CZ20004136A3 - Human deadenylation nuclease, process of its preparation and its use - Google Patents

Abstract

The present invention relates to a nucleic acid encoding a human deadenylation nuclease having an amino acid sequence corresponding to SEQ 11 or one of its functional variants or portions thereof containing at least 8 nucleotides. Next up concerns the methods of their manufacture and pharmaceuticals and the diagnosis of these substances containing. It also relates to the use of said substances.

Description

Technical field

The present invention relates to human deadenylation nuclease (DAN), to its encoding nucleic acids, as well as to a process for its preparation and use.

BACKGROUND OF THE INVENTION

The intracellular concentration of mRNA is probably controlled not only by its rate of production but also by its degradation rate. In doing so, the mRNAs are apparently not degraded by some random nucleolytic reaction, but by specific mechanisms and at degradation rates that are specific to the RNA in question. Currently, two degradation methods are known in which the (A) -terminals of the molecules have a decisive role. In E. coli, the (A) -terminals of the molecules are bound to mRNAs or mRNA-fragments generated by RNAse E action. The (A) -terminals of the molecule appear to function as a relatively unstructured unit to form a complex that contains, among other proteins, a processive 3'-exonuclease represented by polynucleotide phosphorylase, and which contains RNA-dependent ATPase, which helps exonuclease overcome inhibitory secondary structures in mRNA. A similar mechanism seems to work in chloroplasts.

In eukaryotes, exonucleolytic truncation at the (A) ends of the molecules also leads to the degradation of many, but not all, mRNAs. In contrast to this process, which takes place in bacteria, apparently the (A) - degrading exonuclease does not continue to break down 3'-UTR and coding sequences.

-2 • ·· · · ···

Instead, apparently the eukaryotic exonuclease ceases to function after the (A) -terminal breakdown of the molecules. In S. cerevisiae, the second mRNA degradation step involves the removal of the 5'-Cap-structure by treatment with a specific pyrophosphatase. However, the removal of CAP occurs only after the (A) -termination has been shortened to about 10 to 15 nucleotides. By removing the CAP-structure, access to the 5'-exonuclease mRNAs whose most important representative is encoded by the XRN1 gene is released.

Monitoring of the initial deadenylation process in mammalian cells is relatively simple, while monitoring of subsequent steps is difficult due to the rate of subsequent degradation processes and due to the lack of analyzable intermediates. However, indirect evidence suggests that the removal of the CAP structure occurs in the second step. One XRN1 gene homologue has been described in mice. Stable mRNAs are generally deadenylated slowly and unstable mRNAs are deadenylated rapidly. The rate of degradation depends on the presence of certain destabilizing sequences in the 3'-UTR or coding sequence. Mutations in these sequences lead not only to stabilization of mRNA, but also to slowing of deadenylation. In contrast, inactivation of the stabilizing element α-globulin-mRNA leads to instability and accelerated deadenylation. These data clearly indicate that mRNA degradation is regulated by the rate of deadenylation.

Deadenylation of some mRNAs can also lead to inactivation of translation. This can be explained by the importance of the (A) -terminals for translation initiation. Deadenylation as a translational control mechanism plays a decisive role in oocyte maturation and early embryonegesis in many animal species. For example, in Drosophila, the hunchback mRNA regulates the polarity of the embryo.

In vertebrates, three deadenylation reactions can be distinguished essentially by oocyte maturation and early embryogenesis:

1. In immature oocytes, most mRNAs are stored in translational-inactive form with short (A) -terminal strands. An example is the tissue plasminogen activator mRNA in mice. Initially, this mRNA acquires the long poles of the (A) -terminal chain in the normal polyadenylation reaction, and this end is then truncated to the oligo (A) -terminus when deadenylated. This truncation is controlled by 3'-UTR sequences.

2. Oocyte maturation undergoes deadenylation leading to inactivation of those mRNAs that originally had long (A) -terminal poles and were active in the early stages of egg development. This deadenylation is not dependent on specific sequences in the mRNA. All mRNAs are deadenlated except those protected by an active adenylation process.

3. During early embryogenesis, certain mRNAs are deadenylated in a specific reaction that also requires specific 3'-UTR sequences.

All three deadenylation reactions take place in the cytoplasm. However, unlike somatic cells, these oligoadenylated or deadenylated mRNAs remain stable in oocytes and are only re-adenylated or degraded at later developmental stages.

The enzymes controlling these reactions have not yet been fully identified. The degradation of poly (A) - in yeast has been shown to be directly or indirectly dependent on the (A) - binding protein (ΡΑΒΙ). Although the PAB1-dependent Poles (A) nuclease (PAN) has been purified (Sachs A.B. and Deardoff (1992) Cell, 70,

-4 ··· ·· ·· · · · ·

961; Lovell, J.E. et al. (1992) Genes Dev., 6, 2088), only minor defects in deadenylation were found in mutants of the respective genes (PAN2 and PAN3) (Boeck, R. et al. (1996) 271 (1), 432; Brovn, C. (1996) 16 (10) 5744).

Korner Ch.G. and Vahle, E. (1997) J.Biol.Chem., 272,

10448, No.16 described poles of (A) -specific 3´-exoribonuclease o »from calf thymus dependent Mg with a molecular weight of 74 kDa, also referred to as deadenylation nuclease (DAN). The described calf thymus DAN was stimulated by cytoplasmic poles (A) -binding protein I (PAB I) under certain reaction conditions (Korner, Chr. And Vahle, E. (1997), supra) and was used as a Poly (A) substrate .

SUMMARY OF THE INVENTION

It was an object of the present invention to prepare human (A) -specific 3'-exoribonuclease poles.

Surprisingly, no more closely characterized and sequenced clone that encodes human deadenylation nuclease (human DAN) according to the invention has been found in the gene bank.

