KR20000070582A - Mammalian thioredoxin - Google Patents

Abstract

The present invention relates to thioredoxin and methods of using the same.

Description

Mammalian protein {MAMMALIAN THIOREDOXIN}

Thioredoxin (Trx) is a 12-kDa protein known to be present in many prokaryotic and eukaryotic cells and appears to be widely present in all living cells (Holmgren, A. (1984). Methods Enzymol. 107, 295-300) , Holmgren, A. (1985)). It is characterized by having an active site sequence having the conserved sequence Trp-Cys-Gly-Pro-Cys-Lys- during evolution. The active site of thioredoxin is located at the overhang of the three-dimensional structure (Jeng. MF et al (1994) Structure 2, 853-868), and two cysteine residues provide -SH related to Trx-dependent reductive activity. Oxidized thioredoxin, ie Trx-S _2, is reduced to Trx- (SH ₂ ) by the flavin enzymes thioredoxin reductase (TR) and NADPH (thioredoxin system) (Holmgren, A. (1985) Same document as above).

Mammalian thioredoxin isolated from various sources (eg, rat and calf liver, rabbit bone marrow, human placenta, etc.) has structural differences with respect to their prokaryotic morphology. In addition to active site cysteine residues, additional structural cysteine residues of 2 or 3 (depending on the Trx source) are present at the C-terminus of the molecule. Oxidation of these residues results in the loss of their enzymatic activity (Re. X et al. (1993) Biochemistry 32, 9701-9708).

One or more thioredoxins are present in many eukaryotes, such as yeast (Muller E.G. (1992) Yeast 8, 117-120). However, so far only one thioredoxin has been cloned in mammalian cells.

Mammalian thioredoxin is a hydrogen donor of ribonucleotide reductase (Thelander, L., Reichard, P. (1979) Ann. Rev. Biochen. 48, 133-158) and methionine sulfoxide reductase (Holgren, A. ( 1985), the same as the above-mentioned literature, and enable refolding of disulfide-containing proteins ("plasma Membrane oxidoreductases in Control of Animal and Plant Growth", "NATOAST" series, eds, FL Grane) et al., Plenum Press, New York 295-302), activating IL-2 receptors or glucocorticoids (Grippo, JF, Holgren, A., Pratt, WB (1985) Biol. Chem. 260, 93-97), Tagaya, et al. (1989) EMBO J. 8, 757-764), and is involved in a wide range of biochemical functions. In addition, the protein can be directly (TFIIIC (9), BZLF1 (10) and NF-kB (11)) or indirectly (AP-1) through the nuclear factor, which is alternately reduced by thiofpdoxin. Can regulate the DNA binding activity of some transcription factors. The redox regulation of transcription factors by thioredoxin is important in the v-fos oncogene, a mutation in Cys154 / Ser in this oncogene that continually activates the AP-1 complex. (Lkuno, H. et al (1993) Oncogene 8, 695-701). Thioredoxin is secreted by cells using a pathway without a leader (Ericson, ML, et al (1992) J. Biol. Chem. 267, 24161-24164; rubartelli, A., et al (1995) Cancer Res. 55, 675-680) and stimulates lymphoid cells, fibroblasts and various solid tumor cell lines in humans (Wakasugi, N, et al (1990). Proc. Natl. Acad. SCI. USA 87 , 8282-8286; Oblong, JE, et al (1994) J. Biol. Chem 269, 11714-11720; Nakamura, H., et al (1992) Cancer 69, 2091-2097; Gasdaska, UR, et al (1995) ) Cell Growth & Differentiation 6, 1643-1650. Moreover, Trx is a key component of early pregnancy factors (Clarke FM et al (1991) Reproduction & Fertility 93, 525-539), which inhibits HIV expression in macrophages (Newman, GW et al (1994) J. Experim.Medicine 180, 359-363), can induce H ₂ O ₂ (Spector A et al (1988) J. Biol. Chem. 263, 4984-4990), free radicals (Schallreuter KU, Wood JM (1986) Biochem Biophys. Res. Commun. 136, 630-637) and can protect cells from oxidative stress (Nakamura, H. et al (1994) Immunology Letters 42, 75-80).

The inventors have identified a new mammalian thioredoxin that is functionally and structurally different from the known mammalian thioredoxin. This new thioredoxin is Trx2.

Accordingly, a first aspect of the invention is to provide an isolated nucleic acid encoding a Trx2 gene product or a polypeptide functionally similar to Trx2. Preferably, the nucleic acid molecule comprises the sequence shown in FIG. 1A or 9.

The nucleic acid molecule may be cDNA.

Preferably, the nucleic acid has at least 60, 70 or 80% identity, more preferably 90% sequence identity with the nucleic acid sequence of FIG. 1A or 9 encoding a Trx2 gene product or a polypeptide that functions similar to Trx2. This demonstrates that, for example, various sequences can still produce Trx2 products by degeneracy of the genetic code.

"Functionally similar to Trx2" refers to catalysis of disulfide reduction or insulin with NADPH, for example, in the presence of mammalian thioredoxin reductase that is resistant to oxidation compared to Trx1, as indicated. By means of a polypeptide having thioredoxin activity. Known Trx 1 oxidizes cysteine residues and loses their enzymatic activity (Ren X et al. (1993) Biochemistry 32, 9701-9708). However, Trx 2 lacks these cysteine residues.

A second aspect of the invention is to provide a polypeptide, preferably a mature protein, encoded by a nucleic acid according to the first aspect of the invention. Preferably, the polypeptide comprises the nucleic acid sequence shown in FIG. 1A or 10.

Analysis of the amino acid sequence of Trx2 showed that it can be processed into enzymes to become mature proteins. Accordingly, the present invention also provides for mature proteins, fragments, homologs or homologs that are at least functionally similar to Trx2. The present invention also encompasses recombinant polypeptides or synthetic polypeptides that are functionally identical to, or preferably better than, native Trx2.

Preferably, the mature protein comprises Thr 59-Asp166 amino acid sequence of the amino acid sequence of Figure 1A, or Leu 59-166 of the sequence of Figure 10.

Another aspect of the invention provides a plasmid or other vector comprising a nucleic acid according to the first aspect of the invention. Such plasmids or other vectors may preferably be inserted with the nucleic acid according to the present invention and may be a type of expression vector known in the art.

