KR20000007167A - Bifidobacterium longum mk-g7 bifidus strain and this use - Google Patents

Bifidobacterium longum mk-g7 bifidus strain and this use Download PDF

Info

Publication number
KR20000007167A
KR20000007167A KR1019980026354A KR19980026354A KR20000007167A KR 20000007167 A KR20000007167 A KR 20000007167A KR 1019980026354 A KR1019980026354 A KR 1019980026354A KR 19980026354 A KR19980026354 A KR 19980026354A KR 20000007167 A KR20000007167 A KR 20000007167A
Authority
KR
South Korea
Prior art keywords
strain
bifidus
bifidobacterium
hours
bifidobacterium longum
Prior art date
Application number
KR1019980026354A
Other languages
Korean (ko)
Other versions
KR100264295B1 (en
Inventor
전석락
정후길
김응률
지근억
박종현
Original Assignee
김정완
매일유업 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 김정완, 매일유업 주식회사 filed Critical 김정완
Priority to KR1019980026354A priority Critical patent/KR100264295B1/en
Publication of KR20000007167A publication Critical patent/KR20000007167A/en
Application granted granted Critical
Publication of KR100264295B1 publication Critical patent/KR100264295B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

PURPOSE: A novel bifidus strain is provided which is transferred into an intestine in a certain amount to show a profitable effect in the host. CONSTITUTION: Bifidobacterium longum MK-G7 is provided which represents proper physiological activation to Korean, has excellent adaptability to cultivation in the fermented products, cholesterol lowering activity and microphage activation effect and also tolerance to acid, bile, air and mutation.

Description

비피도박테리움 론검 MK-G7 비피더스 균주 및 이의 용도Bifidobacterium rongum MK-G7 Bifidus strain and use thereof

본 발명은 배양 적용능이 우수하고 내산성, 내담즙성, 내산소성, 콜레스테롤 저하능, 항돌연변이능, 마크로파지 활성능 등 탁월한 생리 활성을 보유한 신규 비피도박테리움 론검(Bifidobacterium longum) MK-G7 비피더스 균주 및 이의 용도에 관한 것이다.The present invention is a novel Bifidobacterium longum MK-G7 bifidus strain having excellent physiological activities such as excellent culture application ability, acid resistance, bile resistance, oxygen resistance, cholesterol lowering ability, antimutagenicity, macrophage activity, and the like. To its use.

인간이나 동물에게 살아 있는 미생물을 분말 또는 발효산물의 형태로 투여했을 때 장내 미생물의 바람직한 균형과 그들의 생리 특성을 증진시키며 숙주에게 유익한 효과를 나타내는 미생물 식품 강화제를 프로바이오틱스(probiotics)라고 한다(Fuller, R. 1989. A review : Probiotics in man and animals. Journal of Applied Bacteriology. 66:365-378 ; Lee,Y.K. and S. Salminen. 1995. The coming of age of probiotics. Trends in Food Science & Technology. 6:241-245 ; O'Sullivan, M. G., G.Thornton, G.C.O'Sullivan, and J.K.Collins. 1992. Probiotic bacteria : Myth or reality ? Trends in Food Science & Technology. 3:309-314).Microbial food enhancers that enhance the desirable balance of intestinal microorganisms and their physiological properties when they are administered to humans or animals in the form of powders or fermented products are known as probiotics (Fuller, R). A review: Probiotics in man and animals.Journal of Applied Bacteriology.66: 365-378; Lee, YK and S. Salminen. 1995.The coming of age of probiotics.Trends in Food Science & Technology. 6: 241 -245; O'Sullivan, MG, G. Thornton, GCO'Sullivan, and JK Collins. 1992. Probiotic bacteria: Myth or reality? Trends in Food Science & Technology. 3: 309-314).

특히 비피더스균은 모유를 섭취하는 유아의 장내에 최우세균으로 존재하기 때문에 유아가 대장균 등 외부로부터 유입되는 유해세균의 장내 증식을 저지하여 세균성 설사를 방지하며 여러 종류의 세균성 질환에 대한 예방 능력을 보유하는 것으로 알려져 있다. 이러한 비피더스균은 나이가 들면서 감소하며 특히 노인이 되면 검출율과 균수가 모두 낮아지는 것으로 알려져 있다.In particular, because bifidus bacteria exist as the most dominant bacteria in the intestines of breastfeeding infants, infants prevent bacterial diarrhea by preventing intestinal proliferation of harmful bacteria from the outside, such as E. coli, and have the ability to prevent various kinds of bacterial diseases. It is known. These bifidus bacteria decrease with age, and it is known that both the detection rate and the number of bacteria decrease, especially in the elderly.

비피더스균의 유익한 건강 증진 작용으로는 감염에 대한 저항성, 항암·항종양 효과, 혈중 콜레스테롤 함량의 저하 및 정장 효과 등의 다양한 생리 활성이 보고되어 있다(Hentges,D.J. 1983. In :Human intestinal microflora in health and disease. Academic Press. pp.241-261 ; Hosono,A., R.Wardojo, and H.Otani. 1990. Inhibitory effects of lactic acid bacteria from fermented milk on the mutagenicities of volatile nitrosoamines. Agricultural and Biological Chemistry. 54(7):1639-1643). 따라서 프로바이오틱스(Probiotics)로서 비피더스균과 같은 유산균의 우수 개량 균주를 개발하는 것이 중요한 과제로 부각되고 있다(Klaenhammer,T.R. 1982. Microbiological considerations in selection and preparation ofLactobacillusstrains for use as dietary adjuncts. Journal of Dairy Science. 65:1339-1349).The beneficial health-promoting effects of bifidus bacteria have been reported in various physiological activities such as resistance to infection, anti-cancer and anti-tumor effects, lowering blood cholesterol and intestinal effects (Hentges, DJ 1983. In: Human intestinal microflora in health). and disease.Academic Press.pp.241-261; Hosono, A., R. Wardardo, and H. Otani. 1990. Inhibitory effects of lactic acid bacteria from fermented milk on the mutagenicities of volatile nitrosoamines.Agricultural and Biological Chemistry. 54 (7): 1639-1643). Therefore, it is important to develop excellent modified strains of lactic acid bacteria such as bifidus as probiotics (Klaenhammer, TR 1982. Microbiological considerations in selection and preparation of Lactobacillus strains for use as dietary adjuncts. Journal of Dairy Science) 65: 1339-1349).

비피더스균의 다양한 생리 활성을 식품산업에 이용하는 응용 사례가 증가하고 있지만 비피더스균이 편성 혐기성균이라는 점과 경구 섭취했을 때 공복시의 가혹한 환경, 즉 pH가 3.0 이하로 내려가는 위장과 소장에서 분비되는 소화 효소 및 담즙산에 의해서 비피더스균의 생육이 저해되기 때문에 대장에 도달하는 균수가 감소할 뿐만 아니라 장내 정착율이 저하된다는 점등 문제점이 지적되고 있다(Mitsuoka,T. 1989. Microbes in the intestine. In :Our Lifelong Partners.pp.1-18).Increasingly, applications of bifidus bacteria in the food industry are increasing, but digestive enzymes are secreted from the gastrointestinal and small intestine in which the bifidus bacteria are organized anaerobic bacteria, and when taken orally, in a fasting environment, ie, the pH drops below 3.0. And bile acids inhibit the growth of bifidus bacteria, which leads to a decrease in the number of bacteria reaching the large intestine and a decrease in the intestinal fixation rate (Mitsuoka, T. 1989. Microbes in the intestine.In: Our Lifelong Partners). . pp.1-18).

실제로 현재 요구르트 등 대부분의 유산균 발효유 제품의 제조 공정에서 첨가된 비피더스균은 생육되지 못하고 오히려 사멸되는 근본적인 문제점을 안고 있다. 따라서 이와 같이 제조되어 시판되고 있는 비피더스 유산균 발효유를 섭취하더라도 대장에 도달하여 정착하는 비피더스 균수가 숙주에 유익한 작용을 할 정도로 충분한 양이 되지 못한다고 보고되어 있다(Desjardins,M.L., D.Roy, C.Toupin, and J.Goulet. 1990. Uncoupling of growth and acids production inBifidobacteriumspp. Journal of Dairy Science. 73:1478-1484).In fact, the current bifidus bacteria added in the manufacturing process of most lactic acid bacteria fermented milk products such as yogurt has a fundamental problem that is not grown but rather killed. Therefore, it is reported that even if the ingested bifidus lactobacillus fermented milk produced and marketed as described above is ingested, the number of bifidus bacteria that reach and settle in the large intestine is not sufficient to have a beneficial effect on the host (Desjardins, ML, D. Roy, C.Toupin , and J. Golet. 1990. Uncoupling of growth and acids production in Bifidobacterium spp. Journal of Dairy Science. 73: 1478-1484).

또한, 현재 국내에서 발효유 제품에 사용하고 있는 유산균은 외국인에서 유래된 균주이므로 한국인에 적합한 생리활성을 나타내지 못한다는 점도 문제점으로 지적되어 왔다.In addition, since the lactic acid bacteria currently used in fermented milk products in Korea are strains derived from foreigners, it has been pointed out as a problem that they do not exhibit the physiological activity suitable for Koreans.

본 발명은 이와 같은 종래 비피더스균의 문제점을 감안하여 안출된 것으로서 그 목적은 발효유 제품에서의 배양 적용능이 우수하고 내산성, 내담즙성 및 내산소성, 콜레스테롤 저하능, 항돌연변이능, 마크로파지 활성능 등이 뛰어나며 한국인에 적합한 생리활성을 갖는 신규 비피더스 균주를 제공하는 것이다.The present invention has been devised in view of the problems of the conventional bifidobacteria, the purpose of which is excellent culture application ability in fermented milk products, acid resistance, bile resistance and oxygen resistance, cholesterol lowering ability, antimutagenicity, macrophage activity, etc. It is to provide a novel bifidus strain having excellent physiological activity suitable for Koreans.

도 1은 본 발명에 의한 비피더스 균주의 집락 성상을 나타내는 사진이고,1 is a photograph showing the colony characteristics of the bifidus strain according to the present invention,

도 2는 본 발명에 의한 비피더스 균주의 효소 패턴(API ZYM Test Kit 사용)을 나타내는 사진이고,Figure 2 is a photograph showing the enzyme pattern (using the API ZYM Test Kit) of the bifidus strain according to the present invention,

도 3은 본 발명에 의한 비피더스 균주의 탄수화물 발효 성상(API 50 CHL Test Kit 사용)을 나타내는 사진이고,Figure 3 is a photograph showing the carbohydrate fermentation properties (using the API 50 CHL Test Kit) of the bifidus strain according to the present invention,

도 4는 본 발명에 의한 비피더스 균주의 광학현미경 사진(×1,500)이고,4 is an optical micrograph (× 1,500) of the bifidus strain according to the present invention,

도 5는 본 발명에 의한 비피더스 균주의 PFGE 분석 결과를 나타낸 사진이고,5 is a photograph showing the result of PFGE analysis of the bifidus strain according to the present invention,

도 6은 본 발명에 의한 비피더스 균주의 전자현미경 사진(×12,000)이고,6 is an electron micrograph (× 12,000) of the bifidus strain according to the present invention,

도 7은 본 발명에 의한 비피더스 균주의 배양 중 생균수의 변화를 나타내는 그래프이고,7 is a graph showing a change in the number of viable cells during the culture of the bifidus strain according to the present invention,

도 8은 본 발명에 의한 비피더스 균주를 함유하는 제품의 저장 중 생균수의 변화를 나타내는 그래프이다.8 is a graph showing the change in viable cell number during storage of the product containing the bifidus strain according to the present invention.

상기와 같은 비피더스 균주를 발명하기 위하여 본 발명자들은 건강한 한국인 유아로부터 청장년에 이르기까지 100명 이상의 분변을 시료로 사용하여 200여종의 비피더스 균주를 분리하고 분리된 비피더스 균주에 대한 내산성, 내담즙성, 내산소성을 비교하여 가장 능력이 우수한 비피더스 균주를 1차로 선발하였다.In order to invent the bifidus strain as described above, the present inventors separated over 200 bifidus strains from 100 healthy feces from healthy Korean infants to young adults, and analyzed acid resistance, bile resistance, and acid resistance of the isolated bifidus strains. The best bifidus strains were selected first by comparing the firing.