Accordingly, the present invention provides a nucleic acid encoding human DAN having the amino acid sequence of SEQ 11 or a functional variant thereof and portions thereof with at least 8 nucleotides, preferably with at least 15 or 20 nucleotides, especially with at least 100 nucleotides, and particularly preferably with at least 300 nucleotides. reported as a nucleic acid of the invention).

This complete nucleic acid encodes a 639 amino acid protein with a molecular weight of 73.5 kDa. Expression of this nucleic acid in E. coli resulted in a protein that exhibited similar enzymatic activities to DAN described by Korner, Chr. and Vahle, E. (1997, supra). Further experiments carried out according to the present invention have confirmed that the nucleic acid is a nucleic acid that encodes human DAN. The nucleic acid of the present invention was deposited on March 25, 1998 in the German Collection of Microorganisms and Cell Cultures DSMZ - Deutsche Sammlung von Microorganismen und Zellkulturen GmbH, Mascheroder Veg 1b, 38124 Braunschweig, under number DSM 12075.

A preferred embodiment of the invention is a nucleic acid of the invention which is DNA or RNA, preferably double stranded DNA, especially DNA having the nucleic acid sequence of SEQ 12 at position 58 through position 1977. Both positions indicate the beginning and end of the coding region.

The term functional variant of the present invention refers to a nucleic acid that is functionally used with a human DAN-encoding nucleic acid and is particularly of human origin. Examples of nucleic acids used include nucleic acids from various human cells and cells. tissues or allelic variants. The present invention also encompasses nucleic acid variants that can be derived from a variety of human individuals.

In another aspect, variants of the invention are nucleic acids having homology, in particular sequence identity of at least about 60%, preferably about 75%, especially about 90%, and especially about 95%.

For example, the nucleic acid portions of the invention can be used to obtain individual epitopes, as probes to identify other functional variants, or as antisense nucleic acids. For example, a nucleic acid of at least about 8 nucleotides is suitable as an antisense nucleic acid, a nucleic acid of at least about 15 nucleotides is suitable as a primer in a PCR procedure, a nucleic acid of at least about 20 nucleotides is suitable for identifying additional variants and a nucleic acid consisting of at least about 100 nucleotides is suitable as a probe.

In another preferred embodiment, the nucleic acid of the invention comprises one or more non-coding sequences and / or one (A) -pole sequence. Non-coding sequences are, for example, intron or regulatory sequences, such as promoter or enhancer sequences, to direct expression of a gene encoded by human DAN.

In another embodiment, the nucleic acid of the invention is contained in a vector, preferably an expression vector or a gene-therapeutically effective vector.

Such expression vectors may be, for example, prokaryotic or eukaryotic expression vectors. Examples of prokaryotic expression vectors for expression in E.coli are, for example, the T7 expression vector pGMIO (Martin, 1966) encoding the expression of the N-terminal Met-Ala-His6-Tag, which allows for advantageous purification of the expressed protein through the Ni -NTA column. Suitable eukoaryotic expression vectors for expression in Saccharomyces cerevisiae are, for example, the vectors p426Met25 or p426GAL1 (Mumberg et al. (1994) Nucl. Acids)

Res., 22, 5767), for expression in insect cells, for example, the Baculovirus vectors disclosed in EP-B1-0127839 or EP-B1-0549721 may be used, and for expression in mammalian cells, for example, the SV40 vectors may be used. are generally available.

Expression vectors generally contain regulatory sequences suitable for the host cell, such as the E.coli expression promoter (see, eg, EP-B1-0154133), the ADH-2-yeast expression promoter (Russel et al. (1983) 258, 2674), a baculovirus-polyhedrin promoter for expression in insect cells (see, eg, EP-B10127839) or an early (fruh) SV40 promoter or LTR promoters, eg from MMTV (Mammary Tumor Virus / virus) mouse mammary gland tumor / Lee et al (1981)

Nature, 214, 228).

Examples of gene-therapeutically effective vectors are virusvectors, particularly adenovirusvectors, in particular replication-deficient adenovirusvectors or adeno-associated virusvectors, e.g., an adeno-associated virusvector, consisting exclusively of two inserted terminal repeat sequences (ITRs).

Suitable adenoviral vectors are described, for example, in McGrory, V.J. et al. (1988) Virol. 163, 614; Gluzman,

Y. et al. (1982) in Eukaryotic Viral Vectors (Gluzman, Y. ed.), 187 Cold Spring Harbor Press, Cold Spring Harbor, New York; Chroboczek, J. et al. (1992)

Virol. 186, 280; Karlsson, S. et al. (1986) EMBO J. 5,

2377 or WO95 / 00655.

Suitable adeno-associated virus vectors are described, for example, in Muzyczka, N. (1992) Curr.Top. Microbiol.

Immunol. 158, 97; WO95 / 23867; Samulski, R.J. (1989) J.

Virol. 63, 3822; WO95 / 23867; Chiorini, J.A. et al. (1995) Human Gene Therapy 6, 1531 or Kotin, R.M. (1994) Human Gene Therapy 5,793.

Gene-therapeutically effective vectors may also be obtained by complexing the nucleic acid of the invention with liposomes. Liposome mixtures described by Felgner, P.L. et al. (1987) Proc. Nati. Acad. Sci. USA 84, 7413; Behr, J.P. et al. (1989) Proc. Nati. Acad. Sci. USA 86, 6982; Felgner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 or Gao, X. and Huang, L. (1991) Biochim. Biophys. Acta 1189, 195. In this preparation of liposomes, DNA binds ionically to the surface of the liposomes in such a proportion that the resulting net charge remains on the surface (Nettoladung) and that the liposomes completely bind the DNA to the complex.

