KR20000053140A - Herbicide resistant plants - Google Patents

Abstract

PURPOSE: Provided is recombinant DNA technology, and in particular the production of transgenic plants which exhibit substantial resistance or substantial tolerance to herbicides when compared with non transgenic like plants. CONSTITUTION: Inter alia, a polynucleotide comprises at least a first region encoding a first protein capable of conferring on a plant, or tissue comprising it, resistance or tolerance to a first herbicide, and a second region encoding a second protein likewise capable of conferring resistance to a second herbicide, with the provisos (i) that the polynucleotide does not encode a fusion protein comprising only a 5-enol-pyruvyl-3-phosphoshikimate synthetase (EPSPS) and a glutathione S transferase (GST); (ii) that the polynucleotide does not comprise only regions encoding superoxide dismutase (SOD) and glutathione S transferase (GST); and (iii) that the polynucleotide does not comprise only regions encoding GST and phosphinothricin acetyl transferase (PAT).

Description

Herbicide-tolerant Plants {HERBICIDE RESISTANT PLANTS}

The present invention is directed to recombinant DNA techniques, in particular the preparation of transgenic plants that exhibit significant resistance or significant resistance to herbicides when compared to non-transgenic plants.

When herbicides are applied, plants that substantially "endure" herbicides exhibit a shifted usage / response curve to the right compared to those obtained by nontransgenic plants exposed to similar environments. This use / response curve plots “usage” on the x-axis and “percent eradication”, “herbicide effect”, etc. on the y-axis. A tolerant plant will require more herbicide to see a given herbicidal effect than an unbearable plant. About herbicides Substantially "resistant" plants show little firmness, cytolytic or whitening, even when the herbicides of the concentrations and proportions commonly used in rural areas are killed to kill weeds in the field. Plants resistant to herbicides are also resistant to herbicides. The terms "resistance" and "resistant" may be engraved as "resistant and / or resistance" in the present application.

The present invention provides that (i) the polynucleotide does not encode a fusion protein comprising only 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) impart at least a first herbicide resistance or resistance to a plant or tissue provided that the polynucleotide does not comprise only a region encoding GST and phosphinothricin acetyl transferase (PAT) Provided is a polynucleotide comprising a first region encoding a first protein present and a second region encoding a second protein capable of conferring resistance to a second herbicide.

In a preferred embodiment of the invention the regions that the polynucleotide comprises are under the control of expression of the operable plant promoter and terminator, respectively. Such promoters and modulators are well known to those skilled in the art of selecting them for their particular needs. For example, suitable promoters include 35s CaMV or FMV promoters and Arabidopsis and corn ubiquitin promoters. The promoter is preferably a constituent. This means that there is no need to induce externally, so it is either permanently resistant or resistant to each corresponding herbicide. In addition, under the control of inducible promoters, DNAs encoding herbicide resistance genes may be included in plant transformation vectors to confer inducible herbicide tolerance to transgenic plants. Such promoters include known chemically inducible GST-27 promoters that can be changed in resistance by applying a suitable inducer (such as a chemical stabilizer). In some cases, the ability to express or increase herbicide tolerance only when needed may be advantageous. For example, if the crop is replaced, the first crop will be individually grown in the field where the second crop will be cultivated next year. Herbicides may be used to destroy sensitive "native" plants that are still not induced. Subsequently, plants produce resistant polypeptides only when needed, so in some cases it may also be metabolically more effective to induce herbicide resistance gene expression only when herbicide tolerance is needed (ie, just prior to herbicide application). Suitable inducible promoters are also tetracycline-inducible promoters, rack bacterial suppressor / operator systems, glucocorticoid receptors, copper and salicylic acid-inducible promoters, ecdysone as described in International Patent Application No. PCT / GB96 / 01195. Recipients and promoters based on so-called Alc promoters as described in WO93 / 21334.

In a particularly preferred embodiment of the invention, one or more of the regions that the polynucleotide comprises provides resistance to pre-emergency herbicides and one or more of the regions provides resistance to post-emergence herbicides. A person skilled in the art will not need the definition of pre-emergence and post-emergence, but "pre-emergence" means that the germinating seed is applied before it appears on the soil surface, ie before any plants appear on the ground. Post appearance means germination is visible on the soil surface and then applied.

Pre-expressing herbicides are tetrazolines, including dinitroaniline herbicides, bromasil, flupoxam, picloram, fluorochloridone, N-carbamoyltetrazolinones such as those described in EP-A-612735. Paddy, Sulcatinone, Norflurazon, RP201772, Atrazine or other triazine, Iminothiadozole, Diflufenicone, Sulfonyl urea, Imidazolinone, Thiocarbamate, Triazine, Uracil, Urea, Triketone, Isoxazoles, acetanilides, oxadiazoles, phosphosulfonate herbicides described in EP-A-511,826, oxiacetamides such as triazinone, sulfonanilides, amides, flutiamides, anilides and triazolinone type herbicides You will be able to choose from the groups that take place. Examples of triketone herbicides include 2- (2-nitro-4-trifluoromethylbenzoyl) -cyclohexane-1,3-dione, 2- (2-chloro-4-methanesulfonylbenzoyl) -cyclohexane-1 , 3-dione, 2- (2-2 nitro-4-methanesulfonylbenzoyl) -cyclohexane-1,3-dione, [5-cyclopropyl-4- (2-methylsulfonyl-4-trifluoro Methylbenzoyl) isoxazole and the like. For clarity, "triketone herbicide" refers to a compound that is capable of inhibiting 4-hydroxyphenyl pyruvate (or pyruvic acid) deoxygenase (HPPD). In the present invention, 4-hydroxy phenyl pyruvate (or pyruvic acid) deoxygenase (HPPD) and p-hydroxy phenyl pyruvate (or pyruvic acid) deoxygenase (p-OHPP) are synonymous.

Post-expressing herbicides are glyphosate and salts thereof, glufosinate, diphenyl ether, asulam, bentazone, bialaphos, bromasil, cetoxydim or other cyclohexanedione, dicamba, fosamine, flupoxam , Phenoxy propionate, quizallofo or other aryloxy-phenoxypropanoate, picloram, fluormethrone, atrazine or other triazines, metrizine, chlorimuron, chlorsulphron, flumetsulam , Halosulfuron, sulfomethron, imazaquin, imazuetafir, isoxaben, imazamox, metosullam, pyritrobac, rimsulfuron, bensulfuron, nicosulfuron, pomessafen, fluloglycopene, It may be selected from the group consisting of KIH9201, ET751, carpentrazone, ZA1296, ICIA0051, RP201772, flurochloridone, norflurazone, paraquat, diquat, bromoxynil and phenoxaprop. Particularly preferred combinations of these herbicides to which the polynucleotides of the present invention can tolerate (or tolerate the plants of the present invention) include (i) glufosate and diphenyl ether or acetanalide herbicides; (ii) glyphosate and / or glufosinate and anilide and / or triazolinone herbicides; (iii) triketones and glyphosate and / or glufosinate; (iv) glyphosate and / or glufosinate and triketone and anilide herbicides; (v) glyphosate and / or glufosinate and PDS inhibitors (such as the compounds of formulas (1)-(3) described below).

Proteins encoded by the polynucleotide region include glyphosate oxidase-reductase (GOX), 5-enol-pyruville-3-phosphosikimate synthase (EPSPS), phosphinothricin acetyl transferase (PAT) ), Hydroxyphenyl pyruvate deoxygenase (HPPD), glutathione S transferase (GST), cytochrome P450, acetyl-COA carboxylase (ACC), acetolactate synthase (ALS), protophorinogen oxadase ( protox), dihydroteroate synthase, polyamine transporter protein, superoxide dismutase (SOD), bromocinyl nitrilease (BNX), phytoene desaturase (PDS), Alcaligenes eutrophus It may be selected from the group consisting of tfdA gene products and mutated or modified variants of these proteins. The tfdA gene product is a deoxygenase capable of oxidizing phenoxycarboxylic acids. The EPSPS enzyme may be a so-called class II EPSPS as described in European Patent No. 546,090. Alternatively and / or it may also be mutated to include amino acid substituents known to enhance glyphosate (and its agriculturally acceptable salts) resistance at some location. For example, the EPSPS described in SEQ ID NO: 9 bounded with (i) Thr 174-Ile, (ii) Pro 178-Ser, (iii) Gly 173-Ala, and (iv) Ala 264-Thr is at least for EPSPS. And may have residues Thr, Pro, Gly, and Ala at positions corresponding to 174, 178, 173, and 264, wherein (i) Thr 174 is contiguous in the sequence comprising Ala-Gly-Thr-Ala-Met. Occurs in; (ii) Pro 178 occurs in a sequence that contiguously contains Met-Arg-Pro-Leu-Thr; (iii) Gly 173 occurs in a sequence comprising Asn-Ala-Gly-Thr-Ala contiguously and (iv) Ala 264 occurs in a sequence containing Pro-Leu-Ala-Leu-Gly adjacent . And the terminal Gly residue in the Glu-Arg-Pro-AA1-AA2-Leu-Val-AA3-AAA4-Leu-AA5-AA6-AA7-Gly motif sequence in the EPSPS enzyme region corresponding to spanning position 192-232 in SEQ ID NO: 9. May be replaced with an Asp or Asn residue.

In one embodiment of the polynucleotide the region encoding the HPPD enzyme is 60-in 0.3 strength citrate buffered saline having the sequence set forth in SEQ ID NO: 1 or 3 or otherwise containing 0.1% SDS. Incubated at 65 ° C. and then complemented with rinsing at the same temperature with 0.3 strength citrate buffered saline containing 0.1% SDS hybridization with the sequences set forth in SEQ ID NO: 1 or 3, respectively.

When the test sequence and the present invention sequences are double stranded, the nucleic acid constituting the test sequence has a TM within 15 ° C. of the nucleic acid of SEQ ID NO: 1. When the test sequence and sequence number 1 (or test sequence and sequence number 3) are mixed and denatured simultaneously, the TM value of the sequence is preferably within 5 ° C., respectively, more preferably the test sequence or the inventive sequence is supported. Hybridization under relatively stringent conditions. The modified test sequence or inventive sequence is therefore preferably first supported and subjected to hybridization for a certain time at a temperature of 60-65 ° C. If the hybridization comprises part of the sequences of the invention, the hybridization conditions may be less stringent, as will be apparent to those skilled in the art.

If the polynucleotide contains an HPPD gene capable of conferring resistance to a triketone herbicide, then the transformed plant will add a triketone herbicide to it to change the color between the transformed and the untransformed. Based on this, it can be visually selected. Thus, untransformed can become white or remain in the selection process, whereas transformed can become white and remain green or green later when the selection procedure is performed.

Another embodiment of the polynucleotides of the invention also includes a region encoding a protein that can provide a plant that is resistant to insects, dehydration and / or fungus, bacterial or viral infections. Proteins encoded by these regions are known to those skilled in the art and include delta endotoxins obtained from Bacillus thuringiensis and coated proteins obtained from, for example, viruses.

The polynucleotide may comprise the contiguous 5 ′ sequence, which sequence comprises: (i) a peptide capable of targeting the translation product of the region with a plastid such as chloroplast, mitochondria, other cell organelles or plant cell wall (ii) Encode untranslated translation enhancing sequences. Translation expression of a protein encoding a sequence contained within a polynucleotide may be augmented by introducing a known untranslated translation enhancing sequence 5 ′ of the protein coding region. Those skilled in the art will be familiar with such augmentation sequences, including TMV-derived sequences known as omeras and omega primes and other sequences that can be derived from region 5 ′ of other viral coat protein coding sequences, in particular other Tobacco Etch viruses. do. In view of nucleotide sequence expression, it may be desirable to modify the sequence encoding a known protein that may confer resistance to herbicides. Thus, the present invention also provides a condition in which, when the modified polynucleotide contains a desired plant codon, the identity of the protein coding region in the modified polynucleotide and the protein coding region inherent in the protein and substantially the same protein coding region is less than about 70%. Nucleotides as indicated above, but this is an expression of modified polynucleotides in plants or modified to remove mRNA instability motifs and / or unexpected contacts, such that the protein coding region of the unmodified polynucleotide is endogenous Preferred plant codons are used so that substantially similar proteins are obtained which have substantially similar activities / actions as obtained by the fuming of unmodified polynucleotides in the organism.

The invention also includes a vector comprising said polynucleotide.