The plasmid or vector may be inserted into a suitable microorganism host such as E. coli or a suitable cell known in the art such as mammalian or insect cells for expression of nucleic acid sequences of the present invention. Accordingly, the present invention provides a bacterial, mammalian or insect cell comprising a plasmid or vector according to the present invention.

The advantage of thioredoxin 2 (Trx 2) is that it is resistant to oxidation and migrates to mitochondria. Mitochondria are sites with very important functions of cells such as lipid metabolism and aerobic respiration (oxidative phosphorylation). In respiration, incomplete reduction of dioxyen forms reactive oxygen intermediates, ROIs (hydrogen peroxide, spuroxide anion O ₂ and hydroxy radical OH). Increased levels of ROIs (called oxidative stress in this specification) result in peroxidation of lipids, protein inactivation, and DNA chain cleavage. Thioredoxin acts as an antioxidant molecule and utilizes hydroxy radicals, reduces hydrogen peroxide and reactivates proteins that are inactivated by oxidation.

Thus, the present invention provides a therapeutic application of Trx2 which includes protecting against oxidative stress leading to cytotoxicity and tissue damage. More specifically, Trx2 can be used to protect against ischemic, eye disease, radiation and drug toxicity.

In relation to ischemic injury of tissues, it is believed that reactive oxygen species are involved in ischemic perfusion injury. In many heart attacks and paralysis, reperfusion follows after the ischemic period, and oxygen radicals are produced during the reperfusion period, which is probably the true cause of heart attack or seizure damage. Trx2 can be used as a protective compound to attenuate ischemic perfusion damage.

In connection with eye diseases, many eye diseases, including cataracts, are involved in photo-oxidative stress. Trx2 can also be used to protect retinal cells from damage caused by free radical species during oxidative stress in the retina.

With regard to radiation investigations, exposure to radiation is one of the main causes of oxygen radical oxidation. Trx2 can be used as a radioprotective compound to weaken the radioactive effect.

Finally, with respect to drug toxicity, several well known drugs (eg, adriamycin) exhibit various undesirable side effects caused by the generation of reactive oxygen species. For example, in the presence of adriamycin, cardiac toxicity is a major form of injury, and Trx2 may be used to eliminate side effects.

The invention will be explained in detail by the following examples, with reference to Figures 1-15:

1 shows the cDNA, inferred amino acid sequence and predicted secondary structure of rat Trx2. The inferred amino acid sequence represented by the single letter code in A) is below the nucleotide sequence. Active sites were boxed and underlined potential polyadenylation signals. In B), the secondary structure was predicted using the DNASTAR program and the Garnier-Robson algorithm. The Kyte-Doolittle algorithm was applied to the numerical plot of the Trx2 amino acid sequence;

Figure 2 shows in vitro translation of Trx2 cDNA using SP6 RNA polymerase, TNT coupled reticulocyte transcription translation system and [35S] methionine. A) shows analysis of the N-terminal part of the predicted Trx2 amino acid sequence. Secondary structure prediction of the region suggests alpha-helix as shown. Arrows indicate predicted mitochondrial signal peptide protease cleavage sites determined by the common motif for cleavage by both protease models (Hendrick JP, Hodges, PE, Rosenberg, LE (1989) Proc. Natl. Acad SCI. USA 86, 4056- 4060). Arginine at 10 weight; Hydrophobic residues at position 8; S, G, and T residues are present at position 5. In B) this arrangement is based on the three-dimensional structure of E. coli thioredoxin (Eklund, H., Gleason, FK, Holmgren, A. (1991) proteins 11, 13-28). Black boxes represent amino acid residues conserved in human Trx, rat Trx1 and rat Trx2. The structures represent alpha-helix, twisted 3 ₁₀ helix and 5 beta-sheets;

4 shows a phylogenetic tree. Phylogenetic trees were prepared by the Clustal method using a PAM 250 magnetic weight table;

5 shows Northern blot analysis of Trx1 and Trx2 in rat tissue. Each lane contains 2 μg poly (A) + RNA. The blots were hybridized with Trx1 and Trx2 probes as described in "experimental procedures". The tissue used for analysis is shown at the top. estimated sizes of mRNA were 0.6 kb and 1.3 kb for Trx1 and Trx2, respectively;

6 shows RT-PCR analysis of transcripts encoding Trx1 and Trx2. 1 μgdmf reverse transcription of total RNA was used and 1 μl was used as template for PCR with primers specific for 2 μg 1, 2 μg 2 and beta-actin. The product was separated by agarose gel electrophoresis and transferred to the membrane and probed with specific oligonucleotide probes;

7 shows immunoblot analysis of cell fractions. Cell fractions were analyzed by SDS / PAGE and developed as anti-Trx 2 antibodies. Lane 1, Δ-Trx 2 (5 ng); Lane 2, whole rat hepatocyte extract (15 μg); Lane 3, cytoplasmic fraction (15 μg); Lane 4, mitochondrial fraction (15 μg); Lane 5, peroxysome fraction (15 μg); Lane 6, human Trx1 (5 ng).

8 shows the analysis of Trx activity. Oxidized Trx 2 and human thioredoxin were analyzed for the ability to reduce insulin in the presence or absence of DTT. The reaction was terminated after 20 minutes with the addition of 6M guanidine-HCl and 1 mM DTNB;

9 shows a human Trx2 cDNA sequence;

FIG. 10 shows an expected human Trx2 amino acid sequence based on the cDNA sequence of FIG. 9; FIG.

FIG. 11 shows two cDNA sequences of the human liver encoding a protein that interacts with Trx2; FIG.

12 shows five cDNA sequences of the brain of rats encoding proteins that interact with Trx2;

Figure 13 shows human trx2 genes;

14 shows a gel photograph of the PCR product in chromosome 22;

FIG. 15 shows RNA levels of human Trx2 analyzed using RNA master blot (Clontech).

The present invention relates to the isolation and characterization of nucleic acids encoding new mammalian thioredoxin and to proteins or polypeptides produced from such nucleic acids.

1. Cloning of Rat Thioredoxin 2

To design a denatured primer labeled ³² P with the primary structure of the thioredoxin (VVVDFSATWCGPCK) active site, which is conserved throughout the development, and to test the novel rat heart cDNA library (Clontech) for the novel thioredoxin gene. Used as a lean probe. About 1 × 10 ⁶ plaques were screened according to the manufacturer's instructions (Amersham) and positive bacteriophages were identified. Inserts were excised from this bacteriophage, cloned into a TA-vector (Invitrogen) and sequenced. The A 392 bp portion of the clone was expanded by PCR with specific primers (trx2lee: 5'-AACCTTTATCGTCCAGGATGGAC-3 'and trx2fl: 5'-GCTGGGAGTTCTACTAGGTTCC-3') (1 at 52 ° C for 1 minute, 1 minute at 52 ° C). 30 cycles for 1 minute at 72 ° C.).