Nucleic acids of the invention can be synthesized, e.g., chemically using the sequence contained in SEQ12 or the peptide sequence contained in SEQ11 using the genetic code, eg, according to the phosphotriester method (see, eg, Uhlman, E. and Peyman, A. (1990) Chemical Reviews 90, 543, No. 4). Another possibility for obtaining the nucleic acid of the invention is isolation from a suitable gene bank, e.g. from a human gene bank using a suitable probe (see, eg, Sambrook, J. et al. (1989) Molecular Cloning. A laboratory Manual. 2 ^nt ). Edition, Cold Spring Harbor, New York). Suitable probes are, for example, single-stranded DNA fragments of about 200 to 500 nucleotides in length, in particular about 300 to 400 nucleotides in length, the sequences of which can be derived from the nucleic acid sequence of SEQ 12.

Another object of the present invention is polypep-9-

a peptide having the amino acid sequence of SEQ 11 or a functional variant thereof, and portions thereof with at least six amino acids, preferably at least 12 amino acids, especially at least 65 amino acids, and especially 638 amino acids (hereinafter referred to as the polypeptide of the invention). For example, an epitope comprising a polypeptide of about 6-12, preferably about 8 amino acids, can be obtained, which, after coupling with a carrier, can be used to produce specific pole or monoclonal antibodies (see, eg, US 5,656,435). Polypeptides of at least 65 amino acids in length can be used directly to prepare poly- or monoclonal antibodies without carrier.

The term functional variant within the meaning of the present invention is understood to mean polypeptides having a similar function to the peptide of the present invention, i.e., having the (A) -specific 3'-exoribonuclease activity and being particularly active under dual reaction conditions. In the first reaction conditions, in the absence of salt, activity is entirely dependent on the presence of spermidine. In the absence of spermidine, the activity of this enzyme is dependent on salt concentration. In addition, in the presence of ΡΑΒΙ, gradual degradation of the (A) -terminal chain was observed under certain reaction conditions (see also Korner, Chr.G. and Vahle, E. (1997), supra). The degradation products differ mainly in their length by about 30 nucleotides. By variants are meant allelic variants or polypeptides derived from other human cells or cells. weaving. Polypeptides derived from different human subjects are also understood.

In another sense, it is also meant polypeptides having sequence homology, particularly about 70% sequence identity, preferably about 80%, especially about 90%, and especially about 95%, with the polypeptide having the amino acid sequence of SEQ 11.

Also included are deletions of the polypeptide in the 1-60 region, preferably about 1-30, especially about 1-15, and especially about 1-5 amino acids. For example, the first amino acid methionine may be absent without substantially altering the function of the polypeptide. In addition, fusion proteins comprising the aforementioned polypeptides of the present invention are included, wherein the fusion proteins as such already contain the function of human DAN or do not acquire this specific function until the fusion portion has been cleaved. In particular, fusion proteins having a proportion of in particular non-human sequences consisting of about 1 to 200, preferably about 1 to 150, especially about 1 to 100, and especially about 1 to 50 amino acids are included. Examples of non-human peptide sequences include prokaryotic peptide sequences, e.g., from galactosidase from E. coli or the so-called Histidine-Tag, e.g., Met-Ala-His-Tag. A fusion protein comprising a so-called Histidine-Tag is particularly suitable for purifying the expressed protein through metal ion columns, e.g., a Ni -NTA column. NTA is a complexing agent which is nitrilotriacetic acid (Qiagen GmbH, Hilden).

For example, portions of the polypeptide of the invention are epitopes that can be specifically recognized by antibodies.

Compared to known nucleases, the polypeptide of the invention has been found to belong to the so-called RNaseD-Familie family. Figure 4 shows the conserved amino acids in the EXO I, Exo II and EXO III motifs that are characteristic of this class of exonucleases. The other bound amino acids are shown on a gray background. Three acidic amino acid side chains, two in the exo I-domain and one in the exo III-domain directly bind two Mg?

Ions involved in enzymatic hydrolysis. The third acidic side amino acid chain located in the exo II domain binds one of these metal ions via a water bridge molecule (Vasserbrückenmolekule). All of these amino acid residues are highly conserved within this family (Familia) and have been found in the human DAN of the invention. The polypeptide of the invention may therefore be termed the (A) -specific 3´-exoribonuclease of the RNase D-Familie family.

A polypeptide of the invention was prepared, for example, by expressing a nucleic acid of the invention in a suitable expression system as previously described using methods well known to those skilled in the art. Suitable host cells were, for example, E. coli DH5, HB101 or BL21 strains, the Saccharomyces cerevisiae yeast strain, Lepidopteran insect cell lines, e.g. from Spodoptera Frugiperda, or animal cells such as COS, Vero, 293 and HeLa, which are commonly used. gain.

In particular, said portions of the polypeptide can also be obtained by classical peptide synthesis (Merrifield technique). They are particularly suitable for obtaining antisera through which suitable gene-expression banks can be screened for other functional variants of the polypeptide of the invention.

Another aspect of the invention relates to a process for preparing a polypeptide of the invention, wherein the nucleic acid of the invention is expressed in a suitable host cell and optionally isolated.

A further object of the present invention also relates to counter-

compounds that specifically react with the polypeptide of the invention, wherein the above portions of the polypeptide are either immunogenic themselves or can be immunogenized by binding to a suitable carrier, such as bovine serum albumin, respectively. their immunogenicity can be increased.

The antibodies are either polyclonal or monoclonal. Their preparation, which is also an object of the invention, is carried out, for example, according to well-known methods of immunizing mammals, e.g. rabbits, with a polypeptide of the invention or portions thereof, optionally in the presence of e.g. Freund's adjuvant and / or aluminum hydroxide gels. Diamond, BA et al (1981) The New England Journal of Medicine, 1344). Finally, polyclonal antibodies produced in animals by an immunological reaction can be readily isolated from the blood and purified, for example by column chromatography, by known methods. Preferred is affinity purification of antibodies in which, for example, the C-terminal DAN fragment binds to an NHS-activated HiTrap column.