The present invention also provides a plant comprising two or more nucleotide sequences encoding proteins that are regenerated in transformed with the vector or polynucleotide of the invention and which can confer resistance to two or more herbicides. Transformation techniques are well known and small particle-mediated bioistic transformation, Agrobacterium-mediated transformation, protoplast transformation (optionally in the presence of polyethylene glycol); Sonication of plant tissues, cells or protoplasts in a medium comprising polynucleotides; Micro-insertion of polynucleotides into topipotent plants (using any known silicon carbide “whisker” technique), electroporation, etc. Transformed inventive plants include small grain cereals, oil seed crops, fiber plants, Fruits, vegetables, cultivated crops, and trees are particularly preferred, such as soybeans, cotton, tobacco, sugar beets, oilseed rape, canola, flax, sunflower, potatoes, tomatoes, alfalfa, lettuce, corn, wheat, daggers, Oats, bananas, barley, oats, grass, forage, sugar cane, peas, field beans, rice, pine, poplar, apples, grapes, tangerines or peanut plants and products, seeds and organs of these plants.

The invention also does not contain a polynucleotide encoding a fusion protein comprising only (i) 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione S transferase (GST); (ii) contain no polynucleotide comprising only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) contain no polynucleotide comprising only a region encoding GST and phosphinothricin acetyl transferase (PAT); (iv) where the plant from which the material is derived is sugar beet, a region encoding at least two proteins capable of conferring at least two herbicide tolerance to the material, provided that the genes that confer the herbicide tolerance it contains are not only EPSPS and PAT; Provided is a plant material comprising a nucleic acid sequence comprising.

The material may be recycled into the whole plant in its normal form by methods known to those skilled in the art. In an embodiment of the preferred material, at least one region encodes a protein capable of conferring resistance to pre-emergency herbicides and at least one region encodes a protein capable of providing resistance to post emergent herbicides. Such protein coding regions and herbicides have been discussed above. Those skilled in the art will appreciate that a first plant comprising a polynucleotide encoding a first protein capable of conferring resistance to a first herbicide and a polynucleotide encoding a second protein capable of conferring resistance to a second herbicide It will be appreciated that as a result of the crosslinking of the second plant (see experimental part of the application), there may be a region in the plant (or part thereof) that confers multiple herbicide tolerance. Preferred combinations of herbicide tolerance endogenous genes include (i) the HPPD gene and the EPSPS or GOX genes; (ii) HPPD gene and PAT gene; (iii) GST gene and EPSPS / GOX gene; (iv) EPSPS / GOX gene and PAT gene; (iv) HPPD gene, GOX and / or EPSPS gene and PAT gene; (v) ACC'ase genes and PAT and / or EPSPS genes; (vi) the PDS gene and the PAT and / or EPSPS and / or GOX genes; (vii) Alcaligenes eutrophus and tfdA gene obtainable from EPSPS and / or GOX and / or PAT and / or PDS genes. Each combination of these may also have one or more herbicide genes replaced by SOD, Protox and / or ALS genes. Such plants are referred to in the present application as plants of the invention.

The present invention also includes a method of selectively inhibiting weeds in a field comprising weeds and crop plants, wherein the crop plants comprise (I) (i) polynucleotides of 5-endo-pyruville-3-phosphosikimate syntha Not encode a fusion protein comprising only (EPSPS) and glutathione S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) the polynucleotide does not contain only a region encoding GST and phosphinothricin acetyl transferase (PAT); (iv) if the crop plant is sugar beet, a first protein capable of conferring at least a first herbicide to a plant or tissue comprising the same, provided that the genes that confer the herbicide tolerance it contains are not only EPSPS and PAT. A polynucleotide comprising a first region encoding and a second region encoding a second protein capable of conferring resistance to a second herbicide; Or (II) (i) the polynucleotide does not encode a fusion protein comprising only 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) the polynucleotide does not contain only a region encoding GST and phosphinothricin acetyl transferase (PAT); And (iv) a first protein capable of conferring at least a first herbicide to a plant or tissue comprising the same, provided that the gene that confers the herbicide tolerance it contains is not only EPSPS and PAT if the crop plant is sugar beet. A polynucleotide comprising a first region encoding a polynucleotide and a polynucleotide comprising a second region encoding a second protein capable of conferring resistance to a second herbicide such that the method is substantially effective for crop plants. And applying at least one of the herbicides to the field in an amount sufficient to inhibit weeds without affecting. Genes that confer herbicide tolerance may be present on separate polynucleotides in plants. In a preferred embodiment the plant contains genes encoding EPSPS and / or GOX enzymes and HPPD enzymes and the method uses glyphosate and triketone herbicides in an amount sufficient to inhibit weeds without substantially affecting the crop plants. Application to the field. In an embodiment of another method, the plant contains genes encoding EPSPS and / or GOX enzymes and phosphinothricin acetyltransferase and the method comprises applying glyphosate and glufosinate to the field. In another embodiment embodiment, the plant contains genes encoding EPSPS and / or GOX enzymes and phosphinothricin acetyl transferases and HPPD enzymes and the method comprises glyphosate and glufosinate and triketone herbicides in the field. Application. In another embodiment of the method, the plant contains a gene encoding EPSPS and / or GOX enzymes and / or phosphinothricin acetyl transferase and glutathione S transferase and the method comprises glyphosate and / or glufosinate and Application of an anilide herbicide such as, for example, acetochlor to the field. In another embodiment, the plant contains a gene encoding an ACC'ase and a PAT and / or EPSPS enzyme and the method comprises applying a fluazopif herbicide and glufosinate and / or glyphosate to the field. Include. In an embodiment of another method, the plant contains a gene encoding a product of an EPSPS and / or GOX and / or PAT and / or PDS enzyme and an tfdA gene (optionally optimized codon) obtainable from Alcaligenes eutrophus and the method comprises Application of herbicide inhibitors of 2,4D and glyphosate and / or glufosinate and / or phytoene desaturase to the field. Each of these combinations may also have one or more herbicide genes replaced by SOD, Protox and / or ALS genes.

In a particularly preferred embodiment of the invention, an effective amount of one or more pesticides, fungicides, bacteria, nematicides and antiviral agents is applied to the field before and after applying the one or more herbicides to the field.

The present invention also provides a method for preparing plant material comprising (i) transforming a plant material with a vector or polynucleotide of the present invention; plant that is substantially resistant or substantially resistant to two or more herbicides, the method comprising the steps of: (ii) selecting such transformed material and (iii) regenerating the selected material into the normal form of fertile whole plants. Provide a way to get it.

The plant of the present invention optionally transforms the first plant material with a first herbicide tolerance sequence, transforms a second plant material with a second herbicide tolerance sequence, and regenerates the transformed material into a fertile whole plant. And cross-crossing the plant to obtain a product comprising both the first and second herbicide tolerance genes. Optionally, the first and / or second material comprises a poly that comprises a region encoding one or more herbicide tolerance proteins, pesticidal proteins, antibacterial proteins, antiviral proteins and / or proteins that can confer improved dehydration resistance to plants. It may be pre-transformed with nucleotides.

The present invention also provides the use of the vector or polynucleotide of the invention to obtain plant tissues that are substantially resistant or substantially resistant to two or more herbicides and / or normal forms of fertility.

The present invention also provides the use of the vectors or polynucleotides of the present invention to obtain herbicidal targets for large selection of potential herbicides in vitro. The protein coding region of the polynucleotide may be heterologous expressed in E. coli or yeast.

The invention also encompasses plant tissues transformed with polynucleotides that encode a deoxygenase and comprise the sequence set forth in SEQ ID NO: 1. This may be the only herbicide tolerance endowment gene in the material. The material may be regenerated metabolically into normal fertility plants using known methods. In a particularly preferred embodiment of the transformed tissue, the polynucleotide encoding a protein having an activity substantially similar to that encoded by SEQ ID NO: 1 is 60 in 0.3 strength citrate buffered saline containing 0.1% SDS. Complement to hybridization with the sequence described in SEQ ID NO: 1 when incubated at a temperature of -65 ° C and then rinsed with 0.3 strength citrate buffered saline containing 0.1% SDS at the same temperature.

The invention will also be apparent from the following description taken in conjunction with the drawings and sequence listing.

SEQ ID NO: 1 shows a DNA sequence isolated from Synechocystis sp encoding an enzyme with p-hydroxyphenyl pyruvic acid deoxygenase activity (described in SEQ ID NO: 2).

SEQ ID NO: 3 shows that Pseudomonas spp. Nucleotide 1217-2290 encodes an enzyme (described in SEQ ID NO: 4) having p-hydroxyphenyl pyruvic acid deoxygenase activity. DNA sequence isolated at 87/79 is shown.

SEQ ID NOs: 5 and 6 represent one form of the minimally overlapping synthetic PCR primer (see references below HPPD-P4 and HPPD-REV1) used to separate sequence 3 from the bacterial genome.

SEQ ID NOs: 7 and 8 are also synthetic PCR primers used to modify SEQ ID NO: 3 to incorporate into the intended plant transformation vector.

SEQ ID NO: 9 shows the amino acid sequence of an EPSPS enzyme (including chloroplast signal peptide) obtained from petunia.

SEQ ID NOs: 10-32 are PCR primers or poly-linkers inserted into restricted plasmids that allow for the preparation of constructs comprising multiple genes capable of conferring resistance to herbicides.

FIG. 1 shows a schematic diagram of a clone comprising the sequence set forth in SEQ ID NO: 3, wherein three open reading frames have been identified, number 1 starting at nucleotide 15 at SEQ ID NO 3 and ending at 968; Starting at nucleotide 215 and ending at nucleotide 1066 and ending at nucleotide 1217 at ending 290. This figure also shows restriction sites contained within sequences designed for use of the primers designated SEQ ID NOs: 7 and 8. FIG. 2 schematically illustrates the preparation of a plant expression cassette containing 4-HPPD limited to enzymes Nco1 and Kpn1 and then also ligated into a vector (pMJB1), also limited to Nco1 and Kpn1. FIG. 3 is a schematic diagram showing how the plant transformed binary vector pBin 19 is designed to contain the 4-HPPD expression cassette of FIG. 2.

4 is a schematic diagram of a clone comprising the sequence set forth in SEQ ID NO: 1. FIG. 5 schematically illustrates the preparation of a plant expression cassette containing 4-HPPD, wherein the PCR edited DNA fragment of FIG. 4 is restricted to enzymes Nco1 and Kpn1 and then ligated into a vector (pMJB1) also limited to Nco1 and Kpn1.

FIG. 6 schematically shows the structure of plasmid vectors used for Agrobacterium transformation and includes maps of plasmids pJR1Ri and pGST27Bin.

7 shows GST activity in transformed tobacco coated with four herbicides.

FIG. 8 is a graph comparing damage to GST-27 line and wild type plants after metolachlor treatment at 1400 g / ha for 3 weeks.

9 is a map of plasmid pDV3-puc.

10 is a map of plasmid pDV6-Bin.

FIG. 11 is a map of plasmid pUB-1 containing a PCR ubiquitin promoter fragment obtained from corn and the 2Kb fragment was cloned into pUC and sequenced junctions to confirm the presence of ubiquitin promoter.

12 is a map of plasmid pIE98.

13 is a map of plasmid pIGPAT.

14 is a map of plasmid pCAT10.

15 is a map of plasmid pCAT11.

16 is a map of plasmid pPG6.

Figure 17 shows a portion of the pMVl plasmid.

Example 1

Cloning of the 4-HPPD Gene from Pseudomonas spp, Transformation of the Gene into Plant Material and Preparation of Triketone Herbicide Tolerant Plants

The amino acid sequence of 4-HPPD purified from Pseudomonas fluorescens PJ-874 and grown on tyrosine as the only carbon source is known (Ruetschi et al., Eur. J. Biochem 1992 202 (2): 459-466). These sequences are used to designate minimally overlapping PCR primers to amplify large but incomplete segments of 4-HPPD from genomic DNA obtained from different bacterial strains (Pseudomonas fluorescens strain 87-79). One skilled in the art will know what "minimally overlapping primers" mean, but the redundancy is indicated in square brackets in the sequence described below. Each of SEQ ID NOs 3 and 4 is given an example of each representative primer (corresponding to the 5 'and 3' positions in the HPPD gene).

From the knowledge of the sequences of amino acids 4-9 of the published protein sequence (see above), primer 1 (SEQ ID NO: 5), which is 17mers, is designated and primer 2 (SEQ ID NO: 6), which is also 17mers, is given the knowledge of residues 334-339. Is specified.

Primer 1 (HPPD-P4) has the sequence 5'TA [T / C] GA [G / A] AA [T / C] CC [T / C / G / A] ATGGG and Primer 2 (HPPD-REV1) SEQ ID NO: 5'GC [T / C] TT [G / A] AA [G / A] TT [T / C / G / A] CC [T / C] TC. 100 ng of genomic DNA from Pseudomonas 87-79 was prepared using standard protocols and mixed with 100 pmol of each primer. The mixture is PCR amplified (35 times) using Taq polymerase and other standard reagents under the following DNA synthesis and dehydration conditions (94 ° C. 1.5 min, 55 ° C. 2 min, 74 ° C. 3 min).

