KR19990087571A - Downregulation Resistant C3 Convertase - Google Patents

Abstract

Natural complement pathway proteins were modified to form down-regulation resistant C3 convertases. Preferably the modified protein is a modified human C3 protein. DNA sequences encoding such proteins are also provided with the DNA constructs. Conjugates comprising such proteins and specific binding moieties such as antibodies are also described, and the therapeutic use of such proteins and / or conjugates is also described.

Description

Downregulation Resistant C3 Convertase

The present invention provides novel modified proteins capable of forming C3 convertases resistant to down-regulation, DNA sequences encoding such proteins and their use as therapeutics, in particular complement pathway proteins or It relates to the use in depleting the level of targeted complement attack (C3b deposition) at a specific location.

The complement system functions in the immune response of humans and other vertebrates and is important in effector functions such as phagocytosis, cytolysis, and cellular recruitment that induces local inflammatory responses [15]. ]. This property is desirable for sweeping invasive pathogens, such as bacteria, but can be induced against host tissues (eg, in posterior fever reperfusion injury [3]) or against external therapeutic agents (eg, hypersensitivity rejection of xenografts). It is not desirable when it works. In order to eliminate these undesirable properties, attempts have been made to develop derivatives of complement regulatory proteins that have the function of originally inhibiting complement activation.

The complement system consists of proteins in cell surface proteins (receptors and regulators) and fluid phases (plasma and other extracellular environments). A crucially important step in the reaction is the conversion of C3 to proteolytic hydrolysis to fragments C3b and C3a. C3a is a type of anaphylatoxin that, like C5a, attacks mast cells to the attack site, causing local secretion of histamine, vasodilation and other inflammatory effects. Early C3b has the ability to bind to a surface around its production site. This C3b then concentrates on attack by the cytolytic complement component (C5-C9).

C3b and its degradation products bound to the surface also function as ligands of the C3 receptor, for example to mediate phagocytosis [15]. There are two different pathways for the complement activation pathway that convert C3 to C3b and cause subsequent reactions. Classical pathways are generally induced by complexes of antibodies that bind antigens and then trigger enzymatic steps involving C1q, C1r, C1s, C2, C4 proteins. The alternative pathway involves C3 itself and relies on an activation loop requiring factors B and D.

When converted from C3 to C3b (or C3i), the product binds to factor B resulting in C3bB (or C3iB). The complex is activated by factor D to produce C3bBb, which is a C3 convertase that can cleave more C3 into C3b, resulting in more C3bBb and more C3 conversion. In certain circumstances, the C3bBb complex binds to and stabilizes a positive modulator properdine (P). However, such positive-feedback loops are generally limited to slow cycles by regulatory proteins, mainly Factor H and Factor I.

Factor H (and its structurally related cell binding molecules) acts as a cofactor for Factor I, which (i) replaces B and Bb from C3b, and (ii) cleaves C3b into iC3b, thereby factor B converting C3 convertases. Interfere with recombination to prevent further formation. When this pathway becomes intense (“fired”), the production of C3b is amplified in the presence of surfaces such as many bacterial cell walls that bind early C3b and interfere with its regulation by factors H and I. Early C3b may also bind to endogenous cells. Thus, endogenous cell surfaces normally exposed to complement are further protected by membrane binding modulators such as MCP, DAF, CR1, etc., which originally act in a similar manner as Factor H.

There are some rare spontaneous states in which normal fluid bed regulation cannot occur, so that spontaneous C3 conversion ultimately leads to overall depletion of C3 from the circulatory system (i) genetic defects of factor H or I [13], (ii) the presence of antibodies that bind C3bBb and interfere with dissociation (nephritis factor) [4], (iii) contact with a protein called cobra venom factor (CVF) in cobra venom (this protein binds to factor B To form a C3 convertase enzyme that does not contain C3b and is not affected by factors H and I). They illustrate the general physiological significance of the downregulation of complement when complement is not specifically activated.

In addition, even if specifically activated, this may be unnecessary. Specifically, the host tissue (for example, ischemia or surgically damaged tissue) or a foreign substance deliberately injected for therapeutic purposes (xenografts, artificial organs, dialysis membranes, etc.) This is the case when activated on. Such complement activation results in unnecessary attacks and further damage, in which case it would be beneficial to block or inhibit complement activation and response.

Existing attempts to prevent complement-mediated damage have focused on inhibiting complement activation using down-regulatory proteins (CR1, MCP, DAF, Factor H and I). Complement inhibitors such as factor I, factor H and soluble derivatives of the membrane binding proteins CR1, DAF, MCP inhibit the fluidized bed amplification loop of the second pathway. Thus, attempts have been made to reduce complement mediated damage in physiological context models using these molecules, particularly CR1 (presumably the most potent) [10,18].

Since Factor H is endogenous and is present in the plasma at high concentrations (0.3-0.5 mg / ml is typical [15]), even though it increases the amount of inhibitors and thus attenuates the fluidized-phase reaction, the purified Large amounts of protein must be administered in vivo (eg, soluble CR1 can be administered in excess of 5 mg / Kg body weight). In addition, the second pathway is activated by a surface that has already blocked the influence of factor H. This does not necessarily reduce the activity of other inhibitors at the same time, whereas the same factors mean that they cannot be perfectly or universally effective.