Monoclonal antibodies can be prepared, for example, by known methods of Vinter and Milstein (Vinter, G. and Milstein, C. (1991) Nature, 349, 293).

A further object of the invention is also a medicament comprising a nucleic acid according to the invention or a polypeptide according to the invention and optionally suitable additives or adjuvants, as well as a process for the preparation of such a medicament for the treatment of cancer, autoimmune diseases, in particular for the treatment of multiple sclerosis or rheumatoid arthritis. Alzheimer's disease, allergies, especially neurodermitis, type I or type IV allergies, arthroses, atherosclerosis, osteoporosis, acute and chronic

infectious diseases and / or diabetes and / or for influencing cellular metabolism, particularly in immunosuppression, especially transplants, wherein the nucleic acid of the invention, e.g., an antisense nucleic acid or polypeptide of the invention, is combined with pharmaceutically acceptable excipients or adjuvants substances.

In particular, for gene-therapeutic use in humans, a medicament comprising the nucleic acid of the invention as such (in bare form) or in the form of one of the aforementioned gene-therapeutically effective vectors or in the form of complexes with liposomes is suitable.

Suitable additives or excipients are, for example, saline, stabilizers, proteinase inhibitors, nuclease inhibitors, etc.

The present invention also provides a diagnostic composition comprising a nucleic acid of the invention, a polypeptide of the invention or an antibody of the invention, and optionally suitable additives and adjuvants, as well as a process for preparing the diagnostic composition for diagnosing cancer, autoimmune diseases, particularly multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermitis, type I or type IV allergies, arthrosis, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes, and / or for analysis of cellular metabolism, particularly immune status, particularly in transplants, suitable additives and / or excipients are added to the nucleic acid of the invention, the polypeptide of the invention, or the antibodies of the invention.

For example, according to the present invention, using a nucleic acid according to the present invention, the reagents can be prepared based on polymerase chain reaction (PCR diagnostics, eg according to EP-0200362) or Northern Blot analysis as described in Example 5 These assays are based on specific hybridization of the nucleic acid of the invention with a complementary strand corresponding to the respective mRNA. The nucleic acid according to the invention can be modified, for example, according to the method of EP 0 063 879. Preferably, the DNA fragment according to the invention is labeled with suitable reagents, eg radioactive substances and eg, α-β-dATP or non-radioactive substances such as biotin, according to well-known methods, and incubated with isolated RNA, preferably bound to suitable membranes, eg of cellulose or nylon. In this case, it is advantageous to separate the isolated RNA by size, for example by agarose gel electrophoresis, before hybridization and membrane binding.

Thus, with the same amount of RNA of interest from each tissue sample, the amount of mRNA specifically labeled by the probe can be determined.

For further diagnosis, the polypeptide of the invention and the invention comprise, respectively. immunogenic portions thereof. This polypeptide, respectively. portions thereof, preferably bound to a solid phase, such as nitrocellulose or nylon, may be contacted in vitro with the body fluid of interest, such as blood, for example, to react with autoimmune antibodies. The antibody-peptide complex can then be detected using, for example, labeled antihuman-IgG- or antihuman-IgM-antibodies. This labeling is, for example, an enzyme such as peroxidase, which catalyses the color reaction. Thus, the presence and amount of autoimmune antibodies can be easily and quickly detected using *.

- 15 color reactions.

Other diagnostics include the antibodies of the invention as such. With these antibodies, it is possible, for example, to quickly and easily determine in a human tissue sample whether it contains a particular polypeptide. In this case, the antibodies of the invention are labeled with, for example, an enzyme as described previously. Thus, the specific antibody-peptide complex can be detected easily and rapidly by an enzymatic color reaction.

Another aspect of the invention also relates to an assay for identifying functional interactions, such as inhibitors or stimulators comprising a nucleic acid of the invention, a polypeptide of the invention, or an antibody of the invention, and optionally suitable additives and / or excipients.

A suitable test for identifying functional identifiers is, for example, the so-called Two-Hybrid System (Fields, S. and Sternglanz, R. (1994) Trends in Genetics, 10, 286). In this assay, a cell, e.g., a yeast cell, is transformed (transformer o. Transfiziert) with one or more expression vectors expressing a fusion protein comprising a protein of the invention and a DNA-binding domain of a known protein, e.g. Gal4 or LexA of E. coli and / or expressing a fusion protein comprising an unknown polypeptide and a transcriptional-activation domain comprising, e.g., Gal4, herpesvirus VP16 or B42. In addition, the cell contains a reportergen, e.g., the LacZ gene from E. coli, the Green fluorescence protein or the amino acid biosynthesis gene (Aminosaure-Biosynthesegen) from His3 or Leu2 yeast, which regulates the yeast via regulatory sequences such as e.g.

»·« «V • ·

- 16 lexA promoter / operator or so-called Upstream Activation Sequence (UAS). This unknown polypeptide is encoded, e.g., by a DNA fragment derived from a gene bank, e.g., a human gene bank. As a rule, a cDNA gene bank is also prepared using the described expression vectors in yeast, so that this assay can be performed immediately.

For example, in a yeast expression vector, a nucleic acid of the invention is cloned in a functional unit into a nucleic acid encoding a lexA-DNA-binding domain, such that a fusion protein of a polypeptide of the invention and a LexA-DNA-binding domain is expressed in transformed yeast. In another yeast expression vector, cDNA fragments were cloned from a cDNA gene bank in a functional unit to a nucleic acid encoding a Gal4 transcriptional activation domain, such that a fusion protein from an unknown polypeptide and a Gal4 transcriptional activation domain was expressed in transformed yeast. Yeast, e.g., Leu2, transformed with both expression vectors, further comprises a nucleic acid that encodes Leu2 and which is under the control of the LexA promoter / operator. In the case of a functional interaction between a polypeptide of the invention and an unknown polypeptide, the Gal4-transcriptional-activation domain binds via the LexA-DNA-binding domain to a LexA-promoter / operator that activates and expresses the Leu2 gene. As a result, Leu2-yeasts can grow on minimal medium containing no leucine.