The amplified fragment comprises a region containing three codons from the 5 'end of the coding region of the 4HPPD gene and about 30 codons from the 3' end. PCR products are blunt-ended cloned in vector pGEM3Z-f (+) using standard procedures.

Partial sequencing confirmed that the cloned PCR cloned PCR fragment is 4-HPPD specific. The derived amino acid sequence contains several inconsistencies compared to the published sequence for the Pseudomonas fluorescens PJ-874 enzyme. Partial fragments of this 4-HPPD gene give negative hybridization signals in genomic southern blots for plant DNA under moderate hybridization / wash conditions. A 900 bp EcoR1 / EcoR1 fragment is cut at the center of the previously cloned partial gene and used as a probe. Southern blots using various enzymes to limit genomic DNA are hybridized with radiolabeled fragments.

The Bcl1 restricted DNA shows a single positive band of about 2.5 kb, which is sufficient to contain the flanks and the entire gene of untranslated DNA. Genomic DNA is electrophoresed on agarose gels prepared limited to Bcl1. The fragment containing the catalyzed DNA is cut to a size of 2-3 Kb to elute the DNA electrically. The recovered DNA is cloned into the BamH1 (compatible with Bcl1) site of pUC18. Clone blots were probed with 900bp fragments to separate 12 positive ones. They make minipreps and cut them with EcoR1 to find the 900bp band. Seven of the 12 clones form brown pigments when grown overnight in LB to produce minipreps, five of which are positive for the 900 bp band and the other five minipreps are negative and do not produce brown pigments. Formation of "brown pigment" is related to heterologous expression of 4-HPPD.

Restriction analysis indicated that the cloned insert was 2.5 kb in length with about 1.2 kb of 4-HPPD gene DNA upstream and 400 bp downstream. The ends of the genes are sequenced using appropriate primers and primers obtained from pUC18. This sequencing indicates that the gene is intact, bidirectional with respect to the pUC18 polylinker site.

SDS-PAGE on bacterial cell lysate indicated that a new protein for 4-HPPH was present at the size of 40 kDa. There is a large band in the extract obtained from the cell with the gene inserted in the first direction so that the gene can be expressed from the Flock promoter in the vector. When lysate is obtained from cells with opposite genes, both clones do not clearly show a 40 kD band, although they produce a brown pigment that suggests the presence of active protein in both cell types. The 40 kDa recombinant protein is present in the soluble portion rather than the insoluble protein portion. Clones in which the gene is in the second direction are automated DNA sequence analysis to reveal the sequence described in SEQ ID NO: 3. Some unique restriction sites that edit this sequence to facilitate its assembly are introduced into a vector suitable for plant transformation operations. The edited oligonucleotides described in SEQ ID NOs: 7 and 8 are Primer 3 (HPPDSYN1) 5'-GTTAGGTACCAGTCTAGACTGACCATGGCCGACCAATACGAAAACC-3 'and Primer 4 (HPPDSYN2) 5'TAGCGGTACCTGATCACCCGGGTTATTAGTCGGTGGTCAGTAC-3'.

Expression of Pseudomonas-4HPPD Gene in Transgenic Tobacco

The PCR edited DNA fragment is restricted to the enzymes Nco1 and Kpn1 and then ligated into a vector (pMJB1) that is also limited to Nco1 and Kpn1. pMJB1 is a double CaMV35S promoter; PUC19 derived plasmid containing TMV omega enhancer and NOS transcription terminator. The approximate appearance of the resulting plasmid is shown in FIG. All DNA manipulations use standard protocols known to those skilled in the plant molecular biology art.

Bulk DNA is isolated to partially cleave the 4-HPPD expression cassette (ie 2 × 35S − nos 3 ′ terminator) by restriction EcoR followed by complete cleavage with Hind3. This avoids cleavage at the EcoR1 site in the 4-HPPD gene. After preliminary agarose gel electrophoresis, the intended DNA fragments are recovered by electro-elution.

The 4-HPPD expression cassette is then ligated into a binary vector limited to Hind3 and EcoR1. The structure of the resulting plasmid is shown approximately in FIG.

DNA is isolated and Agrobacterium tumefaciens LBA4404 is transformed to kanamycin resistance again using standard procedures. Agrobacterium-mediated leaf discs / slices of Nicotiana plumbaginifolia var Samsun are transformed using standard procedures. From kanamycin resistant callus, transformed shoots are regenerated. The shoots are sown on MS agar containing kanamycin. The surviving rooted explants are rerooted to obtain about 80 kanamycin resistant transformed tobacco plants. The presence of the 4-HPPD gene (using pre-existing EDIT primers) is verified by PCR. About 60 plants are PCR positive.

Explants (ie short stem portions containing leaves + lateral buds) are placed in MS agar (+ 3% sucrose) containing ZA1206 (triketone herbicide) at various concentrations of 0.02-2 ppm. Untransformed tobacco explants are fully colored to 0.02 ppm. They do not recover after long exposure to herbicides. In these particular experiments, only the buds grown in buds are labeled and the leaves of the explanted tissue remain green.

About 30 PCR + ve transformed plants tolerated 0.1 ppm of ZA1296 (about 5 times the level causing signs on wild tobacco) without bleaching. They are normally rooted and indistinguishable from untransformed plants in phenotype. Some of the transformants tolerated 0.2 ppm and some transformants tolerated concentrations below 0.5-1 ppm. These plants also look normal and take root well in the presence of herbicides. Some transformed plants can be initially bleached with high concentrations of herbicide, but gradually "go green" and recover from prolonged exposure.

A portion of the herbicide resistant transgene plant is treated with the known herbicide Isoxaflutole [5-cyclopropyl-4- (2-methylsulfonyl-4-trifluoromethylbenzoyl) isoxazole or RPA 210772]. These plants are much more resistant to herbicides than to what is called ZA1296, which clearly shows that they are cross-resistant to several classes of 4-HPPD inhibitors.

Example 2

Cloning the 4-HPPD gene from Synechocystis sp into plant material and regenerating the material to obtain triketone herbicide resistant plants

The Synechocystis sp genome, PCC6803, was sequenced. In order to introduce unique restriction sites that will facilitate their assembly into a vector suitable for plant transformation operations, appropriate DNA synthesis and dehydration conditions (general: 94 ° C. 1.5 min, 55 ° C. 2 min, 74 ° C. 3 min) 100 ng of DNA obtained from Synechocystis sp was prepared using the standard protocol and PCR amplification of the sequence specified in SEQ ID NO: 1 using thermostable DNA polymerase and other standard reagents, preferably with test read activity. Mix with two primers of 100 pmol.

The amplified fragment comprises a region containing the coding region of the 4-HPPH gene. PCR products are blunt-ended at end ends in standard vectors such as, for example, pGEM3Z-f (+) using standard procedures.

Automated DNA sequencing confirms that the cloned PCR product is 4-HPPH specific. Several transformed clones containing the cloned 4-HPPH gene produce a brown pigment when grown overnight in LB. The production of "brown pigments" is associated with heterologous expression of the 4-HPPH gene (Denoya et al. 1994 J. Bacteriol. 176: 5312-5319).

SDA-PAGE on bacterial cell lysate indicates that they contain new proteins with the expected molecular weight for the 4-HPPH gene product. In a preferred embodiment the recombinant protein is engineered to be in or so present in the soluble portion rather than the insoluble protein portion. Preferably, the clones are subjected to automated DNA sequence analysis to confirm that there is no PCR induced artificial structure.

Heterologous Expression of Synechocystis sp pcc6803 4-HPPH Gene in E. coli

PCR edited DNA fragments are restricted to appropriate enzymes such as Nco1 and Kpn1 and then ligated into, for example, an appropriately limited E coli expression vector (such as the series of forgotten pETs). All DNA manipulations use standard protocols known to those skilled in the art of molecular biology.

Suitable host strains, such as BL21 (DE3) or other DE3 microorganisms containing the vector, express an amount of HPPD enzyme sufficient for use in screening to identify another 4-HPPH inhibitor. HPPD purified from the transformed host strain may be used for the production of antisera for plant analysis transformed with polynucleotides encoding 4-HPPH.

Heterologous Expression of Synechocystis sp pcc6803 4-HPPH Gene in Transgenic Plants

PCR-edited DNA fragments are limited to suitable enzymes such as Nco1 and Kpn1 and then ligated into a suitable vector, such as, for example, pMJB1, to produce expression cassettes containing the appropriate plant's operable promoters and terminators. pMJB1 is a double CaMV35S promoter; PUC19 derived plasmid containing TMV omega enhancer and nos transcription terminator. The approximate appearance of the resulting plasmid is shown in FIG. 4.

The 4-HPPD expression cassette is then ligated into a binary vector limited to Hind3 and EcoR1. The structure of the resulting plasmid is shown approximately in FIG.

DNA is isolated and Agrobacterium tumefaciens LBA4404 is transformed to kanamycin resistance again using standard procedures. Potato and tomato tissues are transformed via Agrobacterium using standard procedures. From kanamycin resistant callus, transformed shoots are regenerated. The shoots are sown on MS agar containing kanamycin. The surviving rooted explants are rerooted to obtain about 80 kanamycin resistant transformed tobacco plants. The presence of the 4-HPPD gene (using pre-existing EDIT primers) is verified by PCR. A significant number of PCR positive plants are selected for further analysis.

Explants (ie short stem portions containing leaves + lateral buds) are placed in MS agar (+ 3% sucrose) containing ZA1206 (triketone herbicide) at various concentrations of 0.02-2 ppm. Untransformed explants are fully colored at 0.02 ppm. In these particular experiments, only buds grown in buds are bleached and leaves of explanted tissue remain green.

About 30 PCR + ve transformed plants tolerated 0.1 ppm of ZA1296 (about 5 times the level causing signs on wild tobacco) without bleaching. They are normally rooted and indistinguishable from untransformed plants in phenotype. Some of the transformants tolerated 0.2 ppm and some transformants tolerated concentrations below 0.5-1 ppm. These plants also look normal and take root well in the presence of herbicides. Some transformed plants can be initially bleached with high concentrations of herbicide, but gradually "go green" and recover from prolonged exposure.

A portion of the herbicide resistant transgene plant is treated with the known herbicide Isoxaflutole [5-cyclopropyl-4- (2-methylsulfonyl-4-trifluoromethylbenzoyl) isoxazole or RPA 210772]. These plants are much more resistant to herbicides than to what is called ZA1296, which clearly shows that they are cross-resistant to several classes of 4-HPPD inhibitors.

Example 3

Cloning the GST Gene into Plant Material and Regenerating Plants tolerated with Anilide and Diphenyl Ether Type Herbicides

Plant Nicotiana tabacum cv Samsum stems are maintained on Musharige and Skoog medium (MS medium: MS salt supplemented with 3% sucrose and 0.8% Bactoagar (4.6 g / l), pH 5.9). These plants, explants for rooting analysis and germination test seeds are grown in a culture room at 25 ° C. with light for 16 hours. When grown in a greenhouse, the plants are transferred to the culture soil (John Innes 3, Minster Brand product).

Bacterial strains Escherichia coli, (GIBCO BRL) strain DH5 is: F, 80d / acZ M15, (lacZYAargF) U169, deoR, recA1, endA1, hsdR17 a _{^{thi-gyrA96relA1 - (r K -}} , m K +), supE44,. Agrobacterium tumefaciens, strain LBA 4404, is used to transform tobacco leaves.

DNA of plasmid GST-27 is inserted into 2.961 kb pBluescript ™ II SK (+/-) phagemid designated pIJ21-3A (Jepson et al. 1994). pJR1Ri is a 12.6 kb plasmid. The pJR1Ri plasmid contains the bacterial canamycin resistance marker (KAN). It contains two repeat sequences of 25 bp, namely right (RB) and left (LB) borders. T-DNA contains the kanamycin resistance marker gene induced by the NOS promoter. The GST-27 protein coding sequence is expressed under the control of a CaMV 35S promoter.

1 kb of DNA ladder is used as DNA size marker (Bethesda Research Laboratories Life Technologies, Inc.) when size marker dihydrate and PCR (polymerase chain reaction) products are checked on an agarose gel. Rainbow protein molecular weight markers (Amersham) are loaded onto polyacrylamide gels for Western analysis as known to those skilled in the art.

Chemical active ingredients acetochlor, alachlor and metolachlor are manufactured by ZENECA Agrochemicals (UK) of Gillot Hill Research Station. Technical components are prepared in ethanol and used for HPLC analysis, rooting analysis and germination test (see below).

