RU2617946C1 - Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex - Google Patents

Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex Download PDF

Info

Publication number
RU2617946C1
RU2617946C1 RU2015150244A RU2015150244A RU2617946C1 RU 2617946 C1 RU2617946 C1 RU 2617946C1 RU 2015150244 A RU2015150244 A RU 2015150244A RU 2015150244 A RU2015150244 A RU 2015150244A RU 2617946 C1 RU2617946 C1 RU 2617946C1
Authority
RU
Russia
Prior art keywords
strains
glutathione
lactobacillus
brevis
rhamnosus
Prior art date
Application number
RU2015150244A
Other languages
Russian (ru)
Inventor
Валерий Николаевич Даниленко
Серикбай Каримович Абилев
Елена Ульриховна Полуэктова
Мария Викторовна Марсова
Original Assignee
Автономная Некоммерческая Организация "Научно-Исследовательский Центр Биотехнологии Антибиотиков И Других Биологически Активных Веществ "Биоан"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Автономная Некоммерческая Организация "Научно-Исследовательский Центр Биотехнологии Антибиотиков И Других Биологически Активных Веществ "Биоан" filed Critical Автономная Некоммерческая Организация "Научно-Исследовательский Центр Биотехнологии Антибиотиков И Других Биологически Активных Веществ "Биоан"
Priority to RU2015150244A priority Critical patent/RU2617946C1/en
Application granted granted Critical
Publication of RU2617946C1 publication Critical patent/RU2617946C1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225—Lactobacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225—Lactobacillus
    • C12R2001/24—Lactobacillus brevis

Abstract

FIELD: biotechnology.
SUBSTANCE: group of inventions concerns Lactobacillus brevis 47f, Lactobacillus rhamnosus 313, Lactobacillus rhamnosus 40f And Lactobacillus brevis 15f strains capable of synthesizing glutathione antioxidant. The strains are deposited in the All-Russian Collection of Industrial Microorganisms under the registration numbers VKPM B-12237, VKPM B-12236, VKPM B-12238 and VKPM B-12077, respectively. The invention includes isolation, identification, description of properties and nucleotide sequence of the genes. The strains can be used for preparation of accompaniments for cancer patients chemotherapy for drug enteropathy and concomitant diseases prevention and treatment.
EFFECT: group of inventions can prevent severe complications of drug enteropathy.
4 cl, 1 dwg, 9 tbl, 12 ex

Description

Изобретение относится к фармакологии и медицине, в качестве нового пробиотика, в частности для сопровождения химио- и лучевой терапии онкологических заболеваний для предотвращения дисбактериоза и воспалительных процессов слизистых оболочек и кишечника.The invention relates to pharmacology and medicine, as a new probiotic, in particular for accompanying chemo and radiation therapy of cancer to prevent dysbiosis and inflammatory processes of the mucous membranes and intestines.

Штаммы могут быть использованы в производстве функционального питания (йогурт) и для получения препаратов, используемых для профилактики и в комплексном лечении лекарственной энтеропатии. Противовоспалительные свойства штамма - продуцента антиоксидантов, требуются для предотвращения тяжелого осложнения лекарственной энтеропатии - мукозита кишечника.Strains can be used in the production of functional nutrition (yogurt) and to obtain drugs used for prevention and in the complex treatment of drug enteropathy. The anti-inflammatory properties of a strain producing antioxidants are required to prevent severe complications of drug enteropathy - intestinal mucositis.

Уровень техникиState of the art

Огромную роль в жизнедеятельности организма человека играет микробном, совокупность населяющих его микроорганизмов (преимущественно бактерий). Наиболее сложным по общему числу микроорганизмов и числу составляющих его видов является микробном кишечника. Совокупность микроорганизмов, населяющих кишечник, выполняет многочисленные функции: участвует в переваривании пищи, подавляет патогенную микрофлору, проявляет антиканцерогенные и иммуномодулирующие свойства (Role of the normal gut microbiota. Jandhyala S.M., Talukdar R. et al. // World J Gastroenterol 2015 August 7; 21(29): 8787-8803; Gut microbiota and gastrointestinal health: current concepts and future directions. Aziz Q., Dore J. et al. // Neurogastroenterol Motil (2013) 25: 4-15; Pathways and functions of gut microbiota metabolism impacting host physiology. Krishnan S., Alden N., Lee K. // Current Opinion in Biotechnology 2015, 36. P: 137-145; The gut microbiota and host health: a new clinical frontier. Marchesi J.R., Adams D.H. et al. // Gut 2015; Sep. 2 P: 1-10).A huge role in the life of the human body is played by the microbial, the totality of microorganisms inhabiting it (mainly bacteria). The most complex in the total number of microorganisms and the number of species comprising it is the intestinal microbial. The set of microorganisms inhabiting the intestine performs numerous functions: it participates in the digestion of food, suppresses pathogenic microflora, and exhibits anticarcinogenic and immunomodulating properties (Role of the normal gut microbiota. Jandhyala SM, Talukdar R. et al. // World J Gastroenterol 2015 August 7; 21 (29): 8787-8803; Gut microbiota and gastrointestinal health: current concepts and future directions. Aziz Q., Dore J. et al. // Neurogastroenterol Motil (2013) 25: 4-15; Pathways and functions of gut microbiota metabolism impacting host physiology. Krishnan S., Alden N., Lee K. // Current Opinion in Biotechnology 2015, 36. P: 137-145; The gut microbiota and host health: a new clinical frontier. Marchesi JR, Adams DH et al. // Gut 2015; Sep. 2 P: 1-10).

Населяющие ЖКТ бактерии выделяют ряд биологически-активных веществ. Показано, что некоторые из пробиотических компонентов микрофлоры кишечника обладают антиоксидантными (Antioxidant properties of potentially probiotic bacteria: in vitro and in vivo activities. Amaretti A., M. di Nunzio et al., Appi Microbiol Biotechnol (2013) 97:809-817; Probiotics and Oxidative Stress T.Kullisaar. et al. University of Tartu, Bio-competence Centre of Healthy Dairy products LCC, Estonia, 2012), антимутагенными (DNA-protection and antioxidant properties of fermentates from Bacillusamyloliquefaciens B-1895 and Bacillus subtilis KATMIRA1933 / Prazdnova E.V., Chistyakov V.A. et al. // Article in Letters in Applied Microbiology, Sep. 2015; Antimutagenic and anticancer effects of lactic acid bacteria isolated from Tarhana through Ames test and phylogenetic analysis by 16S rDNA. Ahmadi M.A. et al. // Nutr Cancer. 2014; 66(8): 1406-13) и противоопухолевыми свойствами (Probiotics, the New Approach for Cancer Prevention and/or Potentialization of Anti-Cancer Treatment? Daniluk // J Clin Exp Oncol 2012, 1:2; A potential role of probiotics in colorectal cancer prevention: review of possible mechanisms of action. Chong ES // World J Microbiol Biotechnol 2014; 30(2):351-74; Inhibition of Fe-induced colon oxidative stress by lactobacilli in mice. Sun J. et al. // World J Microbiol Biotechnol. 2013 Feb; 29(2): 209-16. doi: 10.1007/s11274-012-1172-5. Epub 2012 Sep 19). Синтезируют и выделяют иммуномодуляторы (Федорова И.А., Даниленко В.Н. Иммуногенные свойства пробиотического компонента микробиоты желудочно-кишечного тракта человека // Усп. соврем, биол. 2014, Т. 134, №2, С. 99-110) и нейромедиаторы (Ingestion of Lactobacillus strain regulates emotional behavior and central GABA receptor expression in a mouse via the vagus nerve. Bravo et al. // Proc Natl Acad Sci USA, 2011; 108: 16050-5; Normal gut microbiota modulates brain development and behavior. Diaz et al. Proc Natl Acad Sci USA, 2011, 108: 3047-52).The bacteria that inhabit the gastrointestinal tract secrete a number of biologically active substances. It has been shown that some of the probiotic components of the intestinal microflora possess antioxidant (Antioxidant properties of potentially probiotic bacteria: in vitro and in vivo activities. Amaretti A., M. di Nunzio et al., Appi Microbiol Biotechnol (2013) 97: 809-817; Probiotics and Oxidative Stress T. Kullisaar. Et al. University of Tartu, Bio-competence Center of Healthy Dairy products LCC, Estonia, 2012), antimutagenic (DNA-protection and antioxidant properties of fermentates from Bacillusamyloliquefaciens B-1895 and Bacillus subtilis KATMIRA1933 / Prazdnova EV, Chistyakov VA et al. // Article in Letters in Applied Microbiology, Sep. 2015; Antimutagenic and anticancer effects of lactic acid bacteria isolated from Tarhana through Ames test and phylogenetic analysis by 16S rDNA. Ahmadi MA et al. // Nutr Cancer. 2014; 66 (8): 1406-13) and antitumor properties (Probiotics, the New Approach for Cancer Prevention and / or Potentialization of Anti-Cancer Treatment? Daniluk // J Clin Exp Oncol 2012, 1: 2; A potential role of probiotics in colorectal cancer prevention: review of possible mechanisms of action. Chong ES // World J Microbiol Biotechnol 2014; 30 (2): 351-74; Inhibition of Fe-induced colon oxidative stress by lactobacilli in mice. Sun J. et al. // World J Microbiol Biotechnol. 2013 Feb; 29 (2): 209-16. doi: 10.1007 / s11274-012-1172-5. Epub 2012 Sep 19). Immunomodulators are synthesized and isolated (Fedorova I.A., Danilenko V.N. Immunogenic properties of the probiotic component of the microbiota of the human gastrointestinal tract // Usp. Sovrem, biol. 2014, T. 134, No. 2, P. 99-110) and neurotransmitters (Ingestion of Lactobacillus strain regulates emotional behavior and central GABA receptor expression in a mouse via the vagus nerve. Bravo et al. // Proc Natl Acad Sci USA, 2011; 108: 16050-5; Normal gut microbiota modulates brain development and behavior Diaz et al. Proc Natl Acad Sci USA, 2011, 108: 3047-52).