When using LacZ- resp. Green Fluorescence of the Protein Reporter gene instead of the amino acid biosynthesis gene can be demonstrated by the activation of transcription by the formation of blue resp. green fluorescing colonies. Blue respectively. fluorescence staining can be easily detected by spectrometry

- 17např. in the case of blue at 585 nm.

In this way, expression gene banks can be readily and rapidly examined for the presence of polypeptides that react with the polypeptide of the invention. Finally, the novel polypeptides found can be isolated and further characterized.

Another possibility of using the Two-Hybrid-System is to influence the interaction between a polypeptide of the invention and a known or unknown polypeptide by the action of other substances, eg, chemical compounds. In this way, valuable new chemically synthesizable active substances can also be easily identified and used as therapeutic agents. Therefore, the present invention is not limited to a process for screening for polypeptide interactions but also to a process for screening for substances that may react with the above protein-protein complex. Accordingly, such peptide and chemical interactions are, within the meaning of the present invention, referred to as functional interactions which may have an inhibitory or stimulating effect.

Another possibility of using the polypeptide of the invention is the (A) -specific degradation of nucleic acids, especially mRNA. Poles (A) -specific degradation of nucleic acids can be used especially in research laboratories.

The following figures and examples illustrate the invention in more detail without limiting it.

- 18Overview of figures in drawings

SEQ 11 depicts the amino acid sequence of human DAN with domains for Exo I (ADFFAIDGEFSGIS), Exo II (LVIGHNMLLDVMHTVH), and Exo III (SEQLHEAGYDAYITGLC).

SEQ 12 depicts the amino acid sequence of human DAN including start- (Pos.58) and stop-codon (Pos. 1977) with a consecutive 3 'UTR.

Giant. 1 shows the elution profile of human DAN on MonoQ (FIG. 3A) and SDS-PAGE (FIGS. IB and 1C).

Giant. 2 shows a Western Blot analysis of recombinant human DAN and native bovine DAN

Giant. 3 captures the deadenylation of mRNA, accumulation of deadenylated RNA, and the effect of ΡΑΒΙ

Giant. 4 shows a comparison of known nucleases with human

DAN according to the invention

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Identification of human DAN cDNA clones

Purification of bovine DAN was performed as described by Korner, G. and Vahle E. (1997), supra, as follows:

- 19All cleaning operations were performed at 4 ° C.

Between each purification operation, samples were frozen in liquid nitrogen and frozen at -80 ° C. The following base buffer was used: 50 mM Tris / HCl / mM EDTA, 10% (v / v) glycerin, 1 mM dithiothreitol, 0.4 µg / ml leupeptin hemisulphate, 0.7 µg / ml pepstatin, 0.5 mM phenylmethylsulfonylfluoride, 0, 02% (v / v) Nonidet P-40, pH 7.9. In various purification operations, different concentrations of KCl were added to this base buffer as described below.

Fresh veal thymus was collected from local slaughterhouses, transported on ice and stored at -80 ° C. 1 kg of thymus was thawed in 2 L of basic buffer with 50 mM KCl and homogenized in a Varing Blendar homogenizer at low, later at medium and finally at high speed. The obtained homogenate was centrifuged for 1 hour at 16,000 x g and the supernatant was decanted and poured over a wide-gauze gauze. (Vahle, E., J. Biol. Chem., 266, 1991).

This calf thymus extract was applied to a DEAE Sepharose FF column (4 L column volume) and eluted at a salt gradient of 50-600 mM KCl at 2.5 times the column volume at a flow rate of 3 L / hr. The active fractions were eluted from the column at a salt concentration between 75 and 200 mM KCl. These fractions were combined, purified, diluted with ammonium sulfate to 30% saturated solution and stirred for 1.5 hours on ice. After centrifugation (30 min, 10,800 x g, these conditions also apply to the following centrifugations), the supernatant was adjusted to 50% saturation with ammonium sulfate and stirred again on ice and centrifuged. The sediment was resuspended in 400 ml of basic buffer with 50 mM KCl

and dialyzed for 10 hours against 2 x 4.5 L of base buffer and centrifuged again. A 1.4 L Sepharose-Blue column (7 x 36 cm) was equilibrated with 50 mM KCl base buffer and the dialyzed extract was applied to the column. This column was washed with 1.5-fold column volume with 250 mM KCl and eluted with 1-fold column volume with 1 M KCl (flow rate 2 L / h).

The active fractions from the two preparations each of 1.2 kg of calf thymus were pooled and precipitated with ammonium sulfate (60% saturation). After centrifugation, the sediment was taken up in 200 ml of basic buffer with 50 mM KCl, dialyzed against 3x41 of the same buffer for 12 hours and loaded onto a column packed with Heparin-Sepharose (2.5 x 37 cm) in two portions. This column was washed with 1.5 times the column volume of 50 mM KCl and finally eluted ten times the column volume at a gradient of up to 500 mM KCl (flow rate: 145 ml / h). Active DAN was eluted between 80 and 150 mM KCl. The active fractions were pooled and dialyzed against base buffer with 30 mM KCl for 4 hours. The dialysate was centrifuged and chromatographed in two aliquots on a MonoQ FPLC column (8 ml fill volume). This column was washed with 2 times the 50 mM KCl base buffer and finally was eluted with a total volume of 320 mL at a gradient with increasing salt concentration (final concentration: 500 mM KCl, flow rate: 2.5 mL / h). DAN was eluted at ca. 160 mM KCl Active fractions (40 mL) were pooled and dialyzed against 2 L of 30 mM KCl for 4 hours, centrifuged and loaded onto another MonoQ packed column (1 mL packing volume, 0.9 flow rate) The column bound active DAN was eluted with 500 mM KCl base buffer and loaded in four aliquots onto a Superdex HR 10/30 FPLC column (equilibration with

base buffer with 300 mM KCl, flow rate: 0.15 ml / h) (Korner, Ch.G. and Vahle, E. (1997), supra).