선발된 비피더스 균주에 대한 생리활성 효과를 검정하기 위하여 in vitro 상에서의 콜레스테롤 저하능, 항돌연변이능, 마크로파지 활성능 등을 검사하고, 생리 활성이 가장 우수한 비피더스균의 동정을 실시한 결과 지금까지의 상업용 균주 및 표준 공시균주와는 특성이 전혀 다른 신규 비피더스 균주를 확인하였다.In order to test the physiological activity of the selected bifidus strains, the cholesterol lowering ability, antimutagenicity, macrophage activating ability, etc. were examined in vitro, and the most physiologically active bifidus strains were identified. And a novel bifidus strain that is completely different from the standard test strain.

따라서, 본 발명자들은 이 새로운 비피더스 균주를 비피도박테리움 론검(Bifidobacterium longum) MK-G7으로 명명하고 한국과학기술연구원 생명공학연구소 유전자원센타 유전자은행에 KCTC 0488 BP로 기탁하였다.Therefore, the present inventors named this new Bifidobacteria strain Bifidobacterium longum MK-G7 and deposited it as KCTC 0488 BP at the Genetic Resource Center Gene Bank of Korea Research Institute of Science and Technology.

본 발명에 의한 균주는 기존의 비피더스 균주와는 달리 단독 또는 락토바실러스(Lactobacilli)와 스트렙토코커스(Streptococci)와의 혼합배양에서도 비피더스 균주의 생육이 108cfu/ml 수준 이상으로 이루어짐은 물론 발효유의 유통기한 중에도 사멸이 거의 일어나지 않아 제품 적용성이 뛰어남을 확인하였다.Unlike the conventional bifidus strain, the strain according to the present invention is grown alone or in mixed culture of Lactobacillus ( Lactobacilli ) and Streptococci ( Streptococci ), the growth of bifidus strains is not less than 10 8 cfu / ml level, as well as the shelf life of fermented milk Almost no death occurred during the process, and the product applicability was confirmed to be excellent.

따라서, 본 발명에 의한 균주는 발효유 제품, 유아식, 비피더스 강화 우유, 유산균 제제, 건강보조식품, 사료첨가제, 의약품, 화장품 등의 다양한 제품에 활용될 수 있다.Therefore, the strain according to the present invention can be used in a variety of products, such as fermented milk products, baby food, bifidus fortified milk, lactic acid bacteria formulations, dietary supplements, feed additives, pharmaceuticals, cosmetics.

이하, 실시예에 의거하여 본 발명을 보다 상세히 설명한다. 하기 실시예는 본 발명의 이해를 보다 용이하게 하기 위하여 제공되는 것으로, 본 발명의 범위가 이들 실시예로 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail based on Examples. The following examples are provided to facilitate the understanding of the present invention, and the scope of the present invention is not limited to these examples.

실시예 1:자연물로부터 비피더스 균주를 분리 Example 1 Separation of Bifidus Strains from Natural Products

100명 이상의 건강한 한국인 성인과 유아로부터 분변을 채취하여 비피더스균의 선택 배지인 TP 배지를 사용하여 비피더스균을 분리하였다.Fecal samples were collected from more than 100 healthy Korean adults and infants, and bifidus bacteria were isolated using TP medium, which is a selection medium of bifidus bacteria.

혐기성 희석액을 사용하여 분변을 10-8까지 희석한 후, 각각의 희석액에서 100㎕를 취하여 TP 배지에 도말하였다. 분변의 희석에 사용된 혐기성 희석액의 성분 조성은 표 1과 같다.Diarrhea was diluted to 10 −8 using anaerobic dilution, then 100 μl of each dilution was plated in TP medium. The composition of the anaerobic diluent used for dilution of feces is shown in Table 1.

혐기성 희석액의 성분 조성Composition of ingredients in anaerobic diluent 성 분ingredient 함 량content 비 고Remarks 0.78 % K2HPO4 0.78% K 2 HPO 4 37.5 ml37.5 ml 염 용액1) Salt solution 1) 37.5 ml37.5 ml Resazurine(0.1 %)Resazurine (0.1%) 1.0 ml1.0 ml L-cysteine·HCl·H2OL-cysteineHClH 2 O 0.5 g0.5 g L-ascorbic acid(25 %)L-ascorbic acid (25%) 2.0 ml2.0 ml Na2CO3(8 %)Na 2 CO 3 (8%) 50.0 ml50.0 ml AgarAgar 0.5 g0.5 g 증류수Distilled water 860.0 ml860.0 ml 1) 염 용액 : 증류수 100 ml에 K2HPO40.47 g, NaCl 1.18 g, (NH4)2SO41.20 g, CaCl20.12 g 및 MgSO4·H2O 0.25 g을 용해시켜 제조한다.1) Salt solution: prepared by dissolving 0.47 g of K 2 HPO 4 , 1.18 g of NaCl, 1.20 g of (NH 4 ) 2 SO 4 , 0.12 g of CaCl 2 and 0.25 g of MgSO 4 · H 2 O in 100 ml of distilled water.

TP 배지의 성분 조성은 표 2와 같다.Component composition of the TP medium is shown in Table 2.

TP 배지의 성분 조성Component Composition of TP Medium 성 분ingredient 함 량content 비고Remarks Trypticase peptoneTrypticase peptone 10.0 g10.0 g BBLBBL Proteose peptone No. 3Proteose peptone No. 3 5.0 g5.0 g 황산암모늄Ammonium Sulfate 3.0 g3.0 g KH2PO4 KH 2 PO 4 2.0 g2.0 g K2HPO4 K 2 HPO 4 1.0 g1.0 g L-cysteine·HClL-cysteineHCl 0.5 g0.5 g Magnesium sulfateMagnesium sulfate 0.2 g0.2 g AgarAgar 15.0 g15.0 g 살균된 20 % TOS 용액1) Sterilized 20% TOS Solution 1) 50.0 ml50.0 ml 프로피온산 나트륨(pH 7.0)Sodium propionate (pH 7.0) 50.0 ml50.0 ml 증류수Distilled water 1,000 ml1,000 ml 1) TOS : Transgalactooligosaccharide※ 최종 pH는 7.0으로 조정1) TOS: Transgalactooligosaccharide ※ Final pH is adjusted to 7.0

이 배지를 혐기 배양조(anaerobic jar)에서 가스 팩 시스템(gas pack system)과 혐기성 글로브 박스(anaerobic glove box)를 이용하여 배양조 내의 산소를 질소로 치환하여 혐기 환경을 조성한 후, 37℃에서 48-72시간 동안 배양하였다.The medium was replaced with nitrogen in an anaerobic jar using a gas pack system and an anaerobic glove box to form an anaerobic environment. Incubated for -72 hours.

이러한 방법으로 200여 비피더스 균주를 1차 분리한 후, 이들을 대상으로 비피더스 균주의 내산성, 내담즙성, 내산소성 등을 조사하여, 스트레스 환경에 대해서 생존능이 우수하고 제품 적용능이 우수한 신규 비피더스균을 선발하여 비피도박테리움 론검(Bifidobacterium longum) MK-G7으로 명명하였다. 선발과정에서 신규 비피더스균의 확인 및 동정, 내산성, 내담즙성, 내산소성 등은 각각 다음과 같이 시행하였다.In this way, 200 isolates of bifidus strains were first isolated, and then, the subjects were examined for acid resistance, bile resistance, and oxygen resistance of the bifidus strains to select new bifidus strains with excellent viability and product application ability against stress environment. It was named Bifidobacterium longum MK-G7. During the selection process, identification and identification of new bifidus bacteria, acid resistance, bile resistance, and oxygen resistance were performed as follows.

실시예 2:비피더스균의 확인 Example 2 Identification of Bifidobacteria

본 발명에 따른 비피도박테리움 론검(Bifidobacterium longum) MK-G7을 실시예 1의 혐기 배양조(anaerobic jar), 고체 TP 배지에서 배양한 결과 형성된 집락 성상을 도 1에 나타내었다. Bifidobacterium longum ( Bifidobacterium longum ) MK-G7 according to the present invention is shown in Figure 1 the colony formed as a result of culturing in the anaerobic jar (anaerobic jar), solid TP medium of Example 1.

본 발명의 균주는 API 50 CHL test kit(API, France)를 이용한 탄수화물 발효 실험 결과 전형적인Bifidobacterium longum의 탄수화물 발효 성상을 나타냈으며, API ZYM test kit(API, France)를 이용한 효소 분석 실험도 전형적인 비피더스균의 효소 패턴을 나타냈다(도 2, 3).Carbohydrate fermentation using the API 50 CHL test kit (API, France) showed a typical carbohydrate fermentation of Bifidobacterium longum . The enzyme pattern of (Fig. 2, 3) was shown.

한편, 그램 염색을 한 후 현미경으로 관찰하여 형태적으로 다형성을 나타내는 비피더스 균주임을 확인하였다(도 4).On the other hand, after gram staining was observed under a microscope to confirm that the strain is a bifidus strain showing a polymorphism (Fig. 4).

본 발명의 비피더스 균주를 BHI(brain heart infusion) 액체 및 고체배지에 접종하여 활성화시킨 배양액으로 Scardovi(Scardovi,V. 1986. GenusBifidobacterium. In :Bergey's Manual of Systematic Bacteriology. 9th Ed. Vol.2. Ed. Sneath,P.H., N.S.Mair, M.E.Sharpe, and J.G.Holt. pp.1418-1434. Williams and Wilkins Publishers. Baltimore. MD)의 방법에 따라서 F6PPK(fructose-6-phosphate phosphoketolase) 실험을 실시하였다. 노란색의 반응액은 음성으로, 보라색의 반응액은 양성으로 판정하였으며 비피더스균의 확정 실험을 위하여 초산과 유산이 3:2의 비율로 생산되는 것을 가스크로마토그라피(gas chromatography) 상에서 확인하였다.Scardovi (Scardovi, V. 1986. Genus Bifidobacterium . In: Bergey's Manual of Systematic Bacteriology . 9th Ed. Vol. 2. Ed.) As a culture medium inoculated by inoculation into BHI (brain heart infusion) liquid and solid medium. F6CTK (fructose-6-phosphate phosphoketolase) experiments were performed according to the method of Sneath, PH, NSMair, MESharpe, and JGHolt.pp. 1418-1434. Williams and Wilkins Publishers. Yellow reaction solution was negative, purple reaction solution was determined to be positive, and acetic acid and lactic acid were produced at a ratio of 3: 2 for the confirmation experiment of bifidus bacteria by gas chromatography.

실시예 3:선발 비피더스균의 분자생물학적 동정 Example 3 Molecular Biology of Selected Bifidus

(1) 16S rRNA 분석 및 DNA 핑거프린팅(fingerprinting)(1) 16S rRNA analysis and DNA fingerprinting

① RNA의 준비① Preparation of RNA

10 ml의 비피더스 배양액으로부터 세포를 회수하여 0.5 ml의 ice-cold TE(pH 7.5) 완충액에 현탁시킨 후 0.6 g 유리 구슬(glass bead: 0.1 mm 이하), 0.17 ml 마칼로이드 점토(macaloid clay), 0.5 ml 페놀-클로로포름(1:1), 50 μl 10 % SDS를 첨가하고 4 ℃에서 5분간 강하게 혼합한 후 12,000 rpm에서 15분 동안 원심분리하였다.Cells were harvested from 10 ml of bifidus culture and suspended in 0.5 ml of ice-cold TE (pH 7.5) buffer, followed by 0.6 g glass beads (0.1 mm or less), 0.17 ml macaloid clay, 0.5 ml Phenol-chloroform (1: 1), 50 μl 10% SDS were added and vigorously mixed at 4 ° C. for 5 minutes and then centrifuged at 12,000 rpm for 15 minutes.

상등액을 페놀-클로로포름(1:1) 용액으로 추출하여 1/10배량의 3 M 소디움-아세테이트와 3배량의 96 % 에탄올로 -20 ℃에서 30분 동안 RNA를 침전시킨 후 원심분리(12,000 rpm, 15분)하여 침전된 펠렛 RNA를 70 % 에탄올로 수세하였다. 그후 펠렛 RNA를 실온에서 건조시키고 50 μl TE(pH 7.5) 완충액으로 현탁시켰다.The supernatant was extracted with phenol-chloroform (1: 1) solution to precipitate RNA for 30 min at -20 ° C with 1/10 fold of 3 M sodium-acetate and 3 folds of 96% ethanol, followed by centrifugation (12,000 rpm, 15 minutes), the precipitated pellet RNA was washed with 70% ethanol. The pellet RNA was then dried at room temperature and suspended in 50 μl TE pH 7.5 buffer.