This PCR product was labeled ³² P by random priming and was used to rescreen the same library under high-stringency conditions. Hybridization was performed at 60 ° C. in an Expresshyb hybridization solution (Clontech), followed by 2 × SSC-0.1% SDS at room temperature (1 × SSC being '0.15 M NaCl + 0.15 M sodium citrate'). Rinse 5 times for 10 minutes, and washed twice for 40 minutes with 0.1% SSC-0.1% SDS at 60 ℃. More than 600,00 clones were screened and five clones were identified, cloned and sequenced with a TA-vector. All clones were duplicated and the longest Trx2 had a 501 bp open reading frame starting with the ATG start codon and ending with the TGA terminal codon. To obtain full length cDNA 5 ', in the presence of an anchor-specific primer and antisense primer complementary to the 3' untranslated region of trx2 (trx2r2: 5'-GCTGGGAGTTCTACTAGGTTCC-3 ') Rapid Aplication of cDNA Ends (RACE) by nested PCR using oligonucleotide-anchored cardiac cDNA templates was performed according to the Clontech protocol. PCR products were cloned and sequenced with the TA-vector. The cDNA fragment was expanded to overlap Trx2 and encode 46 bp of a novel 5 'sequence containing the TGA termination codon upstream of the ATG start codon in the sequence. The entire complex sequence consists of 1276 bp and a stretch of 20 adenosines corresponding to the poly (A) tail and 18 bp, AATAAAA motive, on top of the poly (A) tail. Include. This open reading frame encodes a protein of 166 amino acids with an expected weight of 18.2 kDa and a pi of 7.9 (FIGS. 1A, 1B).

To confirm that the open reading frame present in the Trx2 clone is functional and codes for protein translation, the cDNA was transcribed from the SP6 promoter of the TA-Trx2 clone and mixed with [ ³⁵ S] methionine at 30 ° C. for 60 minutes. 0.5 μg was translated using Sp6 RNA polymerase and TNT paired reticulocyte lysate system (Promega). These translation products were visualized by analytical doors, autoradiography by 15% SDS-polyacrylamide gel electrophoresis. This resulted in a 20-kDa translation product, indicating the presence of a translatable and functional coding sequence (FIG. 2).

2. Analysis of Inferred Amino Acid Sequences

The N-terminal region of the protein has a high content of positively charged residues and has a secondary predicted structure, indicating potential α-helices and subsequent β-sheets (FIG. 1B).

These features are characterized by algorithmic analysis of partial amino acid compositions showing mitochondrial intramolecular position (Newman, GW etal (1994). J. Experim. Medicine 180, 359-363) and most mitochondrial target signal peptides (Neupert, W). (1994) Clinical Investigator, 72, 251-261). Motives of mitochondrial peptide proteases were also found as cleavage sites between Ser 58 and Thr 59 (FIG. 3A). This presumed cleavage produces a 12.2 kDa mature protein, which is similar in size to thioredoxin known in the art.

The C-terminal half of the protein contained the active site found in thioredoxin with the characteristic amino acid sequence, Trp-Cys-Gly-Pro-Cys-Lys. The molecule was 35% homologous to thioredoxin in other mammals, and a number of structural amino acids conserved in mammalian thioredocin, Phe-12, Pro-40, Asp-59 and Lys-82, were also found in Trx2. Conserved (FIG. 3B). However, amino acids involved in protein-protein interactions, such as Ala-93 and Glu-57, are converted to Ile and Lys, respectively. One major difference between Trx2 and mammalian thioredoxin is the absence of structural cysteines, residues present in all mammalian thioredoxin.

Trx2 is more homologous to E. coli thioredoxin than conventional mammalian proteins and, according to phylogenetic analysis, Trx2 is considered to be a different branch of this phylogenetic tree, far from mammalian protein and prokaryotic and subeukaryotic. It seems to be close to the cell thing.

Sequence homology is outlined in FIG. 4.

3. Northrun Blot and RT-PCR Analysis of Trx1 and Trx2 mRNA Expression

Rat multi-tissue northern blots with 2 μg / lane of high purity poly (A) + RNA from various rat tissues (Clontech) were hybridized with two probes, one of which was Spyrou et al. J. As described in Biol Chem 272, 2936-2941 (1996), one is 392 bp specific to rat Trx2 and the other is 360 bp specific to rat thioredoxin (Trx1). Rat Trx1 and Trx2 open reading frame probes were labeled with [ ³² P] dCTP by random priming methods and hybridized with ExpressHive solution (Clontech). This Trx1 probe hybridized with very high levels of 0.6 kb RNA in the lung. This Trx2 mRNA was detected as a 1.3 kb band depending on the size of cDNA (1.276 bp) and expressed very largely in the heart, lung, skeletal muscle and kidney. RT-PCR was used to compare the relative expression levels of Trx1 and Trx2 in tissues that may be very low in expression of these proteins (FIG. 6). RT-PCR analysis was performed by killing male and female rats (6-8 weeks old) through cervical dislocation to collect the tissues and immediately sample the guanidium thiocyanate-phenol-chloroform single step extraction protocol (Chomczymski, P.). , Sacchi, N. (1987). J. Biol. Chem. 162, 156-159). The identity and quality of the purified RNA were adjusted by formaldehyde modified agarose gel electrophoresis and A ₂₆₀ / A ₂₈₀ ratio measurement.