Various fractions from the Superdex packed column that exhibited DAN activity were collected and separated on a Phenyl-Superose column (Korner, Ch.G. and Vahle, E. (1997), supra). The active fractions were collected and diylated against buffer (50 mM Tris-HCl, pH 7.9, 1 mM EDTA, 10% (v / v) glycerin, 1 mM dithiothreitol, 0.4 µg / ml leupeptin hemisulfate, 0.7 µg / ml pepstatin, 0.5 mM phenylmethylsulfonate (PMSF), 0.02% (v / v) Nonidet p-40, 50 mM KCl). After centrifugation, the obtained dialysate was loaded onto a 100 µSmart MonoQ column (PC 1.6 / 5). Finally, the column was washed with 200 μΐ of buffer. Bound proteins were eluted at a gradient with increasing salt concentration (final concentration of 500 mM KCl) with a total volume corresponding to 40 times the column volume. Fractions with positive DAN activity were eluted at a concentration of about 200 mM KCl. The two fractions with the highest DAN activity were analyzed by SDS-polyacrylamide gel electrophoresis. Finally, hydrolysis with Protease Lys-C was performed, separated by HPLC and peptide sequencing was performed. The following sequences were found:

1. KSFNFYVFPK,

2. KPFNRSSPD (V / K) K

3. KYAESYVIQTYADYVG and also

4. a mixture which consisted of KEQEELNDA and KLFLMRVMD.

The N-terminal sequence of purified bovine DAN was not possible

• · · · · determine.

Finally, the EST (expressed sequence tags) of the database was performed using the BLAST (NCBI) program to identify the following clones:

I.M.A.G.E.-Consortium clone ID 645295 using peptides 1 and 2 a

I.M.A.G.E.-Consortium clone ID 301901 using peptide 3.

Full sequence determination of the found clones was performed on an ABI373A-Sequenziergerate using the ABI Dye Terminator Cycle Sequencing Kit.

It was found that the IMAGE-Consortium clone ID 301901 encodes 176 C-terminal amino acids from DAN and the entire 3'-UTR, while the IMAGE-Consortium clone ID645295 encodes the entire ORF and 5'-UTR and the 3'-UTR portion corresponding to the protein with 639 amino acids having a molecular weight of 73.5 kDa (SEQ11). The 57 nucleotides that were downlinked (stromaufvárts) from the first AUG codon contained no stop codon in the raster (Leseraster). These sequences (AGAAUGG) surrounding this AUG-codon comply with the so-called Kozak rules (Kozak, 1991), which describe the start sequences preferred for translation start. The 0.7 kb 3'-UTR is found in cDNA-clone 645295 and the (A) -terminals of the molecule do not go at the end of clone 301901. The (A) -terminals of the molecule precede the uplink (stromaufwárts) rare polyadenylation signal AUUAAA (SEQ 12).

-23 Example 2

Preparation of expression vectors

Plasmid pGMMCS was constructed as follows:

The pGMIO expression vector (Martin, 1996), which contains the PABII cDNA sequence (Nemetli, 1996) with an N-terminal label (Tag) Met-Ala-His6-Tag was exposed to Xho I and BamH I and the fragment obtained containing 3 The PAB II part was replaced with the Xho I / BamH I fragment from the Multiple Cloning Site cloning site of the pBluescript KS (+/-) plasmid. The obtained plasmid contains a controlled sequence

The T7 promoter, which starts with Met-Ala-Hisg, followed by the 5´-part of the PAB II and Multi Cloning Site. The Nde I cleavage site lies between the His 1 -Tag and PAB II sequences and can be used together with the Multi Cloning Site to replace the remaining PAB II sequence with any coding sequence.

Plasmid pGMMCS 301901 was prepared as follows:

A portion of the human DAN-clone sequence containing 176 C-terminal amino acids was amplified using PCR from clone 301901 under the following conditions:

cycles: 45 sec at 94 ° C, 45 sec at 54 ° C and 3.5 min. at 72 ° C.

Pfu-polymerase and primers Nde I 301901:

CCATATCCATATGCTTTTCAGTGCCTTTCCTAAC and Xho I 301901:

AGTACTCGAGTTACAATGTGTCAGG. After treatment with Nda I and Xho I, the resulting cDNA fragments were purified using a Qia-Ex-Kit (Quiagen GmbH, Hilden) and integrated into the pGMMCS-vector t

• · ·

-24 treated with Nde I and Xho I. This sequence was confirmed by sequencing (Sequenzierung).

Plasmid pGMMCS645295 was prepared as follows:

The coding sequence of the human DAN-clone was amplified using PCR from clone 645295 under the following conditions:

cycles: 45 sec at 94 ° C, 45 sec at 54 ° C and 3.5 min. at 72 ° C.

Pfu-polymerase and primers Nde 1645295:

AGTGTCGCATATGGAGATAATCAGGAGCA and Xho I 645295:

AGTACTCAGCGGTTTGCTGCCCTCA. The resulting product was cloned in the pCR2.1 vector using the TA-Klonierungs-Kit (Invitrogen®). After treatment with Nde I and Xho I, the resulting cDNA fragments were purified using a Qia-Ex-Kit (Quiagen) and integrated into the pGMMCS-vector engineered with Nde I and Xho I. Finally, much of the PCR generated sequence was removed by treatment ( Verdau) using Dra III and BstE II and replaced with the corresponding fragment of the original clone. This new sequence was confirmed by sequencing.