Пробиотические микроорганизмы - представители нормальной микрофлоры желудочно-кишечного тракта человека и животных, обладающие антагонистической активностью по отношению к патогенной микрофлоре. Пробиотики оказывают благотворное влияние на функциональное состояние жк-тракта и здоровье человека, поддерживают здоровый баланс пищеварительной системы, стимулируют иммунитет, ферментируют клетчатку, участвуют в синтезе биологически активных веществ - витаминов, пептидов, незаменимых аминокислот; подавляют действие канцерогенов и препятствуют развитию аллергии. Синтезируют антибиотикоподобные вещества, препятствующие размножению гнилостных и гноеродных бактерий (например лизоцим и ацидофилин). Лактобактерии являются пробиотическими микроорганизмами и считаются безопасными (GRAS - generally regaded as safe), они широко используются в функциональных пищевых продуктах, биологически активных добавках, лекарственных средствах. Пробиотики, и лактобактерии в частности, все чаще используются в комбинированном лечении начальных стадий различных заболеваний (язвенного колита, синдрома воспаленного кишечника, аллергических заболеваний). Существует большой интерес к пробиотикам - естественным симбионтам человека, синтезирующим биологически активные вещества, в том числе антиоксиданты (Probiotics as potential antioxidants: A Systematic Review // V. Mishra et al. // Joumal of Agricultural and Food Chemistry. 03/2015; 63(14); Health benefits of probiotics: are mixtures more effective than single strains? Chapman C.M.; Gibson G.R.; Rowland I. // EurJ Nutr. 2011, 50,1-17; Antioxidative potential of lactobacilli isolated from the gut of Indian people. Achuthan AA. et al. // Mol. Biol. Rep. 2012, 39, 7887-97).Probiotic microorganisms are representatives of the normal microflora of the gastrointestinal tract of humans and animals, which have antagonistic activity against pathogenic microflora. Probiotics have a beneficial effect on the functional state of the gastrointestinal tract and human health, maintain a healthy balance of the digestive system, stimulate immunity, ferment fiber, and participate in the synthesis of biologically active substances - vitamins, peptides, essential amino acids; inhibit the action of carcinogens and prevent the development of allergies. Synthesize antibiotic-like substances that prevent the growth of putrefactive and pyogenic bacteria (for example, lysozyme and acidophilus). Lactobacilli are probiotic microorganisms and are considered safe (GRAS - generally regaded as safe), they are widely used in functional foods, dietary supplements, and medicines. Probiotics, and lactobacilli in particular, are increasingly used in the combined treatment of the initial stages of various diseases (ulcerative colitis, inflammatory bowel syndrome, allergic diseases). There is great interest in probiotics - natural human symbionts that synthesize biologically active substances, including antioxidants (Probiotics as potential antioxidants: A Systematic Review // V. Mishra et al. // Joumal of Agricultural and Food Chemistry. 03/2015; 63 (14); Health benefits of probiotics: are mixtures more effective than single strains? Chapman CM; Gibson GR; Rowland I. // EurJ Nutr. 2011, 50,1-17; Antioxidative potential of lactobacilli isolated from the gut of Indian people Achuthan AA. Et al. // Mol. Biol. Rep. 2012, 39, 7887-97).

Преимуществами использования пробиотиков в качестве лекарственных средств является их относительная безвредность и физиологичность по сравнению с химическими препаратами и возможность подбора конкретного препарата - вплоть до индивидуальной терапии - для лечения одного и того же заболевания у разных пациентов.The advantages of using probiotics as medicines are their relative harmlessness and physiology compared to chemical drugs and the possibility of selecting a specific drug - up to individual therapy - for treating the same disease in different patients.

В соответствии с современными представлениями, вещества, обладающие антиоксидантными свойствами (АОС), играют ключевую роль в поддержании общего здоровья человека, продления его жизни и молодости. Большая часть патологических процессов в организме связана с воздействием активных форм кислорода (АФК), образующихся в процессе жизнедеятельности клетки и свободнорадикального окисления (СРО) биомолекул - белков, липидов, нуклеиновых кислот.In accordance with modern concepts, substances with antioxidant properties (AOS) play a key role in maintaining the overall health of a person, prolonging his life and youth. Most of the pathological processes in the body are associated with exposure to reactive oxygen species (ROS) formed during cell activity and free radical oxidation (SRO) of biomolecules - proteins, lipids, nucleic acids.

Использование микроорганизмов, являющихся естественными симбионтами человека, в качестве источника антиоксидантов (АО), имеет ряд преимуществ перед другими способами повышения антиоксидантного статуса организма. В отличие от химических фарм. препаратов, применение Lactobacillus позволяет поддерживать постоянную продукцию АО в физиологических дозах непосредственно в кишечнике, исключая воздействие (желудочного сока и желчи) и возможную модификацию АО молекул. Такой подход особенно перспективен при лечении воспалительных заболеваний кишечника (неспецифический колит, мукозит и т.п.).The use of microorganisms, which are natural symbionts of man, as a source of antioxidants (AO), has several advantages over other methods of increasing the antioxidant status of the body. Unlike chemical farming. drugs, the use of Lactobacillus allows you to maintain a constant production of AO in physiological doses directly in the intestine, excluding exposure (gastric juice and bile) and the possible modification of AO molecules. This approach is especially promising in the treatment of inflammatory bowel diseases (nonspecific colitis, mucositis, etc.).

Существует большое количество препаратов, в основном БАДов, в состав которых входят лактобациллы. Такие препараты используют для коррекции и стабилизации кишечной микрофлоры при дисбактериозах различной этиологии, лечении урогенитальных инфекций, коррекции аллергических реакций. Около пятидесяти из них зарегистрированы в России как фармпрепараты [http://www.rlsnet.ru/baa_fg_id_367.htm].There are a large number of drugs, mainly dietary supplements, which include lactobacilli. Such drugs are used to correct and stabilize the intestinal microflora in case of dysbiosis of various etiologies, treatment of urogenital infections, and correction of allergic reactions. About fifty of them are registered in Russia as pharmaceuticals [http://www.rlsnet.ru/baa_fg_id_367.htm].

Широкое использование пробиотиков в виде БАДов выявило ряд побочных эффектов. В силу этого, возросли требования к разрабатываемым пробиотическим препаратам, ужесточились требования как в Евросоюзе так и в России. Существенными являются: полногеномное секвенирование новых используемых штаммов и выявление активных компонентов (конкретных веществ) в используемых препаратах, установление механизмов действия, включая систему передачи сигнала к конечным биомишеням на уровне органов и молекулярном уровне и др. Выполнение данных требований позволяет более полно охарактеризовать пробиотик и позиционировать его для профилактики или лечения конкретных нозологии.The widespread use of probiotics in the form of dietary supplements has revealed a number of side effects. Due to this, the requirements for the developed probiotic preparations have increased, the requirements have become tougher both in the European Union and in Russia. Significant are: genome-wide sequencing of new strains used and identification of active components (specific substances) in the preparations used, establishment of mechanisms of action, including a signal transmission system to final biological targets at the organ level and molecular level, etc. The fulfillment of these requirements allows a more complete characterization of the probiotic and positioning its for the prevention or treatment of specific nosology.

Выявление основного активного механизма его действия и отнесение исследуемого комплексного препарата (пробиотика) к одному из фармацевтических классов: иммуномодулятор; антибактериальный; противовирусный; нейродепрессант; и др.Identification of the main active mechanism of its action and assignment of the studied complex preparation (probiotic) to one of the pharmaceutical classes: immunomodulator; antibacterial; antiviral; neurodepressant; and etc.

Выбор типа препарата (препарат сопровождения при комплексной терапии, основной препарат и др.) и нозологической ниши.The choice of the type of drug (accompaniment drug in complex therapy, the main drug, etc.) and nosological niche.

Комплексность препаратов пробиотиков требует установления их молекулярной структуры (в том числе на уровне ДНК) и стандартизации по основным заявленным фармакологическим свойствам, продуктам и определяющим их генам.The complexity of probiotic preparations requires the establishment of their molecular structure (including at the DNA level) and standardization according to the main declared pharmacological properties, products, and genes that determine them.

Полногеномное секвенирование позволяет составить аннотацию геномов: на отсутствие генов, обусловливающих патогенность и лекарственную устойчивость, локализованную на мобильных генетических элементах; на наличие генов, участвующих в синтезе нейротрансмиттеров и их ингибиторов; генов, контролирующих продукцию потенциальных иммуномодуляторов (экзополисахаридов, пектинов и др.); генов, контролирующих продукцию антиоксидантов (глутатиона, витаминов Е, С, линолевой кислоты и др.); генов детоксикации ксенобиотиков; генов, контролирующих биосинтез бактериоцинов; генов гистаминов и других аллергенных факторов.Full genome sequencing allows you to compile an annotation of genomes: the absence of genes that determine pathogenicity and drug resistance, localized on mobile genetic elements; the presence of genes involved in the synthesis of neurotransmitters and their inhibitors; genes that control the production of potential immunomodulators (exopolysaccharides, pectins, etc.); genes that control the production of antioxidants (glutathione, vitamins E, C, linoleic acid, etc.); xenobiotic detox genes; genes that control the biosynthesis of bacteriocins; histamine genes and other allergenic factors.

На основе полученных результатов отбираются штаммы, потенциально способные синтезировать антиоксиданты.Based on the results, strains that are potentially capable of synthesizing antioxidants are selected.

Далее, проводятся исследования отобранных штаммов на способность синтезировать антиоксидант.Further, studies of selected strains for the ability to synthesize an antioxidant are conducted.

Основным антиоксидантным веществом, обеспечивающим лечебный эффект предложенного пробиотика является глутатион. Штаммы L.brevis 15f, Lactobacillus rhamnosus 313 и Lactobacillus rhamnosus 40 синтезируют и выделяют в среду глутатион, обладающий высокой антиоксидантной активностью.The main antioxidant substance that provides the therapeutic effect of the proposed probiotic is glutathione. The strains L.brevis 15f, Lactobacillus rhamnosus 313 and Lactobacillus rhamnosus 40 are synthesized and secreted into the medium of glutathione, which has high antioxidant activity.

Глутатион (2-амино-5-{[2-[(карбоксиметил)амино]-1-(меркаптометил)-2-оксоэтил]амино}-5-оксопентаноевая кислота, glutathione, GSH) - значение глутатиона в клетке определяется его антиоксидантными свойствами.Glutathione (2-amino-5 - {[2 - [(carboxymethyl) amino] -1- (mercaptomethyl) -2-oxoethyl] amino} -5-oxopentanoic acid, glutathione, GSH) - the value of glutathione in the cell is determined by its antioxidant properties .

Глутатион играет в клетке важную роль и участвует во многих процессах, таких как антиоксидантная защита клетки, иммуностимуляция и активирование клеточной детоксикации (Current status and emerging role of glutathione in food grade lactic acid bacteria. Pophaly S.D. et al. // Microb.l Cell Factories. 2012. P. 11:114).Glutathione plays an important role in the cell and is involved in many processes, such as antioxidant cell defense, immunostimulation and activation of cell detoxification (Current status and emerging role of glutathione in food grade lactic acid bacteria. Pophaly SD et al. // Microb.l Cell Factories . 2012. P. 11: 114).