② 염기 배열 분석을 위한 DNA의 준비② Preparation of DNA for Sequence Analysis

하룻밤 배양한 비피더스 배양액 10 ml로부터 세포를 회수하고, 1 ml TES(20 mM Tris-HCl, 0.1 mM Na2EDTA, 10 mM NaCl) 완충액으로 수세한 후 100 μl TES 완충액에 현탁시켰다. 라이소자임(Lysozyme)과 뮤타노라이신(mutanolysin)으로 37 ℃에서 15-30분 동안 처리하여 용해시킨 후 SDS(sodium dodecyl sulfate)로 65℃에서 5분 동안 처리하였다.Cells were recovered from 10 ml of bifidus culture incubated overnight, washed with 1 ml TES (20 mM Tris-HCl, 0.1 mM Na 2 EDTA, 10 mM NaCl) buffer and suspended in 100 μl TES buffer. Lysozyme (Lysozyme) and mutanolysine (mutanolysin) was treated for 15-30 minutes at 37 ℃ and dissolved with SDS (sodium dodecyl sulfate) for 5 minutes at 65 ℃.

그 후 NaCl을 첨가하여 1시간 동안 얼음상에서 배양한 후 12,000 rpm에서 20분 동안 원심분리하였고 동량의 클로로포름/이소아밀알코올로 DNA를 추출하였다. 정제된 DNA는 1/9배량의 3 M 소디움 아세테이트 용액과 2배량의 96% 에탄올로 침전시키고 70% 얼음으로 차게 한 에탄올(ice-cold ethanol)로 수세한 후 DNA 샘플을 진공 건조시켜 PCR(polymerase chain reaction)에 사용하였다. 16S rRNA 유전자의 서로 다른 부분들을 표 3의 프라이머(primer)와 결합시켜 증폭시켰다.Thereafter, the mixture was incubated on ice for 1 hour by addition of NaCl, centrifuged at 12,000 rpm for 20 minutes, and DNA was extracted with the same amount of chloroform / isoamyl alcohol. Purified DNA was precipitated with 1/9 times 3M sodium acetate solution and 2 times 96% ethanol and washed with 70% ice-cold ethanol, followed by vacuum drying the DNA sample to PCR (polymerase). chain reaction). Different parts of the 16S rRNA gene were amplified by binding to the primers of Table 3.

염기 배열 분석을 위한 프라이머들Primers for Sequence Analysis 이 름name 목 표goal 위 치location 염기 배열 순서Sequence 616v616v 16S16S 8-278-27 AG(G/A)GTTTGAT(T/C)C(G/T)GGCTAGAG (G / A) GTTTGAT (T / C) C (G / T) GGCTAG 612r612r 16S16S 969-984969-984 GTAAGGTTCTTCGCGTGTAAGGTTCTTCGCGT 610r610r 16S16S 515-531515-531 ACCGCGGCTGCTGGCACACCGCGGCTGCTGGCAC 612v612v 16S16S 515-531515-531 ACGCGAAGAACCTTACACGCGAAGAACCTTAC 630rII630rII 16S16S 189-206189-206 CA(T/G)AAAGGAGGTGATCCCA (T / G) AAAGGAGGTGATCC 941r941r 23S23S 1529-15451529-1545 ACT(G/A/T)AGATGTTTCA(G/C)TTCACT (G / A / T) AGATGTTTCA (G / C) TTC * Primers are referred to as universal primers* Position means the nucleotide number of 16S rDNA ofE.colicorresponding to the oligo.* Primers are referred to as universal primers * Position means the nucleotide number of 16S rDNA of E. coli corresponding to the oligo.

상기의 PCR 혼합물로부터 얻은 16S rDNA 유전자 분획물을 1 % TBE(89 mM Tris-borate, 2 mM EDTA) 완충액을 사용하여 전기영동 방법으로 분리하였다. 에티디움-브로마이드 염색 및 UV 조사후 DNA 단편이 있는 겔을 일정한 크기로 절단하여 겔 추출 키트(gel extraction kit: QiaGen)를 사용하여 DNA를 정제하였으며 16S rDNA 단편은 동일한 프라이머를 사용하여 염기 배열을 분석하였다.16S rDNA gene fractions obtained from the PCR mixture were separated by electrophoresis using 1% TBE (89 mM Tris-borate, 2 mM EDTA) buffer. After ethidium-bromide staining and UV irradiation, gels containing DNA fragments were cut to size and purified using a gel extraction kit (QiaGen), and 16S rDNA fragments were analyzed for nucleotide sequence using the same primers. It was.

③ DNA 핑거프린팅(fingerprinting)을 위한 DNA 준비③ DNA preparation for DNA fingerprinting

1) 삽입 DNA 준비1) Insert DNA Preparation

: 회수한 세포를 50 mM EDTA(pH 8.5)에 현탁시킨 후 1 % 저융점 아가로스에 고정시켰다. 고정된 세포를 라이소자임으로 37℃에서 3-4 시간 처리하여 용해시킨 후 1 % SDS와 2 mg/ml proteinase K(0.5 M EDTA, pH 8.5)를 50 ℃에서 하룻밤 반응시켰다. 마지막으로 고정된 세포를 50 mM EDTA(pH 8.5)로 5회 이상 수세한 후 50 mM EDTA(pH 8.5)에 담아 4 ℃에서 저장하였다. 이와 같이 준비한 DNA를 삽입 DNA라고 하였다.: The recovered cells were suspended in 50 mM EDTA (pH 8.5) and fixed to 1% low melting agarose. Fixed cells were lysozyme treated at 37 ° C. for 3-4 hours to lyse, and then reacted with 1% SDS and 2 mg / ml proteinase K (0.5 M EDTA, pH 8.5) at 50 ° C. overnight. Finally, the fixed cells were washed at least 5 times with 50 mM EDTA (pH 8.5) and then stored in 4 mM in 50 mM EDTA (pH 8.5). The DNA thus prepared was called insertion DNA.

2) 직접 삽입 DNA 준비2) Direct Insert DNA Preparation

: 소량의 동결 건조 분말을 50 mM EDTA(pH 8.5)에 현탁하여 세포를 회수한 후 동일한 완충액으로 1회 이상 수세하여 펠렛화 하였다. 다시 세포를 50 mM EDTA(pH 8.5)에 현탁시켜 1% 저융점 아가로스에 고정시켰다. 한편 DNA 핑거프린팅(fingerprinting)을 위한 DNA 준비는 1)과 같이 처리하였다.: A small amount of lyophilized powder was suspended in 50 mM EDTA (pH 8.5) to recover the cells, and washed with the same buffer one or more times to pellet. Cells were again suspended in 50 mM EDTA (pH 8.5) and fixed in 1% low melting agarose. Meanwhile, DNA preparation for DNA fingerprinting was performed as in 1).

(2) RNA 도트 블롯팅 및 하이브리드화(2) RNA dot blotting and hybridization

: 50 μl의 RNA 용액에 66 % 포름아마이드 150 μl를 첨가하고 65 ℃에서 10분 동안 변성시킨 후 즉시 얼음 물로 옮겼다. RNA를 미니폴드(Shleicher & Schuell, SRC 96-D)의 유전자스크린 플러스멤브레인에 블롯팅시킨 후 80℃에서 80분간 가열하였다. 필터를 증류수로 적셔 5×SSC(20× SSC = 3M NaCl, 0.3M disodium citrate dihydrate), 20mM NaHPO4,7 % SDS, 10×Denhardt (50×Denhardt = 1% bovine serum albumin, 1 % polyvinylpyrrolidon, 1 % Ficoll type 400)에서 50 ℃로 밤새 방치하여 사전 하이브리드화하였다.: 150 μl of 66% formamide was added to 50 μl of RNA solution, denatured at 65 ° C. for 10 minutes, and immediately transferred to ice water. RNA was blotted onto the gene screen plus membrane of minifold (Shleicher & Schuell, SRC 96-D) and then heated at 80 ° C. for 80 minutes. Wet the filter with distilled water, 5 × SSC (20 × SSC = 3M NaCl, 0.3M disodium citrate dihydrate), 20mM NaHPO 4 , 7% SDS, 10 × Denhardt (50 × Denhardt = 1% bovine serum albumin, 1% polyvinylpyrrolidon, 1% % Ficoll type 400) at 50 ° C overnight to prehybridize.

올리고들은 Pharmacia의 즉석 키트(Ready to go kit)를 사용하여 라벨링하였고 5pmol 올리고와 10 μCi[γ-32P]-ATP를 하이브리드화에 사용하였다. 라벨된 프로브를 소량의 사전 하이브리드화 완충액과 혼합한 후 필터가 들어있는 하이브리드화 튜브에 넣었다. 하이브리드화를 2시간 동안 실시하였고 2× SSC, 0.1 % SDS에서 10분 동안 2회 수세하였다. 실험에 사용된 올리고들의 특성, 염기 배열, 하이브리드화 온도, 세척 온도는 표 4와 같다.Oligos were labeled using Pharmacia's Ready to go kit and 5 pmol oligo and 10 μCi [γ- 32 P] -ATP were used for hybridization. The labeled probes were mixed with a small amount of prehybridization buffer and placed in a hybridization tube containing a filter. Hybridization was performed for 2 hours and washed twice for 10 minutes in 2 × SSC, 0.1% SDS. The characteristics, base sequence, hybridization temperature and washing temperature of the oligos used in the experiment are shown in Table 4.

(3) DNA 염기 배열 분석(3) DNA sequence analysis

: 염기 배열 반응은 Perkin Elmer로부터 구입한 싸이클 시퀀싱 키트(cycle sequencing kit)와 염료 종결제(dye terminator)를 사용하여 실시하였고 16S rDNA의 염기 배열은 ABI prism 310 자동 DNA 서열 분석기(automatical DNA sequencer)를 사용하였다. 각 샘플의 증폭된 16S rDNA와 이미 알려진 세균의 16S rDNA 염기 배열과의 유사성은 블라스트 유사성 조사 프로그램(Blast similarity search program: National Institute of Biotechnology Information)으로 계산하였다.: The sequencing reaction was performed using a cycle sequencing kit purchased from Perkin Elmer and a dye terminator. The nucleotide sequence of 16S rDNA was determined using an ABI prism 310 automatic DNA sequencer. Used. The similarity between the amplified 16S rDNA of each sample and the 16S rDNA sequence of known bacteria was calculated by the Blast similarity search program (National Institute of Biotechnology Information).

염기 배열 정렬은 다중 서열 정렬 프로그램(multiple sequence alignment program) MSA를 사용하여 실행하였으며 16S rDNA 유사성 계산 후 종-특이적 프로브의 타겟을 보유하는 것으로 이미 알려진 16S rDNA 부분을 관찰함으로서 최종적으로 비피더스 균종의 동정을 실행하였다(표 5).Sequence alignment was performed using a multiple sequence alignment program MSA and finally identified the bifidus species by observing the 16S rDNA moiety already known to possess the target of the species-specific probe after 16S rDNA similarity calculations. Was run (Table 5).

(4) Pulsed field gel electrophoresis (PFGE) 분석(4) Pulsed field gel electrophoresis (PFGE) analysis

: 4 ℃에서 30분 동안 TE 완충액에 평형된 삽입 DNA는 적당한 제한 완충액에 평형시킨 후(3-4시간, 4 ℃) 완충액을 제거하고 ml당 20 유닛의 효소와 10 μg 메틸화된 소 혈청 알부민이 함유된 200 μl의 완충액을 첨가한 후 4 ℃에서 15-30분 동안 처리하고 37 ℃에서 밤새 배양하였다.: Insertion DNA equilibrated in TE buffer for 30 minutes at 4 ° C. was equilibrated in appropriate restriction buffer (3-4 hours, 4 ° C.), then the buffer was removed and 20 units of enzyme and 10 μg methylated bovine serum albumin were added per ml. 200 μl of buffer was added and then treated for 15-30 minutes at 4 ° C. and incubated overnight at 37 ° C.