Example 3

Preparation of antibodies

Antibodies against the C-terminal portion of human DAN were obtained as follows:

Plasmid pGMMCS 301901 was transformed into BL21 (pLysC).

Cells were incubated at 37 ° C in SOB-medium with 200 gg / ml

-25 of Carbenicellin up to OD600 of 1.9 (bis zu einer OD600 of 1.9). Finally, 200 μΜ of isopropyl-β-ϋ-thiogalactoside was added and incubated for an additional 5 hours. Cells were collected and transferred to buffer A (100 mM NaH ₂ PO ₄ , 10 mM Tris, 8 M urea, pH 7.9). Cell lysis was performed by ultrasound, the lysate was centrifuged and incubated for 2 h at room temperature with 3 ml of Ni-NTA-packed column. The packing was then loaded onto the column and washed with 70 ml of Buffer A, pH 6.3. Finally, the column was washed with 15 ml of buffer B (300 mM NaCl, 10% (v / v) glycerin, 50 mM Tris,

0.01% (v / v) Nonidet-P40, 8 M urea, pH 7.9). The protein remained retained on the column with the urea content reduced by two urea gradients (45 ml / h, gradient 1: buffer B from 8 to 4 M urea at room temperature, gradient 2: from 4 to 0 M urea at 4 ° C). The protein was eluted from the column with buffer B containing 500 mM imidazole, dialyzed against buffer B without urea and used to immunize rabbits.

The affinity purification of the anti-DAN antibody was performed as follows:

The C-terminal DAN fragment was coupled to an NHS-activated HiTrap column (1 ml volume, Pharmacia, Freiburg) according to the manufacturer's instructions. 3 ml of serum was added to the column and the column was washed according to the manufacturer's instructions. To the fractions obtained, 300 gg / ml BSA and 0.02% (w / v) NaN 2 were added and the buffer was exchanged by dialysis.

Example 4

Expression and purification of human DAN

Human DAN was expressed in E. coli as a fusion protein with an N-terminal His-Tag (Met-Ala-His-Tag) as follows:

Plasmid pGMMCS645295 was transformed into BL21 (pLysC). Cells were placed in 50 ml LB-medium with 100 µg / ml Carbenicellin and 24 gg / ml chloramphenicol at 37 ° C and then transferred to 500 ml of chloramphenicol-free culture and further incubated at 33 ° C. After reaching 0D600 of 1.3, 100 μΜ of isopropyl-β-ϋ-thiogalactoside was added and incubated for an additional hour. Cells were collected and transferred to buffer A (50 mM Tris, 300 mM KCl, 0.1 mM MgAc, 1 mM β-mercaptoethanol, 0.4 µg / ml leupeptin, 0.7 mg / ml pepstatin, 0.5 mM PMSF pH 7.9). Cell lysis was performed by ultrasound, the lysate was centrifuged and incubated for 2 h at 4 ° C.

with 2 ml of Ni -NTA column packing. The packing was then loaded onto the column and washed with 25 ml of buffer A and then the column was washed with 20 ml of buffer B (buffer A and 10% (v / v) glycerin, 0.02% (v / v) Nonidet-P40, magnesium free, pH 6,3). Finally, the protein was eluted with 5 ml of buffer C (buffer B with 500 mM imidazole). This was followed by dialysis against buffer D (50 mM Tris, 20 mM KCl, 1 mM EDTA, 5 ml PMSF, 10% (v / v) glycerin, 0.02 (v / v) Nonidet-P40, pH 7.9). This preparation was centrifuged and loaded onto a MonoQ column (1 ml packing volume). Finally, this column was washed with 50 mM KCl buffer at 5 times the column load and eluted with a gradient buffer with a final concentration of 500 mM KCl at 40 times the column load. Active DAN was eluted and formed a sharp peak at about 190 mM KCl (Fig. IA).

Purification yielded an almost homogeneous protein preparation of predicted molecular weight (Figures IB and 1C). This protein showed a (A) -specific 3'-exoribonuclease poles

activity (see Example 6). Thus, the cDNA clone found encodes human DAN.

Example 5

Northern blot analysis

RNA was isolated from HeLa cells by the method of Chomczynski, P, and Sacchi, N (1987) Anal.Biochem. 162, 156. Poly (A) mRNA was purified using oligo (dT) -cellulose according to the method of Sambrook, J. et al., (1989) Molecular Cloning. A Laboratory Manual

2 ^nd . ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY The obtained RNA was resolved on a 1% agarose-formaldehyde gel, transferred by Kapillar-Blot to a Hybond N ⁺ membrane from the company. Amersham Buchler, Braunschweig was fixed to this membrane at a 2 hour incubation at 80 ° C. The human DAN coding sequence was amplified by PCR, Ramdom-Priming designated α-β-dATP and used as a probe. Hybridization was performed as described and the membrane was washed under very strict (Stringenz) conditions. Northern-blot analysis with poly (A) ⁺ RNA from HeLa cells revealed a single 3.1 kb fragment that hybridized to the DAN probe. This size corresponds well to the size of the cDNA clone.

Example 6

DAN activity test

Determination of DAN activity was performed as described (Korner, Chr. G. and Vahle, E. (1997), supra). SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was performed according to Laemmli, U.K. (1970) Nature 227, 680.

Like bovine enzyme, recombinant DAN is active depending on the neutralization of phosphate charge under two different reaction conditions. In the absence of salt, activity is entirely dependent on the presence of spermidine with a concentration optimum of 1 mM. Under these conditions, the specific activity of recombinant DAN (79,000 U / mg) is not significantly different from that of purified bovine DAN (110,000 U / mg). In the presence of spermidine, DAN activity is inhibited by salt. In the absence of spermidine, enzyme activity is dependent on salt concentration with a concentration optimum of 150 mM potassium acetate. Bovine DAN behaves similarly under these conditions. Under these conditions, however, the specific activity of the recombinant protein (960 U / mg) is lower than the activity of the purified calf-derived enzyme (8070 U / mg). This difference can be explained by post-translational modification or by the presence of contaminating proteins in the preparation.