Большинство биологических функций глутатиона связаны с его конверсией из восстановленной формы в окисленную и обратно при помощи ферментов глутатион редуктазы (gshR/gor) и глутатион пероксидазы (gpo) - двух основных ферментов, участвующих в метаболизме глутатиона. Каталитический перевод восстановленной формы глутатиона(GSH) в его окисленную форму(GSSG) и дальнейшая каталитическая регенерация его восстановленной формы, позволяет поддерживать уговень глутатиона на весьма высоком уровне (Glutathione and cellular redox control in epigenetic regulation. García-Giménez JL, Ibañez-Cabellos JS, Seco-Cervera M, Pallardo FV. // Free Radic Biol Med. 2014).Most of the biological functions of glutathione are associated with its conversion from the reduced form to the oxidized one and vice versa using the enzymes glutathione reductase (gshR / gor) and glutathione peroxidase (gpo), the two main enzymes involved in glutathione metabolism. The catalytic conversion of the reduced form of glutathione (GSH) to its oxidized form (GSSG) and the subsequent catalytic regeneration of its reduced form allows the glutathione to be kept at a very high level (Glutathione and cellular redox control in epigenetic regulation. García-Giménez JL, Ibañez-Cabellos JS Seco-Cervera M, Pallardo FV. // Free Radic Biol Med. 2014).

Фактически, глутатион поддерживает внутриклеточный гомеостаз, определяет редокс-статус внутриклеточной среды, защищая клетку от таких токсичных агентов, как свободные радикалы и активные формы кислорода. В случае низкой концентрации внутриклеточных антиоксидантов редокс-статус клетки понижается, происходит накопление реакционно-активных частиц. При накоплении окисленных молекул происходит "кислородный взрыв", сопровождающийся повреждением клеток. Окисленные молекулы действуют на молекулярный сенсор окислительного стресса -ядерный фактор каппа В (NFkB), вызывая уход клеток в апоптоз, что приводит к массовой гибели эпителиоцитов и воспалению слизистой оболочки.In fact, glutathione supports intracellular homeostasis, determines the redox status of the intracellular environment, protecting the cell from toxic agents such as free radicals and reactive oxygen species. In the case of a low concentration of intracellular antioxidants, the redox status of the cell decreases, and the accumulation of reactive particles occurs. With the accumulation of oxidized molecules, an “oxygen explosion” occurs, accompanied by cell damage. Oxidized molecules act on the molecular sensor of oxidative stress - the nuclear factor Kappa B (NFkB), causing the cells to go into apoptosis, which leads to mass death of epithelial cells and inflammation of the mucous membrane.

Глутатион участвует в синтезе лейкотриенов, он также важен в качестве гидрофильной молекулы, которая присоединяется ферментами печени к гидрофобным токсическим веществам в процессе их биотрансформации с целью выведения из организма (в составе желчи). Как часть глиоксалазной ферментативной системы глутатион участвует в реакции детоксификации метилглиоксаля, токсического побочного продукта метаболизма. Глутатион является субстратом реакций конъюгирования и восстановления, катализируемых глутатион-5-трансферазой в цитозоле, микросомах и в митохондриях (The potential role of the antioxidant and detoxification properties of glutathione in autism spectrum disorders: a systematic review and meta-analysis. Main P.A. et al. // Nutr Metab (London). 2012 Apr 24; 9:35.).Glutathione is involved in the synthesis of leukotrienes, it is also important as a hydrophilic molecule, which is attached by liver enzymes to hydrophobic toxic substances in the process of their biotransformation with the aim of excretion from the body (as part of bile). As part of the glyoxalase enzyme system, glutathione is involved in the detoxification of methylglyoxal, a toxic metabolic byproduct. Glutathione is a substrate of the conjugation and reduction reactions catalyzed by glutathione 5-transferase in the cytosol, microsomes and mitochondria (The potential role of the antioxidant and detoxification properties of glutathione in autism spectrum disorders: a systematic review and meta-analysis. Main PA et al . // Nutr Metab (London). 2012 Apr 24; 9:35.).

Все клетки организма человека способны синтезировать глутатион, тем не менее в стрессовых для организма ситуациях, жизненно необходимо поддерживать его концентрацию на достаточно высоком уровне. Например, после рождения, мыши, у которых синтез глутатиона в печени генетически нарушен, живут не более одного месяца. Смерть вызвана повреждением митохондрий и недостаточностью печени («Hepatocyte-specific GCLC deletion leads to rapid onset of steatosis with mitochondrial injury and liver failure». Chen Y. et al. // Hepatology 2007, 45: 1118.).All cells of the human body are able to synthesize glutathione, however, in situations stressful for the body, it is vital to maintain its concentration at a sufficiently high level. For example, after birth, mice in which the synthesis of glutathione in the liver is genetically impaired do not live more than one month. Death is caused by mitochondrial damage and liver failure (Hepatocyte-specific GCLC deletion leads to rapid onset of steatosis with mitochondrial injury and liver failure. Chen Y. et al. // Hepatology 2007, 45: 1118.).

Для лечения онкологических заболеваний используют ряд препаратов, обладающих эффективным противоопухолевым действием, но вызывающих целый ряд побочных эффектов, в т.ч. гематологическая токсичность, воспаление слизистой оболочки кишечника (мукозит или эпителиит) и общий дисбактериоз (5-Fluorouracil-induced changes of intestinal integrity biomarkers in BALB/c mice. Song M.K., Park M.Y., Sung M.K.J. // Cancer Prev. 2013. V. 18. P. 322-329). Последние два наиболее тяжелые и требуют специальных средств коррекции. Для решения данных задач в последние годы предложено использование нескольких штаммов Lactobacillus, обладающих антиоксидантным действием (Lactobacillus fermentum, a probiotic capable to release glutathione, prevent colonic inflammation in the TNBS model of rat colitis. L. Peran, D. Camuesco, M. Comalada et al. // Int J Colorectal Dis. 2006. V.21. P. 737-746; Bifidobacterium infantis has a beneficial effect on 5-fluorouracil -induced intestinal mucositis in rats. Yuan K.T., Yu H.L., Feng W.D. et al. // Benef. Microbes. 2014. V. 6. P. 1-6).For the treatment of cancer, a number of drugs are used that have an effective antitumor effect, but cause a number of side effects, including hematological toxicity, inflammation of the intestinal mucosa (mucositis or epithelitis) and general dysbiosis (5-Fluorouracil-induced changes of intestinal integrity biomarkers in BALB / c mice. Song MK, Park MY, Sung MKJ // Cancer Prev. 2013. V. 18 P. 322-329). The last two are the most difficult and require special correction tools. To solve these problems in recent years, it has been proposed to use several strains of Lactobacillus with antioxidant effects (Lactobacillus fermentum, a probiotic capable of release glutathione, prevent colonic inflammation in the TNBS model of rat colitis. L. Peran, D. Camuesco, M. Comalada et al. // Int J Colorectal Dis. 2006. V.21. P. 737-746; Bifidobacterium infantis has a beneficial effect on 5-fluorouracil -induced intestinal mucositis in rats. Yuan KT, Yu HL, Feng WD et al. / / Benef. Microbes. 2014. V. 6. P. 1-6).

Противовоспалительные свойства штамма - продуцента антиоксидантов требуются для предотвращения тяжелого осложнения лекарственной энтеропатии - мукозита кишечника.The anti-inflammatory properties of the strain producing antioxidants are required to prevent severe complications of drug enteropathy - intestinal mucositis.

Есть отдельные зарубежные работы, предлагающие штаммы Lactobacillus, имеющих перспективы клинического применения (Complete Glutathione System in Probiotic Lactobacillus fermentum ME_31 Kullisaar Т., Songisepp E., Mikelsaar M. et al. //. Applied Biochemistry and Microbiology, 2010, Vol. 46, No. 5, pp. 481-486; In vitro and in vivo antioxidant activity of Bifidobacterium animalis 01 isolated from Centenarians. Shen Q.; Shang N.; Li P. // Curr. Microbiol. 2011, 62, 1097-1103).There are some foreign studies offering strains of Lactobacillus with clinical prospects (Complete Glutathione System in Probiotic Lactobacillus fermentum ME_31 Kullisaar T., Songisepp E., Mikelsaar M. et al. //. Applied Biochemistry and Microbiology, 2010, Vol. 46, No. 5, pp. 481-486; In vitro and in vivo antioxidant activity of Bifidobacterium animalis 01 isolated from Centenarians. Shen Q .; Shang N .; Li P. // Curr. Microbiol. 2011, 62, 1097-1103) .

Существует ряд патентов на пробиотические организмы с антиоксидантной активностью: Probiotic bacteria having antioxidant activity and use thereof, Mogna G.; Strozzi G.P.; Mogna L., US 20140065116 A1, 2014; Lactobacilli with Anti-Oxidant Action / Grompone G., Degivry M-C., Legrain-Raspaud S., Chambaud I., Bourdet-Sicard R. US 20130171117 A1, 2013; Human lactobacillus casei gr x 12 with antioxidant function and application thereof. Ruixia G. Dong. L, CN 103343107 (A), 2013; A Novel lactobacillus plantarum, composition with antibacterial and antioxidant activity comprising the same and use of thereof. Ki K.S., Kyung CH. W. // KR20120023480 (А) 2012; KR101197203 2012; Method of treatment using Lactobacillus fermentum ME-3. Kullisaar Т., Zilmer M. SG11201504787V (A), 2015). Описанные в них штаммы являются ближайшим аналогом изобретения.There are a number of patents for probiotic organisms with antioxidant activity: Probiotic bacteria having antioxidant activity and use thereof, Mogna G .; Strozzi G.P .; Mogna L., US 20140065116 A1, 2014; Lactobacilli with Anti-Oxidant Action / Grompone G., Degivry M-C., Legrain-Raspaud S., Chambaud I., Bourdet-Sicard R. US 20130171117 A1, 2013; Human lactobacillus casei gr x 12 with antioxidant function and application thereof. Ruixia G. Dong. L, CN 103343107 (A), 2013; A Novel lactobacillus plantarum, composition with antibacterial and antioxidant activity comprising the same and use of thereof. Ki K.S., Kyung CH. W. // KR20120023480 (A) 2012; KR101197203 2012; Method of treatment using Lactobacillus fermentum ME-3. Kullisaar T., Zilmer M. SG11201504787V (A), 2015). The strains described therein are the closest analogue of the invention.