제한 효소는 SpeI과 XbaI(Promega)를 사용하였고 시료를 1.1% 아가로스 겔, 0.5× TBE에 로딩하여 PFGE 전기영동 분석(Switch time : 2->30초, run time : 24시간, 5.3 v/cm, linear ramping, 14 ℃, 0.5× TBE)을 하였다. 크기 표준물(Size standard)로서는 λ-ladder를 사용하였으며 이미지 분석을 위해서 정규화 인자(normalisation factor)를 사용하였다. 대조균으로는 상업용 비피더스 종균인Bifidobacterium bifidum,Bifidobacterium breve,Bifidobacterium longum,Bifidobacterium lactis를 사용하였다[도 5. 상기 도에서, 각 레인은 다음과 같다. 01:λ-ladder, 02:NF, 03:Bif.lactis(SpeI), 04:Bif.longumMK-G7 dir(SpeI), 05:Bif.longumMK-G7 ON(SpeI), 06:Bif.longumRD-09 dir(SpeI), 07:Bif.longumRD-09 ON(SpeI), 08:Bif.longumdir(SpeI), 09:Bif.longumON(SpeI), 10:NF, 11:Bif.lactis(XbaI), 12:Bif.longumMK-G7 dir(XbaI), 13:Bif.longumMK-G7 ON(XbaI), 14:Bif.longumRD-09 dir(XbaI), 15:Bif.longumRD-09 ON(XbaI), 16:Bif.longumdir(XbaI), 17:Bif.longumON(XbaI), 18:NF. 상기에서, dir은 DNA를 직접 삽입한 경우이며, ON은 밤새 배양한 경우이다. 괄호 안은 사용한 제한 요소이다.]Restriction enzymes were used for SpeI and XbaI (Promega), and the samples were loaded on 1.1% agarose gel, 0.5 × TBE and subjected to PFGE electrophoresis (Switch time: 2-> 30 seconds, run time: 24 hours, 5.3 v / cm , linear ramping, 14 ° C., 0.5 × TBE). Λ-ladder was used as the size standard and a normalization factor was used for image analysis. As a control bacterium, Bifidobacterium bifidum , Bifidobacterium breve , Bifidobacterium longum , and Bifidobacterium lactis , which are commercial bifidus species, were used [FIG. 5. 01: λ-ladder, 02: NF, 03: Bif.lactis (SpeI), 04: Bif.longum MK-G7 dir (SpeI), 05: Bif.longum MK-G7 ON (SpeI), 06: Bif.longum RD-09 dir (SpeI), 07: Bif.longum RD-09 ON (SpeI), 08: Bif.longum dir (SpeI), 09: Bif.longum ON (SpeI), 10: NF, 11: Bif.lactis (XbaI), 12: Bif.longum MK-G7 dir (XbaI), 13: Bif.longum MK-G7 ON (XbaI), 14: Bif.longum RD-09 dir (XbaI), 15: Bif.longum RD- 09 ON (XbaI), 16: Bif.longum dir (XbaI), 17: Bif.longum ON (XbaI), 18: NF. In the above, dir is the case where DNA is directly inserted, ON is the case of overnight culture. The parenthesis is the restriction used.]

(5)Bifidobacterium longumMK-G7 비피더스 균주의 전자현미경 사진 촬영(5) Electron microscopy photography of Bifidobacterium longum MK-G7 bifidus strain

: 다음과 같이 전처리하여 전자현미경으로 촬영하였다(도 6). 우선Bifidobacterium longumMK-G7 비피더스 균주의 세포를 원심분리하여 회수한 후 4 % 파라포름 알데히드, 2.5 % 글루타르알데히드가 함유된 0.1 M 소렌젠 인산 완충액(Sorensen's phosphate buffer: pH 7.2)에 23 ℃, 1시간 동안 고정시켰다. 동일한 `조건으로 2.5 % 글루타르알데히드가 함유된 동일 완충액으로 재차 고정시켰으며 완충액으로 수세한 후 펠렛 클램프(pellet clamp)를 1% 오스뮴 테트록사이드가 함유된 동일 인산 완충액(pH 7.2)으로 4 ℃에서 1시간 동안 처리하였다.: Preprocessed and photographed with an electron microscope as follows (Fig. 6). First, cells of the Bifidobacterium longum MK-G7 bifidus strain were recovered by centrifugation, and then 23 ° C. in 0.1 M Sorensen's phosphate buffer (pH 7.2) containing 4% paraformaldehyde and 2.5% glutaraldehyde. Fixed for time. Re-fixed with the same buffer containing 2.5% glutaraldehyde under the same condition and washed with buffer and pellet pellet clamped at 4 ° C with the same phosphate buffer containing 1% osmium tetroxide (pH 7.2). Treatment for 1 h.

각각의 농도별 에탄올(30, 50, 70, 80, 90, 100 %)을 사용하여 탈수시킨 후 스퍼 매질(Spurr's medium)내에 넣었다(embedding). 초박면(Ultrathin section)은 다이아몬드 칼(diamond knife)로 절단하여 우라닐 아세테이트(Uranyl acetate)와 시트르산 납(lead citrate)으로 염색시키고 일부는 또한 포스포텅스텐 산(phosphotunstic acid)과 크롬산(chromic acid) 혼합물로, 다른 부위는 퍼요오드산-납(periodic acid-lead)으로 염색하였다.Each concentration was dehydrated using ethanol (30, 50, 70, 80, 90, 100%) and then embedded in a Spurr's medium. Ultrathin sections are cut with a diamond knife and dyed with uranyl acetate and lead citrate, and some are also phosphotunstic acid and chromic acid. As a mixture, the other sites were stained with periodic acid-lead.

실시예 4:비피더스균의 내산성(acid tolerance) 및 내담즙성(bile tolerance) 측정 Example 4 Measurement of Acid Tolerance and Bile Tolerance of Bifidus Bacteria

비피더스 균주의 성장에 미치는 pH의 영향을 알아보기 위하여, 비피더스 균주를 1차 활성화시킨 다음 L-cysteine·HCl이 0.05% 첨가된 MRS 액체 배지(Difco Laboratories, Detroit, MI)의 초기 pH를 4N HCl과 0.1N NaOH를 이용하여 7.0, 5.0, 4.5, 4.0으로 각각 조절한 후 1% 되도록 접종하여 배양하면서 OD600값을 24시간 동안 경시적으로 측정하였다.To investigate the effect of pH on the growth of bifidus strains, the initial pH of MIF liquid medium (Difco Laboratories, Detroit, MI) supplemented with 0.05% L-cysteine-HCl was first activated with 4N HCl. The OD 600 values were measured over time for 24 hours while incubating with 0.1% NaOH and inoculating to 1% after adjusting to 7.0, 5.0, 4.5, and 4.0, respectively.

내담즙성의 측정을 위하여 0.05N의 Na2HPO4에 L-cysteine·HCl을 0.05% 되도록 첨가한 후 질소 가스로 치환시켜 기본배지를 제조하였다. 기본배지에 담즙을 0, 0.5, 1% 수준으로 첨가하여 알루미늄 캡으로 밀봉할 수 있는 튜브에 가득 채운 후 멸균시켰다. 상기 배지에 실시예 1에서 분리된 비피더스 균주 및 상업적으로 사용되고 있는 대조 비피더스 균주[비피도박테리움 론검(Bifidobacterium longum),비피도박테리움 비피덤(Bifidobacterium bifidum),비피도박테리움 인펀티스(Bifidobacterium infantis)]를 1% 수준으로 각각 접종한 후 37℃의 항온 배양기에서 배양하였다. 접종 직후 및 배양 1, 3, 8, 12시간째의 배양액 100 μl를 취하여 전술한 바와 같이 혐기성 희석액으로 적정 희석하였다. 상기 희석액을 BL 고체배지(Difco Laboratories, Detroit, MI)에 도말하여 혐기 배양조에서 혐기적으로 36-48시간 동안 배양한 후 생균수를 측정하였다.In order to measure the biliary resistance, the base medium was prepared by adding L-cysteine.HCl to 0.05% of Na 2 HPO 4 at 0.05 N and then substituting with nitrogen gas. Bile was added to the base medium at a level of 0, 0.5, 1%, filled with a tube that can be sealed with an aluminum cap, and then sterilized. Control being used in this medium with the embodiments Bifidobacterium strains isolated from 1 and commercially Bifidobacterium strain [Bifidobacterium rongeom (Bifidobacterium longum), Bifidobacterium bipyridinium bushes (Bifidobacterium bifidum), Bifidobacterium inpeon tooth (Bifidobacterium infantis )] Was inoculated at 1% level and incubated in a 37 ° C. incubator. Immediately after inoculation and 100 μl of the culture solution at 1, 3, 8, and 12 hours of culture were taken and titrated in an anaerobic dilution as described above. The diluted solution was plated on BL solid medium (Difco Laboratories, Detroit, MI) and incubated anaerobicly for 36-48 hours in an anaerobic culture, and the number of viable cells was measured.

실험 결과, 본 발명에 의한 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주는 내산성과 내담즙성을 동시에 보유하고 있으며, 그 성능도 매우 우수한 것으로 나타났다.As a result, the Bifidobacterium longum MK-G7 strain according to the present invention has both acid resistance and bile resistance, and its performance was also excellent.

pH 4.0에서 OD600값을 비교했을 때, 본 발명의 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주는 0.11, 상업용 균주 비피도박테리움 비피덤(Bifidobacterium bifidum)은 0.01, 상업용 균주 비피도박테리움 인펀티스(Bifidobacterium infantis)는 0.03, 상업용 균주 비피도박테리움 론검(Bifidobacterium longum)은 0.04로 나타나, 본 발명에 따라 선발된 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주의 내산성이 가장 우수한 것으로 밝혀졌다.When comparing the OD 600 values at pH 4.0, the Bifidobacterium longum MK-G7 strain of the present invention is 0.11, the commercial strain Bifidobacterium bifidum is 0.01, and the commercial strain Bifidobacterium Bifidobacterium infantis is 0.03, and the commercial strain Bifidobacterium longum is 0.04.Bifidobacterium longum MK-G7 strain selected according to the present invention has the highest acid resistance. It turned out.

한편, 담즙 0.5% 첨가 배지에서 OD600값을 비교했을 때, 본 발명의 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주는 0.45, 상업용 균주 비피도박테리움 비피덤(Bifidobacterium bifidum)은 0, 상업용 균주 비피도박테리움 인펀티스(Bifidobacterium infantis)는 0.49, 상업용 균주 비피도박테리움 론검(Bifidobacterium longum)은 0.37로서, 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주 내담즙성 역시 우수한 것으로 밝혀졌다.On the other hand, when comparing the OD 600 value in 0.5% bile added medium, the Bifidobacterium longum MK-G7 strain of the present invention is 0.45, the commercial strain Bifidobacterium bifidum is 0, commercial strain Bifidobacterium inpeon teeth (Bifidobacterium infantis) is 0.49, turns a commercial strain Bifidobacterium rongeom (Bifidobacterium longum) is a 0.37, as Bifidobacterium rongeom (Bifidobacterium longum) within the biliary MK-G7 strains too high lost.

본 발명에 의한 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주 및 상업용 균주[비피도박테리움 론검(Bifidobacterium longum),비피도박테리움 비피덤(Bifidobacterium bifidum), 비피도박테리움 인펀티스(Bifidobacterium infantis)]를 10% 탈지유에 0.05%의 L-cysteine·HCl을 첨가하여 제조한 우유 배지에 1% 수준으로 접종하였다. 접종후 37℃의 항온배양기에서 72시간 동안 배양하면서 매 12시간마다 배양액을 취해 BL 고체배지(Difco Laboratories, Detroit, MI)에 도말하고 혐기적으로 배양하여 생균수를 측정하였다.Bifidobacterium rongum according to the present invention (Bifidobacterium longum) MK-G7 strain and commercial strain [Bifidobacterium rongum (Bifidobacterium longum),Bifidobacterium BifidemBifidobacterium bifidum), Bifidobacterium infantis (Bifidobacterium infantis)] Was inoculated at a 1% level in milk medium prepared by adding 0.05% L-cysteine.HCl to 10% skim milk. After inoculation, the culture medium was taken every 12 hours while incubating for 72 hours at 37 ° C. incubator and plated on BL solid medium (Difco Laboratories, Detroit, MI) and cultured anaerobicly to measure the number of viable cells.