Plasmid Construction The plasmid pIJ21-3A, containing the DNA gene of GST-27, is catalyzed by the restriction enzyme EcoRI (Pharmacia) in 1 × Tris acetate (TA) buffer. Dihydrate is checked on 0.8% agarose gel. Fragments categorized with EcoRI fill the ends called Klenow DNA polymerase (Pharmacia) and then ligated into the Sma 1 (Pharmacia) site of pJR1Ri (FIG. 6). Calf-alkaline-phosphatase (CAP) enzymes block the self-ligation of pJR1Ri prior to the ligation of the GST promoter. Reactive E. coli cells (DH5) are transformed into plasmids by the blood shock method. They grow on L-agar and kanamycin plates. Positive clones are checked by hybridization or PCR overnight at 42 ° C. with labeled probes (α- ³² P dNTP). The melting point (Tm) of the probe is determined by adding 2 ° C for each A or T and 4 ° C for each G or C. The reaction is carried out at the lowest Tm-5C with Taq polymerase (Ampli-Taq DNA polymerase, Perkin Elmer Cetus) according to the manufacturer's protocol. PCR conditions were determined as 35 times as follows: DNA denaturation for 48 seconds at 94 ° C., 1 min anneal at the lowest Tm and 2.5 min extension at 72 ° C. The reaction starts at 85 ° C. before the first cycle.

Eight positive clones are selected and grown on overnight L-broth and kanamycin cultures. DNA from these cell cultures is extracted and then purified by centrifugation at 50,000 rpm on the CsCl slope.

The orientation of the insert in pJR1Ri is checked by sequencing the region between the GST gene and the 35S promoter according to the Sanger method using Sequenase ™ (version 2.0, United States Biochemical Corporation) following the manufacturer's protocol. Using the thawing method described by Hostlers et al. 1987, the resulting plasmid (pGST-27Bin) (Figure 6) is introduced into Agrochemical tumefaciens strain LBA4404.

Leaf Transformation with Agrobacterium The pGST-27Bin is transformed into tobacco according to the method described by Bevan 1984. Sterile cultures of 2-3 weeks old tobacco grown in MS are used for transformation. The leaves are incubated for 1 day on canamycin and NBM medium (MS medium supplemented with 1 mg / l 6-benzylaminopurine (6-BAP), 0.1 mg / l naphthalene acetic acid (NAA)). This medium allows the growth of shoots from the leaves. After a day, cut off the edges of the leaves and slice them. They are then co-incubated with transformed Agrobacterium cells containing suspension (strain LBA 4404), insert (pGST-27Bin) and pJR1RI plasmid for 20 minutes. The pieces are then returned to the plate containing the NBM quality. After 2 days, explants are transferred and cultured in pots containing NBM medium supplemented with canamycin (100 mg / l) and carbenicillin (500 mg / l). After 5 days, one shoot per leaf disc is transferred onto NBM medium supplemented with canamycin (100 mg / l) and carbenicillin (200 mg / l). After 2-3 weeks, shoots and roots are transferred to fresh medium. Transfer two slices from each shoot to separate pots. One is kept as a tissue culture stock and the other is rooted and transferred to soil for growth in the greenhouse. 42 independent transformants containing the GST-27 construct are transferred to the greenhouse.

Extraction of Leaf DNA for PCR Reaction The presence of the transgene in the putative transformant is confirmed by PCR. Leaf samples are taken from plants that have grown for 3-4 weeks under sterile conditions. Discoid leaves about 5 mm in diameter are ground for 30 seconds in 200 μl of extraction buffer (0.5% sodium dodecyl sulfate (SDS), 250 mM NaCl, 100 mM Tris HCl, pH 8). Samples are centrifuged at 13,000 rpm for 5 minutes, then 150 μl of isopropanol is added to the same volume top layer. Samples are placed on ice for 10 minutes, then centrifuged at 13,000 rpm for 10 minutes and stored dry. After the sample is resuspended in 100 μl of deionized water, 15 μl thereof is used for PCR reaction. PCR is performed using the conditions described by Jepson and co-author (1991). Plants transfected with GST-27 DNA had primers GSTII / 7 (AACAAGGTGGCGCAGTT) (SEQ ID NO. 10) having specificity in the 3 'region of the GST-27 region and NOS3 (CATCGCAAGCCCGGCAACAG) having specificity at the NOS terminator (SEQ ID NO: 11). Is analyzed). 42 of the first transformant provided 310bp fragments by PCR.

Western blot analysis Western blot analysis is performed to confirm the heterologous expression of GST-27 in tobacco. 120 mg of leaves from plants grown for 3-4 weeks under sterile conditions were subjected to 0.06 g of polyvinylpoly-pyrrolidone (PVPP) and 0.5 ml of extraction buffer to adsorb phenolic compounds at 4 ° C. (1M Tris HCl, 0.5M EDTA (ethylenediamine-tetraacetate), 5 mM DTT (dithiothritol), pH7.8). Then additional buffer (200 μl) is added. After the samples are mixed, they are centrifuged at 4 ° C. for 15 minutes. The supernatant is removed and the concentration of protein present in it is measured by Bradford using BSA as a standard solution. Samples are stored at -70 ° C until needed.

33% (v / v) Laemmli dye (97.5% Laemmli buffer (62.5 mM Tris HCl, 10% w / v sucrose, 2% w / v SDS, pH6.8), 1.5% pyronin y and 1 Samples of protein (5 μg) containing% percaptoethanol) were loaded onto SDS-polyacrylamide gel (17.7%, acrylamide: bisacrylamide at 30: 0.174) and then heated for 2 minutes. The protein extract is separated by electrophoretic effect in the following buffer (14.4% w / v glycine, 1% w / v SDS, 3% w / v Tris Base). They were then subjected to electroblotting overnight at 40 mV in the following blotting buffer (14.4% w / v glycine, 3% w / v Tris Base, 0.2% w / v SDS, 20% v / v methanol). Biorad device) is used to transfer onto nitro-cellulose (Hybond-C, Amersham).

The same loading of protein is measured by staining lightly blotted nitrocellulose in 0.05% CPTS (copper phthalocyanine tetrasulfonic acid, tetrasodium salt) and 12 mM HCl. The blots are then rinsed 2-3 times in 12 mM HCl solution and excess dye is removed for 5-10 minutes in 0.5 M NaHCO ₃ solution and then rinsed with deionized water. The filtrates were filtered through TBS-Tween (2.42% w / v Tris HCl, 8% w / v NaCl, 5% Tween 20 (polyethylene sorbitan monourauriate) for 1 hour), pH7.6). They are then washed for 20 minutes in TBS-Tween with 2% w / v BSA added. Indirect immunodetection of 1: 2000 dilutions of sheep GST-27 antiserum as the first antibody coupled with horseradish peroxidase (HRP) and rabbit anti-sheep antiserum as the second antibody Perform at 1: 1000 dilution. Surplus extraserum of the seedlings is washed with TBS-Tween added 2% w / v BSA. ECL (Enhanced Chemiluminescence) detection is performed using the protocol described by Amersham. The background of the seedlings is removed by additional film washing in the above-mentioned solution.

The level of expression of the GST gene is measured by LKB 2222-020 Ultroscan XL laser densitometer (densometer; Pharmacia). Western assay revealed eight PCR positive first transformants showing undetectable GST-27 expression. The 31 present shows varying degrees of expression, from almost undetectable to high levels corresponding to 1% of the total soluble protein as measured from signals detected in pure maize GSTII samples.

Southern blot analysis Southern blot analysis confirms the aggregate form of the transgene. Fresh in plastic bags containing 0.75 ml of extraction buffer (0.35 M sorbitol, 0.1 M Tris HCl, 0.005 M EDTA, 0.02 M sodium metabisulfite, pH 7.5) taken from plants grown in a greenhouse Tobacco leaves (2.5 g) were crushed by passing through a roller of a "pasta machine". The crushed extract is centrifuged at 6000 rpm for 5 minutes at room temperature. After removing the supernatant, pellets were extracted with 300 μl of extraction buffer and 300 μl of cell lysis buffer (2% w / v CTAB, 0.2M Tris HCl, 0.05M EDTA, 2M NaCl, pH7. 5) Resuspend in. After adding 5% Sarkosyl (120 μl), the sample is placed in a 65 ° C. water bath for 15 minutes. Centrifuge the extract at 6000 rpm for 15 minutes, then add 24: 1 chloroform: isoamyl alcohol (600 μl). Isopropanol (700 μl) is added to the same volume of supernatant and centrifuged at 13,000 rpm for 10 minutes. The supernatant is then washed with 70% ethanol and left in dry air. The pellet is resuspended by standing overnight at 4 ° C. in 30 μL of TE (10 mM Tris HCl, 1 mM EDTA). Store these samples at 20 ° C. until needed.

Restriction of whole leaf DNA dissolved in 1 x Phor-one-all buffer (20 mM Tris Acetate, 20 mM Magnesium Acetate, 100 mM Potassium Acetate, Pharmacia) for extracts from plants containing the GST-27 gene Catalyze with enzymes SacI and XbaI at 37 ° C. for 6 hours. DNA was sorted on a 0.8% agarose gel and denatured by gentle stirring in 0.5M NaOH, 1.5M NaCl for 30 minutes, and then the gel was neutralized by stirring in 0.5M Tris HCl, 1.5M NaCl for 75 minutes. Let's do it. DNA is then transferred onto Hybond-N (Amersham) nylon membranes by 20 × SSC (3M NaCl, 0.3M Na ₃ citrate) capillary blots. The DNA is fixed to a membrane dried at 80 ° C. for 20 minutes using a combination of UV strata binding (stratagene). Probes for use in Agrobacterium transformation are excised by catalyzing the GST-27 gene containing plasmid with EcoRI. The probes were prepared using a random priming protocol described by Prime-a-Gene Kit (Promega), Feinberg and Vogelstein. Mark with ³² PdNTP (3,000 Ci / mM). Positive controls are prepared by catalyzing pIJ21-3A with Sacl and EcoRI.

5 x SSPE (0.9M NaCl, 0.05M Sodium Phosphate, 0.005M EDTA, pH7.7), 0.5% SDS, 1% w / v Marvel (dry milk powder), 200 μg / ml denatured salmon sperm DNA at 65 ° C. Prehybridisations are performed for 3-4 hours. Hybridization is carried out with the same buffer, which excludes the latter component. Prior to radiography at −70 ° C., wash for 30 minutes at 65 ° C. with 3 × SSC and twice with 1 × SSC, 0.1% SDS for 20 minutes.

HPLC analysis

Herbicides are analyzed using HPLC to determine whether GST-27 expressing plants exhibit GST activity on herbicide substrates in vitro. Take leaf tissue (1 g) from tobacco plants that grew and bloomed in the greenhouse for 3-4 months, and extracted it with liquid nitrogen and 7 ml of extraction buffer (50 mM glycyl glycine, 0.5 mM EDTA, 1 mM DTT, pH7.5). Crush in. The extract is transferred to a test tube containing 0.1 g of PVPP and centrifuged at 16,500 rpm for 30 minutes at 4 ° C. Supernatant (2.5 ml) is loaded into a Sephadex G-25 (PD10) column (Pharmacia) and developed with 3.5 ml sodium phosphate buffer (50 mM, pH7.0) containing 1 mM EDTA and 1 mM DTT. Proteins are measured by the Bradford method using BSA as a standard. Divide the extract by ellicott and store at -70 ° C until needed. HPLC analysis is performed on a Sphersorb 5μODS2 column (25 cm * 4.6 mm diameter, Hichrom) using 65:35 acetone: 1% aqueous sulfuric acid mobile phase. The compound is detected using a UV LC-6A Schimadzu detector (wavelength 200 nm).

The reactions are carried out in 0.8 ml HPLC glass bottles at room temperature (20-25 ° C.). 15-94% by volume of plant extracts were sodium phosphate buffer (pH7), 5 mM glutathione or homoglutathione and 2 or 20 ppm of compound (2 ppm for fluorodiphene, 20 ppm for acetochlor, alachlor and metolachlor) Add to Set up controls at the same rate except for extracts replaced by sodium phosphate buffer. The reaction is initiated by adding the herbicide used as the substrate. Monitor compound reactivity for up to 9-19 hours. Specific retention time and peak area are calculated by JCL 6000 chromatography data system package (Jones chromatography). HPLC peak area vs. time profiles based on 7-11 hour points are determined from each compound. Half-life and pseudo first-order rate constant data are obtained from an exponential function using accurate peak area vs. time data. The data can be obtained sufficiently with FIT package version 2.01.

Using the taxonomy described above, the GST activity of the transformed plants is analyzed by contrasting with other herbicide substrates. The herbicides consist of 3 dichloroacetanilide (acetochlor, alachlor, metolachlor) and diphenyl ether (fluorodiphene). Such chemicals are known to be conjugated with glutathione, in particular dichloroacetanilide. The extraction is carried out under low temperature which limits the denaturation of the protein in the presence of PVPP. Studies on GST stability indicate that the corn GST activity decreased 73% in the crude extract when stored at -20 ° C. Therefore, it was decided to split the extracts into ellicotts. These were stored at -70 ° C until needed. Each sample is thawed only once and stored in the refrigerator overnight. Analyze for 2 weeks and extract.