For the first strand synthesis, total RNA (1 μg) was dissolved in 10 μL of water, heated at 70 ° C. for 5 minutes and then cooled on ice. Volume increased to 20 μL, 1 mM dATP, dGTP, dCTP, dTTP, 10 mM DTT, 5 pmol random hexamers / L (Promega), 1 U RNAsin / μL, 200 U superscript, respectively (Superscript) RT (GIBCO-BRL) and the final concentration of recommended culture buffer from the feed were given. For PCR amplification, 1 μL of cDNA (20 μL total) was applied to the PCR, followed by 94 ° C. for 10 seconds, 54 ° C. for 30 seconds, and 60 seconds in a PCR9600 thermocycler (Perkin-Elmer, Norwalk, CT). Incubation at 72 ° C. for 24 cycles. Oligonucleotides trx2fl: 5'-AACCTTTATCGTCCAGGATGGAC-3 'and trx2rl: 5'-GCTGGGAGTTCTACTAGGTTCC-3' were used to amplify the 392 bp fragment of Trx2 mRNA. Oligonucleotides trx1fl: 5'-CCAAAATGGTGAAGCTGATCGAGAG-3 'and trx1rl: 5'-TGATTAGGCAAACTCCGTAATAGTG-3' were used to amplify the 360 bp fragment of Trx1 mRNA. Oligonucleotides Act 5 ', CTGGCACCACACCTTCTA and Act3', GGGCACAGTGTGGGTGAC were used to augment the 238 bp fragment from β-actin mRNA. After blotting on agarose gel electrophoresis and nitrocellulose filters, the PCR product hybridized to the following ³² P-labeled internal oligonucleotides: trx2r2 for Trx2: 5'-CACCACCTTCCCGTGCTGTTT-GGCTACCATCTTCTCTAACCGAGGTCC-3 ', Trx1 Trx1r2 for: 5'-CTGGAATGTT-GGCGTGCATTTGACTTCACACTCTGAAGCAACATCCTG-3 'and actin primer 5'-GATGACCCAGATCATGTTTGA-3'.

Hybridization was performed at 50 ° C. in the ExpressHive Hybridization Solution, then washed 5 times at room temperature with 2 × SSC-0.1% SDS for 10 minutes, and finally at 40 ° C. for 40 minutes at 50 ° C. with 0.1% SSC-0.1% SDS. Washed once. While Trx1 is known to follow β-actin expression, which is more expressed in colon and liver, Trx2 exhibited a completely different pattern, which was largely expressed in the cerebellum, heart, skeletal muscle, kidney, adrenal gland and testes. No cross hybridization between Trx1 and Trx2 was observed.

4. Expression and Subcellular Location of Recombinant Thioredoxin 2

The cDNA C-terminus, which encodes some rat Trx2 (aa 60-166y, Trx2), contains NdeI (trx2pl: 5'-ACCACCAGAGTCCATATGACAACCTTTAAACGTC-3 ') and BamHI (trx2p2: 5') at each polypeptide N-terminus and C-terminus. -CTGGCCGGATCCCTGCTTATCAGCCAATTAGC-3 ') site was expanded by PCR from the TA-Trx2 plasmid using two mutant primers. The expanded DNA was cloned into the NdeI-BamHI site of the pET-15b expression vector (Novagen) under the control of the T7 promoter, so that the resulting plasmid, pET-trx, was converted to E. coli strain BL21 (DE3). Single positive colonies were inoculated in 1 L of L-culture at 50 μg / mL of ampicillin and incubated at 37 ° C. up to OD ₆₀₀ = 0.5. Thereafter, fusion protein expression was induced by addition of 0.5 mM IPTG, followed by further incubation for 3.5 h.

Cells were collected by centrifugation at 10,000 × g for 10 minutes and the pellet was resuspended in 50 mL of 20 mM Tris-HCl pH 8.0, 100 mM NaCl and 1 mM PMSF. Lysozyme was stirred for 30 minutes on ice and added to a final concentration of 0.5 mg / mL. Thereafter, MgCl ₂ (10 mM), MnCl ₂ (1 mM), DNAxe I (10 μg / mL) and RNAse (10 μg / mL) were added and the culture continued on ice for an additional 45 minutes. Cells were ground using 8 minutes of ultrasound, centrifuged at 15,000 × g for 30 minutes to remove supernatant, loaded onto Talon resin column (Clontech) and eluted with 20 mM imidazole. The size and purity of the eluted protein was determined by SDS-PAGE on a 15% gel. After Talon chromatography, a single band of 15 kD was observed (without data).

We next analyzed the subcellular localization of Trx2 using purified polyclonal antibodies (Zeneca Research Biochemicls, England) obtained from affinity immunized rabbits. After six inoculations, serum from rabbits was purified with ammonium sulfate precipitate.

Affinity-purified antibodies were prepared using a cyanogen-bromide-activated Sepharose 4B column, and 0.5 mg of Trx2 was coupled thereto using a method recommended by the manufacturer (Pharmacia). The specificity of the antibody was tested by western blotting using recombinant Trx2 and total cell extracts. Svensson, L. T., Alexsohn, S. E. H., Hiltunen, J. K. (1995) J. Biol. Chem. Mitochondria, peroxysomes and cytoplasmic fractions were prepared from the livers of rats as described in 270, 12177-12183. Samples were treated with 15% SDS-PAGE for immunoblotting analysis and the separated proteins were electrophoresed to nitrocellulose membranes (Hybond-C Super, Amersham). The membrane was blocked with PBS containing 5% dry skim milk powder and 0.05% Tween 80 and then further incubated with affinity-purified anti-trx2 antibody. An immunoassay was performed using anti-rabbit IgG (Amersham) of horseradish peroxidase-conjugated goat diluted 1: 5000 fold and then luminol catalyzed by hydrogen peroxide by ECL protocol (Amersham). As shown in FIG. 7, trx2 was present only in the mitochondrial fraction and no signal appeared in the cytoplasmic fraction and the peroxysome fraction. Rat Trx1 did not cross react with affinity purified antibodies to trx2. The photoximeter analysis evaluated the trx2 content in the total cell free extract obtained from the liver of the rat to be about 0.1 μg / mg protein (data not shown). Transient preproteins with mitochondrial translocation peptides were not detected, indicating that the translocation process is very rapid. Recombinant trx2 in lane 1 had a higher molecular weight because His-tag was not removed by thrombin.