이와 같이 우유 배지에서 배양했을 때 비피더스 균체의 증식에 따라서 배지 내에 분해산물이 축적되어 생존 환경이 악화되어도 본 발명에 따라서 선발된 비피도박테리움 론검(Bifidobacterium longum) MK-G7 균주는 높은 생존력을 보임을 알 수 있다.As described above, the Bifidobacterium longum MK-G7 strain selected according to the present invention shows high viability even when degradation products accumulate in the medium as the growth of the bifidus cells increases. It can be seen.

실시예 5:내산소성 Example 5 Oxygen Resistance

실시예 1에서 분리한 비피더스 균주를 TOS를 프럭토올리고당 0.5%와 갈락토올리고당 0.5%로 대체한 변형 IP 액체 배지에서 24시간 동안 배양한 후 혐기 희석액으로 십진 희석하여 중성 변형 TP 평판 배지에 즉시 도말하였다. 37℃의 혐기 배양기에서 각각 하룻밤 산소에 노출시킨 후 다시 혐기 배양기 내에서 48시간 동안 배양하였다. 산소에 노출시키지 않은 실험구에서 생육한 균수에 대하여 산소에 20시간 노출시킨 실험구의 균수 비율을 생존율로 정의하고 이를 상호 비교하여 내산소성 비피더스 균주를 선발하였다.The bifidus strain isolated in Example 1 was incubated in modified IP liquid medium in which TOS was replaced with 0.5% of fructooligosaccharide and 0.5% galactooligosaccharide for 24 hours, and then diluted in anaerobic dilution to immediately smear on neutral modified TP plate medium. It was. Each was exposed to oxygen overnight in an anaerobic incubator at 37 ° C., and then incubated for 48 hours in the anaerobic incubator. Oxygen-resistant bifidus strains were selected by comparing the number of bacteria in the experimental group exposed to oxygen for 20 hours with respect to the number of microbial cells exposed to oxygen as survival rate and comparing them with each other.

산소의 영향을 최대한으로 배제하기 위하여 실험 배지를 혐기성 글로브 박스(anaerobic glove box) 내에서 분주한 후 37 ℃의 혐기 배양기 내에서 12시간 동안 방치하여 산소를 완전히 제거하였다. 실험에 사용된 비피더스 균주를 산소가 배제된 혐기성 희석액으로 십진 희석하여 클린 벤취(clean bench) 내에서 신속히 도말하고 혐기 배양조와 혐기성 글로브 박스(anaerobic glove box)를 이용하여 48시간 동안 배양하였다.In order to eliminate the effects of oxygen to the maximum, the experimental medium was dispensed in an anaerobic glove box and left in an anaerobic incubator at 37 ° C. for 12 hours to completely remove oxygen. The bifidus strain used in the experiment was diluted 10 times with oxygen-free anaerobic dilution, rapidly smeared in a clean bench, and incubated for 48 hours using an anaerobic culture tank and an anaerobic glove box.

이때 호기 상태에서 도말하는 시간은 10분 이내, 배지 중의 산소가 혐기 배양조 등에서 제거되는 시간을 1시간 이내로 제한하여 비피더스 균주가 산소에 노출되는 시간을 최대한으로 줄였다.At this time, the smearing time in the aerobic state was limited to less than 10 minutes, the time that the oxygen in the medium is removed in the anaerobic culture tank to less than 1 hour to reduce the time that the bifidus strain is exposed to oxygen to the maximum.

상기의 실험 결과, 본 발명에 의한 비피도박테리움 론검(Bifidobacterium longum) MK-G7는 생존률 43%로서 내산소성이 높은 것으로 나타났다.As a result of the above experiments, Bifidobacterium longum MK-G7 according to the present invention was found to have high oxygen resistance with a survival rate of 43%.

실시예 6:항돌연변이원성 Example 6 Antimutagenicity

Maron과 Ames(Maron,D.M. and B.N.Ames. 1983. Revised methods for theSalmonellamutagenicity test. Mutation Research. 113:173-215)의 방법에 따라서 사전배양 시험법(preincubation test)을 이용하여 비피더스균의 돌연변이 억제 효과를 조사하였다. 돌연변이원으로서는 직접 돌연변이원(direct mutagen)인 NQO와 간접 돌연변이원(indirect mutagen)인 IQ를 사용하였다. NQO와 IQ 등은 Wako Chemical Co.(Japan)에서 구입하였으며 아로클로 1254(Aroclor 1254)는 Chem Service(USA)에서 구입하였다. 한편, DMSO, L-히스티딘, D-비오틴, D-글루코오스-6-포스페이트, NADPH, NADH 등은 Sigma Chemical Co.(USA)로부터 구입하였으며 영양 브로스(Nutrient broth), 박토-아가(Bacto-agar) 등은 Difco Chemical Co.(USA)로부터 구입하였다.Mutation inhibitory effect of bifidus bacteria using preincubation test according to the method of Maron, Ames (Maron, DM and BNAmes. 1983. Revised methods for the Salmonella mutagenicity test. Mutation Research. 113: 173-215) Was investigated. As mutagens, direct mutagen NQO and indirect mutagen IQ were used. NQO and IQ were purchased from Wako Chemical Co. (Japan) and Aroclor 1254 was purchased from Chem Service (USA). Meanwhile, DMSO, L-histidine, D-biotin, D-glucose-6-phosphate, NADPH, NADH, etc. were purchased from Sigma Chemical Co. (USA), and nutritional broth, Bacto-agar. And the like were purchased from Difco Chemical Co. (USA).

S9 분획은 다음과 같이 조제하였다. 옥수수 기름에 200 mg/ml 농도로 희석한 아로클로 1254(Aroclor 1254)를 체중 약 200 g의 래트(Spraque-Dawley rat, male)에 500 mg/kg 체중 양으로 복강내 주입하였다. 5일후(해부 12시간 전부터 물만을 제공하고 절식시킴) 무균 상태의 실험 조건에서 실험쥐의 간을 채취하여 냉각된 KCl로 여러번 수세하였다. 3배량의 0.15M KCl 용액에 옮긴 수세된 간을 균질한 후 원심분리(9,000×g,10분)하여 그 상등액을 취하였다. 이 S9 분획은 취해지는 즉시 Nunc 튜브에 담아 -80℃ 초저온 냉동고(deep freezer)에 보관하였다.The S9 fraction was prepared as follows. Aroclor 1254 diluted in corn oil at a concentration of 200 mg / ml was injected intraperitoneally into a body weight of about 200 g (Spraque-Dawley rat, male) at a 500 mg / kg body weight. After 5 days (only water and fasting from 12 hours before dissection) the livers of the mice were collected under sterile experimental conditions and washed several times with cooled KCl. The washed liver transferred to 3 times 0.15M KCl solution was homogenized, and then centrifuged (9,000 x g, 10 minutes) to obtain the supernatant. This S9 fraction was taken in a Nunc tube and stored in a -80 ° C deep freezer as soon as it was taken.

실시예 1에서 분리된 균주와, 상업용 균주로서 비피도박테리움 론검(Bifidobacterium longum), 비피도박테리움 비피덤(Bifidobacterium bifidum), 비피도박테리움 인펀티스(Bifidobacterium infantis)를 사용하여 시험하였다.Conducted a strain isolated in Example 1 and was tested using a Bifidobacterium rongeom (Bifidobacterium longum), Bifidobacterium bipyridinium bushes (Bifidobacterium bifidum), Bifidobacterium inpeon tooth (Bifidobacterium infantis) as commercial strains.

Salmonella typhimurium복귀 분석 방법(reversion assay)에 사용한 시험균주Salmonella typhimuriumTA 98은 Ames 교수(UC Berkeley, USA)로부터 분양받았다. TA 98 균주의 유전적 안정성을 확인하기 위하여 주기적으로 암피실린 내성(25 μg/ml)을 확인하고 최소 글루코오스 아가(Minimal glucose agar) 배지와 히스티딘 첨가 배지에서 히스티딘 영양 요구성을 확인하였다.Salmonella typhimurium복귀 분석 방법에서 돌연변이원으로 S9을 필요로 하는 간접 돌연변이원으로 IQ를 사용하였고 S9에 의한 활성화를 필요로 하지 않는 직접 돌연변이원으로는 NQO를 사용하였다. The test strain Salmonella typhimurium TA 98 used in the Salmonella typhimurium reversion assay was distributed by Professor Ames (UC Berkeley, USA). Ampicillin resistance (25 μg / ml) was periodically checked to confirm the genetic stability of TA 98 strain and histidine nutritional requirements in minimal glucose agar medium and histidine addition medium. In the Salmonella typhimurium reversion assay, IQ was used as an indirect mutagen that required S9 as a mutagen and NQO was used as a direct mutagen that does not require activation by S9.

비피더스 균주를 1% 글루코오스가 첨가된 BHI(brain heart infusion) 배지에서 10-12시간 동안 배양하였다. 원심분리후 얻은 비피더스 균체를 20mM 인산염 완충액(pH 7.0)에 3회 수세한 후 동결 건조시켰다. 0.2M 인산염 완충액(pH 4.0) 용액 0.3ml에 돌연변이원으로서 DMSO에 용해시킨 5㎕의 IQ(250 μg/ml)와 10㎕의 NQO(1 mg/ml) 등을 각각 혼합하고 동결 균체 2 mg을 첨가하였다. 대조군에는 균체를 첨가하지 않았다. 이 혼합액을 37℃에서 3시간 동안 진탕한 후 원심분리하여 상등액을 취하였다.Bifidus Strains were incubated for 10-12 hours in BHI (brain heart infusion) medium with 1% glucose. Bifidus cells obtained after centrifugation were washed three times in 20 mM phosphate buffer (pH 7.0) and then lyophilized. To 0.3 ml of 0.2 M phosphate buffer (pH 4.0) solution, 5 µl of IQ (250 µg / ml) dissolved in DMSO as a mutagen, 10 µl of NQO (1 mg / ml), etc., were mixed, and 2 mg of frozen cells were added. Added. No cells were added to the control group. The mixture was shaken at 37 ° C. for 3 hours and then centrifuged to obtain a supernatant.

이와 같이 전처리한 후 10㎕의 NQO와 10㎕의 IQ 반응액을 각각 취하여 45 ℃의 2.3 ml 탑 아가(top agar)와 혼합하고 TA 98 균주 배양액 100 μl와 S9 혼합액 500 μl을 첨가하였다. 최소 글루코오스 아가 평판배지에 균일하게 도말하여 37 ℃에서 48시간 동안 배양한 후 형성된 복귀 집락의 수를 측정하였다.After pretreatment in this way, 10 μl of NQO and 10 μl of IQ reaction solution were taken, respectively, mixed with 2.3 ml top agar at 45 ° C., and 100 μl of TA 98 strain culture solution and 500 μl of S9 mixture were added. The number of return colonies formed after incubation for 48 hours at 37 ° C. was evenly spread on minimal glucose agar plates.

돌연변이 억제능(antimutagenicity, %)은 다음의 식으로 계산하였다.Mutagenicity (antimutagenicity,%) was calculated by the following equation.

상기의 실험 결과, 본 발명에 의한 비피도박테리움 론검(Bifidobacterium longum) MK-G7은 NQO에 대해서 76.5%, IQ에 대해서 75.4%의 돌연변이 억제능을 보여, 상업용균주 비피도박테리움 비피덤(Bifidobacterium bifidum)(NQO에 대해서 0.0%, IQ에 대해서 63.9%), 비피도박테리움 인펀티스(Bifidobacterium infantis)(NQO에 대해서 78.9%, IQ에 대해서 80.2%), 비피도박테리움 론검(Bifidobacterium longum)(NQO에 대해서 11.0%, IQ에 대해서 84.7%)에 비해서 대체로 우수하였다.As a result of the above experiments, Bifidobacterium longum MK-G7 according to the present invention showed a 76.5% mutation inhibition ability against NQO and 75.4% against IQ, and the commercial strain Bifidobacterium bifidum ) (0.0% based on the NQO, 63.9% based on IQ), Bifidobacterium inpeon tooth (Bifidobacterium infantis) (78.9% based on the NQO, 80.2% based on IQ), Bifidobacterium rongeom (Bifidobacterium longum) (NQO 11.0% for IQ and 84.7% for IQ).