Недавно установлено, что геном например, Bifidobacterium longum GT15, содержит 35 уникальных генов, характерных только для популяции жителей России (Zakharevich N.V. et al., 2015). Это дает основания считать, что разработка российских штаммов лактобацилл, адаптированных для российской популяции, с учетом происхождения штамма (т.е. выделенные из ЖКТ людей - жителей центрального региона России) и препаратов на их основе необходимы в России. Депонируемые штаммы отличаются от всех описанных ранее тем, что они: 1. выделены из ЖКТ именно жителей центрального региона России; 2. имеют отличную от других заявленных штаммов последовательность генома; 3. синтезируют глутатион в больших количествах - 1.5 г/л, определяемый с помощью стандартной валидированной методики.It has recently been established that the genome, for example, Bifidobacterium longum GT15, contains 35 unique genes that are characteristic only of the population of the inhabitants of Russia (Zakharevich N.V. et al., 2015). This suggests that the development of Russian strains of lactobacilli adapted for the Russian population, taking into account the origin of the strain (i.e. people isolated from the gastrointestinal tract - residents of the central region of Russia) and preparations based on them are necessary in Russia. Deposited strains differ from all the previously described strains in that they: 1. are isolated from the gastrointestinal tract precisely of the inhabitants of the central region of Russia; 2. have a different genome sequence from other claimed strains; 3. synthesize glutathione in large quantities - 1.5 g / l, determined using a standard validated method.

Раскрытие изобретенияDisclosure of invention

Целью данного изобретения является представление штаммов микроорганизмов в качестве нового пробиотика - продуцента антиоксидантов (в том числе глутатиона, как основного действующего вещества) для использования в фармацевтической и пищевой промышленности, а также в медицине в качестве препарата сопровождения химио- и лучевой терапии, а так же для профилактики и лечения воспалительных заболеваний кишечника.The aim of this invention is the presentation of strains of microorganisms as a new probiotic - a producer of antioxidants (including glutathione, as the main active substance) for use in the pharmaceutical and food industries, as well as in medicine as a drug for accompanying chemo- and radiation therapy, as well as for the prevention and treatment of inflammatory bowel disease.

Отбор штаммов.The selection of strains.

Задачей настоящего исследования является поиск и отбор штаммов лактобацилл, выделенных из организма людей - жителей центрального региона России, обладающих пробиотическими свойствами и способных синтезировать и выделять в среду глутатион и комплекс других антиоксидантов. Была проверена коллекция штаммов лактобацилл, состоящая из видов L.rhamnosus, L.fermentum, L.brevis, L.casei, L.plantarum, L.helveticus, L.delbrieckii, всего 89 штаммов, на наличие антиоксидантных свойств (Пример 1.). Штаммы выращивали в среде MRS в атмосфере CO2 при 37°С в течение 18-48 часов. Определяли наличие антиоксидантных свойств и, в частности, глутатиона при помощи биолюминесцентного и биохимического анализов.The objective of this study is the search and selection of strains of lactobacilli isolated from the body of people - residents of the central region of Russia, with probiotic properties and able to synthesize and excrete glutathione and a complex of other antioxidants into the environment. A collection of lactobacilli strains, consisting of the species L.rhamnosus, L.fermentum, L.brevis, L.casei, L.plantarum, L.helveticus, L.delbrieckii, a total of 89 strains, was checked for antioxidant properties (Example 1.) . The strains were grown in MRS medium in a CO 2 atmosphere at 37 ° C for 18-48 hours. The presence of antioxidant properties and, in particular, glutathione was determined using bioluminescent and biochemical analyzes.

Были отобраны четыре штамма, принадлежащие к этим видам, имеющие достаточно высокий уровень продукции антиоксидантов и характеризующиеся рядом пробиотических свойств - Lactobacillus brevis 47f, Lactobacillus rhamnosus 313 и Lactobacillus rhamnosus 40f и L.brevis 15f.Four strains belonging to these species were selected, having a fairly high level of antioxidant production and characterized by a number of probiotic properties - Lactobacillus brevis 47f, Lactobacillus rhamnosus 313 and Lactobacillus rhamnosus 40f and L.brevis 15f.

Штамм L.brevis 47f выделен из фекалий здоровой женщины в возрасте 38 лет, которая на момент обследования была клинически здорова, не имела в анамнезе инфекционных и соматических заболеваний желудочно-кишечного тракта и других систем органов, в 2010 г.Strain L.brevis 47f was isolated from the feces of a healthy woman aged 38 years who was clinically healthy at the time of the examination and did not have a history of infectious and somatic diseases of the gastrointestinal tract and other organ systems in 2010.

Штамм L.rhamnosus 313 выделен из слюны здоровой девушки в возрасте 19 лет, которая на момент обследования была клинически здорова, не имела в анамнезе инфекционных и соматических заболеваний желудочно-кишечного тракта и других систем органов, в 2013 г.Strain L.rhamnosus 313 was isolated from the saliva of a healthy girl at the age of 19, who was clinically healthy at the time of the examination, did not have a history of infectious and somatic diseases of the gastrointestinal tract and other organ systems, in 2013.

Штамм L.rhamnosus 40f выделен из фекалий здоровой девушки в возрасте 19 лет, которая на момент обследования была клинически здорова, не имела в анамнезе инфекционных и соматических заболеваний желудочно-кишечного тракта и других систем органов, в 2010 г.The strain L. rhamnosus 40f was isolated from the feces of a healthy girl aged 19 years, who at the time of the examination was clinically healthy, had no history of infectious and somatic diseases of the gastrointestinal tract and other organ systems, in 2010.

Штамм L.brevis 15f выделен в 2010 г. в г. Твери из фекалий здоровой девушки в возрасте 19 лет, которая на момент обследования была клинически здорова, не имела в анамнезе инфекционных и соматических заболеваний желудочно-кишечного тракта и других систем органов.The strain L.brevis 15f was isolated in 2010 in Tver from the feces of a healthy girl at the age of 19, who at the time of the examination was clinically healthy, did not have a history of infectious and somatic diseases of the gastrointestinal tract and other organ systems.

Штаммы не являются генетически модифицированным и не содержат генов других организмов; перенесенных генов резистентности; генетических изменений, связанных с использованием генно-технических методик. Не являются зоопатогенными, не являются фитопатогенными, не представляют опасности по другим причинам.The strains are not genetically modified and do not contain the genes of other organisms; transferred resistance genes; genetic changes associated with the use of genetic engineering techniques. They are not zoopathogenic, are not phytopathogenic, are not dangerous for other reasons.

Геномы штаммов были секвенированы и аннотированы в соответствии с требованиями Евросоюза по биобезопасности.The genomes of the strains were sequenced and annotated in accordance with the EU biosafety requirements.

Штаммы охарактеризованы в соответствии с требованиями по биобезопасности, опубликованными в Фармакопейной статье «Пробиотики для медицинского применения» Министерства здравоохранения Российской Федерации (Государственный стандарт качества лекарственных средств).The strains are characterized in accordance with the requirements for biosafety published in the Pharmacopoeia article “Probiotics for medical use” of the Ministry of Health of the Russian Federation (State standard for the quality of medicines).

Штаммы депонированы во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ), Геномы депонированы в международную базу GenBank (Пример 2)Strains are deposited in the All-Russian Collection of Industrial Microorganisms (VKPM), Genomes are deposited in the international GenBank database (Example 2)

Штамм L.brevis 47f депонирован в ВКПМ (г. Москва) 26.03.2015 г. В-12237; в GenBank WGS LBHR00000000;The strain L.brevis 47f was deposited in VKPM (Moscow) 03/26/2015, B-12237; in GenBank WGS LBHR00000000;

Штамм L.rhamnosus 313 депонирован в ВКПМ (г. Москва) 26.03.2015 № В-12236; в GenBank WGS LFNB00000000;The strain L.rhamnosus 313 was deposited in VKPM (Moscow) 03/26/2015 No. B-12236; in GenBank WGS LFNB00000000;

Штамм L.rhamnosus 40i депонирован в ВКПМ (г. Москва) 26.03.2015 № В-12238; в GenBank WGS LFNA00000000.The strain L. rhamnosus 40i was deposited in VKPM (Moscow) 03/26/2015 No. B-12238; at GenBank WGS LFNA00000000.

Штамм L.brevis 15 f депонирован в ВКПМ (г. Москва) 10.10.2014 № В-12077; в GenBank WGS JXCD00000000The strain L.brevis 15 f was deposited in VKPM (Moscow) 10/10/2014 No. B-12077; at GenBank WGS JXCD00000000

Определение видовой принадлежности патентуемых штаммов.Determination of species affiliation of patentable strains.

Определение видовой принадлежности штамма L.brevis 47f было проведено по нуклеотидной последовательности гена 16S РНК.The species affiliation of the strain L.brevis 47f was determined by the nucleotide sequence of the 16S RNA gene.

Для определения вида по гену 16S РНК использовали стандартные праймеры 27f (AGAGTTTGATCCTGGCTCAG) и 1492r (GGTTACCTTGTTACGACTT) (Lane, D. J. 1991. 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley). Штамм был идентифицирован как L.brevis. (Пример 3).To determine the species from the 16S RNA gene, standard primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (GGTTACCTTGTTACGACTT) (Lane, DJ 1991, 16S / 23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175 Ed. Stackebrandt & M. Goodfellow. Chichester: Wiley). The strain has been identified as L.brevis. (Example 3).

Определение видовой принадлежности штамма L.rhamnosus 313 было проведено по нуклеотидной последовательности гена 16S РНК; 2. НП межгенного района, предшествующего первому гену оперона FOF1 синтазы; 3. НП 8-ми генов «домашнего хозяйства» и 3-х систем токсин-антитоксин. Выделенный штамм лактобацилл по результатам анализа был идентифицирован как Lactobacillus rhamnosus (Пример 4).The species affiliation of L. rhamnosus 313 was determined by the nucleotide sequence of the 16S RNA gene; 2. NP intergenic region preceding the first gene of the operon FOF1 synthase; 3. NP 8 genes of "household" and 3 toxin-antitoxin systems. The selected strain of lactobacilli according to the analysis was identified as Lactobacillus rhamnosus (Example 4).

Определение видовой принадлежности штамма L.rhamnosus 40f было проведено по нуклеотидной последовательности гена 16S РНК; 2. наличия и НП 5-ти систем токсин-антитоксин, специфичных для вида L.rhamnosus. Выделенный штамм лактобацилл по результатам анализа был идентифицирован как L.rhamnosus (Пример 5).The species affiliation of L. rhamnosus 40f was determined by the nucleotide sequence of the 16S RNA gene; 2. the presence and NP of 5 toxin-antitoxin systems specific for the species L. rhamnosus. The selected strain of lactobacilli according to the analysis was identified as L. rhamnosus (Example 5).

Определение видовой принадлежности штамма L.brevis 15f было проведено по нуклеотидной последовательности гена 16S РНК. Штамм был идентифицирован как L.brevis. (Пример 6).The species affiliation of the strain L.brevis 15f was determined by the nucleotide sequence of the 16S RNA gene. The strain has been identified as L.brevis. (Example 6).