5. Thioredoxin Catalyzed Insulin Reduction

To confirm the specificity of recombinant trx2, we tested the reduction of insulin. This experiment is a classical assay in which thioredoxin catalyzes the disulfide reduction of insulin by NADPH in the presence of thioredoxin reductase (TR) in mammals. The experimental results were compared with the activity of recombinant trx2 and human thioredoxin. In order to activate Trx1 and trx2 by reduction, basically an insulin disulfide reduction assay was performed with only minor modifications as described in Holgrem, A. BjUrnstedt, M. (1995) Methods Enzymol 252, 199-208. Aliquots of Trx1 and trx2 were preincubated with 2 μldml 50 mM Hepes pH 7.6, 100 μg / ml BSA and 2 mM DTT in a total volume of 70 μl at 37 ° C. for 20 min. Then 40 μl of the reaction mixture consisting of 200 μl Hepes (1M) pH 7.6, 40 μl EDTA (0.2M), 50 μl NADPH (40 mg / ml) and 500 μl insulin (10 mg / ml) were added. The reaction was initiated by the addition of 10 μl of TR (3.0 A ₄₁₂ units) obtained from the calf thymus and incubated at 37 ° C. for 20 minutes. 0.5 ml of 1 mM DTNB, 6 M guanidine-HCl was added to stop the reaction and the absorbance at 412 nm was measured. Calf-thymus TR and human thioredoxin were obtained from Professor Holmgren of the Karolinska Institute, Sweden. As shown in FIG. 8, when the samples were previously incubated with DTT, trx2 and human Trx served as equally superior substrates for TR. However, oxidized human Trx has a significant lag phase and has been shown to reduce insulin's ability to reduce. The activity of trx2 was not affected by oxidation. Although trx2 is homologous to thioredoxin in prokaryotic cells, it could not act as a substrate for E. coli TR (data not shown).

6. Isolation of Human cDNA

Using polymerase chain reaction, human cDNA encoding trx2 was isolated. This is shown in FIG. 9. This showed 87.4% homology with the trx2 cDNA of rats.

10 shows the expected amino acid sequence of human trx2. It also contains the putative mitochondrial prepeptide protease cleavage site between Ser58 and Leu59.

7. Thioredoxin 2 Interacting Protein

To determine which proteins interact with trx2, we isolated trx2 interacting proteins in a yeast two hybrid system using human liver cDNA libraries. trx2 was cloned into the pGBT9y vector (Clontech) and expressed the DNA binding zone of the GAL4 transcriptional activator fused with trx2. The liver cDNA library was cloned into pGAD10 vector (Clontech) expressing cloned cDNA fused with the DNA activation band of GAL4. These two vectors were co-transformed to an HF7c yeast strain that was a trophogenic strain for tryptophan and leucine and had histidine as a reporter gene under the control of the upstream activating sequence (UAS) and the TATA portion of the GAL1 promoter. Transcriptional activation of GAL4 is restored after interaction of trx2 with the protein cloned in the pGAD10 vector, resulting in histidine expression and thus growth on histidine-deficient plates. Approximately 16 × 10 ⁶ clones were tested and 2000 colonies could be grown on Leu / Trp / His lacking plates. 110 positive (growing) clones were selected for further analysis.

Isolated proteins have no homology with known proteins in fibrinogen β-chain precursors, plasminogen, vitronectin, PDI, γ-actin, serine hydroxymethyltransferase, NF-kB p65, and protein sequence databases Were two cDNA sequences encoding them (FIG. 11).

Using the brain cDNA library of rats screened in the same manner as above, the following clones were isolated: cytochrome c oxidase, ribosomal protein S17 of rats, c-myc intron binding protein (zinc finger protein), and apparent in database 5 cDNA sequences encoding proteins that do not exhibit homology. The cDNA sequence can be seen in FIG. 12.

8. Genome organization of trx2

To determine the number and location of introns in the trx2 gene in the human genome (FIG. 13), two sets of primers were prepared for use in PCR amplification of trx2 gene portions. The first set consists of the forward primers corresponding to aa1 to aa7 and the reverse primers of aa110 to aa117 and the second set consists of the forward primers of aa88 to aa96 and reverse primers downstream of the stop codon. The first set produced about 4.2 kb of product when used for amplification from human genomic DNA and the second primer produced about 96 kb of product, resulting in a total of about 13.2 kb of binding intron. Both of these products were sequenced by cloning into the pGEMT easy vector (Promega). There was only one intron of 4 kb in the first PCT amplification product, which was located between aa87 and aa88 of trx2. 9kb PCR amplification also produced only one intron, which was located between aa129 and aa130 of trx2. Both splice junctions fit well with GT / AG rules. The trx2 gene has therefore been shown to have two introns.

9. Human PAC Clone Isolation and Chromosome Localization

Human PAC library (German Human Genome Project, Berlin Resource Center / Primary Database) constructed from cell lines of human male fibroblasts and conjugated with pCYPAC-2 (Lehrach et al. (1990); Loannou et al. (1994). 704) was screened using genomic DNA probe H6-2 trx2 from the human trx2 gene Labeling 4.2 kb fragment at ³² P by random priming and under harsh conditions (45% formamide, 42 ° C.) After overnight hybridization to the filter combined with the PAC clone, the filter was rinsed for 20 minutes at 2XSSC, 0.1% SDS, 20 minutes at 0.1XSSC, 0.1% SDS at room temperature and then 0.1XSSC, 0.1% at 65 ° C. Wash 30 times in SDS three times for 30 minutes Autoradiography (FUJI Medical X-ray) was analyzed 4 days later One 130kb clone containing the trx2 gene was found, from which DNA was isolated by Qiagen preparation. Cle In order to ensure that the real-positive, let perform PCR using a primer set used in the bar, the same amplified products was obtained.

10. Somatic Hybrid Panel Fluorescence in situ Hybridization (FISH)

To identify which chromosomes in humans carry the trx2 gene, high molecular weight DNA was isolated from somatic hybrid cell lines (hamster / human and mouse / human) that maintain the chromosomes of each individual. PCR amplification was performed for each chromosome using primers corresponding to the start codon and stop codon. The expected product size was about 130 kb. Chromosome 22 was a chromosome that produced the product expected by PCR amplification and was found to be a chromosome containing the trx2 gene (FIG. 14).

PAC clones of trx2 were used as probes after labeling with biotin-16-UTPtrx2 by nick-translation. To obtain more detailed localization analysis of the trx2 gene, slides with human meta-chromosomes were prepared using standard techniques. The slides were postfixed and treated with RNase and then denatured as described above (Pinkel et al. (1986) Proc. Natl. Acad. Sci USA 83, 2934-2938). PAC clones for trx2 were labeled with biotin-16-dUTP by nick-translation and used as probes. Probes (50 ng, 100 ng) were denatured at 68 ° C. for 10 minutes and then pre-annealed with Cot-1 DNA (2.5-3.5 (g) for 30-60 minutes at 37 ° C. in 37 ° C. overnight in 50% formamide Hybridization was carried out The slides were then washed three times in 50% formamide for 5 minutes each at 2 × SSC at 42 ° C. and 0.1 × SSC at 60 ° C. After washing, the hybridized probes were fluorescent-isothio. Amplification by three successive treatments with a biotinylated anti-avidin antibody that was coupled to cyanate-avidin D and modified with fluorescence-isothiocyanate-avidin D (Vector Lab). 2.3% DABCO (1,4-diazabicyclo- (2,2,2) octane) as antifade, and 0.5 g / of DAPI (4,6-diamino-2-phenyl-indole) as counterstain Mounted on glycerol containing ml Controlled by Power macintosh Quadra 950 computer Signals were visualized using a Zeiss Axioskop fluorescence microscope equipped with a cooled cooling CCD-camera (Photometrics Synsys) Gray scale images were captured, pseudocolored and merged using SmartCapture software (Vysis). The redidation signal was retrieved as a symmetrical spot on both chromatids of chromosome 22 homologous at q131.1.