실시예 7:in vitro 콜레스테롤 저하능 Example 7 : in vitro cholesterol lowering ability

분리된 비피더스 균주에 대해서 in vitro 상태에서 콜레스테롤 저하능이 우수한 비피더스 균주를 선발하기 위하여 다음과 같이 실험하였다. In vitro 콜레스테롤 공급원으로서 가용성 콜레스테롤인 폴리옥시에타닐-콜레스테릴 세바케이트(polyoxyethanyl-cholesteryl sebacate)를 0.045%, L-시스테인·HCl을 0.05% 첨가한 MRS 배지에 각각의 비피더스 균주를 24시간 동안 배양한 후 원심분리(12,000×g, 4 ℃)하고 그 상등액 0.5ml를 취하여 여기에 2 ml의 50% KOH와 3 ml의 95% 에탄올을 첨가하여 60 ℃ 항온수조에서 10분 동안 반응시켰다. 이것을 상온으로 냉각한 후 5 ml의 헥산을 첨가하여 혼합하고 다시 3 ml의 증류수를 첨가하여 혼합한 후 15분 동안 실온에 방치하여 층 분리가 일어나도록 하였다.In order to select the bifidus strain having excellent cholesterol lowering ability in vitro against the isolated bifidus strain was tested as follows. Incubate each bifidus strain for 24 hours in MRS medium containing 0.045% of soluble cholesterol polyoxyethanyl-cholesteryl sebacate and 0.05% of L-cysteine-HCl as an in vitro cholesterol source. After centrifugation (12,000 × g , 4 ° C.), 0.5 ml of the supernatant was added thereto, and 2 ml of 50% KOH and 3 ml of 95% ethanol were added and reacted in a 60 ° C. constant temperature water bath for 10 minutes. After cooling to room temperature, 5 ml of hexane was added and mixed, and 3 ml of distilled water was added and mixed, and the mixture was left at room temperature for 15 minutes to cause layer separation.

그 후 2.5 ml의 헥산층을 취하여 질소 가스를 이용하여 60 ℃에서 헥산을 증발시킨 후 4 ml의 ο-프탈알데히드(o-phthalaldehyde)를 첨가하여 10분 동안 반응시키고, 2 ml의 진한 황산을 첨가하여 다시 10분 동안 반응시킨 후 OD550값을 측정하였다. 이때 콜레스테롤 저하능은 다음의 식으로 계산하였다.After taking 2.5 ml of hexane layer, hexane was evaporated at 60 ° C. using nitrogen gas, and then 4 ml of ο-phthalaldehyde was added to react for 10 minutes, followed by addition of 2 ml of concentrated sulfuric acid. After reacting for another 10 minutes, the OD 550 value was measured. The cholesterol lowering ability was calculated by the following equation.

본 발명의 비피도박테리움 론검(Bifidobacterium longum) MK-G7 비피더스 균주는 12.00 %의 콜레스테롤 저하능을 나타내어 상업용 균주 , 비피도박테리움 비피덤(Bifidobacterium bifidum)(15.6%), 비피도박테리움 인펀티스(Bifidobacterium infantis)(15.6%), 비피도박테리움 론검(Bifidobacterium longum)(25.3%)과 비교했을 때 다소 낮은 것으로 나타났다. Bifidobacterium longum (Kifidobacterium longum ) MK-G7 bifidus strain of the present invention shows a cholesterol lowering capacity of 12.00%, commercial strain, Bifidobacterium bifidum (15.6%), Bifidobacterium infuntis Bifidobacterium infantis (15.6%) and Bifidobacterium longum (25.3%) were somewhat lower.

실시예 8:마크로파지 세포라인(cell line) 활성능 Example 8 Macrophage Cell Line Activity

마크로파지 및 TH(T helper) 세포 라인의 선정 및 배양 비피더스균의 투여에 따른 마크로파지의 활성화 여부를 규명하기 위하여 최적 세포라인을 선정하고 증식 배양하였다. 마크로파지 세포 라인은 Raw 264.7을 사용하고 TH(T helper) 세포라인은 EL$ 세포라인을 사용하였다. 이들 세포를 10 % FBS(fetal bovine serum)가 첨가된 DMEM(Dulbecco's modified eagle medium)에 계대하여 5% CO2농도의 CO2배양기에 배양하였다.Selection and cultivation of macrophages and TH (T helper) cell lines Optimal cell lines were selected and cultured to determine whether macrophages were activated by administration of bifidus bacteria. Macrophage cell line was used Raw 264.7 and TH (T helper) cell line was used EL $ cell line. These cells were passaged in Dulbecco's modified eagle medium (DMEM) with 10% FBS (fetal bovine serum) and cultured in a CO 2 incubator at 5% CO 2 concentration.

임파구의 제조는 에테르를 사용하여 실험쥐를 마취시킨 후 복강을 개복하고 장내 면역세포의 중심 기관인 PP(peyer's patch), IEL(intraepithelial lymphocyte), LP(lamina propria) 등을 무균적으로 취택하였다. 이들을 미세하게 절단하여 균질한 후 암모늄 클로라이드 등장액을 사용하여 적혈구를 파괴시킨다.The preparation of lymphocytes was anesthetized with mice using ether, followed by an open abdominal cavity and aseptic selection of PP (peyer's patch), IEL (intraepithelial lymphocyte), and LP (lamina propria). These are finely cut and homogenized and then red blood cells are destroyed using ammonium chloride isotonic solution.

LP 세포는 Lycke(Lycke,N. 1986. A sensitive method for the detection of specific antibody production in different isotypes from single lamina propria plasma cells. Scandinavian Journal of Immunology. 24:393-403)의 방법에 따라서 제조하고 IEL은 Mosley와 Klein(Mosley,R.L. and J.R.Klein. 1992. A rapid method for isolating murine intestine intraepithelial lymphocytes with high yield and purity. Journal of Immunological Method. 156:19-26)의 방법에 따라서 제조하였다. 한편 PP 세포는 콜라게나아제 처리를 하고 De Simone의 방법(De Simone,C. 1988. Adherence of specific yogurt microorganisms to human peripheral blood lymphocytes. Microbios. 55:49-57)을 사용하여 제조하였다.LP cells were prepared according to the method of Lycke (Lycke, N. 1986. A sensitive method for the detection of specific antibody production in different isotypes from single lamina propria plasma cells.Scandinavian Journal of Immunology. 24: 393-403). Mosley and Klein (Mosley, RL and JR Klein. 1992. A rapid method for isolating murine intestine intraepithelial lymphocytes with high yield and purity.Journal of Immunological Method. 156: 19-26). PP cells were treated with collagenase and prepared using De Simone's method (De Simone, C. 1988. Adherence of specific yogurt microorganisms to human peripheral blood lymphocytes. Microbios. 55: 49-57).

마크로파지의 활성화에 따른 면역호르몬 시토킨의 생성량을 측정하기 위하여 TNF(tumour necrosis factor)-α, IL(interleukin), IFN(interferon) 등을 조사하였으며 샌드위치 ELISA(sandwich ELISA) 방법을 이용하여 각각의 시토킨에 대하여 정량적으로 시토킨 농도를 측정하였다. 한편, 정량적인 발색은 바이오틴화된 스트렙트아비딘 HRP(biotinylated streptavidin horse radish peroxidase)를 이용하였다.Tumor necrosis factor (TNF) -α, interleukin (IL), IFN (interferon), etc. were investigated to measure the production of immune hormone cytokines according to the activation of macrophages. Cytokine concentrations were measured quantitatively for the kin. On the other hand, quantitative color development was performed using biotinylated streptavidin horse radish peroxidase (HRP).

면역호르몬 시토킨의 유전자 발현성 측정은 비피더스균의 투여에 따른 IL-6와 TNF-α 등의 mRNA 발현 수준을 검사하였다. 정확성이 높은 방법으로서 역전사효소 PCR(polymerase chain reaction) 방법을 사용하였다. 각각의 시토킨에 대한 PCR 증폭 프로브를 사용하여 혼성화한 후 얻어진 오토라디오그라프(autoradiograph)를 비디오 스캐닝하여 정량하였다.Gene expression of immunohormone cytokines was determined by mRNA levels of IL-6 and TNF-α following bifidus administration. Reverse transcriptase PCR (polymerase chain reaction) method was used as a high accuracy method. The autoradiographs obtained after hybridization using PCR amplification probes for each cytokine were quantified by video scanning.

파고사이토시스(phagocytosis) 능력은 균체 농도 250㎍/ml에서 비피도박테리움 론검(Bifidobacterium longum) MK-G7 비피더스 균주는 288.4 ng/ml, 상업용 균주 비피도박테리움 비피덤(Bifidobacterium bifidum)은312.9 ng/ml, 상업용 균주 비피도박테리움 인펀티스(Bifidobacterium infantis)는 208.6 ng/ml, 상업용 균주 비피도박테리움 론검(Bifidobacterium longum)은 307.3 ng/ml로 나타났다. TNF-α 생성능은 균체 농도 250㎍/ml에서Bifidobacterium longumMK-G7 비피더스 균주는 8.64 ng/ml, 상업용 균주 비피도박테리움 비피덤(Bifidobacterium bifidum)는 2.43 ng/ml, 상업용 균주 비피도박테리움 인펀티스(Bifidobacterium infantis)는 2.25 ng/ml, 상업용 균주 비피도박테리움 론검(Bifidobacterium longum)은 2.93 ng/ml로 나타났다. 한편, IL-6 생성능은 균체 농도 250㎍/ml에서 비피도박테리움 론검(Bifidobacterium longum) MK-G7 비피더스 균주는 0.60 ng/ml, 상업용 균주 비피도박테리움 비피덤(Bifidobacterium bifidum)은 1.20 ng/ml, 상업용 균주 비피도박테리움 인펀티스(Bifidobacterium infantis)는 0.90 ng/ml, 상업용 균주 비피도박테리움 론검(Bifidobacterium longum)은 0.30 ng/ml로 나타났다. 이와 같이 본 발명에 의한Bifidobacterium longumMK-G7 비피더스 균주는 상업용 균주에 비해서 파고사이토시스와 TNF-α 생성능은 우수하지만, IL-6 생성능은 다소 낮은 것으로 평가되었다.The ability of pagocytosis was determined by Bifidobacterium lon gum at a cell concentration ofBifidobacterium longum) MK-G7 bifidus strain was 288.4 ng / ml, commercial strain bifidobacterium bifidum (Bifidobacterium bifidum)312.9 ng / ml, commercial strain Bifidobacterium inflorescences (Bifidobacterium infantis)208.6 ng / ml, commercial strain Bifidobacterium lon gum (Bifidobacterium longum) Was found to be 307.3 ng / ml. TNF-α production capacity was obtained at the cell concentrationBifidobacterium longumMK-G7 bifidus strain is 8.64 ng / ml, commercial strain Bifidobacterium bifidum (Bifidobacterium bifidum)Is 2.43 ng / ml, commercial strain Bifidobacterium inflorescences (Bifidobacterium infantis)2.25 ng / ml, commercial strain Bifidobacterium lon gum (Bifidobacterium longum) Was 2.93 ng / ml. On the other hand, IL-6 production capacity was determined to be Bifidobacterium RON gum at cell concentrationBifidobacterium longum) MK-G7 bifidus strain was 0.60 ng / ml, commercial strain Bifidobacterium bifidum (Bifidobacterium bifidum) Is 1.20 ng / ml, the commercial strain Bifidobacterium inflorescences (Bifidobacterium infantis) Is 0.90 ng / ml, commercial strain Bifidobacterium lon gum (Bifidobacterium longum) Was 0.30 ng / ml. Thus according to the present inventionBifidobacterium longumMK-G7 bifidus strains were superior to commercial strains in pagocytosis and TNF-α production, but IL-6 production ability was evaluated to be somewhat low.

실시예 9:우유 배지에서의 단독 배양 Example 9 : Sole Culture in Milk Medium

본 발명에 의한 비피도박테리움 론검(Bifidobacterium longum) MK-G7의 발효유 제품 제조에의 이용 가능성을 평가하기 위하여, 동 균주의 발효특성을 살펴보았다.In order to evaluate the applicability of Bifidobacterium longum MK-G7 to the production of fermented milk products according to the present invention, the fermentation characteristics of the strain were examined.