Культурально-морфологические особенности штаммов:Cultural and morphological features of the strains:

Штамм Lactobacillus rhamnosus 40f представляет собой грам-положительные бесспоровые палочки короткие и длинные с закругленными концами, некоторые расположены в цепочку, 2-5 мкм. При культивировании на жидких средах в течение 22-24 ч происходит равномерное помутнение среды по всему ее объему с образованием осадка. При выращивании на поверхности агаризованных сред образуются колонии S-формы, выпуклые, гладкие, светло-желтого или белого цвета с ровными краями. Диаметр колонии 1-2 мм. Время культивирования 48 часов. Температура инкубации 37°С.The strain Lactobacillus rhamnosus 40f is a gram-positive, indisputable sticks short and long with rounded ends, some are arranged in a chain, 2-5 microns. When cultured in liquid media for 22-24 hours, a uniform turbidity of the medium occurs over its entire volume with the formation of a precipitate. When grown on the surface of agarized media, S-shaped colonies are formed, convex, smooth, light yellow or white with even edges. The diameter of the colony is 1-2 mm. The cultivation time is 48 hours. The incubation temperature is 37 ° C.

Штаммы L.brevis 47f, и L.rhamnosus 313 при культивировании на твердой среде MRS в течение 48 часов образуют колонии S-формы с диаметром 2 мм, выпуклые, гладкие, белого цвета с ровными краями. При культивировании в жидкой среде MRS в течение 18 и более часов происходит равномерное помутнение среды по всему ее объему, кроме зоны аэробиоза, с образованием осадка. При микроскопировании обнаруживаются одиночные грамположительные палочки правильной формы с округлыми концами, 2-5 мкм. По данным свойствам штаммы L.brevis 47f, и L.rhamnosus 313 неотличимы друг от друга.Strains L. brevis 47f, and L. rhamnosus 313, when cultured on solid MRS medium for 48 hours, form S-shaped colonies with a diameter of 2 mm, convex, smooth, white with even edges. When cultured in liquid MRS for 18 hours or more, uniform turbidity of the medium occurs over its entire volume, except for the aerobiosis zone, with the formation of a precipitate. Microscopic examination revealed single gram-positive bacilli of regular shape with rounded ends, 2-5 microns. According to these properties, strains of L. brevis 47f, and L. rhamnosus 313 are indistinguishable from each other.

Штамм L.brevis 15f грамположительные бесспоровые палочки короткие и длинные (2-5 мкм) с закругленными концами, некоторые расположены в цепочку. Выросшие колонии S-формы 1-2 мм, выпуклые, гладкие, светло-желтого или белого цвета с ровными краями. При культивировании в жидкой среде MRS в течение 22-24 ч происходит равномерное помутнение среды по всему ее объему, кроме зоны аэробиоза, с образованием осадка.Strain L.brevis 15f gram-positive, non-spore bacilli are short and long (2-5 microns) with rounded ends, some are arranged in a chain. Overgrown S-shaped colonies of 1-2 mm, convex, smooth, light yellow or white with smooth edges. When cultured in liquid MRS for 22-24 hours, a uniform turbidity of the medium occurs over its entire volume, except for the aerobiosis zone, with the formation of a precipitate.

Способ, условия и состав сред для размножения штаммов.The method, conditions and composition of the media for the propagation of strains.

Штаммы культивировали на жидкой и агаризованной средах MRS (Himedia) в течении 24-48 час. Состав среды MRS на 1 литр в граммах: протеозопептон - 10,0; мясной экстракт - 10,0; дрожжевой экстракт - 5,0; глюкоза - 20,0; полисорбат 80 - 1,0; цитрат аммония - 2,0; ацетат натрия - 5,0; сульфат магния - 0,1; сульфат марганца - 0,05; фосфат калия двузамещенный - 2,0. рН (при 25°С) 6,5. Культивирование осуществляли как в анаэробных условиях с использованием анаэростата и системы GasPak+, так и в аэробном режиме. Температура инкубации 37°С.The strains were cultured on liquid and agar medium MRS (Himedia) for 24-48 hours. The composition of the MRS medium per 1 liter in grams: proteozopeptone - 10.0; meat extract - 10.0; yeast extract - 5.0; glucose - 20.0; polysorbate 80 - 1.0; ammonium citrate - 2.0; sodium acetate - 5.0; magnesium sulfate - 0.1; manganese sulfate - 0.05; disubstituted potassium phosphate - 2.0. pH (at 25 ° C) 6.5. Cultivation was carried out both under anaerobic conditions using an anaerostat and the GasPak + system, and in aerobic mode. The incubation temperature is 37 ° C.

Активность (продуктивность) штаммов.Activity (productivity) of strains.

В MRS-бульоне продуктивность штаммов достигала 109 KОЕ/мл.In MRS broth, the productivity of the strains reached 10 9 KOE / ml.

Антиоксидантная активность определялась биолюминесцентным методом на тест-системе с рекомбинантными штаммами E.coli, несущими lux-оперон (Lux-биосенсоры для детекции SOS-ответа, теплового шока и окислительного стресса. Котова В.Ю., Манухов И.В., Завильгельский Г.Б. // Биотехнология, 2009, №6, С. 16-25) (Пример 7).Antioxidant activity was determined by a bioluminescent method on a test system with recombinant E. coli strains carrying a lux operon (Lux biosensors for detecting the SOS response, heat shock and oxidative stress. Kotova V.Yu., Manukhov IV, Zavilgelsky G .B. // Biotechnology, 2009, No. 6, S. 16-25) (Example 7).

Общий уровень поглощающей способности активных форм кислорода, таких как супероксид-анион, гидроксильный радикал и другие стабильные неорганические радикалы, определялся при помощи стандартной методики по скорости восстановления окрашенного метастабильного катион - радикала 2,2'-азинобис (3-этил-бензотиазолин-6-сульфоновой кислоты) (ABTS+•), образующегося в присутствии миоглобина и перекиси водорода (Antiradical and antioxidant activity of total anthocyanins from Perillapankinen is decne. Gulcin I. et al. // J. Ethnopharmacol. 2005, 101, 287-293) (Пример 8).The total absorption capacity of reactive oxygen species, such as superoxide anion, hydroxyl radical, and other stable inorganic radicals, was determined using a standard technique for the rate of reduction of a colored metastable cation - the radical 2,2'-azinobis (3-ethyl-benzothiazolin-6- sulfonic acid) (ABTS + •), formed in the presence of myoglobin and hydrogen peroxide (Antiradical and antioxidant activity of total anthocyanins from Perillapankinen is decne. Gulcin I. et al. // J. Ethnopharmacol. 2005, 101, 287-293) (Example 8).

Для определения уровня глутатиона в культуральной жидкости штаммов, был проведен анализ при помощи набора реактивов НТ Glutathione Assay Kit (Trevigen, Catalog #7511-100-K). В основу метода положена реакция сульфгидрильных групп GSH с DTNB (5,5'-дитиобис-2-нитробензойной кислотой, реагент Эллмана) с образованием 5-тио-2-нитробензойной кислоты (TNB) желтого цвета и смешанного дисульфида GSTNB (Пример 9).To determine the level of glutathione in the culture fluid of the strains, an analysis was carried out using the NT Glutathione Assay Kit (Trevigen, Catalog # 7511-100-K). The method is based on the reaction of GSH sulfhydryl groups with DTNB (5,5'-dithiobis-2-nitrobenzoic acid, Ellman's reagent) with the formation of yellow 5-thio-2-nitrobenzoic acid (TNB) and mixed GSTNB disulfide (Example 9).

Антагонистическое действие на бактериальные и дрожжевые тест-культуры выявляли методом агаровых слоев (Блинкова, 2003) на бактериальных тест-штаммах: S.aureus ATCC 25923, B.subtilis 534, E.coli ATCC 25922, Sh.sonnei I фазы 941, P.aeruginosa ATCC 9027, Salmonella enterica typhimurium 415, C.albicans ATCC 885-653. (Пример 10)Antagonistic effect on bacterial and yeast test cultures was detected by the method of agar layers (Blinkova, 2003) on bacterial test strains: S.aureus ATCC 25923, B.subtilis 534, E.coli ATCC 25922, Sh.sonnei I phase 941, P. aeruginosa ATCC 9027, Salmonella enterica typhimurium 415, C. albicans ATCC 885-653. (Example 10)

Штаммы L. brevis 47f и L. rhamnosus 313 проявили высокую антагонистическую активность по отношению к S.aureus, B.subtilis, Sh.sonnei, P.aeruginosa; среднюю - по отношению к S.enterica.Strains L. brevis 47f and L. rhamnosus 313 showed high antagonistic activity against S.aureus, B.subtilis, Sh.sonnei, P.aeruginosa; medium - in relation to S.enterica.

Штамм L. rhamnosus 40f проявил высокую антагонистическую активность по отношению к B.subtilis, Sh.sonnei,; среднюю - по отношению к S.enterica, P.aeruginosa, S.aureusThe strain L. rhamnosus 40f showed a high antagonistic activity against B. subtilis, Sh.sonnei ,; medium - in relation to S.enterica, P.aeruginosa, S.aureus

Устойчивость (чувствительность) к антибиотикам.Resistance (sensitivity) to antibiotics.

Штамм L.brevis 47f устойчив к канамицину, амикацину, полимиксину В, ванкомицину, стрептомицинуя, линкомицину, ампициллину; чувствителен к рифампицину, хлорамфениколу, азитромицину, олеандомицину, эритромицину, тетрациклину, неомицину, гентамицину.The strain L.brevis 47f is resistant to kanamycin, amikacin, polymyxin B, vancomycin, streptomycin, lincomycin, ampicillin; sensitive to rifampicin, chloramphenicol, azithromycin, oleandomycin, erythromycin, tetracycline, neomycin, gentamicin.

L.rhamnosus 313 устойчив к канамицину, неомицину, амикацину, полимиксину В, ванкомицину, стрептомицину; промежуточно устойчив к гентамицину; чувствителен к рифампицину, хлорамфениколу, азитромицину, олеандомицину, эритромицину, тетрациклину, линкомицину, ампициллину.L. rhamnosus 313 is resistant to kanamycin, neomycin, amikacin, polymyxin B, vancomycin, streptomycin; intermediate resistant to gentamicin; sensitive to rifampicin, chloramphenicol, azithromycin, oleandomycin, erythromycin, tetracycline, lincomycin, ampicillin.