11. Northern analysis of trx2 expression

To detect the presence of trx2 mRNA molecules in human cell types, trx2 cDNA probes labeled with ³² P dUTP were hybridized with human mRNA master blot (Clontech). After exposing this blot to an autoradiographic film, photographic concentration measurements were performed on the dots appearing on the film. The measured values were then corrected using G3PDH (glyceraldehyde-3-phosphate dehydrogenase). The highest value was set to 100% and the rest was evaluated as a relative value of the set value. Figure 15 shows the relative values of mRNAs of various tissues blotted.

12. Submitochondrial Localization and Immunohistochemical Analysis

To better understand the function of trx2 in mitochondria and to assess the interaction of trx2 with several proteins isolated in two hybrid screenings, it is necessary to investigate the submitochondrial localization of trx2. Using immunohistochemistry with the kidneys of the sprinkled rats and electron microscopy, we found that trx2 was located in the inner membrane of the mitochondria.

Immunocytochemistry

Rats were anesthetized with pentobarbital for immunocytochemical analysis by light microscopy and first sparged with 100 ml of saline, followed by 0.1% picric acid and 4% paraformaldehyde in 0.1 M phosphate buffered saline (PBS; pH 7.3). The mixture was sprayed for 4-5 minutes. After sparging, the tissues were dissected and fixed by immersion in the solution for 60 minutes. This sample was cryopreserved with 15% sucrose in PBS before sectioning on the cryostat. Immunocytochemistry was performed using the ABS-method. The sections were first incubated with rabbit antiserum against trx2 (1: 250 dilution in PBS containing 1% BSA and 0.3% Triton X-100) for 12-24 hours. After washing several times the sections were incubated with biotinylated goat-anti-rabbit (Vector Labs, 1: 300 dilution) and ABS-complexes for 30 minutes. Diaminobenzidine was used as the pigment source to visualize the site showing trx2-immunoreactivity. These sections were dehydrated and observed by mounting on a Nikon Microphot-FXA microscope.

Immunoelectron Microscopy Analysis

Animals anesthetized for immunoelectron microscopic analysis were sprinkled with 4% paraformaldehyde, 0.1% picric acid and 0.2% glutaraldehyde in PBS for 5 minutes. Tissues were post-fixed by soaking for 5-6 hours. Tissues were cryoprotected with 10% glycerol and 50% sucrose in PBS. Tissue was rapidly frozen in liquid nitrogen and 50 μm frozen fractions were sieved in a cryostat. Sections were freely floated. The trx2 antibody was diluted (1:50) with PBS containing 1% BSA and 0.2% saponin and sections were incubated with the antibody for 4-6 days. After washing several times the sections were incubated with the secondary antibody and ABS-complex for 12 hours each. Diaminobenzidine was used as the dye source. Sections were then fixed for 30 minutes each with 2% glutaraldehyde, 1% osmium tetraoxide and 1% uranyl acetate. Tissues were dehydrated with ethanol and planted in Epon. Samples were observed with an electron microscope and thin sections were observed with a Jeo 1200 electron microscope.

Nitric acid (NO) is a short-lived free radical gas that plays various physiological roles, including S-nitrosylation of proteins in vivo. Thioredoxin 1 is widely known for scavenging free radicals (Schallreuter, KV, Wood JM (1986) Biochem Biophys. Res. Commum 136, 630-637) and reversible the action of NO in AP1 in vitro. (Nikitorite et al. (1998) Biochem. Biophys Res. Commun. 242, 109-112), trx2 located in the mitochondria is likely to have a similar function to trx1.

13. Immunocytochemistry and in situ hybridization in other tissues of adult female and male mice

in situ hybridization

In situ hybridization was performed as described in detail above (Kononen and Pelto-Huikko, 1997, TIPS online). Two oligonucleotides specific for murine Trx2 (terminal trx2r2: CACCACCTTCCCGTGCTGTTTGGCTACCATCTTCTCTAACCGAGGTCC and trx2r3) with terminal deoxynucleotide transferases (Amersham) (3) AAGGGA of TCNAPGGG Labeled as specific activity of 109 cpm / mg. Both probes produced similar results when used individually and in combination with hybridization to increase signal strength. Several control probes with similar CG-content and inactivity were used to confirm the specificity of hybridization. An excess of 100 moles of unlabeled probe disappeared the hybridization signal. Mice were killed, tissues were excised and frozen in dry ice. The cold section (14 um) is sectioned using a Micron HM 500 cryostat and thawed on a probe-on glass slide (Fisher Scientific, Philadelpia, PA). The section was stored at −20 ° C. until use. The sections were incubated for 18 hours in a humidified box at 42 ° C. with 5 ng / ml labeled probes in a hybridization coctail, washed, dried and 30-60 with Amersham B-max radiographic film. Covered for days. Optionally the sections were immersed in Kodak NTB2 nuclear track emulsion (Rochester, NY) and exposed at 4 ° C. for 90 days. The sections were examined on a Nikon Microphot-FXA microscope equipped with dark-field and epipolarization microscopes. Finally, the sections were stained with cresol bioret and analyzed under Brightfield conditions.

The results of immunocytochemistry and studies are following in-situ hybridization.

Male Reproductive Organs:

testicle:

in situ: High levels of trx2 mRNA in the seminal ducts, fluctuate during the reproductive cycle.

Immunity: Sertoli cells, strong labeling in primary sperm cells, slight labeling in Leidig cells.

Negation:

in situ: signal from epithelium

Immunity: Epithelial cells are clearly labeled.

prostate:

in situ: clear signal in the epithelium

Immunity: Most epithelial cells are labeled.