The herbicide concentration in the HPLC vial is adjusted accordingly to its solubility limit. Acetochlor, alachlor and metolachlor are analyzed at 20 ppm and fluorodiphene is analyzed at 2 ppm. The assay is performed for 9-19 hours depending on the reactivity of the herbicide. Metolachlor is analyzed for a long time because its half-life is high under these conditions. Compounds are detected at 200 nm with a UV detector. Monitor specific retention times and peak areas for the herbicides. Calculate GST activity using 7-11 time points as standard. Enzyme conjugation leads to a decrease curve of the exponential function. Reduction of the peak area of the herbicides analyzed is used in the calculation of GST activity. It also calculates half-life and first-order rate constants.

Five tobacco lines including wild type (negative control), 4 GST-27 lines 5, 6, 12 and 17 are analyzed. They are selected because of their large expression as measured by Western assay. The herbicides are last added to limit any rapid conjugation before monitoring. Also analyze column 17 of GST-27 for conjugation of acetochlor to homoglutathione. The results are recorded in FIG. 7, indicating that GST-27 expressing plants have activity against chloroacetanilide herbicides.

Summary: Transgenic tobacco plants express GST-27 protein and can be distinguished by their relative activity against herbicide substrates in vitro.

In Vitro Assays-Rooting Assay

GST-27 columns have significant activity in vitro against at least three chloroacetanilides. Moreover, most of the herbicides of this class are known to inhibit root elongation. Therefore, it is concluded that routing tests for acetochlor, alachlor and metolachlor should be performed.

Preliminary experiments should be conducted to determine the most effective concentration. The range of 7 concentrations is selected from 0, 1, 5, 10, 20, 40 and 100 ppm. Two transformed rows (GST-27 Nos. 6 and 17) and wild type tobaccos are measured by Alachlor. Rows 6 and 17 are selected because they are the lowest and highest expressing plants based on Western blot analysis. Three explants consisting of leaves with one shoot attached are transferred onto MS medium to which herbicide has been added. Root growth was observed after 2 weeks (Fig. 8). In the general aspect of plants, the effect of herbicides is observable with wild type obtained from concentrations of 1 ppm, the leaves discoloring and becoming smaller yellow.

As the concentration increases, the effect becomes stronger and the number of new leaves decreases. At 10ppm, no new leaves sprout from the plants. On the other hand, in the transformed rows, the effect of the herbicide can be observed from 20 ppm concentration for row 2 and 40 ppm for row 6. Between these concentrations the leaves appear smaller and their number is also somewhat reduced but still green. Next, wild-types have some roots below 5ppm, but their length decreases dramatically from 0-5ppm. With respect to rows 2 and 6, the roots fall relatively below 10 ppm and 20 ppm, and at lower concentrations the length decreases. After two weeks under these conditions, it was found that the concentration limiting the routing was 20-40 ppm for the "best" heat measured in this step of the experiment.

Wild type (control), 4 GST-27 (lines 5, 6, 12, and 17) continue to be tested. With respect to acetochlor, alachlor and metolachlor, the following ratios: 0, 10, 20, 40 ppm for acetochlor and metolachlor mentioned as herbicides and 0, 20, 40, 100 ppm for alachlor Analyze The above concentrations are chosen because plants show the lowest activity against acetochlor and metolachlor on HPLC. Three explants per line and concentration transferred onto MS medium with herbicides added are used under the same conditions. It takes three weeks to analyze root growth.

In a pilot, the response of explants in each pot is generally uniform. With respect to acetochlor, the wild-type explants are in the presence of herbicides, showing no rooting or no new leaf formation. However, rows 6 and 17 of GST-27 rarely produce roots and small leaves at 10 and 20 ppm. Rows 5 and 12 are not as resistant as those two columns. For Alachlor, the wild type does not generate any roots for the measured proportions, only a few leaves at 20 ppm. Rows 6 and 17 develop roots at concentrations below 40 ppm, which appear to be unaffected by herbicides. As the herbicide concentration increases, the number of roots decreases further. For the rows, the limit of routing concentration is 40-100 ppm after 3 weeks under the above conditions. Rows 9 and 16 do not generate any roots, but produce very small leaves at herbicide concentrations of 20 and 40 ppm. Regarding metolachlor, wild-type tobacco produces very small roots at 10 and 20 ppm. Rows 6 and 17 produce short roots but are not more than those occurring in Alachlor. For herbicides, the limit of routing concentration is 20-40 ppm for row 6 and at least 40 ppm for row 17.

Treatment on plants with herbicides

To demonstrate that transgenic plants expressing GST-27 confer resistance to herbicide treatment, pre- and post-emergence herbicide tests are performed in the greenhouse.

A pre-emergence test is performed by spraying about 50 seeds per line for each proportion of herbicide in sand (25% sieved black soil, 75% slow fertilizer-releasing grift). Four replicate genes are processed for each chemical ratio. Seed trays with herbicides (0, 300 and 350 g / ha) formulated with 5% JF 5969 (905.6 g / L cyclohexanone, 33.33 g / L synferonic NPE1800 and 16.7 g / L Tween 85) using a track sprayer Apply to When left in the greenhouse to sprout seeds, they germinate after three weeks. The result for alachlor is that transgenic plants show resistance to pre-appearance application of herbicides. Similar results are obtained for acetochlor, metolachlor and EPTC (12000 g / ha).

Post-appearance tests are performed by sowing 28 seeds per line and per herbicide ratio in the culture. After 16 days, tobacco plants (1 cm in height) are applied with alachlor in 5% preparation JF 5969 using a track sprayer. Damage occurred in three weeks, followed by spray treatment using the shape of leaves, peak state, necrosis, and plant size for the untreated control. 100% damage means that the plants have been wiped out by herbicides, and 0% damage means that the plants are similar to the untreated control. Post-expression results for alachlor are to demonstrate that the transgene is resistant to herbicides. Damage to wild type plants, isolated GST-27 heat is shown on the graph of FIG. 9, and also for metolachlor treatment at 1400 g / ha.

Example 4

Cloning of glyphosate resistant genes into plant materials and development of glyphosate resistant plants

The main cassettes and specific plant transformation constructs used in this example are described in the drawing of EP EP 1 536330.

Dicot Vector 1 Vector 1 contains the Glyphosate Oxidase Gene (GOX) fused to Chloroplast Transit (CTP) Sequence No. 1 obtained from the Arabidopsis Rubisco gene induced by an enhanced 35S CaMV promoter. Is a structural control plasmid. The construct contains the CTP coding sequence of the omega translation enhancer 5 '. Vector 1 uses a NOS terminator.

CTP-GOX constructs are synthesized according to the sequence disclosed in WO 92-00377 with the addition of the Nco I site located at the translation initiation ATG and Kpn I located at the 3 'end. Internal Sph I sites and Nco I sites are deleted during synthesis without alteration of protein sequence. The CTP-GOX sequence is separated into Nco I Kpn I fragments, which replace the tobacco etch virus 5 ′ non-translated leader, truncated with Nco I Kpn I using standard molecular cloning techniques. PIBT211 based plasmid containing pIBT211 containing a cloned enhancer and CaMV35 promoter coupled to the viral translation enhancer sequence, pMJB1, terminated with a NOS terminator.

Cassettes containing the enhanced CaMV35S promoter-omega enhancer-CTP-GOX-Nos sequence are separated into Hind III EcoRI fragments, which are ligated into plant transformation vectors based on pJRli, pBin 19, truncated with Hind III EcoRI.

CP4-EPSP (classification 2 EPSPS) fused to chloroplast transit peptide obtained from diecoat vector 2 Petunia is synthesized by the NcoI site located in the translation initiation ATG and the sequence shown in WO92-04449. The internal SphI site in EPSPS is inactive without changing the protein sequence. Fragments containing the synthetic CTP-EPSPS sequence are separated into NcoI SacI fragments and ligated into pMJBI. The sequence is placed under the expression control of the NOS terminator with omega fragments located 5 'in the enhanced 35S promoter and protein coding region, separated into EcoRI Hind III fragments and cloned into pJRIi to yield a dicoat vector2.

Diecoat vector 3

Control vectors with EPSPS and GOX genes are prepared by cleaving the diecoat vector with EcoRI and inserting the EcoRI-SphI-EcoRI linker. The vector thus obtained is cleaved with SphI and the cassette ("B") is liberated, and then cloned into the SphI site in diecoat vector 1 (5 'promoter to form pDV3puc) (Figure 9). Coding regions comprising promoters and terminators derived from vector (1) and (2) were excised from Hind III and EcoRI fragments from pDV3puc and cloned into pJRIi.

Plasmid pDV3 in the bicomponent vector pJRIi is introduced into tobacco via Agrobacterium mediated transformation using known techniques. 270 shoots are transferred from calli obtained from the transformed material and only 77 of them are routed. To confirm the presence of EPSPS and GOX in rooted shoots, DNA extracts are prepared from pDV3 plants and analyzed by PCR using the following primers:

3 'terminal EPSPS gene

GATCGCTACTAGCTTCCCA (SEQ ID NO. 12) EPSPS2

5 'terminal GOX gene

AATCAAGGTAACCTTGAATCCA (SEQ ID NO. 13) GOX1

If both genes are present, the PCR reaction gives a 1.1 kb band. To confirm the functionality of the glyphosate tolerance gene, pDV3 tissue culture explants are transferred to MS medium containing 0.01 mM and 0.05 mM glyphosate. The plants are left for 2 weeks and then transferred to a medium containing glyphosate. Lines of resistance successfully growing on medium containing herbicides are analyzed by Western assay using anti-serum resulting in rabbits against purified GOX and EPSPS.

Leaf DNA extracts are prepared from each primary transformant and used in a PCR reaction to confirm the presence of a vector. Using the methods described above, Western blot analysis is performed on each PCR positive pDV3 plant to confirm heterologous expression of GOX and EPSPS. High levels of expressors are self-pollinating and their seeds are screened on kanamycin dishes. Single locus plants are maintained for homozygous production. Data confirming that plants transformed with the pDV3 construct are resistant to glyphosate is described in Example 8.

Example 5

Preparation of Plants Resistant to Anilide Form Preparations and Glyphosate

Heterogeneous and homogenous tobacco lines expressing GOX and EPSPS are cross-pollinated on homogenous tobacco lines expressing GST-27. The seed produced at the crossover is sprinkled and the leaf material is taken for Western analysis using the procedure as described above. Proteins from GST-27 western positive plants are screened with GOX / EPSPS antibodies to select rows expressing all of GST-27, GOX and EPSPS. Pre-expressing herbicide sprays comprising acetochlor, alachlor, metolachlor and EPTC can be used in the rows, followed by spraying the plants with the formulated glyphosate using a post-expression method.

Example 6

Preparation of plants resistant to anilide and glyphosate form herbicides by methods that do not include cross-pollination

The vector pDV3puc is cleaved with EcoRI and the phenol chloroform is extracted and then precipitated. Delta EcoRI-HindIII-EcoRI coupler MKOL3 5'AATTACGGAAGCTTCCGT3 '(SEQ ID NO: 14) is heated to 70 ° C and cooled to room temperature (to the extent self-annealing is possible). The annealed bonder is ligated with pDV3puc cleaved with EcoRI. Putative recombinants are screened with the end-labeled oligonucleotide MKOL3. Plasmid DNA is isolated from positively hybridized colonies. Restriction catabolism using HindIII releases a 5.4 kb fragment containing 35S CaMV promoter causing expression of omega-CTP2-EPSPS-NOS and 35S CaMV promoter causing expression of omega-CTP1-GOX-NOS. The fragment is cloned into pGST-27 Bin digested with HindIII and dephosphorylated with CIP. The recombinant is selected using an insertion probe. The resulting vector pDV6-Bin (FIG. 10) is confirmed by appropriate sequencing. The transformed plasmid is transformed into tobacco by Agrobacterium using known techniques. 270 shoots are harvested and transformed and 80 of them are rooted. Leaf DNA extracts were prepared from each primary transformant and PCR reactions were used to confirm the presence of protein encoded regions of the vector in the leaves. Primers are as described above (SEQ ID NOs. 12 and 13). To confirm the functionality of the transplant-gene, the first transformant obtained from pDV6-Bin is analyzed with 0, 0.01 mM and 0.05 mM glyphosate and 10 ppm and 40 ppm alachlor in tissue culture medium. It successfully grows on both media under conditions where many transgenes have failed for wild-type controls. Using the method described above, Western blot analysis is performed on each PCR positive plant to confirm heterologous expression of GOX and EPSPS. Thereafter, pre-expressing herbicide sprays are used on the rows with acetochlor, alachlor, metolachlor and EPTC. Subsequently, the plants can be sprayed in a post-expression manner with the formulated glyphosate. Table 1 below provides data for pre and post herbicide treatment of DV6 plants (ie, plants expressing both glyphosate resistance gene and GST). The upper table of the following table shows the rate at which the pre-expressing herbicide is applied and the state in which the post-expressing herbicide application is excluded and continued. The lower table of the following table shows the damage that occurs after 800 g / ha glyphosate treatment. The bottom table indicates that the replication score for damage done on plants does not affect the pre-expression treatment as a result of the post-expression glyphosate treatment. All clones of wild-type plants show aborted levels, while the numbers of transgenes reflect the fact that they are segregating populations, which means that plants that do not express a transgene and that do not pair with organs are post- To say that you can complete the emergence spray test.