Штамм L.rhamnosus40f устойчив к канамицину, неомицину, амикацину, полимиксину В, ванкомицину; чувствителен к рифампицину, хлорамфениколу, азитромицину, олеандомицину, эритромицину, тетрациклину, линкомицину, ампициллину, стрептомицину, гентамицину.The strain L. rhamnosus40f is resistant to kanamycin, neomycin, amikacin, polymyxin B, vancomycin; sensitive to rifampicin, chloramphenicol, azithromycin, oleandomycin, erythromycin, tetracycline, lincomycin, ampicillin, streptomycin, gentamicin.

У штаммов L.brevis 47f, L.rhamnosus 313 и L.rhamnosus 40f отсутствует ДНК-азная, РНК-азная и казеиназная активности.The strains of L. brevis 47f, L. rhamnosus 313, and L. rhamnosus 40f lack DNAase, RNAase, and caseinase activity.

Продукты, синтезируемые штаммами:Products synthesized by strains:

При выращивании в питательном бульоне MRS патентуемые штаммы синтезируют и секретируют в среду глутатион и комплекс антиоксидантов, обладающий высокой антиоксидантной и генопротекторной активностью.When grown in MRS nutrient broth, patentable strains synthesize and secrete glutathione and an antioxidant complex with high antioxidant and gene-protective activity on Wednesday.

Гены, кодирующие глутатион у патентуемых штаммовGenes encoding glutathione in patentable strains

У патентуемых штаммов было установлено наличие генов, кодирующих ферменты, ответственные за синтез, транспорт и восстановление окисленного глутатиона (γ-glutamylcystiene synthetase (GSHA), glutathione peroxidase (GPO), glutathione reductase (GSHR) и putative glutathione transport proteins (CydC и CydD)), отвечающие за пробиотические свойства штамма. (Пример 11).Patent strains have been found to have genes encoding enzymes responsible for the synthesis, transport, and reduction of oxidized glutathione (γ-glutamylcystiene synthetase (GSHA), glutathione peroxidase (GPO), glutathione reductase (GSHR) and putative glutathione transport proteins (CydC and CydD) ), responsible for the probiotic properties of the strain. (Example 11).

Позиции генов метаболизма глутатиона, определенных у штаммов L.brevis 47f., L.rhamnosus 313, L.rhamnosus 40f и L.brevis 15fa соответситвующих геномах приведены в табл. 9. (Пример 12).The positions of the glutathione metabolism genes determined in the strains L.brevis 47f., L. rhamnosus 313, L. rhamnosus 40f and L. brevis 15fa of the corresponding genomes are given in table. 9. (Example 12).

Таким образом, способность штаммов L.brevis 47f, L.rhamnosus 313, L.rhamnosus 40f и L.brevis 15f продуцировать глутатион, антагонистическая активность по отношению к патогенной и условно-патогенной микрофлоре, отсутствие протеазной и др. активностей делают возможным использование штаммов по отдельности и в составе различных смесей бактериальных штаммов при производстве функциональных продуктов питания и лекарственных средств в виде лиофилизированных препаратов, капсул, жидких культур и других аналогичных средств для сопровождения химио- и лучевой терапии онкологических заболеваний, для предотвращения дисбактериоза и воспалительных процессов кишечника. Штаммы отличны от всех описанных ранее штаммов L.brevis и L.rhamnosus, продуцирующих комплекс антиоксидантов в т.ч. глутатион, т.к. выделены из организма людей - жителей центрального региона Российской Федерации и имеют уникальную последовательность генов кодирующих глутатион, иThus, the ability of strains L.brevis 47f, L.rhamnosus 313, L.rhamnosus 40f and L.brevis 15f to produce glutathione, antagonistic activity against pathogenic and conditionally pathogenic microflora, the absence of protease and other activities make it possible to use strains according to individually and as part of various mixtures of bacterial strains in the production of functional foods and drugs in the form of lyophilized preparations, capsules, liquid cultures and other similar means to accompany chemo- and radiation therapy ologicheskih diseases, to prevent dysbiosis and intestinal inflammatory processes. The strains are different from all the previously described strains of L.brevis and L. rhamnosus, producing a complex of antioxidants including glutathione, as isolated from the body of people - residents of the central region of the Russian Federation and have a unique sequence of genes encoding glutathione, and

Примеры по характеристике получения и свойствам штамма L.brevis 47f, L.rhamnosus 313 и L.rhamnosus 40f по настоящему изобретению.Examples on the characteristics of the preparation and properties of the strain L.brevis 47f, L.rhamnosus 313 and L.rhamnosus 40f of the present invention.

Пример 1Example 1

Проверка коллекшии штаммов, при помощи биолюминесцентного анализа на основе рекомбинантных штаммов Е.coli,Verification of the collection of strains using bioluminescent analysis based on recombinant E. coli strains,

Figure 00000001
Figure 00000001

Пример 2Example 2

Базовые аннотации геномов штамма L.brevis 47f, L.rhamnosus 313 и L.rhamnosus 40f, депонированные в GenBankBasic annotations of the genomes of L. brevis 47f, L. rhamnosus 313 and L. rhamnosus 40f, deposited in GenBank

Figure 00000002
Figure 00000002

Figure 00000003
Figure 00000003

Пример 3Example 3

Определение видовой принадлежности штамма Lactobacillus brevis 47fDetermination of the species of strain Lactobacillus brevis 47f

1. Для определения вида по гену 16S РНК использовали стандартные праймеры 27f (AGAGTTTGATCCTGGCTCAG) и 1492r (GGTTACCTTGTTACGACTT) (Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley). Ген состоит из 1563 пн; определяли 500 пар нуклеотидов, с 46 по 595.1. Standard primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (GGTTACCTTGGTTACGACTT) (Lane, DJ 1991. 16S / 23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175) were used to determine the species from the 16S RNA gene. E. Stackebrandt & M. Goodfellow. Chichester: Wiley). The gene consists of 1563 bp; 500 nucleotide pairs were determined, from 46 to 595.

Figure 00000004
Figure 00000004

Figure 00000005
Figure 00000005

Результат однозначно свидетельствует о принадлежности штамма к виду L.brevis.The result clearly indicates that the strain belongs to the species L.brevis.

Пример 4Example 4

Определение видовой принадлежности штамма Lactobacillus rhamnosus 313.Determination of the species affiliation of the strain Lactobacillus rhamnosus 313.

1. Для определения вида по гену 16S РНК использовали стандартные праймеры 27f (AGAGTTTGATCCTGGCTCAG) и 1492r (GGTTACCTTGTTACGACTT) (Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley). Ген состоит из 1558 пн; определяли НП 1392 нуклеотидов, с 69 по 1460.1. Standard primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (GGTTACCTTGGTTACGACTT) (Lane, DJ 1991. 16S / 23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175) were used to determine the species from the 16S RNA gene. E. Stackebrandt & M. Goodfellow. Chichester: Wiley). The gene consists of 1558 bp; NP 1392 nucleotides were determined, from 69 to 1460.

Figure 00000006
Figure 00000007
Figure 00000006
Figure 00000007

Figure 00000008
Figure 00000008

Данный метод не позволяет отнести штамм 313 однозначно к одному из 4-х видов (L.rhamnosus, L.zeae, L.casei, L.paracasei).This method does not allow to assign strain 313 uniquely to one of 4 species (L. rhamnosus, L.zeae, L.casei, L.paracasei).

2. Помимо гена 16S рРНК мы используем в работе видоспецифические праймеры и НП межгенного района, предшествующего первому гену оперона F0F1 синтазы atpB (Полуэктова Е.У., Даниленко В.Н2. In addition to the 16S rRNA gene, we use species-specific primers and NPs of the intergenic region preceding the first gene of the operon F0F1 synthase atpB (Poluektova E.U., Danilenko V.N.

Патент Ru 2508406 "Метод видовой идентификации лактобацилл L.casei/paracasei, L.fermentum, L.plantarum, L.rhamnosus". 2012 г.). Величина этого района у L.rhamnosus составляет 298 пн. Праймеры для выделения данного участка ДНК:Patent Ru 2508406 "Method for the species identification of lactobacilli L.casei / paracasei, L.fermentum, L.plantarum, L.rhamnosus". 2012). The size of this region in L. rhamnosus is 298 bp. Primers for isolating a given DNA region:

Figure 00000009
Figure 00000009

Нуклеотидная последовательность фрагмента:The nucleotide sequence of the fragment:

Figure 00000010
Figure 00000010

Данная нуклеотидная последовательность имеет следующую идентичность с ДНК лактобацилл:This nucleotide sequence has the following identity with lactobacilli DNA:

С ДНК L.rhamnosusWith the DNA of L. rhamnosus 99-100%99-100% С ДНК L.zeaeWith L.zeae DNA ≤83%≤83% С ДНК L.caseiWith L.casei DNA ≤83%≤83% С ДНК L.paracaseiWith L.paracasei DNA ≤80%≤80%

Что свидетельствует о принадлежности штамма к виду L.rhamnosus.This indicates that the strain belongs to the species L. rhamnosus.

3. Кроме того, проведено типирование штамма по НП 8-ми генов «домашнего хозяйства» [parB, recG, isoleu, recA, leu, ychF (GTP-depending NA-binding protein), strC, spaC] и 3-м системам токсин-антитоксин, специфичным для вида L.rhmnosus (RelE1Lrh, RelBE3Lrh, PemK1-A1Lrh - Klimina et al., 2013. Identification and characterization of toxin-antitoxin systems in strains of Lactobacillus rhamnosus, isolated from humans. Anaerobe. № P. 1-8).3. In addition, the strain was typed using 8 genes of “household” [NPB, recG, isoleu, recA, leu, ychF (GTP-depending NA-binding protein), strC, spaC] and 3 toxin systems according to NP -antitoxin specific for the species L. rhmnosus (RelE1 Lrh , RelBE3 Lrh , PemK1-A1 Lrh - Klimina et al., 2013. Identification and characterization of toxin-antitoxin systems in strains of Lactobacillus rhamnosus, isolated from humans. Anaerobe. No. P . 1-8).

Пример 5Example 5

Определение видовой принадлежности штамма Lactobacillus rhamnosus 40f.Determination of the species affiliation of the strain Lactobacillus rhamnosus 40f.

1. Для определения вида по гену 16S РНК использовали стандартные праймеры 27f (AGAGTTTGATCCTGGCTCAG) и 1492r (GGTTACCTTGTTACGACTT) (Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley). Ген состоит из 1558 пн; определяли НП 800 нуклеотидов, с 44 по 843.1. Standard primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (GGTTACCTTGGTTACGACTT) (Lane, DJ 1991. 16S / 23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175) were used to determine the species from the 16S RNA gene. E. Stackebrandt & M. Goodfellow. Chichester: Wiley). The gene consists of 1558 bp; NP 800 nucleotides were determined, from 44 to 843.

