone found codes for a human DAN.

5. Northem blot analysis

RNA was extracted from HeLa cells by a method from Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162, 156 isolated. Poly (A) mRNA was analyzed with the aid of oligo (dT) cellulose according to a method by Sambrook, J. et al. (1989) Molecular Cloning. A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. The resulting RNA was separated on a 1% agarose formaldehyde gel, transferred to a Hybond N + membrane from Ameramam Buchler, Braunschweig, by capillary blot and by incubation at 80 ° C. for 2 hours on the Membrane fixed. The sequence coding for human DAN was amplified by PCR, labeled with α- ³² P-dATP by random priming and used as a probe. The hybridization was carried out as described (Ausubel) and the membrane was washed with high stringency. Northern blot analysis with poly (A) ⁺ RNA from HeLa cells showed a single 3.1 kB fragment that hybridized with the DAN sample. This size agrees well with the size of the cDNA clone.

6. DAN activity test

The DAN activity assay was performed as described (Körner, Chr G. & Wahl, E. (1997), supra). SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out according to Laemmli, U.K. (1970) Nature 227, 680.

Like the bovine enzyme, the recombinant DAN is active under two different reaction conditions, depending on the neutralization of phosphate charges. In the absence of salt, activity is completely dependent on the presence of spermidine with an optimum concentration of 1 mM. Under these conditions, the specific activity of the recombinant DAN (79,000 U / mg) is not significantly different from the activity of purified bovine DAN (110,000 U / mg). In the presence of spermidine, the activity of DAN is inhibited by salt. In the absence of spermidine, the activity of the enzyme with an optimum concentration of 150 mM potassium acetate is dependent on salt. Bovine DAN behaves similarly under these conditions. However, the specific activity of the recombinant protein (960 U / mg) is lower under these conditions than that of the enzyme purified from calf thymus (8070 U / mg). This difference can be explained by a post-translational modification or by contaminating proteins in the preparation of the bovine enzyme. When a capped polyadenylated RNA was incubated with the DAN preparations in the presence of salt, the poly (A) tail was degraded and fully deadenylated RNA was temporarily accumulated (Fig. 3). If the assay was carried out in the presence of PABI, the activity was partially inhibited and gradual degradation of the poly (A) tail was observed. The predominant degradation products differed in length by approximately 30 nucleotides, which was apparently caused by the PABI binding. These results are in agreement with the tests for bovine protein (Körner Chr. & Wahl, E. (1997, supra). In summary, the results show that the recombinant protein is a poly (A) -specific 3 ^' exoribonuclease.

7. Western blot analyzes

Western blot analyzes were carried out as follows: The proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane using the Semidry method (Kyse-Andersen, 1984). The blots were incubated with TNT buffer (20 mM Tris-HCl, 150 mM NaCl, 0.05% (v / v) Tween 20, pH 7.5) with 5% (w / v) defatted dry milk. The same buffer was used for the antiserum incubation and washing steps. The blots were incubated with the antibodies for 2-3 h at room temperature and then washed. The bound antibodies were detected using a peroxidase-conjugated pig anti-rabbit antibody (DAKO, Glostrup, Denmark) and chemiluminescent staining (SuperSignal-Kit, Pierce).

The analyzes show that rabbit antibodies raised against a C-terminal fragment of DAN can precipitate DAN from partially purified fractions. The antibodies recognize both bovine and human DAN in the Western blot (FIG. 4). In this experiment, the recombinant DAN appears somewhat larger than the enzyme in SDS lysates from HeLa cells, which can be explained by the introduction of the tag (1004 Da) into the sequence. If the first AUG in the cDNA sequence were not the start codon used, the natural DAN from HeLa cells would have been at least 1260 Da larger than the tagged re- combined protein must be. These results also confirm the use of the first AUG sequence in the cDNA clone as the start codon in vivo.

Claims

claims

1. Nucleic acid coding for a human deadening nuclease (DAN) with an amino acid sequence according to SEQ 11 or a functional variant thereof, and parts thereof with at least 8 nucleotides, SEQ 11 being part of the claim.

2. Nucleic acid according to claim 1, characterized in that the nucleic acid is a DNA or RNA, preferably a double-stranded DNA.

3. Nucleic acid according to claim 1 or 2, characterized in that the nucleic acid is a DNA with a nucleic acid sequence according to SEQ 12 from position 58 to 1977, wherein SEQ 12 is part of the claim.

4. Nucleic acid according to claim 3, characterized in that the nucleic acid contains one or more non-coding sequences and / or a polyA sequence.

5. Nucleic acid according to one of claims 1-4, characterized in that the nucleic acid is contained in a vector, preferably in an expression vector or gene therapy vector.

6. A method for producing a nucleic acid according to any one of claims 1-4, characterized in that the nucleic acid is chemically synthesized or isolated from a gene bank using a probe.

7. Polypeptide with an amino acid sequence according to SEQ 11 or a functional variant thereof, and parts thereof with at least 6 amino acids.

8. A method for producing a polypeptide according to claim 7, characterized in that a nucleic acid according to one of claims 1-5 is expressed in a suitable host cell.

9. Antibody against a polypeptide according to claim 7.

10. A method for producing an antibody according to claim 9, characterized in that a mammal is immunized with a polypeptide according to claim 7 and the resulting antibodies are optionally isolated.

11. Medicament containing a nucleic acid according to any one of claims 1-5 or a polypeptide according to claim 7 and optionally pharmaceutically acceptable additives and / or auxiliaries.

12. Process for the manufacture of a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for influencing cell metabolism, in particular in immunosuppression, especially in transplantations, characterized in that a nucleic acid according to one of claims 1-5 or a polypeptide according to claim 7 or antibody according to claim 9 with a pharmaceutically acceptable additive. and / or auxiliary substance is formulated.

13. Diagnostic agent containing a nucleic acid according to any one of claims 1-5 or a polypeptide according to claim 7 or antibody according to claim 9 and optionally suitable additives and / or auxiliaries.

14. Process for the production of a diagnostic agent for the diagnosis of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermatitis, type I allergies or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for the analysis of cell metabolism, in particular the immune status, especially in the case of transplantations, characterized in that a nucleic acid according to one of claims 1-5 or a poly peptide according to claim 7 or antibody according to claim 9 with a pharmaceutically acceptable carrier.

15. Test for the identification of functional interactors containing a nucleic acid according to one of claims 1 -5 or a polypeptide according to claim 7 or antibody according to claim 9 and, if appropriate, suitable additives and / or auxiliaries.

16. Use of a nucleic acid according to any one of claims 1-5 or a polypeptide according to claim 7 for the identification of functional interactors.

17. Use of a nucleic acid according to any one of claims 1 -5 to find variants of human DAN, characterized in that a gene library is searched with the nucleic acid mentioned and the variant found is isolated.

18. Use of a polypeptide according to claim 7 for the poly (A) -specific degradation of nucleic acids, in particular of mRNA.