Example 7

Preparation of Corn Tolerant to Glyphosinate and Anilide Type Herbicides

A monocotyledonous (corn, wheat) transformation vector containing GST-27 resistant to pre-expressing herbicides and phosphinothricin acetyl transferase resistant to post-expressing herbicide glufosinate was prepared as follows. Lose.

Step 1: Digest pUB1 (pUC-based vector containing maize ubiquitin promoter and intron) (FIG. 11) with HindIII. A HindIII-AgeI-HindIII coupler (5 'AGCTTGTACACCGGTGTACA 3' (SEQ ID NO: 15)) is introduced between the gaps generated by catabolism, and the resulting recombinant vector is named pUB2.

Step 2: Using KpnI and BamHI, GST-27 cDNA is excised from pIJ21-3A and cloned into pUB2 cleaved with BamHI and KpnI to form pUB3.

Step 3: Self-anneal the KpnI-PacI-KpnI coupler (5 ′ CGGACAATTAATTGTCCGGTAC 3 ′ (SEQ ID NO: 15)) and clone into pUB3 cleaved with KpnI to form pUB4.

Step 4: The NOS terminator was isolated from pIE98 (FIG. 12) as a SmaI fragment and coarse and short terminally cloned into pub4 digested with EcoRI to form pUB5. The orientation of the NOS terminator in pUB5 is confirmed by restriction catabolism with EcoRV and BamHI. All conjugates are sequenced to ensure correct insertion of the various structural components.

Step 5: The ubiquitin GST-27 NOS cassette present in pUB5 is removed from it by catalyzing AgeI and PacI and cloned into the ampicillin minus vector pIGPAT containing the PAT gene under the control of the 35S-CaMV promoter (FIG. 13). . Recombinant is detected by colony hybridization with EcoRI cDNA introduced from pIJ21-3 A. Recombinant is Nco

Oriented with I restriction catabolism to form pCAT10 (FIG. 14).

Step 6

The 35S-PAT-NOS cassette is removed by catalyzing AscI ubiquitin-PAT-NOS and AscI obtained from pPUN14 introduced to form pCAT11 (FIG. 15). pCAT11 is transformed into wheat and corn using known whiskers and particle bombardment techniques. The cells are transferred into vial force-containing medium to select a callus material that expresses a PAT gene. Calli grown on a medium containing the herbicide is PCR performed using the following primers (SEQ ID No. 33 and No. 34, respectively) to confirm the presence in the calli of the GST-27 gene.

5'CCAACAAGGTGGCGCAGTTCA3 '(SEQ ID NO. 33)

5'CATCGCAAGACCGGCAACAG3 '(SEQ ID NO. 34)

Calli containing the GST-27 expression cassette is transferred to plant regeneration medium and corn plants are recovered. The transformed corn plants (whole protein extract of Western blot from leaves) are identified to constitutively express the GST gene at high levels. The plants are cross-pollinated with selected corn homogenous rows and the seeds are recovered. In order to confirm the increased tolerance of the plant to herbicide acetochlor, the seeds are planted in soil with 2,000 to 8,000 g of herbicide used per hectare. The seeds are germinated and grown for 7 days, after which the damaging chemicals are approached and compared to the seedlings obtained from the non-transgenic seeds sown under the same conditions. "Transgenic" seedlings and non-transgenic control seedings planted in soil treated with herbicides and corresponding safeners are very small, even if there is damage to the seedlings, while growth in soils containing herbicides excluding herbicides One non-gene seedling causes very severe damage. Surviving seedlings for the first herbicide treatment are grown for an additional 20 days and sprayed with industrially mixed glufosinate at various concentrations having an area of 0.1-1% active ingredient. Seedlings containing the PAT gene (expression measured by the method described by De Block M. et al (EMBO journal 6 (9): 2513-2518 (1987))) when compared to seedlings not containing said gene ( Completely resistant to glufosinate or relatively tolerant to herbicides, depending on the concentration used).

Example 8

Preparation of plants (mono and diecoats) resistant to glyphosate and glufosinate

This example relates to the production of plants resistant to both glyphosate and glufosate. Various herbicide tolerances are obtained from the intersection of a second plant treated to be resistant to glyphosate and a first plant treated to be resistant to glufosinate.

Preparation of Glufosinate Resistant Structure pPG6

pPG6 is a Bin19 based vector derived from pBin19RIPAT, which contains a cassette containing a 35S CaMV promoter that generates the GUS gene. The second intron of the ST-LS1 gene is introduced between the promoter and the GUS. The sequence is 189 bp, which has an A / T content of 80%, stop codons in all three read structures, and a typical flake conjugate. The presence of the intron prevents the expression of GUS in Agrobacterium, since thinning does not occur in prokaryotes. It also contains a cassette that causes expression of the PAT gene and carries the 35S CaMV promoter. 16 shows a schematic of pPG6.

Glyphosate resistant structures

Diecoat vectors 1-3 are prepared as described in Example 4 above.

Monocoat Vector 1

Monocoat Vector 1 is a plasmid containing CTP1 GOX and CTP2 EPSPS, augmented by corn polyubiquitin intron 1 and induced by corn polyubiquibitin promoter, in a pUC-derived plasmid. It also contains a cassette that confers tolerance to phosphinothricin.

Plasmid 1: Vector puB1 is catalyzed by KpnI and introduced into Kpn1-Not1-Kpn1 combiner (SEQ ID NO: 5'CAT TTG CGG CCG CAA ATG GTA C3-SEQ ID NO: 17). EcoR1-Not1-EcoR1 conjugates (5'AAT TCA TTT GCG GCC GCA AAT G 3 '(SEQ ID NO: 18)) are introduced into the EcoR1 site of DV1-pUC. The obtained plasmid is cleaved with NcoI and the 5 'overhang is filled with DNA polymerase 1 Klenow fragment. Linearize the linear vector to Not1 and separate Not1-short and thick fragments. Fragments containing CTP1-GOX and NOS sequences are ligated with pUB1 catalyzed by Sma1-Not1. HindIII-Not1-HindIII binder (SEQ ID NO: 5 'AGC TTG CAG CGG CCG CTG CA 3' (SEQ ID NO: 19)) was introduced into the plasmid to obtain plasmid 1.

Plasmid 2: EcoR1-Not1-EcoR1 combiner (5'AAT TCA TTT GCG GCC GCA AAT G 3 '(SEQ ID NO: 18)) is another clone isolated without containing the above mentioned binder, Introduction into the EcoR1 site). The obtained plasmid is cleaved with NcoI and the 5 'overhang is filled with DNA polymerase 1 Klenow fragment. Plasmid 2 is prepared by cleaving the linear vector with Not1 and cloning this fragment into the same vector (modified pUB1) as described above. A PAT selectable marker cassette comprising a 35S CaMV promoter, Adh1 intron, phosphinothricin acetyl transferase (PAT) gene and nos terminator was excised with pIE108 and cloned into the HindIII site of plasmid 2 to prepare cassette 2. Specific restriction assays are used to confirm that the PAT cassette is in the same orientation as the CTP2 EPSPS cassette.

The cassette carrying the polyubiquitin promoter and intron, the CTP1 GOX and the nos terminator, were excised from plasmid 1 present on the Not1 fragment and ligated to the Not1 cleaved cassette 2 to yield monocoat vector 1, pMV1 (FIG. 17). Get

Plasmids for tobacco transformation diecoat transformation are transferred to Agrobacterium tumefaciens LBA4404 using the freeze thaw method by Holsters et al. (1978). Nicotiana tabaccum var Samsun is delivered using the leaf disc method described by Bevan et al. (1984). Seeds are regenerated on a medium containing 100 mg / l kanamicin. After rooting, the selected plants are transferred to a greenhouse and grown under 16 hours of light and 8 hours of darkness. The transformant of pPG6 is named 35S-PAT column.

Corn Transformation Corn transformation is performed using a particle bombardment method as described by Klein et al. (1988). The choice of transformed material is 1 mg / l bialophos.

Plant analysis

This assay is performed on PCR tissue culture and all tobacco rows rooted in maize calli. DNA is extracted by methods known by those skilled in the art. The first transformant is analyzed using the following oligonucleotides:

The sequence of oligonucleotides is as follows:

PCR + ve plants are selected for further analysis.

Selection for Glyphosate The kill curve for the growth of tobacco in tissue culture on medium containing glyphosate is shown. This is done by introducing stem segments (6 mm in length) and transporting the leaf rods to MS medium containing a range of glyphosate isopropylamine concentrations. 4/5 stem segments are used for each concentration. The result is calculated after two weeks and is shown in Table 2.

pDV 1st, 2nd and 3rd transformants are selected by growing on a medium containing 0.01 and 0.05 mM glyphosate isopropylamine salts as described above. The results are shown in Table 3 below.

Table 3 above shows the selection of glyphosate tolerant heat in tissue culture.

Selective regeneration calli for PAT is measured in 1 mg / l vialophos.

Western analysis Regeneration of proteins and antibodies with respect to expression of GOX and EPSPS is performed by methods known by those skilled in the art. Tobacco first transformants are analyzed as follows. Up to 100 mg PVPP is added to the bottom of the Eppendorf tube. The leaf material (four leaf disks obtained using the tube cap as a cutting tool) is placed on ice. 0.5 ml of extraction buffer (50 mM Tris HCl pH7.8, 1 mM EDTA sodium salt, 3 mM DTT) and 2 μl 100 mM PMSF are added. The sample is ground to low temperature using an electric grinder. Continue grinding for 10 seconds and the uncrushed material is pushed back into the tube and continues to grind for an additional 10-15 seconds until the sample is uniform. The tube is centrifuged at low temperature for 15 minutes and the resulting supernatant is transferred to an additional tube and stored frozen at -70 ° C until needed. Protein concentrations are measured using known Braford methods. 25 μg of protein is sorted by SDS PAGE and blotted onto Hybond-N membrane at 40 mA overnight. The filter is separated from the blotting apparatus and placed in 100 ml of 1 × Tris-Saline 5% Marvel and stirred at room temperature for 45 minutes. The filter is washed by stirring once in 5 minutes in 1X Tris-Saline 0.1% Tween 20 and twice in 20 minutes. The membrane is incubated with the first antibody overnight at room temperature for 2 hours or at 4 ° C. The membrane is washed for 10 minutes at room temperature in 1X T-S 0.1% Tween and then for 1 hour. The second antibody (anti rabbit IgG peroxidase conjugate) is used in a 1: 10000 dilution and the membrane is incubated for 1 hour at room temperature. Wash as mentioned above. Detect using Amersham ECL detector kit. The extent of protein expression in pDV columns 1 and 2 is observed based on Western results. The expression level of GOX and EPSPS in PDV3 showed little change in the amount of GOX expressed, but increased in the amount of EPSPS.

Maize calli are analyzed in the same way and calli expressing GOX and EPSPS are regenerated with whole plant and leaf material analyzed again for expression of both genes.

Analysis of phosphinothricin acetyl transferase activity

PAT activity is measured using ¹⁴ C labeled acetyl CoA. The labeled acetyl group is transferred to phosphinothricin (PPT) substrate by PAT in the leaf extract. Acetylated PPT and ¹⁴ C are moved at different rates on TLC plates (which can be seen by radiographing). 10X T ₅₀ E ₂ Buffer (TE) -50ml 1M Tris. Prepare a leaf extract buffer using HCl pH7.5, 4ml 0.5M EDTA and 46ml dd water. Nupeptin is prepared at a rate of 15 mg in 1 × TE. Stock PMSF is prepared at 30 mg / ml in methanol. BSA stem solutions are prepared at 1 M, 30 mg / ml in TE and DTT. PPT is used as a 1 mM solution in TE. 14C Acetyl CoA is 58.1 mCi / mmol (Amersham). The extract buffer is prepared by combining 4315 μl dd water, 500 μl 10 × TE, 50 μl Neupeprine stock, 25 μl PMSF stock, 100 μl BSA stock and 10 μl DDT stock (final volume 5000 μl). Collect the leaf sample in an ice Eppendorf tube using a stopper as a cutting tool. The sample (3 pieces) is ground in 100 μl extraction buffer using an electric mill at low temperature. Centrifuge these samples for 10 minutes and transfer 50 μl into a clean tube on ice. Samples are stored at -70 ° C until use. Bradford assay to determine the amount of protein present in the extract. The substrate solution is prepared by mixing 5 volumes of labeled acetyl CoA with 3 volumes of 1 mM PPT solution. 2 μl substrate solution is added to ˜25 μg total leaf protein sample (˜2 μg / μl), the mixture is incubated at 37 ° C. for 30 seconds, and then transferred to ice to terminate the reaction. 6 μl of the sample is spotted on a silica gel TLC plate (Sigma T-6770). Ascending chromatography is performed for 3 hours in a 3: 2 isopropanol and 25% ammonia mixed solution. The plate is wrapped with vinyl film and exposed to Kodak XAR-5 film. All 26 first transformants were analyzed for PAT activity using this assay. Table 4 below provides detailed results of the assay.