Female Reproductive Organs:

in situ: Strong signal in the ovary. The corpus luteum is the strongest and is also labeled in the follicles and epilepsy. Signals in the uterine epithelium and muscle layer.

Immunity: Strong labeling in decaying follicles. Some labeling in the corpus luteum. Labeling in oocytes in primitive follicles. Clear signal from the epithelium in the uterus and pigmentation in the smooth muscle cells of the myometrium.

skin

Immunity: Labeling in keratinocytes in the basal epidermis. Labeling on some cells in follicles. Labeling on epithelial cells within the gland.

Endocrine organs

Pituitary: Intermediate labeling in immunity in many cells, low signal in situ.

Adrenal Glands: Strong signal of in-situ in the adrenal cortex, low signal in bone marrow. Strong signal in the adrenal cortex, especially in globules and upsets. No pigmentation in the chromocompatible cells in the bone marrow.

alimentary canal:

Salivary glands: several labeled cells in secretory bubbles.

Stomach: strong labeling on mucous membranes, body wall cells of the gastric gland and epithelial cells of the mucosa.

Duodenum: strong labeling on epithelial cells within the mucosa.

Liver: Uniform and clear signal in situ. Clear labeling in most of the hepatocytes, some very strongly colored.

Eye:

cornea; Clear pigmentation in epithelium, stromal fibroblasts and endothelial.

Lens: Very strong labeling in the epithelium of the subcapsule of the lens.

Retina: pigmentation in neuronal and bipolar neurons (rod and cones negative). Labeling in the pigmented epithelium.

Respiratory:

Pigmentation in some cells on the alveolar layer. Parasympathetic neurons in local ganglia are immunoreactive.

kidney:

Stronger labeling in situ in the bone marrow of the kidney (Henre's loop in this area), lower labeling in small bumps (aggregation tubules in this area). Also labeling in the cortex. Clear signal to immunity in tubules and aggregates within the bone marrow. Also labeled in the new district.

Immune system:

Clear signal to in situ in lymph nodes, spleen, thymus and bone marrow. Immunity-resistant pigmentation in multiple lymphocytes (proliferating cells in the ventral center) in lymph nodes. Many cells in the spleen and thymus are pigmented. Bone Marrow For some cell types, megakaryocytes are easily identified.

Brown fat:

Immunity-resistant labeling, especially in young animals.

bone:

Labeling on chondrocytes in cartilage. Labeling in cell wall wall bones. Strong labeling on some cells around growing bones. Very strong labeling for in-situ in some cells around the growing bone.

muscle:

Labeling in many cells of muscles.

Peripheral Nervous System:

Sympathetic nerves, many labeled neurons in the accompanying cell (nerve) are negative. Some cells of the carotid body (chemical receptor) are immunoreactive. The motor neurons of the spinal cord are labeled. Many perceptual neurons (associated with pain) are labeled, with small neurons and medium-sized neurons most strongly labeled.

Central nervous system:

Trx2 is primarily located in a specific series of neurons (meteor cells in the olfactory muscles, supraoptic nucleus, melanoma, giant cells in Purkinie cells).

Circulatory system:

Heart: In-Sight: Strong signal in both atria and ventricles.

Immunity: Strong pigmentation in most muscle cells.

Blood vessels: clear pigmentation in smooth muscle cells and small blood vessels.

The above study shows that smooth muscle cells do not contain Trx1. Given the antioxidant properties of thioredoxin, the possibility of the association of trx2 expression and artheriosclerosis is very interesting.

These results demonstrate the fertility of trx2 mRNA and translation products in the tissues of adult female and male mice.

Because thioredoxin is known to protect cells against oxidative stress (Nakamura, H. et. Al (1994). Immunology Letters 42, 75-80), particularly in the epithelium of the subcapsule of the lens of the eye. The strongest pigmentation suggests an important role of Trx2 in the protection of the eyes caused by free radicals.

Similarly, high levels of Trx2 expression in neurons suggest an important role of Trx in protecting these cells from oxidative damage. For example, high expression of Trx2 in neurons, along with thioredoxin's ability to encroach free radicals and regenerate damaging proteins, suggests that Trx2 plays an important role in limiting and / or repairing neuronal damage. This is because common factors in various neurodegenerative diseases are associated with the production of free radicals.

Trx2 also plays an important role in the control of pain because there are many perceptual neurons associated with pain in the peripheral nervous system that are strongly labeled with trx2 antibodies.

14. Comparison of Known Trx1 Proteins with Trx2

Southern hybridization analysis of the human genome has revealed several thioredoxin genes including at least one inactive pseudogene (Tonissen, K.F., Wells, J.R. (1991) Gene 102, 221-228).

The encoded protein sequence of Trx2 shows a two domain structure consisting of the N-terminus of 60 amino acids enriched with basic amino acids with a hypothetical pi of 12.1 and the C-terminus homologous to thioredoxin with a pi of 4.8. The N-terminus of Trx2 has the properties of putative protease cleavage sites capable of producing mitochondrial migrating peptides and 12.2 kD mature protein. In fact, slightly larger mitochondrial forms of Trx compared to cytoplasmic Trx have been reported to exist in the pig heart based on electrokinetic movements (Bodenstein, J., Follman, H. (1990) Z. Naturforsch 46 ??, 270-). 279). In vitro transcription-translational coupling confirmed the presence of putative open reading frames in the Trx2 clone. In SDS-polyacrylamide gel electrophoresis analysis, the size of the translation product is slightly larger than the calculated size (20 kDa vs 18.2 kDa), which may be due to the primary properties (eg charge) of the protein. Of course, natural proteins still have different sizes due to post-transcriptional modifications.

Although Trx2 is phylogenetically closer to prokaryotic than mammalian thioredoxin, some amino acids that are conserved in all prokaryotes, such as Trp-28, are not conserved in Trx2. In addition, amino acid differences related to protein interactions such as Ala093 and Glu-57 will probably impart different specificities to Trx2 compared to Trx1. All previously described mammalian thioredoxins have 2-3 additional cysteine residues in addition to the two cysteines located in the active site. Such structural or non-catalyzed cysteine residues may undergo oxidation resulting in inactivation. From the structure of reduced human thioredoxin, Cys-72 is located in a loop close to the active site. Xilin et al. (Ren, X. et al (1993) Biochemistry 32, 9701-9708) show that Cys-72 is responsible for dimer formation and subsequent loss of activity. The absence of structural cysteine corresponding to Trx2 confers resistance to oxidation. These properties may have important physiological relationships with the role of Trx2.