MRS 액체 배지와 L-시스테인·HCl이 각각 0.05% 함유된 11% 탈지유 배지에서 비피도박테리움 론검(Bifidobacterium longum)MK-G7 비피더스 균주와 상업용 균주인 비피도박테리움 론검(Bifidobacterium longum), 비피도박테리움 비피덤(Bifidobacterium bifidum), 비피도박테리움 인펀티스(Bifidobacterium infantis)의 발효 특성을 비교하였다(표 6, 7). Bifidobacterium longum MK-G7 Bifidobacteria strain and Bifidobacterium longum, a commercial strain, Bifidobacterium longum and Bifidobacterium Fermentation characteristics of Bifidobacterium bifidum and Bifidobacterium infantis were compared (Tables 6 and 7).

Bifidobacterium longumMK-G7 비피더스 균주의 탈지유 배지에서의 pH, 적정산도, 생균수 측정 결과PH, titratable acidity and viable cell counts in skim milk medium of Bifidobacterium longum MK-G7 bifidus strain 사용균주Use strain pHpH 적정산도(%)Titratable acidity (%) 생균수(cfu/ml)Viable cell count (cfu / ml) MK-G7 비피더스 균주MK-G7 bifidus strain 4.414.41 0.920.92 4.75 × 108 4.75 × 10 8 상업용 균주 비피도박테리움 비피덤(Bifidobacterium bifidum)Commercial strain Bifidobacterium bifidum 4.874.87 0.570.57 4.06 × 108 4.06 × 10 8 상업용 균주 비피도박테리움 인펀티스(Bifidobacterium infantis)Commercial strain Bifidobacterium infantis 5.155.15 0.510.51 1.77 × 108 1.77 × 10 8 상업용 균주비피도박테리움 론검(Bifidobacterium longum)Commercial strain Bifidobacterium longum 3.783.78 1.341.34 9.86 × 108 9.86 × 10 8

Bifidobacterium longumMK-G7 비피더스 균주의 탈지유 배지에서의 유산과 초산 생성량 측정 결과Measurement of Lactic Acid and Acetic Acid Production in Skim Milk Medium of Bifidobacterium longum MK-G7 Bifidus Strain 사용균주Use strain 유산 생성량(mM/ml)Lactic Acid Production (mM / ml) 초산 생성량(mM/ml)Acetic acid production amount (mM / ml) 생성비율(유산:초산)Generation ratio (lactic acid: acetic acid) MK-G7 비피더스 균주MK-G7 bifidus strain 47.6047.60 68.4568.45 1 : 1.4381: 1.438 상업용 균주비피도박테리움 비피덤(Bifidobacterium bifidum)Commercial strain Bifidobacterium bifidum 12.5212.52 17.3917.39 1 : 1.3891: 1.389 상업용 균주비피도박테리움 인펀티스(Bifidobacterium infantis)Commercial strain Bifidobacterium infantis -- -- -- 상업용 균주비피도박테리움 론검(Bifidobacterium longum)Commercial strain Bifidobacterium longum 136.46136.46 48.4148.41 1 : 0.3551: 0.355

MK-G7 비피더스 균주는 탈지유 배양시 생육성이 양호하여 제품 제조에 적합한 적정산도와 생균수를 나타냈으며, 유산과 초산 생성 비율이 1:1.438로서 비피더스균의 전형적인 대사산물 생성능(1:1.5)을 나타냈다.MK-G7 bifidus strain had good growth rate in cultivated skim milk, and showed proper acidity and viable cell number for product production. Indicated.

실시예 10:혼합배양에 따른 요구르트 제조시의 관능성 및 제품 적용능 Example 10 : Functionality and Product Application of Yogurt Prepared by Mixed Culture

현재 출원인 회사에서 생산 판매하고 있는 드링크 요구르트의 상용 비피더스 비피도박테리움 인펀티스(Bifidobacterium infantis)를 본 발명에 의한Bifidobacterium longumMK-G7 비피더스 균주로 대체하기 위하여, 시료 A는 기존의 상용 비피더스 균주 100%, 시료 B는Bifidobacterium longumMK-G7 비피더스 균주 100%, 시료 C는 기존의 상용 비피더스 균주 50% +Bifidobacterium longumMK-G7 비피더스 균주 50%, 시료 D는 기존의 상용 비피더스 균주 90% +Bifidobacterium longumMK-G7 비피더스 균주 10% 를 접종하여 배양 0시간부터 24시간까지 4시간 간격으로 pH, 적정산도, 비피더스 균수를 측정하였다. 나머지 제조 공정과 성분 배합비는 동일하게 하였다.In order to replace the commercial Bifidobacterium infantis ( Bifidobacterium infantis ) of the drink yogurt produced and sold by the present applicant company with the Bifidobacterium longum MK-G7 bifidus strain according to the present invention, sample A was 100% of the conventional commercial bifidus strain. , Sample B is 100% Bifidobacterium longum MK-G7 bifidus strain, Sample C is 50% conventional Bifidobacteria strain + 50% Bifidobacterium longum MK-G7 bifidus strain, Sample D is 90% Bifidobacterium longum MK- 10% of G7 bifidus strains were inoculated to measure pH, titratable acidity, and bifidus bacteria at 4 hour intervals from 0 hours to 24 hours of culture. The remaining manufacturing process and the component blending ratio were the same.

적정산도는 배양 0시간부터 8시간까지는 공시시료 모두에서 유사한 산 생성능을 보였으나 배양 12시간부터 공시시료 B와 C가 대조구 A에 비해서 높은 산 생성능을 가지는 것으로 나타났다(표 8). 총 유산균수의 변화에 있어서는 시료 4가지 모두에서 유사한 변화 경향을 보였으며 비피더스 균수의 변화에 있어서는 배양 초기부터 대조구에 비해서 처리구 B, C, D가 우세한 균수를 유지하는 것으로 나타났다(표 9, 10).The titratable acidity showed similar acid production in all of the specimens from 0h to 8h in culture, but B and C showed higher acid production than control A from 12h in culture (Table 8). Changes in total lactic acid bacteria showed similar trends in all four samples, and B, C, and D maintained higher bacterial counts than control in the change of non-fidus bacteria (Table 9, 10). .

Bifidobacterium longumMK-G7 비피더스 균주의 발효유 제품 제조시 배양시간에 따른 적정산도의 변화(%)Change in titratable acidity according to incubation time for the production of fermented milk products of Bifidobacterium longum MK-G7 bifidus strain (%) 배양시간Incubation time 시료 A(기존 상용균주)Sample A (existing commercial strain) 시료 B(MK-G7 균주 100%)Sample B (100% of MK-G7 strain) 시료 C(MK-G7 균주 50%)Sample C (50% of MK-G7 strain) 시료 D(MK-G7 균주 10%)Sample D (10% of MK-G7 strain) 0 시간0 hours 0.160.16 0.160.16 0.160.16 0.160.16 2 시간2 hours 0.170.17 0.170.17 0.170.17 0.160.16 4 시간4 hours 1.451.45 0.440.44 0.440.44 0.390.39 6 시간6 hours 0.650.65 0.670.67 0.640.64 0.610.61 8 시간8 hours 0.760.76 0.770.77 0.760.76 0.760.76 10 시간10 hours 0.810.81 0.830.83 0.830.83 0.800.80 12 시간12 hours 0.880.88 0.910.91 0.870.87 0.830.83 24 시간24 hours 1.171.17 1.301.30 1.221.22 1.171.17

Bifidobacterium longumMK-G7 비피더스 균주의 발효유 제품 제조시 배양시간에 따른 생균수의 변화(cfu/ml)Changes in the Number of Viable Cells According to Incubation Time in Preparation of Fermented Milk Products of Bifidobacterium longum MK-G7 Bifidus Strain (cfu / ml) 배양시간Incubation time 시료 A(기존 상용균주)Sample A (existing commercial strain) 시료 B(MK-G7 균주 100%)Sample B (100% of MK-G7 strain) 시료 C(MK-G7 균주 50%)Sample C (50% of MK-G7 strain) 시료 D(MK-G7 균주 10%)Sample D (10% of MK-G7 strain) 0 시간0 hours 5.50 × 106 5.50 × 10 6 5.15 × 106 5.15 × 10 6 2.60 × 106 2.60 × 10 6 8.30 × 105 8.30 × 10 5 2 시간2 hours 8.45 × 106 8.45 × 10 6 1.32 × 107 1.32 × 10 7 7.40 × 106 7.40 × 10 6 3.00 × 106 3.00 × 10 6 4 시간4 hours 7.75 × 106 7.75 × 10 6 4.68 × 107 4.68 × 10 7 3.17 × 107 3.17 × 10 7 4.75 × 106 4.75 × 10 6 6 시간6 hours 1.27 × 107 1.27 × 10 7 8.00 × 107 8.00 × 10 7 4.80 × 107 4.80 × 10 7 2.06 × 107 2.06 × 10 7 8 시간8 hours 1.15 × 107 1.15 × 10 7 7.35 × 107 7.35 × 10 7 5.10 × 107 5.10 × 10 7 2.05 × 107 2.05 × 10 7 10 시간10 hours 8.50 × 106 8.50 × 10 6 7.55 × 107 7.55 × 10 7 4.65 × 107 4.65 × 10 7 1.00 × 107 1.00 × 10 7 12 시간12 hours 1.10 × 107 1.10 × 10 7 6.15 × 107 6.15 × 10 7 6.00 × 107 6.00 × 10 7 1.30 × 107 1.30 × 10 7 24 시간24 hours 1.65 × 107 1.65 × 10 7 6.50 × 107 6.50 × 10 7 4.15 × 107 4.15 × 10 7 8.50 × 106 8.50 × 10 6

Bifidobacterium longumMK-G7 비피더스 균주의 발효유 제품 제조시 배양시간에 따른 총 유산균수 변화(cfu/ml)Changes in Total Lactic Acid Bacteria in Cultured Bifidobacterium longum MK-G7 Bifidus Strains with Culture Time (cfu / ml) 배양시간Incubation time 시료 A(기존 상용균주)Sample A (existing commercial strain) 시료 B(MK-G7 균주 100%)Sample B (100% of MK-G7 strain) 시료 C(MK-G7 균주 50%)Sample C (50% of MK-G7 strain) 시료 D(MK-G7 균주 10%)Sample D (10% of MK-G7 strain) 0 시간0 hours 5.55 × 105 5.55 × 10 5 5.25 × 105 5.25 × 10 5 5.35 × 105 5.35 × 10 5 4.30 × 105 4.30 × 10 5 2 시간2 hours 1.14 × 107 1.14 × 10 7 4.85 × 106 4.85 × 10 6 4.35 × 106 4.35 × 10 6 6.25 × 106 6.25 × 10 6 4 시간4 hours 2.83 × 108 2.83 × 10 8 2.97 × 108 2.97 × 10 8 2.84 × 108 2.84 × 10 8 2.72 × 108 2.72 × 10 8 6 시간6 hours 3.10 × 108 3.10 × 10 8 4.15 × 108 4.15 × 10 8 3.30 × 108 3.30 × 10 8 4.10 × 108 4.10 × 10 8 8 시간8 hours 3.95 × 108 3.95 × 10 8 2.95 × 108 2.95 × 10 8 4.90 × 108 4.90 × 10 8 6.95 × 108 6.95 × 10 8 10 시간10 hours 4.55 × 108 4.55 × 10 8 5.65 × 108 5.65 × 10 8 4.85 × 108 4.85 × 10 8 3.80 × 108 3.80 × 10 8 12 시간12 hours 4.50 × 108 4.50 × 10 8 3.85 × 108 3.85 × 10 8 7.15 × 108 7.15 × 10 8 4.05 × 108 4.05 × 10 8 24 시간24 hours 8.85 × 108 8.85 × 10 8 4.60 × 108 4.60 × 10 8 4.00 × 108 4.00 × 10 8 4.00 × 108 4.00 × 10 8

또한 배양 초기부터 12시간까지의 비피더스 균수 변화는 산 생성능과 비례적으로 공시시료 B가 훨씬 우세하였으며 접종량과 비례적으로 B, C, D 순으로 비피더스 균수가 낮아지는 것으로 밝혀졌다. 배양 12시간째에 비해서 사멸기에 도달한 배양 24시간째의 비피더스 균수 변화에서는 대조구를 제외한 처리구에서 동일한 비율로 사멸하는 것으로 보인다.In addition, the change in the number of bifidus bacteria from the beginning of culture to 12 hours was much higher in the blank sample B in proportion to the acid production capacity, and the numbers of bifidus bacteria were decreased in the order of B, C, and D in proportion to the inoculation amount. The change in the number of bifidus bacteria at 24 hours of cultivation reached the same rate as the control group except the control.