Painting Herbicides on Leaves 35S-PAT first transformants and control plants exhibiting a range of 35S-PAT activity are measured by painting Challenge on each leaf. On both surfaces of the labeled leaves, paint 1% and 0.2% solutions of stock solution (150 g / l) dissolved in water. 48 hours and one week later, the numbers are counted and leaf samples are taken for PAT analysis. Table 5 shows the results of painting on the leaves.

Herbicide spray test

Clufosinate (Challenge and Basta) Show the dose-response curves for the effect of the challenge on wild-type tobacco. Each of the five plants is treated. Count the numbers after 14 days. The spray test is then conducted using a challenge with the same proportion of 35SPAT rows selected according to the composition of the kill curve. Table 6 shows the data for two columns, 12th and 27th. Plants of the transgene do not cause any damage at these rates.

The death curve is shown for the effect of glyphosate on wild-type tobacco. Wild-type tobacco grown in tissue culture is sub-cultured to regenerate into 20 new plants by taking their stem segments and growing in additional medium. They are grown in tissue culture for one month before being transferred to a 3-inch pot in John Innes' third soil. After removing the cover, allow them to acclimate to the environment for 4 days before spraying them. After spraying, water is sprayed only on the dish, which keeps the water from touching the leaves for five days. The values are counted for 8 and 28 days after the treatment. Table 7 below shows the average percent damage (3 reps per treatment) over the range of concentrations used.

The next structure of the glyphosate killing curve, multiple pDV columns 1, 2 and 3, is the spray measured at the proper proportion of glyphosate. Table 8 below shows the results for pDV3, and the results for the pDV1 and pDV2 columns are similar to the results for pDV3.

Segregation analysis Each first transformant (pDV6, pDV1, pDV2 and pDV3) is sterilized for 20 minutes in 10% Domestos. After several washes with sterile water, 100 seeds of each self-pollinated first transformant, 0.5XMS (2.3 g / l MS salt, 1.5% sucrose, 0.8% Bactoagar) containing 100 mg / l kanamycin , pH5.9) incubated on the medium. The rows separated by a ratio of 3: 1 are believed to introduce a single transgene. For the pPG6 rows, twelfth, twenty, and twenty-seven are separated by the required ratio. For the pDV3 columns, 14, 19, 21, 31, 34, 43 and 45 are separated by the required ratio.

From the developmental separation test of homozygous fever, 10 unbleached seedlings (heterozygote or homozygote) are transferred to additional medium in the tube and grown for 2-3 weeks. After this time, they are transferred to JI No 3 culture in 31 pots for flowering. Seeds are retested on Km containing 0.5XMS to identify homozygous rows.

Homozygous rows containing the pDV1, pDV2, and pDV3 crossovers of tobacco rows, ie plants expressing GOX, EPSPS and GOX / EPSPS genes, respectively, are cross-pollinated at homozygous pPG6 row expressing the PAT gene, number 27. It also conducts moisture using the pPG6 row as the male row.

Analysis of Transgene Corn Fever Regeneration calli is tested by PCR using the oligos described above, 35S-AlcR, AlcA-GOX1, and internal oligos for GOX and EPSPS. We also perform Western analysis on PCR + ve calli to select for expressing GOX and EPSPS. calli regenerates and re-analyzes the resulting plants by PCR. After the plants are hybridized, they self-pollinate.

Analysis of Tobacco Substances

GOX, EPSPS and PAT Expression All progeny are homozygous for both genes. Seeds from each intersection and seeds from each blast homozygote are sown and leaf material is collected from multiple plants for analysis. Protein extraction is analyzed by Western blot and PAT activity assay as described above. The degree of expression of GOX and EPSPS and PAT activity are found to be similar to those of each other and homozygous blasts within a specific cross range. Count plant numbers with respect to appearance, height, and growth.

Herbicide Treatments Three extensive experiments are designed for:

1.35S-PAT cf pDV1 cf pDV1-PAT

2. 35S-PAT cf pDV2 cf pDV2-PAT

3. 35S-PAT cf pDV3 cf pDV3-PAT

35S-PAT columns are treated with glufosinate at various concentration ranges at different time points and the percentage of specific damage generated. DV heat is treated with glufosinate at various concentration ranges and the damage rate is identified. DV-PAT heat is treated with a mixture of two herbicides at different rates and the extent of the damage is analyzed. Each of these populations is treated at the 5-6 leaf stage (5 reps per treatment).

Resistance to Pathogen Attacks 35S-PAT, DV1,2 and 3 and DV-PAT rows expressing each protein to a good degree and exhibiting good herbicide tolerance are exposed to multiple fungal pathogens to estimate and compare levels of infection.

Analysis of Corn Progenitors The plants obtained are used to select rows that best express the seed obtained from the intersection of the first transformant. This is done by Western analysis and PAT activity experiments to analyze the expression level of GOX, EPSPS as described above. In order to determine herbicide tolerance to glyphosate and glufosinate, experiments similar to the above, in which single or various combinations are used, are performed.

Example 9

Preparation of plants that are resistant to pre-expressing bleaching herbicides such as fluorocloridone, norflurazone, flulidone, flutamone and diflufenican, and to glyphosate

Phytoenic desaturase (PDS) inhibitors, such as fluorocloridone and norflurazone, cause bleaching signs as a group of herbicides that interfere with carotenoid biosynthesis. The PDS gene (crt1) is Erwinia uredovora, a non-green plant pathogen (phytop)

It is cloned from an athogenic bacterial lot and over-expressed in transgene tobacco (and tomatoes) using plasmids containing CaMV 35S promoter and chloroplast transit peptide (pYPIET4) (Misawa et al., 1993). Homozygous seeds of heat ET4-208 tobacco plants over-expressing the crt1 gene are obtained as obtained from tomato plants containing the same construct.

Herbicide Tolerance Test The compounds of formulas (1), (2) and (3) are tested. Strain the transgene and wild type tomato seeds (cv Ailsa Craig) into 3 "ports of JIP3 (3 seeds per port). Each compound was added in 4% JF5969 (except commercial formula (1)). Formulated and sprayed into the devices in the track sprayer at 200 l / ha The test is measured at 13, 20 and 27 DAT (time spent after treatment), most in all cases showing 87-100% phytotoxicity. Responses from all treatments to wild type tomatoes with high proportions are evident: Transgenic tomatoes are compounds (1) and (3) and more than 1 kg / ha and compounds (1 and 9 and less). High resistance to all PDS inhibitors tested for (see Table 9.) Similar results are obtained for transgenic tobacco.

DV3 # 43B (glyphosate resistant heat including EPSPS and GOX genes-see Example 4) is cross-pollinated on homozygous ET4-208 and vice versa in conventional manner. Seeds are collected and tested for herbicides similar to those described above. Line up in small devices the day before processing tobacco seeds. Each compound is formulated in 4% JF5969 (excluding the commercial formulation Racer) and sprayed onto the device in the track sprayer at 200 l / ha. The test is analyzed at 13, 20 and 27 DAT. Seedlings that are resistant to bleaching herbicides are transferred to additional John Innes III culture soil in 3 "ports after the final analysis. After two weeks they are under the control of glyphosate herbicides used at 500 and 800 g / ha. Count the numbers at 14 and 28 DAT The resulting plants are resistant to both classes of herbicides, which are inherited by the Mendelian method.

[Formula 1]

[Formula 2]

[Formula 3]

Example 10

Development of plants resistant to triketone, acetanylide and glyphosate

pDV6 # 71G and pDV3 # 19J are cross pollinated onto heat and vice versa with homozygous triketone resistance as described above. Seeds are collected and herbicide tests are performed as described below. Tobacco seeds from the DV6 / HPPD intersection are planted in small devices the day before processing. Some devices are treated with acetochlor (75 g / ha), some with alachlor (300 g / ha) and others with ZA1296 (100 and 300 g / ha). Analyze at 21 DAT. Figures for 21DAT analysis are given below and show phytotoxicity.

The heads surviving the 300 g / ha treatment of ZA1296 are sprayed with 800 g / ha glyphosate and the resistance to this is described.

Sequence list

(1) General Information:

(i) Applicant:

(A) Name: Geneca Limited

(B) Distance: 15 Stenovgate

(C) City: London

(E) Country: United Kingdom

(F) Zip code (ZIP): W1Y 6LN

(G) Telephone: 0171-304 5000

(ii) Name of the Invention: Plants tolerant to herbicides

(iii) SEQ ID NO: 32

(iv) computer readable form:

(A) Medium type: floppy disk

(B) Computer: IBM PC compatible

(C) working system: PC-DOS / MS-DOS

(D) Software: PatentIn Release # 1.0. Version # 1.30 (EPO)

(2) information on SEQ ID NO: 1

(i) sequence properties:

(A) Length: 1020 base pairs

(B) type: nucleic acid

(C) Chain property: Unknown

(D) Topology: Unknown

(ii) molecular form: DNA

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: Synechocystis sp. PCC6803

(ix) Features:

(A) Name / Key: CDS

(B) Location: 1..1020

(xi) Sequence description: SEQ ID NO: 1

(2) information on SEQ ID NO: 2

(i) sequence properties:

(A) Length: 339 amino acids

(B) Type: Amino Acid

(D) Topology: Linear

(ii) molecular form: protein

(xi) sequence description: sequence 2

(2) information on SEQ ID NO: 3

(i) sequence properties:

(A) Length: 2582 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Linear

(ii) molecular form: cDNA

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: Pseudomonas fluorescens

(ix) Features:

(A) Name / Key: CDS

(B) Location: 1217..2290

(xi) sequence description: sequence 3

(2) information on SEQ ID NO: 4

(i) sequence properties:

(A) Length: 358 amino acids

(B) Type: Amino Acid

(D) Topology: Linear

(ii) molecular form: protein

(xi) sequence description: SEQ ID NO: 4

(2) information on SEQ ID NO: 5

(i) sequence properties:

(A) Length: 17 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO:

TATGAGAATC CTATGGG

(2) information on SEQ ID NO: 6

(i) sequence properties:

(A) Length: 17 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO. 6:

GCTTTGAA GTTTCCCTC

(2) information on SEQ ID NO: 7

(i) sequence properties:

(A) Length: 46 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO.

GTTAGGTACC AGTCTAGACT GACCATGGCC GACCAATACG AAAACC

(2) information on SEQ ID NO: 8

(i) sequence properties:

(A) Length: 43 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 8

TAGCGGTACC TGATCACCCG GGTTATTAGT CGGTGGTCAG TAC

(2) information on SEQ ID NO: 9

(i) sequence properties:

(A) Length: 516 amino acids

(B) Type: Amino Acid

(D) Topology: Linear

(ii) molecular form: protein

(xi) sequence description: SEQ ID NO.

(2) information on SEQ ID NO: 10

(i) sequence properties:

(A) Length: 17 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 10:

AACAAGGTGG CGCAGTT

(2) information on SEQ ID NO: 11

(i) sequence properties:

(A) Length: 20 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO.

CATCGCAAGA CCGGCAACAG

(2) information on SEQ ID NO: 12

(i) sequence properties:

(A) Length: 19 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO: 12.

GATCGCTACT AGCTTCCCA

(2) Information about SEQ ID NO: 13

(i) sequence properties:

(A) Length: 22 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 13:

AATCAAGGTA ACCTTGAATC CA

(2) information on SEQ ID NO: 14

(i) sequence properties:

(A) Length: 18 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 14

AATTACGGAA GCTTCCGT

(2) information on SEQ ID NO: 15

(i) sequence properties:

(A) Length: 20 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 15

AGCTTGTACA CCGGTGTACA

(2) information on SEQ ID NO: 16

(i) sequence properties:

(A) Length: 22 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 16:

CGGACAATTA ATTGTCCGGT AC

(2) information for SEQ ID NO: 17

(i) sequence properties:

(A) Length: 22 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO: 17.

CATTTGCGGC CGCAAATGGT AC

(2) information on SEQ ID NO: 18

(i) sequence properties:

(A) Length: 22 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO: 18.

AATTCATTTG CGGCCGCAAA TG

(2) Information about SEQ ID NO: 19

(i) sequence properties:

(A) Length: 20 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO: 19.