Figure 00000011
Figure 00000012
Figure 00000011
Figure 00000012

2. Кроме того, проведено типирование штамма по 5-ти системам токсин-антитоксин, специфичным для вида L.rhamnosus (RelE1Lrh, RelBE3Lrh, PemK1-A1Lrh, PemK2-A2Lrh, YefM-YoeBLrh - Klimina et al., 2013. Identification and characterization of toxin-antitoxin systems in strains of Lactobacillus rhamnosus, isolated from humans. Anaerobe. № P. 1-8).2. In addition, the strain was typed using 5 toxin-antitoxin systems specific for the species L. rhamnosus (RelE1 Lrh , RelBE3 Lrh , PemK1-A1 Lrh , PemK2-A2 Lrh , YefM-YoeB Lrh - Klimina et al., 2013. Identification and characterization of toxin-antitoxin systems in strains of Lactobacillus rhamnosus, isolated from humans. Anaerobe. No. P. 1-8).

Пример 6Example 6

Определение видовой принадлежности штамма L.brevis 15fDetermination of the species affiliation of strain L.brevis 15f

Использовали стандартные праймеры 27f (AGAGTTTGATCCTGGCTCAG) и 1492r (GGTTACCTTGTTACGACTT); (Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley). Ген состоит из 1563 пн; определяли НП 500 пн (с 46 по 545).Used standard primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (GGTTACCTTGTTACGACTT); (Lane, D.J. 1991. 16S / 23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics, pp. 115-175. Edited by E. Stackebrandt & M. Goodfellow. Chichester: Wiley). The gene consists of 1563 bp; determined NP 500 bp (from 46 to 545).

Figure 00000013
Figure 00000013

Figure 00000014
Figure 00000014

Пример 7Example 7

Определение антиоксидантных свойств биолюминесцентным методом.Determination of antioxidant properties by the bioluminescent method.

Для работы нами были использованы 3 биосенсора на основе штамма E.coli K12:For work, we used 3 biosensors based on E. coli K12 strain:

MG1655 (pSoxS-lux), MG1655(pKatG-lux) и MG1655 (pColD-lux), несущие рекомбинантную плазмиду с lux-опероном люминесцирующей бактерии Photorhabdus luminescens, слитым с промоторами генов супероксидисмутазы SoxS, катазазы KatG и колицина ColD. Штаммы E.coli, несущие lux-оперон, под воздействием индукторов окислительного стресса или ДНК-повреждающих веществ начинают активно продуцировать люциферин-люциферазный комплекс, что приводит к повышению уровня биолюминесценции.MG1655 (pSoxS-lux), MG1655 (pKatG-lux) and MG1655 (pColD-lux) carrying a recombinant plasmid with the lux operon of the luminescent bacterium Photorhabdus luminescens fused to the promoters of the SoxS superoxide dismutase, KatD and colicin catazase genes. Strains of E. coli carrying a lux operon, under the influence of oxidative stress inducers or DNA damaging substances, begin to actively produce the luciferin-luciferase complex, which leads to an increase in the level of bioluminescence.

Для индукции окислительного стресса в биосенсорах E.coli MG1655(pKat-lux) и MG1655(pSox-lux), соответственно, использовали перекись водорода и паракват, который вызывает формирование в клетке супероксид-анион-радикала. Для индукции SOS-ответа в биосенсоре E.coli MG1655(pColD-lux) был использован антибактериальный ДНК-повреждающий агент диоксидин. В качестве контроля служили растворитель (вода или раствор ДМСО). Интенсивность биолюминесценции измеряли на микропланшетном люминометре Beckman coulter DTX880 при комнатной температуре и через определенные интервалы времени.To induce oxidative stress in E. coli biosensors MG1655 (pKat-lux) and MG1655 (pSox-lux), respectively, hydrogen peroxide and paraquat, which causes the formation of superoxide anion radical in the cell, were used. An antibacterial DNA-damaging agent dioxidin was used to induce the SOS response in the E. coli MG1655 biosensor (pColD-lux). A solvent (water or DMSO solution) served as a control. Bioluminescence intensity was measured on a Beckman coulter DTX880 microplate luminometer at room temperature and at specified time intervals.

Измерение уровня индуцированной люминесценции в присутствии образцов культуральных жидкостей (Iind/кж) проводили в сравнении с уровнем спонтанной люминесценции культуры (I0), индуцированной люминесценции (Iind) и индуцированной в присутствии стандартного антиоксиданта (Iind/AO).The level of induced luminescence in the presence of samples of culture fluids (I ind / kl ) was compared with the level of spontaneous luminescence of a culture (I 0 ), induced luminescence (I ind ) and induced in the presence of a standard antioxidant (I ind / AO ).

Вычисления и обработку экспериментальных данных проводили по формулам:Calculation and processing of experimental data was carried out according to the formulas:

Figure 00000015
Figure 00000015

иand

Figure 00000016
Figure 00000016

Где IКЖ% и IAO% - относительная эффективность культуральной жидкости и антиоксиданта соответственно.Where I QOL% and I AO% - the relative effectiveness of the culture fluid and antioxidant, respectively.

Пример 8Example 8

Определение антиоксидантных свойств: определение общего количества антиоксидантов в культуральной жидкостиDetermination of antioxidant properties: determination of the total amount of antioxidants in the culture fluid

Был проведен анализ при помощи набора Antioxidant Assay Kit (Sigma CS0790) для определения общего количества низкомолекулярных антиоксидантов. В основу метода положена реакция взаимодействия антиоксидантов с окрашенным метастабильным катион - радикалом 2,2'-азинобис (3-этил-бензотиазолин-6-сульфоновой кислоты) (ABTS+•).An analysis was performed using the Antioxidant Assay Kit (Sigma CS0790) to determine the total amount of low molecular weight antioxidants. The method is based on the reaction of the interaction of antioxidants with a colored metastable cation - the radical 2,2'-azinobis (3-ethyl-benzothiazolin-6-sulfonic acid) (ABTS + •).

Схему реакции можно представить следующим образом:The reaction scheme can be represented as follows:

Figure 00000017
Figure 00000017

Где HX-Fe(III) - метмиоглобин, •X-[Fe(IV)=O] - феррилмиоглобинWhere HX-Fe (III) is metmyoglobin, • X- [Fe (IV) = O] is ferrylmyoglobin

Для получения ABTS+• в режиме on-line использована реакция жидкофазного окисления диаммонийной соли 2,2'-азинобис(3-этил-бензотиазолин-6-сульфоновой кислоты). В качестве окислителя выступает радикал феррил-миоглобина, формирующийся из миоглобина и перекиси водорода. Полученный радикал окисляет ABTS с получением катион-радикала ABTS+•. Полученный катион-радикал имеет в структуре хромоген, обеспечивающий его зеленую окраску.To obtain ABTS + • in the on-line mode, the liquid-phase oxidation reaction of the diammonium salt of 2,2'-azinobis (3-ethyl-benzothiazolin-6-sulfonic acid) was used. The oxidizing agent is the ferryl-myoglobin radical, which is formed from myoglobin and hydrogen peroxide. The resulting radical oxidizes ABTS to give the ABTS + • radical cation. The resulting radical cation has a chromogen in its structure, which ensures its green color.

Количество ABTS+• определяли по поглощению при 405 нм. В качестве стандарта или контрольного антиоксиданта использовать тролокс - водорастворимый аналог витамина Е.The amount of ABTS + • was determined by absorbance at 405 nm. Use trolox, a water-soluble analogue of vitamin E, as a standard or control antioxidant.

Вычисление концентрации антиоксиданта относительно тролоксового стандарта (X, мМ) проводили по формуле:The calculation of the concentration of antioxidant relative to the trolox standard (X, mm) was carried out according to the formula:

Figure 00000018
Figure 00000018

Где Y(А405) - уровень абсорбции образца при 405 нмWhere Y (A 405 ) is the absorption level of the sample at 405 nm

Int - пересечение тролоксовой кривой с осью YInt - intersection of the trolox curve with the Y axis

Slope - наклон стандартной тролоксовой кривой;Slope - the slope of the standard trolox curve;

Df - суммарное разведение исходного образца до добавления в реакционную смесь в лунке.Df - total dilution of the original sample before adding to the reaction mixture in the well.

Пример 9Example 9

Определение антиоксидантных свойств: определение общего количества глутатиона в культуральной жидкостиDetermination of antioxidant properties: determination of the total amount of glutathione in the culture fluid

Для определения уровня глутатиона в культуральной жидкости штаммов, был проведен анализ при помощи набора НТ Glutathione Assay Kit (Trevigen, Catalog # 7511-100-K). В основу метода положена реакция сульфгидрильных групп GSH с DTNB (5,5'-дитиобис-2-нитробензойной кислотой, реагент Эллмана) с образованием 5-тио-2-нитробензойной кислоты (TNB) желтого цвета и смешанного дисульфида GSTNB. Глутатионредуктаза уменьшает концентрацию окисленного глутатиона за счет его восстановления, а накопление смешанного дисульфида GSTNB мешает глутатионредуктазе рециркулировать глутатион и производить больше TNB. Скорость TNB производства прямо пропорционально этому процессу переработки, которые, в свою очередь прямо пропорционально концентрации глутатиона в образце (Рис. 1). Измерение оптической плотности раствора при 405 или 414 нм обеспечивает точную оценку глутатиона в образце.To determine the level of glutathione in the culture fluid of the strains, analysis was performed using the Glutathione Assay Kit (Trevigen, Catalog # 7511-100-K). The method is based on the reaction of GSH sulfhydryl groups with DTNB (5,5'-dithiobis-2-nitrobenzoic acid, Ellman's reagent) to form yellow 5-thio-2-nitrobenzoic acid (TNB) and mixed GSTNB disulfide. Glutathione reductase reduces the concentration of oxidized glutathione due to its reduction, and the accumulation of mixed GSTNB disulfide prevents glutathione reductase from recycling glutathione and producing more TNB. The rate of TNB production is directly proportional to this processing process, which in turn is directly proportional to the concentration of glutathione in the sample (Fig. 1). Measurement of the optical density of the solution at 405 or 414 nm provides an accurate estimate of glutathione in the sample.

Пример 10Example 10

Определение антагонистической активности штаммов.Determination of antagonistic activity of strains.