When the capped polyadenylated RNA was incubated with DAN-preparations in the absence of salt, the (A) -terminal of the molecule degraded and completely deadenylated RNA was obtained (Fig. 3). If this assay (Assay) was performed in the presence of ΡΑΒΙ, activity was partially inhibited and gradual degradation of the (A) -terminal molecule was observed. The predominant degradation products varied in length by about 30 nucleotides, which was probably due to the binding of ΡΑΒΙ. These results are consistent with the work on overall research on bovine protein (Korner, Chr. And Vahle, E. (1997), supra). The results show that the recombinant protein is a (A) -specific 3'-exoribonuclease.

Example7

Western blot analysis

Western blot analyzes were performed as follows:

Proteins were resolved by SDS-PAGE and transferred to nitrocellulose membrane using the Semidry method (Kyse-Andersen, 1984). Individual blots were incubated with TNT buffer (20% mM Tris-HCl, 150 mM NaCl, 0.05% (v / v) Tween 20, pH 7.5) with 5% (w / v) non-fat skim milk powder. The same buffer was used for incubation with antiserum and for washing. Individual blots were incubated with antibodies for 2-3 hours at room temperature and finally washed. Bound antibodies were detected using peroxidase-conjugated porcine-anti-rabbit-antibodies (Peroxidase-Schwein-anti-Kaninchen Anticorper) (DAKO, Glostrup, Denmark) and chemiluminescent staining (SuperSignal-Kit, Pierce).

These analyzes showed that rabbit antibodies raised against the C-terminal fragment of DAN can precipitate from partially purified DAN fractions. These antibodies can be observed in a Western blot analysis of both bovine and human DAN (Fig. 4). In this experiment, the recombinant DAN appears slightly larger than the enzyme in HeLebuen SDS-lysates, which can be explained by introducing a Tag (1004 Da) into this sequence. If the Start A codon was not used for the first AUG in the cDNA sequence, the natural DAN from HeLa cells would have to be at least 1260 Da larger than the recombinant Tag protein. These results also confirm the use of the first AUG sequence in the cDNA clone as the start codon under in vivo conditions.

Claims (18)

A nucleic acid encoding a human deadenylation nuclease (DAN) having the amino acid sequence of SEQ 11 or a functional variant thereof or portions thereof comprising at least 8 nucleotides, wherein SEQ 11 is part of this claim. Nucleic acid according to claim 1, characterized in that the nucleic acid is DNA or RNA, preferably double-stranded DNA. The nucleic acid of claim 1 or 2, wherein the nucleic acid is DNA having the nucleic acid sequence of SEQ 12 from position 58 to 1977, wherein SEQ 12 is part of this claim. Nucleic acid according to claim 3, characterized in that the nucleic acid comprises one or more non-coding sequences and / or one (A) -pole sequence. Nucleic acid according to one of Claims 1 to 4, characterized in that the nucleic acid is included in a vector, preferably in an expression vector or in a gene-therapeutically active vector. 6. A method for preparing a nucleic acid as claimed in any one of claims 1 to 4, wherein the nucleic acid is synthesized by chemical means or isolated. -31 ·· ··· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · From a gene bank using a probe. 7. A polypeptide having the amino acid sequence of SEQ 11 or a functional variant thereof, and portions thereof with at least 6 amino acids. A method for preparing a polypeptide according to claim 7, wherein the nucleic acid of any one of claims 1 to 5 is expressed in a suitable host cell. Antibodies against the polypeptide of claim 7. 10. A method of preparing an antibody according to claim 9, wherein the mammal is immunized with the polypeptide of claim 7 and the optionally formed antibodies are isolated. A medicament comprising the nucleic acid of any one of claims 1 to 5 or the polypeptide of claim 7 and optionally pharmaceutically acceptable excipients or excipients. A method for the preparation of a medicament for the treatment of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermitis, allergies type I or type IV, arthroses, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes; / or for influencing cellular metabolism, particularly in immunosuppression, in particular in transplants, characterized in that the nucleic acid according to any one of claims 1 to 5 or the polypeptide according to claim 7 or the antibody according to claim 9 is formulated. The excipients acid according to the pharmaceutically acceptable excipients; or Diagnostics comprising the nucleic acid of any one of claims 1 to 5 or the polypeptide of claim 7 or the antibody of claim 9 and optionally pharmaceutically acceptable excipients or excipients. Method for the preparation of a diagnostic device for the diagnosis of cancer, autoimmune diseases, in particular multiple sclerosis or rheumatoid arthritis, Alzheimer's disease, allergies, in particular neurodermitis, allergies type I or type IV, arthroses, atherosclerosis, osteoporosis, acute and chronic infectious diseases and / or diabetes and / or for the analysis of cellular metabolism, in particular the immune status, in particular in transplants, characterized in that the nucleic acid according to any one of claims 1 to 5 or the polypeptide according to claim 7 or the antibody according to claim 9 is mixed with a pharmaceutically acceptable carrier. A method for identifying functional interactions comprising the nucleic acid of any one of claims 1 to 5 or the polypeptide of claim 7 or the antibody of claim 9 and optionally pharmaceutically acceptable excipients and / or excipients. Use of a nucleic acid according to any one of claims 1 to 5 or a polypeptide according to claim 7 for identifying functional interactions. Use of a nucleic acid according to any one of claims 1 to 5 for screening variants of human DAN, characterized in that the gene bank is screened using said nucleic acid and the variant found is isolated. Use of a polypeptide according to claim 7 for the (A) -specific degradation of nucleic acids, in particular mRNA.