AGCTTGCAGC GGCCGCTGCA

(2) Information about SEQ ID NO: 20

(i) sequence properties:

(A) Length: 22 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO: 20.

AATTCATTTG CGGCCGCAAA TG

(2) Information about SEQ ID NO: 21

(i) sequence properties:

(A) Length: 28 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) Sequence description: SEQ ID NO: 21.

CTCGAGTATT TTTACAACAA TTACCAAC

(2) Information about SEQ ID NO: 22

(i) sequence properties:

(A) Length: 22 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 22

AATCAAGGTA ACCTTGAATC CA

(2) Information about SEQ ID NO: 23

(i) sequence properties:

(A) Length: 26 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 23

ACCACCAACG GTGTTCTTGC TGTTGA

(2) information on SEQ ID NO.24;

(i) sequence properties:

(A) Length: 27 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 24:

GCATTACATG TTAATTATTA CATGCTT

(2) Information about SEQ ID NO: 25

(i) sequence properties:

(A) Length: 28 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 25

GTGATACGAG TTTCACCGCT AGCGAGAC

(2) information for SEQ ID NO: 26

(i) sequence properties:

(A) Length: 24 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 26:

TACCTTGCGT GGACCAAAGA CTCC

(2) Information about SEQ ID NO: 27

(i) sequence properties:

(A) Length: 24 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 27

ATGGCTTCCG CTCAAGTGAA GTCC

(2) information on SEQ ID NO: 28

(i) sequence properties:

(A) Length: 24 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 28

CGAGACCCAT AACGAGGAAG CTCA

(2) information for SEQ ID NO: 29

(i) sequence properties:

(A) Length: 24 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 29

ATTGCGTGAT TTCGATCCTA ACTT

(2) Information about SEQ ID NO: 30

(i) sequence properties:

(A) Length: 24 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 30

GAGAGATGTC GATAGAGGTC TTCT

(2) Information about SEQ ID NO: 31

(i) sequence properties:

(A) Length: 24 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 31

GGTGGAGCAC GACACACTTG TCTA

(2) information on SEQ ID NO: 32

(i) sequence properties:

(A) Length: 18 base pairs

(B) type: nucleic acid

(C) Chain property: Japanese chain

(D) Topology: Unknown

(ii) molecular form: other nucleic acids

(A) Skill: / desc = "primer"

(iii) Hypothesis: None

(iv) anti-sense: none

(vi) Source of Supply:

(A) organism: primer

(xi) sequence description: SEQ ID NO: 32

GTCTCAATGT AATGGTTA

Claims (30)

(i) the polynucleotide does not encode a fusion protein comprising only 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) impart at least a first herbicide resistance or resistance to a plant or tissue provided that the polynucleotide does not comprise only a region encoding GST and phosphinothricin acetyl transferase (PAT) A polynucleotide comprising a first region that encodes a first protein that is present and a second region that encodes a second protein that can confer resistance to a second herbicide. The polynucleotide of claim 1, wherein each region is under the control of expression of the operable plant promoter and terminator. The polynucleotide of any one of the preceding claims wherein the first herbicide is a post emergent herbicide and the second herbicide is a pre-emergency herbicide. The method of any one of the preceding claims, wherein the protein is glyphosate oxido-reductase, 5-enol-pyruville-3-phosphosikimate synthase, phosphinothricin acetyl transferase, hydroxyphenyl pyruvate Deoxygenase, glutathione S transferase, cytochrome P450, acetyl-COA carboxylase, acetolactate synthase, protoporpynogen oxadase, dihydroteroate synthase, polyamine carrier protein, superoxide dismutase, bro A polynucleotide selected from the group consisting of moxinil nitriase, phytoene desaturase, tfdA gene product obtainable from Alcaligenes eutrophus, and known mutated or modified variants of the protein. The poly according to any one of claims 1 to 4, further comprising a region encoding a protein capable of imparting resistance or resistance to insects, dehydration and / or bacteria, bacterial or viral infections to the plant. Nucleotides. The polynucleotide of any one of the preceding claims, wherein the polynucleotide comprises SEQ ID NO: 5 'of the region and SEQ ID NO: 5' adjacent to the region, wherein the sequence comprises (i) chloroplast, mitochondria, other organelles or plant cell walls; Peptides capable of targeting the translation product of the region with the same plastid; And / or (ii) a polynucleotide encoding an untranslated translation enhancing sequence. The method according to any one of the preceding claims, wherein when the modified polynucleotide contains a desired plant codon, the identity of the protein coding region in the modified polynucleotide and the protein coding region inherent in the protein and substantially the same protein coding region Under conditions of less than about 70%, expression of modified polynucleotides in plants, the protein coding region of the unmodified polynucleotides having substantially similar activity / action as that obtained by expression of unmodified polynucleotides in an endogenous organism Nucleotides modified to remove mRNA labile motifs and / or unexpected contacts so that substantially similar proteins can be obtained or using preferred plant codons. 8. The pre-emergency herbicide of claim 3, wherein the pre-expressing herbicide is a dinitroaniline herbicide, diphenyl ether, sulfonyl urea, phosphosulfonate, oxacetamide, tetrazolinone and N-carbamoyltetra. Zolinone, imidazolinone, thiocarbamate, triazine, triazolopyrimidine, uracil, phenylurea, triketone, isoxazole, acetanilide, oxadiazole, triazinone, sulfonanilide, amide, anilide, PR201772, Glyphosate and its salts, glufosinate, asulam, ventazone, bialaphos, bromasyl, cetoxy, selected from the group consisting of fluorochloridone, norflurazone and triazolinone herbicides Dim or another cyclohexanedione, dicamba, fosamine, flupoxam, phenoxy propionate, quizallofo or another aryloxy-phenoxypropanoate, picloram, floe Ormetrone, atrazine or another triazine, metrizinine, chlorimuron, chlorsulfuron, flumetsulam, halosulfuron, sulfomethrone, imazaquin, imazuetapyr, isoxaben, imazamox , Metosullam, pyritrobac, rimsulfuron, bensulfuron, nicosulfuron, pomessafen, fluloglycopene, KIH9201, ET751, carpentrazone, ZA1296, sulcotrione, paraquat, diquat, bromoxynil and A polynucleotide selected from the group consisting of phenoxaprop. The method of claim 1 wherein the pre-expressing herbicide is selected from the group consisting of acetanilide, triketone, PDS inhibitor, thiocarbamate, tetrazolinone and the post-expressing herbicides are glyphosate, glufosinate, paraquat and non-alphos. Polynucleotide selected from the group consisting of. A vector comprising the polynucleotide of any one of claims 1 to 9. (i) the polynucleotide does not encode a fusion protein comprising only 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) the polynucleotide does not contain only a region encoding GST and phosphinothricin acetyl transferase (PAT); And (iv) a plant capable of imparting resistance or resistance to at least a first herbicide to a plant or tissue comprising the same, provided that the herbicide resistance or resistance conferring genes it contains are not only EPSPS and PAT if the plant is sugar beet. A plant comprising a polynucleotide comprising a first region encoding a first protein and a polynucleotide comprising a second region encoding a second protein that can confer resistance to a second herbicide. The plant of claim 1 wherein the first herbicide is a pre-emergency herbicide and the second herbicide is a post emergence herbicide. A plant comprising organs, seeds and products thereof resistant to two or more herbicides obtained from a material transformed with the polynucleotide of any one of claims 1 to 9 or the vector of claim 10. The plant according to the preceding claim, which is selected from the group consisting of bovine grain cereals, oil seed crops, fiber plants, fruits, vegetables, cultivated crops and trees. The soybean, cotton, tobacco, sugar beet, oilseed rape, canola, flax, sunflower, potato, tomato, alfalfa, lettuce, corn, wheat, streaks, oats, bananas according to any one of claims 11-14. , Plants selected from the group consisting of barley, oats, grass, forage, sugarcane, field beans, peas, rice, pine, poplar, apples, grapes, tangerines or peanut plants and their products, seeds and organs of these plants. A method of selectively inhibiting weeds in a field comprising weeds and crop plants, wherein the crop plants are (I) (i) polynucleotides of 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione. Not encode fusion proteins containing only S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) the polynucleotide does not contain only a region encoding GST and phosphinothricin acetyl transferase (PAT); And (iv) if the crop plant is sugar beet, provided that the herbicide resistance or resistance imparting gene is not the only EPSPS and PAT, at least the first herb to impart resistance to the first herbicide to the plant or tissue comprising the same; A polynucleotide comprising a first region encoding a protein and a second region encoding a second protein that can confer resistance to a second herbicide; Or (II) (i) the polynucleotide does not encode a fusion protein comprising only 5-endo-pyruville-3-phosphosikimate synthase (EPSPS) and glutathione S transferase (GST); (ii) the polynucleotide does not contain only a region encoding superoxide dismutase (SOD) and glutathione S transferase (GST); (iii) the polynucleotide does not contain only a region encoding GST and phosphinothricin acetyl transferase (PAT); And (iv) if the crop plant is sugar beet, provided that the herbicide resistance or resistance imparting gene is not the only EPSPS and PAT, the first plant capable of conferring at least a first herbicide to the plant or tissue comprising the same; A polynucleotide comprising a first region encoding a protein and a polynucleotide comprising a second region encoding a second protein that can thus impart resistance to a second herbicide and substantially affect crop plants And applying one or more of the herbicides to the field in an amount sufficient to inhibit weeds without affecting the weeds. The method of claim 1, wherein the crop plant comprises a gene encoding the EPSPS enzyme and a gene encoding the GST enzyme, and an amount of acetanilide and glyphosate sufficient to inhibit weeds without substantially affecting the crop plant. A method comprising applying to a field. The crop plant of claim 16, wherein the crop plant comprises a gene encoding the HPPD enzyme and a gene encoding the PAT enzyme, wherein the crop plant contains an amount of triketone and glufosinate sufficient to inhibit weeds without substantially affecting the crop plant. A method comprising applying to a field. 17. The method of claim 16, wherein the crop plant comprises a gene encoding a PAT enzyme and a gene encoding a GST enzyme, wherein the amount of glufosinate and acetanilide is sufficient to inhibit weeds without substantially affecting the crop plant, A method comprising applying thiocarbamate and / or tetrazolinone to a field. The crop plant of claim 16, wherein the crop plant comprises a gene encoding an EPSPS and / or GOX enzyme and a gene encoding an HPPD enzyme, an amount of triketone sufficient to inhibit weeds without substantially affecting the crop plant and A method comprising applying glyphosate to a field. 17. The method of claim 16, wherein the crop plant comprises a gene encoding a PDS enzyme and a gene encoding an EPSPS and / or GOX enzyme, the amount of the PDS inhibitor being sufficient to inhibit weeds without substantially affecting the crop plant; A method comprising applying glyphosate to a field. 17. The weed of claim 16, wherein the crop plant comprises a gene encoding an EPSPS and / or GOX enzyme and a gene encoding a PAT enzyme, and provided that the plant is not a sugar beet, without substantially affecting the crop plant. Applying a sufficient amount of glufosinate and glyphosate to the field. 17. The method according to claim 16, wherein the crop plant comprises a gene encoding a PDS enzyme and a gene encoding a PAT enzyme, and an amount of PDS inhibitor and glufosinate sufficient to inhibit weeds without substantially affecting the crop plant. A method comprising applying to a field. 17. The method according to claim 16, wherein the crop plant comprises a gene encoding a PDS enzyme and a gene encoding a GST enzyme, and an amount of PDS inhibitor and acetanilide herbicide sufficient to inhibit weeds without substantially affecting the crop plant. A method comprising applying to a field. 25. The plant according to any one of claims 17 to 24, wherein the crop plant further contains a gene encoding ALS, SOD or BNX, and in an amount sufficient to inhibit weeds without substantially affecting the crop plant. A method comprising applying a ponyl urea, paraquat or bromoxynil herbicide to a field. 26. The method of any one of claims 16-25, further comprising applying to the field an insecticidal effective amount of one or more pesticides, fungicides, bacteria, anti nematodes and antiviral agents. (i) transforming the plant material with the vector of claim 10 or the polynucleotide of any one of claims 1 to 9; (ii) selecting the so transformed material; And (iii) regenerating the material thus selected into the normal form of fertile whole plants; A method of obtaining a plant substantially resistant to or substantially resistant to two or more herbicides. Use of the polynucleotide of any one of claims 1 to 9 or the vector of claim 10 to obtain a normal form of fertile plant and / or plant tissue that is substantially resistant or substantially resistant to two or more herbicides. Use of the polynucleotide of any one of claims 1 to 9 or the vector of claim 10 to obtain a herbicide target for large screening of potential herbicides in vitro. The method of claim 1, wherein the protein coding region of the polynucleotide is heterologously expressed in E. coli or yeast.