Антагонистическую активность определяли при помощи модификации метода отсроченного антагонизма в агаре (Muriana Р.М., Klaenhammer Т.R. 1987. Conjugal transfer of plasmid-encoded determinants for bacteriocin production and immunity in Lactabacillus acidophilus 88. Appl. Environ. Microbiol. 53, 553-560). Для этого на поверхность плотной питательной среды MRS-агар бактериологической петлей бляшками с диаметром 15 мм засевали 24 часовые культуры лактобактерий и культивировали 24 часа при 37°С в анаэробных условиях. После культивирования круглым металлическим пробойником с диаметром 16 мм удаляли фрагмент агара с выросшими бактериями. Затем на подготовленные таким образом чашки наносили 5,5 мл расплавленной и остуженной до 50°С полужидкой (0,5% агара) среды Columbia agar, в которую предварительно вносили 0,1 мл суточной культуры индикаторного штамма. После 18-часовой инкубации при 37°С измеряли величину зон задержки роста от края удаленной бляшки до края роста индикаторных штаммов. Исследования по определению антагонистической активности по отношению к индикаторным штаммам микроорганизмов повторяли три раза. Из полученных данных вычисляли среднюю величину. Полученные результаты представлены в таблице 7.Antagonistic activity was determined by modifying the method of delayed agar agonism (Muriana R.M., Klaenhammer T.R. 1987. Conjugal transfer of plasmid-encoded determinants for bacteriocin production and immunity in Lactabacillus acidophilus 88. Appl. Environ. Microbiol. 53, 553-560). For this, 24 hour cultures of lactobacilli were seeded onto the surface of a dense nutrient medium MRS agar with a bacteriological loop with plaques with a diameter of 15 mm and cultured for 24 hours at 37 ° C under anaerobic conditions. After cultivation with a round metal punch with a diameter of 16 mm, an agar fragment with grown bacteria was removed. Then, 5.5 ml of molten and cooled to 50 ° C semi-liquid (0.5% agar) Columbia agar medium was applied onto the plates thus prepared, into which 0.1 ml of the daily culture of the indicator strain was previously added. After an 18-hour incubation at 37 ° C, the size of growth inhibition zones was measured from the edge of the removed plaque to the growth edge of indicator strains. Studies to determine antagonistic activity against indicator strains of microorganisms were repeated three times. From the obtained data, the average value was calculated. The results are presented in table 7.

Figure 00000019
Figure 00000019

Степень антагонизма определяли по следующим критериям:The degree of antagonism was determined by the following criteria:

10 мм и менее - низкая,10 mm or less - low

10-20 мм - средняя,10-20 mm - medium

21 мм и более - высокая.21 mm and more - high.

Р - резистентность.P is resistance.

Пример 11Example 11

Гены, кодирующие глутатион у патентуемых штаммов и их положение в геноме.Genes encoding glutathione in patentable strains and their position in the genome.

Figure 00000020
Figure 00000020

Figure 00000021
Figure 00000021

Пример 12Example 12

Нуклеотидная последовательность генов gpo и gshR/gor метаболизма глутатиона у штаммов L.brevis 47f, L.rhamnosus 40f, L.rhamnosus 313 и L.brevis 15f.The nucleotide sequence of the gpo and gshR / gor genes of glutathione metabolism in strains L.brevis 47f, L.rhamnosus 40f, L.rhamnosus 313 and L.brevis 15f.

Figure 00000022
Figure 00000022

Figure 00000023
Figure 00000023

Figure 00000024
Figure 00000024

Figure 00000025
Figure 00000025

Figure 00000026
Figure 00000026

Figure 00000027
Figure 00000027

Claims (4)

1. Штамм Lactobacillus brevis 47f ВКПМ № В-12237, способный к синтезу антиоксиданта глутатиона и обладающий пробиотическими свойствами.1. The strain Lactobacillus brevis 47f VKPM No. B-12237, capable of synthesizing the antioxidant glutathione and having probiotic properties. 2. Штамм Lactobacillus rhamnosus 313 ВКПМ № В-12236, способный к синтезу антиоксиданта глутатиона и обладающий пробиотическими свойствами.2. Strain Lactobacillus rhamnosus 313 VKPM No. B-12236, capable of synthesizing the antioxidant glutathione and having probiotic properties. 3. Штамм Lactobacillus rhamnosus 40f ВКПМ № В-12238, способный к синтезу антиоксиданта глутатиона и обладающий пробиотическими свойствами.3. The strain Lactobacillus rhamnosus 40f VKPM No. B-12238, capable of synthesizing the antioxidant glutathione and having probiotic properties. 4. Штамм Lactobacillus brevis 15f ВКПМ № В-12077, способный к синтезу антиоксиданта глутатиона и обладающий пробиотическими свойствами.4. The strain Lactobacillus brevis 15f VKPM No. B-12077, capable of synthesizing the antioxidant glutathione and having probiotic properties.
RU2015150244A 2015-11-24 2015-11-24 Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex RU2617946C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2015150244A RU2617946C1 (en) 2015-11-24 2015-11-24 Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2015150244A RU2617946C1 (en) 2015-11-24 2015-11-24 Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex

Publications (1)

Publication Number Publication Date
RU2617946C1 true RU2617946C1 (en) 2017-04-28

Family

ID=58697518

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2015150244A RU2617946C1 (en) 2015-11-24 2015-11-24 Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex

Country Status (1)

Country Link
RU (1) RU2617946C1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115927106A (en) * 2022-12-16 2023-04-07 南方医科大学南方医院 Rhamnose cheese bacillus DY801 and application thereof
RU2800992C1 (en) * 2019-10-29 2023-08-01 СиДжей ЧеилДжеданг Корпорейшн Glutathione-producing yeast strain and a method of producing glutathione using the same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2190015C1 (en) * 2001-04-27 2002-09-27 Закрытое акционерное общество "Партнер" Strain lactobacillus brevis ba-13 used for probiotic preparations and foodstuffs preparing
RU2453591C1 (en) * 2011-04-21 2012-06-20 Общество с ограниченной ответственностью "Бифилюкс" Strain lactobacillus rhamnosus used for making lactic acid bacillus containing products
US20130171117A1 (en) * 2010-01-08 2013-07-04 Gianfranco Grompone Lactobacilli with Anti-Oxidant Action
CN103343107A (en) * 2013-07-23 2013-10-09 扬州大学 Human lactobacillus casei gr x 12 with antioxidant function and application thereof
US20140065116A1 (en) * 2011-03-17 2014-03-06 Giovanni Mogna Probiotic bacteria having antioxidant activity and use thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2190015C1 (en) * 2001-04-27 2002-09-27 Закрытое акционерное общество "Партнер" Strain lactobacillus brevis ba-13 used for probiotic preparations and foodstuffs preparing
US20130171117A1 (en) * 2010-01-08 2013-07-04 Gianfranco Grompone Lactobacilli with Anti-Oxidant Action
US20140065116A1 (en) * 2011-03-17 2014-03-06 Giovanni Mogna Probiotic bacteria having antioxidant activity and use thereof
RU2453591C1 (en) * 2011-04-21 2012-06-20 Общество с ограниченной ответственностью "Бифилюкс" Strain lactobacillus rhamnosus used for making lactic acid bacillus containing products
CN103343107A (en) * 2013-07-23 2013-10-09 扬州大学 Human lactobacillus casei gr x 12 with antioxidant function and application thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2800992C1 (en) * 2019-10-29 2023-08-01 СиДжей ЧеилДжеданг Корпорейшн Glutathione-producing yeast strain and a method of producing glutathione using the same
CN115927106A (en) * 2022-12-16 2023-04-07 南方医科大学南方医院 Rhamnose cheese bacillus DY801 and application thereof
CN115927106B (en) * 2022-12-16 2023-09-08 南方医科大学南方医院 Lactobacillus rhamnosus DY801 and application thereof

Similar Documents

Publication Publication Date Title
Baccouri et al. Probiotic potential and safety evaluation of Enterococcus faecalis OB14 and OB15, isolated from traditional tunisian testouri cheese and rigouta, using physiological and genomic analysis
Strompfová et al. Enterococcus faecium EK13—an enterocin A-producing strain with probiotic character and its effect in piglets
Salazar et al. Safety and intestinal microbiota modulation by the exopolysaccharide-producing strains Bifidobacterium animalis IPLA R1 and Bifidobacterium longum IPLA E44 orally administered to Wistar rats
EP1789531B1 (en) Lactobacillus rhamnosus with body-fat reducing activity and the foods containing them
Kaur et al. Lactic acid bacteria isolated from yak milk show probiotic potential
WO2006025643A1 (en) Lactobacillus plantarum with body-fat reducing activity and the foods containing them
BR112012011315B1 (en) Formulation comprising probiotic bifidobacteria strain
Gupta et al. Probiotic potential of bacteriocin-producing Enterococcus hirae strain LD3 isolated from dosa batter
AU2020103929A4 (en) Bacillus coagulans strain BACO-17 with high germination rate in the intestines and its uses for promoting gastrointestinal health
CN109069552A (en) For treating the bifidobacterium longum of obesity and associated metabolic disease
JP7399400B2 (en) A composition for suppressing trypsin activity containing bacteria belonging to the genus Paraprevotella as an active ingredient
Osmanagaoglu et al. Immunomodulatory function and in vivo properties of Pediococcus pentosaceus OZF, a promising probiotic strain
Rezaei et al. Isolation of lactic acid probiotic strains from Iranian camel milk: technological and antioxidant properties
van Bokhorst‐van de Veen et al. Genotypic adaptations associated with prolonged persistence of Lactobacillus plantarum in the murine digestive tract
SE526711C2 (en) Novel strains of Bifidobacterium having ability to survive in intestinal tract and produce glutamine and arginine in vivo, useful for preparing medicament for treatment of intensive care patients with intestinal failure
KR20030077895A (en) Lactobacillus plantarum isolated from kimchi with inhibiting activities on helicobacter pylori
CN113337440A (en) Lactobacillus salivarius MG-587 and application thereof
RU2617946C1 (en) Lactobacillus brevis and lactobacillus rhamnosus strains with established genomic sequency synthesizing glutathion and intracellular antioxidants complex
CN112877231A (en) Lactic acid bacteria with bacteriostatic and antioxidant activity and application thereof
Denou et al. A Mesocosm of Lactobacillus johnsonii, Bifidobacterium longum, and Escherichia coli in the mouse gut
Raj et al. Genomic and metabolic properties of Staphylococcus gallinarum FCW1 MCC4687 isolated from naturally fermented coconut water towards GRAS assessment
KR100523256B1 (en) Novel acid tolerant probiotic lactobacillus acidophilus Probio-40 with probiotic activities
RU2616899C1 (en) Anti-inflammatory pharmaceutical compositions based on bacterial strain
Costa et al. Probiotics: the effects on human health and current prospects
KR20020011953A (en) Lactic acid bacteria with inhibiting activities on helicobacter pylori

Legal Events

Date Code Title Description
MM4A The patent is invalid due to non-payment of fees

Effective date: 20201125