Mammalian Trx can be found in many other cell fractions, including the nucleus, endoplasmic reticulum, mitochondria and cell membranes (Martin, H., Dean, M. (1991) Biochem. Biophys. Res. Commun 175, 123-128), (Holgrem, A., Luthman, M. (1978) Biochemistry 17, 4071-4077). In addition, Trx is differentially regulated and has distinct functions including activation of transcription factors and promotion of cell growth and radical removal activity. Trx2 is highly expressed in tissues such as heart and skeletal muscle, where no Trx1 protein is detected (Fujii, S. et al (1991) Virchows Archiv A, Pathological Anatomy & Histopathology 419, 317-427). Reactive oxygen intermediates (ROIs) consisting of hydrogen peroxide, hydroxy radicals and superoxide anions are essential components for oxidative metabolism (Halliwell, B., Gutteridge, J.M.C. (1990) Methods Enzymol 186, 1-85). An important source of ROI is mitochondria (Turens, J. F., Boveris, R. (1980) Biochem. J. 191, 421-427). In general, ROI is cytotoxic and has been reported to act as a signal transducer of TNT-induced gene expression (Schulze, O. K. et al (1993) EMBO, J. 12, 3095-3104). Thioredoxin can reduce hydrogen peroxide and remove free radicals (23-25). Using the affinity purified antibody of Trx2, we demonstrated that thioredoxin is present in the mitochondria and the mature protein has a molecular weight of 13 kD. Trx2 present in mitochondria is more resistant to oxidation than Trx1 and may explain high expression in cardiac and skeletal muscle tissue with high metabolic activity and impart important regulatory and / or protective functions.

[order]

Claims (40)

An isolated nucleic acid molecule comprising at least a portion of the nucleic acid sequence shown in FIG. 1A or 9. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is cDNA. The nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid molecule has a sequence homology of 87.4% or more. The nucleic acid molecule according to any one of claims 1 to 3, wherein the isolated nucleic acid molecule is derived from a mammal. The nucleic acid molecule of claim 4, wherein the mammal is a rat. The nucleic acid molecule of claim 4, wherein the mammal is a human. An isolated human nucleic acid molecule obtained by using the nucleic acid molecule according to claim 1. Protein or polypeptide encoded by the nucleic acid molecule according to any one of the preceding claims. The protein or polypeptide of claim 8 comprising at least a portion of the amino acid sequence shown in FIG. 1A or 10. A composition comprising a protein or polypeptide according to claim 8 or 9, wherein said protein or polypeptide is free of free radicals. A composition comprising the protein or polypeptide according to any one of claims 8 to 10, wherein said protein or polypeptide is capable of regenerating a damaged protein. A composition comprising the protein or polypeptide according to any one of claims 8 to 11, wherein said protein or polypeptide is involved in the control of pain in an organism. A composition consisting of the protein or polypeptide according to any one of claims 8 to 12, wherein said protein or polypeptide provides protection against oxidative stress leading to cytotoxicity and tissue damage. A composition consisting of the protein or polypeptide according to any one of claims 8 to 13, wherein said protein or polypeptide provides protection against ischemic damage to organs. A composition comprising the protein or polypeptide according to claim 14, wherein the protein or polypeptide attenuates ischemic reperfusion injury. A composition comprising the protein or polypeptide according to any one of claims 8 to 15, wherein the protein or polypeptide consists of a protective compound against heart attack or heart attack. A composition consisting of the protein or polypeptide according to claim 8, wherein the protein or polypeptide protects the retinal cells from damage caused by active oxidation species during oxidative stress on the retina. 18. A composition comprising the protein or polypeptide according to any one of claims 8 to 17, wherein the protein or polypeptide consists of a radio-protecting compound that attenuates the radiation effect. A composition comprising the protein or polypeptide according to any one of claims 8 to 18, wherein said protein or polypeptide protects neuronal cells from oxidative damage. 20. A composition comprising the protein or polypeptide according to any one of claims 8 to 19, wherein the protein or polypeptide is capable of limiting or eliminating the side effects of a medicament due to the generation of reactive oxygen species. . A mature protein, fragment, mole or homologue of a protein according to claim 8, which is at least functionally similar to Trx2. The mature protein of claim 21 comprising an amino acid sequence of Thr 59 to amino acid 166 of FIG. 1A. The mature protein of claim 21 comprising an amino acid sequence of Leu59 to amino acid 166 of FIG. 10. A plasmid or other vector comprising the nucleic acid molecule according to any one of claims 1 to 7. A host cell having a plasmid according to claim 24 or another vector. The host cell according to claim 25, wherein said host cell is a mammalian cell, a bacterial cell or an insect cell. An antibody against a protein or polypeptide according to any one of claims 8 to 23. A diagnostic probe comprising any portion of a protein or polypeptide according to any one of claims 8 to 23. 24. A diagnostic test, assay or monitor method using the protein or polypeptide according to any one of claims 8 to 23 or fragments thereof. A diagnostic test, analysis or monitoring method using a probe consisting of at least a portion of a nucleic acid molecule according to any one of claims 1 to 7. 31. The method according to claim 29 or 30, wherein the test method, assay and monitor method is for testing, analyzing and monitoring microorganisms, animal cells or biodiagnosis. Preparation of a protein or polypeptide according to any one of claims 8 to 23 by chemical or biological methods. An organism comprising or overexpressing a protein or polypeptide according to any of claims 8 or 23. An organism that has been processed to produce Trx2 encoded by the nucleic acid molecule according to claim 1. The organism of claim 33 or 34, wherein the organism is a bacterium or a human. The organism of claim 33 or 34, wherein the organism is a rat or human species. A method of treating a patient with ischemia injury or retinal injury, which comprises feeding a subject a pharmaceutical composition consisting of the protein or polypeptide according to any one of claims 8 to 23. A method of treating a patient with oxidative stress that induces cytotoxicity and tissue damage, comprising feeding to a subject a pharmaceutical composition comprising a protein or polypeptide according to any one of claims 8 to 23. A method of controlling pain in a patient, comprising feeding to a subject a pharmaceutical composition comprising a protein or polypeptide according to any one of claims 8 to 23. A method of protecting against heart attack or heart attack damage in a patient, comprising feeding a pharmaceutical composition comprising the protein or polypeptide according to any one of claims 8 to 23 to a subject.