결론적으로 기존의 상용 비피더스 균주에 비해서 본 연구에서 최종적으로 선발된Bifidobacterium longumMK-G7 비피더스 균주의 사용량을 1/5 수준으로 하향 조정하는 것이 가능하며, 비피더스균의 생육을 촉진하는 인자를 이용하면 더욱 양호한 균수를 유지할 수 있다.In conclusion, it is possible to lower the amount of Bifidobacterium longum MK-G7 bifidus strain finally selected in this study to 1/5 compared with the existing commercial bifidus strains. Good bacteria can be maintained.

실시예 11:제품 저장 중의 균주의 안정성 Example 11 Stability of Strains During Product Storage

현재 매일유업(주)에서 생산 판매되고 있는 드링크요구르트의 제조시 사용하는 기존의 상업용 비피더스균을 한국인에 적합한 신규 생리활성Bifidobacterium longumMK-G7 비피더스 균주로 대체 사용하여 완제품으로 생산하였다.The existing commercial bifidus bacteria used in the manufacture of the drink yogurt, which is currently produced and sold by Maeil Dairy Co., Ltd., were replaced with new bioactive Bifidobacterium longum MK-G7 bifidus strains suitable for Koreans to produce finished products.

완제품을 냉장, 실온, 37 ℃에 저장하면서 10일 동안의 pH, 적정산도, 비피더스 균수, 총 유산균수, 관능 특성을 비교하였다. 이때의 비피더스 균수 변화로서 균주의 안정성을 측정하였다.The final product was refrigerated, stored at room temperature, 37 ℃ to compare the pH, titratable acidity, bifidus bacteria, total lactic acid bacteria, sensory properties for 10 days. The stability of the strain was measured as the number of bifidus bacteria at this time.

기존의 배양 환경 하에서 선발 비피더스 균주의 생존 실험을 수행하였다. 기존의 상업용 균주를 사용한 것 이외에는 동일한 방법으로 생산한 발효유 제품(107cfu/ml, A)을 대조구로 하고 선발된Bifidobacterium longumMK-G7 비피더스 균주를 107cfu/ml(B), 0.5×107cfu/ml(C), 106cfu/ml(D)의 균수 수준으로 접종하였다. 발효후 비피더스 균수는 A 시료의 균수가 101cfu/ml 증가하는데 반하여 B, C, D 시료에서는 102cfu/ml 증가하여 상기와 같은 배양 조건에서Bifidobacterium longumMK-G7 비피더스 균주의 생육이 잘 이루어지고 있음을 알 수가 있었다(도 7).Survival experiments of the selected bifidus strains were performed under the existing culture environment. A fermented milk product (10 7 cfu / ml, A) produced by the same method was used as a control except for the use of conventional commercial strains. The selected Bifidobacterium longum MK-G7 bifidus strain was selected as 10 7 cfu / ml (B), 0.5 × 10. Inoculation was carried out at a bacterial count of 7 cfu / ml (C) and 10 6 cfu / ml (D). Bifidobacterium bacteria are contrary to the number of bacteria A sample 10 1 increased cfu / ml B, C, D samples at 10 2 cfu / ml increase in culture conditions, such as the well the growth of Bifidobacterium longum MK-G7 Bifidobacterium strain achieved after fermentation It can be seen that the loss (Fig. 7).

4 ℃에서는 A, B, C, D 시료 모두 9일간의 보존시에 비피더스균의 생존성에커다란 영향이 없었다(도 8). 20 ℃에서는 보존 중에 약간의 생존성이 감소하고 있었지만 0.5×101cfu/ml 정도의 감소를 보여 주었다. 그러나, 37℃에서는 6일 보존 후의 생존율이 동일한 비율로 낮아져 동일한 수준의 생균수를 나타냈다.At 4 ° C., A, B, C, and D samples had no significant effect on viability of bifidus bacteria after 9 days of storage (FIG. 8). At 20 ° C., there was a slight decrease in viability during storage, but a decrease of 0.5 × 10 1 cfu / ml. However, at 37 ° C., the survival rate after 6 days of storage was lowered at the same rate, indicating the same level of viable count.

따라서,Bifidobacterium longumMK-G7 비피더스 균주는 약산성에서의 증식성(acid tolerance)에서 A 시료 균주보다 약간 낮은 것으로 보였으나 발효 후 균수의 증가가 월등하여 기존의 상업용 비피더스 균주에 필적할 수 있는 우수한 균주로 보인다.Therefore, Bifidobacterium longum MK-G7 bifidus strain was shown to be slightly lower than A sample strain in acid tolerance in weak acidity, but it was superior to the existing commercial bifidus strain due to the increase in the number of bacteria after fermentation. see.

한편 보존온도가 높아질수록 총 유산균수가 감소하는 현상을 나타냈는데 4 ℃에서는 보존 5일까지 108cfu/ml를 유지했으나 그 이후 균수가 현저히 감소하였다. 20 ℃에서는 9일 보존까지 108cfu/ml를 유지했고, 37 ℃에서 9일 보존시에는 107cfu/ml의 균수를 유지하였다.On the other hand, as the preservation temperature increased, the total number of lactic acid bacteria decreased. At 4 ℃, 10 8 cfu / ml was maintained until 5 days of preservation, but the number of bacteria decreased significantly after that. At 20 ℃ was maintained for 10 8 cfu / ml to 9, preserving, at the time of nine days at 37 ℃ retention was maintained for the number of bacteria 10 7 cfu / ml.

적정산도는 모든 시료에서 비슷한 수준을 나타냈으며 온도가 높아질수록 약간씩 증가하였는데 37 ℃에서 6일 동안 보존했을 때에는 적정산도가 2.0 %까지 증가하였다. pH도 시간이 경과함에 따라서 저하되는 경향을 나타냈는데 37 ℃에서 가장 심하게 저하되었다. 실제로 37℃에서 2일 보존시 pH가 4.2에서 3.6까지 저하되었다.The titratable acidity was similar in all samples and increased slightly with increasing temperature. The titratable acidity increased to 2.0% when stored at 37 ℃ for 6 days. The pH also showed a tendency to decrease with time, which was the most severe at 37 ° C. Indeed, the pH decreased from 4.2 to 3.6 when stored for 2 days at 37 ℃.

본 발명에 의하면 배양 적용능이 우수하고 내산성, 내담즙성 및 내산소성, 콜레스테롤 저하능, 항돌연변이능, 마크로파지 활성능 등이 뛰어나며 한국인에 적합한 생리활성을 갖는 신규 비피더스 균주를 얻을 수 있다.According to the present invention, it is possible to obtain a novel bifidus strain having excellent cultivation ability, excellent acid resistance, bile resistance and oxygen resistance, cholesterol lowering activity, antimutagenicity, macrophage activity, etc. and having physiological activity suitable for Koreans.

Claims (2)

Bifidobacterium longum MK-G7 비피더스 균주(유전자 은행 균주 기탁 번호: KCTC 0488 BP).Bifidobacterium longum MK-G7 bifidus strain (Gene Bank Strain Deposit No .: KCTC 0488 BP). 유산균 발효균주로 사용되는 제1항에 따른 균주.The strain according to claim 1 used as a lactic acid bacteria fermentation strain.
KR1019980026354A 1998-07-01 1998-07-01 Bifidobacterium longum mk-g7 srains and its application KR100264295B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1019980026354A KR100264295B1 (en) 1998-07-01 1998-07-01 Bifidobacterium longum mk-g7 srains and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1019980026354A KR100264295B1 (en) 1998-07-01 1998-07-01 Bifidobacterium longum mk-g7 srains and its application

Publications (2)

Publication Number Publication Date
KR20000007167A true KR20000007167A (en) 2000-02-07
KR100264295B1 KR100264295B1 (en) 2000-08-16

Family

ID=19542658

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1019980026354A KR100264295B1 (en) 1998-07-01 1998-07-01 Bifidobacterium longum mk-g7 srains and its application

Country Status (1)

Country Link
KR (1) KR100264295B1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100610379B1 (en) * 2004-08-26 2006-08-10 하남주 Novel lactic acid bacteria having immune enhancement activity
KR100720024B1 (en) * 2006-12-20 2007-05-18 (주)바이오토피아 Probiotic bifidobacterium boum r5 strain and composition comprising the same
KR100720025B1 (en) * 2005-09-27 2007-05-21 (주)바이오토피아 Probiotic lactic acid bacteria and composition comprising the same
KR20210158580A (en) * 2020-06-24 2021-12-31 대한제당 주식회사 Novel Bifidobacterium longum TSB-L1 with xylooligosaccharide specific availability

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240138228A (en) 2023-03-10 2024-09-20 숙명여자대학교산학협력단 Bifidobacterium pseudolongum SMFM2020-F1 strain for improving anti-cholesterol efficacy of fermented milk

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100610379B1 (en) * 2004-08-26 2006-08-10 하남주 Novel lactic acid bacteria having immune enhancement activity
KR100720025B1 (en) * 2005-09-27 2007-05-21 (주)바이오토피아 Probiotic lactic acid bacteria and composition comprising the same
KR100720024B1 (en) * 2006-12-20 2007-05-18 (주)바이오토피아 Probiotic bifidobacterium boum r5 strain and composition comprising the same
KR20210158580A (en) * 2020-06-24 2021-12-31 대한제당 주식회사 Novel Bifidobacterium longum TSB-L1 with xylooligosaccharide specific availability

Also Published As

Publication number Publication date
KR100264295B1 (en) 2000-08-16

Similar Documents

Publication Publication Date Title
EP2221360B1 (en) Lactic acid bacterium having effect of lowering blood uric acid level
KR100686557B1 (en) Lactobacillus rhamnosus with body-fat reducing activity and the foods containing them
Iyer et al. Probiotic properties of folate producing Streptococcus thermophilus strains
KR102372949B1 (en) Butyric acid-producing microbe and use thereof
JP3940929B2 (en) Acid and bile salt resistant Lactobacillus isolates with the ability to lower and assimilate cholesterol
JP5875975B2 (en) Probiotic microorganisms isolated from donkey milk
JP2008539776A (en) Symbiotic Bifidobacterium species
KR101473146B1 (en) Composition for preventing or treating irritable bowel syndrome
EP4209579A1 (en) Bifidobacterium inhibiting expression of muscle atrophy gene
KR100264295B1 (en) Bifidobacterium longum mk-g7 srains and its application
KR101098946B1 (en) A compound for feed additive comprising novel Lactobacillus salivarius G1-1
JP4457364B2 (en) New lactic acid bacteria and various products processed using the lactic acid bacteria
CN117159598A (en) Application of lactobacillus plantarum Lp18 in preparation of immunity-enhancing medicines or health-care foods and products
JP6712598B2 (en) Butyric acid-producing bacteria
EP1424075B1 (en) Acid and bile-resistant Lactobacillus isolates having the ability to lower and assimilate cholesterol
US11045507B2 (en) Bifidobacterium animalis AMT30 strain and the composition containing the strain of Bifidobacterium animalis AMT30
CN112877231A (en) Lactic acid bacteria with bacteriostatic and antioxidant activity and application thereof
Njeru et al. Identification and characterisation of lactobacilli isolated from Kimere, a spontaneously fermented pearl millet dough from Mbeere, Kenya (East Africa)
KR100523256B1 (en) Novel acid tolerant probiotic lactobacillus acidophilus Probio-40 with probiotic activities
KR101453982B1 (en) Composition for preventing or treating irritable bowel syndrome
KR100720025B1 (en) Probiotic lactic acid bacteria and composition comprising the same
JP2022130286A (en) Compositions for improving bacterial flora, methods for improving bacterial flora using same, and applications thereof
KR100299306B1 (en) Lactic acid bacteria with high acid resistance and growth rate and excellent blood cholesterol lowering ability
KR100715730B1 (en) 24A novel Bifidobacterium longum A24 with anti-bacterial activity against toxigenic pathogens
RU2617946C1 (en) Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20130305

Year of fee payment: 14

FPAY Annual fee payment

Payment date: 20140417

Year of fee payment: 15

LAPS Lapse due to unpaid annual fee