Cobra venom factor (CVF) is characterized by producing stable C3 convertase, which is used for experimental depletion of complement in animal in vivo and other in vitro samples (eg, human plasma). Can be. CVF is potent (eg, 40 μg / kg can destroy the complement activity of mice [16]). However, there are disadvantages that are not suitable for therapeutic use in humans.

First, CVF is obtained from cobra venom (a source difficult to handle and dangerous to handle) and therefore must be carefully purified from venom neurotoxins. It is also very difficult to find a source. This problem cannot be easily overcome by cloning and expressing the gene ex vivo, because post-translational modifications (specific proteolytic processing) occurring in snakes are difficult to reproduce in vitro or It may be impossible. In addition, the enzyme and digestion conditions required for this processing are currently unknown. Second, because this protein is foreign (to humans), it is immunogenic. This is an obstacle to using this protein for repeat treatment if it is necessary to deplete complement from the patient over several weeks (eg to enable xenograft surgery).

Although CVF has some structural and functional homology with human C3 [17], there are also important differences for both (eg, chain structure, biosynthesis site, insensitivity to complement regulators, formation of stable C3 convertases, etc.). ). CVF is not derived from the C3 equivalent of Cobra, which is known and already cloned and sequenced and resembles human C3 more closely than CVF in overall structure and function [8].

CVF is a venom specific product of an animal that is far from evolution in homo sapiens. Therefore, it is not practical to transform this protein into a product that can be used to prevent immune responses in humans through genetic engineering.

We have devised another strategy to superactivate the system instead of inhibiting complement activation by bypassing physiological control. This can be applied in two ways. First, one or more components can be used to activate complement in vivo until one or more components are exhausted and eventually lose the ability to cause a local response to any subsequent challenge (such as xenografts). Second, deliberately unregulated overactivation can be concentrated on specific targets (such as virus or virus infected cells) to increase the sensitivity of the target to complement mediated disruptive responses.

The term "modulator of complement activation" is used herein to encompass all proteins that inhibit the amplification of C3 convertases, but the gene is not limited to proteins that are placed in the RCA gene position. It does not, however, include "up-regulators" such as propferdin. "C3 conversion" is defined as C3 is converted by proteolysis of C3b and C3a unless otherwise indicated, and "C3 convertase (or simply convertase)" refers to an enzyme that catalyzes this reaction (typically Is defined as a complex of two or more protein components, such as C3bBb, C3iBb, CVFBb or C4b2a.

Thus, in a first aspect, the present invention provides natural complement pathway proteins that are modified to form down-regulated resistant C3 convertases.

"Native" means naturally occurring, that is, it can be obtained in its natural state. Thus, this definition encompasses all naturally occurring complement pathway proteins modified as defined above. It is not limited to species specific proteins. In other words, the modified human protein may be used as a downregulation resistant C3 convertase, for example in other mammalian species. Typically modified complement pathway proteins obtained from homologous will be used.

For example, modification of the C3 DNA coding sequence, such as by positional mutagenesis, maintains positive functional properties (cutting to C3b by C3 convertase) and complete structure (with the correct chain structure, and thioester bonds), while C3 variants resistant to complement regulatory proteins can be obtained. The invention described herein relates to genetically engineered forms of natural complement proteins, eg, human C3, whose C3b fragments acquire properties that are resistant to physiological complement regulation. Because of this resistance, these molecules can produce a stabilized form of the corresponding C3 convertase that amplifies the C3 to C3b conversion in the physiological environment (eg in vivo), and later to produce degradation products.

In a preferred embodiment, the invention provides a modified human C3 protein that is resistant to cleavage of factor I.

This can be obtained by modifying the residues of the protein at the proteolytic site.

Particularly preferred embodiments of the present invention are directed to human C3 proteins which have been modified by replacing Arg-1303, Arg-1320 or both with other amino acids. Other amino acids may be tyrosine, cystine, tryptophan, glutamine, glutamic acid or glycine. Arg-1303 is preferably substituted by glutamic acid or glycine (less preferably glutamine). Arg-1320 is preferably substituted with glutamine.

Other strategies for producing suitable modified proteins of the present invention include the following.

(i) reduced sensitivity to the inhibitory action of Factor H and related proteins (eg, MCP, DAF, CR1). For example, in human C3 residues 767-776 and 1209-1271 are involved in factor H binding [20, 24], and one or more of these regulatory proteins is substituted if one or more of these or other residues involved in the action of these proteins are substituted. The above combination may be reduced.

(ii) reduction of dissociation rate of C3bBb. Mutations can be made to enhance the interaction between C3b and Bb. This will not only reduce the natural degradation rate of the enzyme but also reduce the efficacy of Factor H (and related modulators) in replacing Bb from C3b.

Such mutations preferably reduce the rate of both spontaneous degradation and degradation of C3bBb mediated by factor H. Even in the absence of factor H, the half-life of the fluidized bed C3bBb complex is only 10 minutes at 37 ° C. in the presence of properdine [6].

(iii) Human C3 residues 752-761 are involved in binding to factor B. This is a well conserved region in C3, and closely related sequences are found in C4. Because C4 binds to Factor B homolog C2, the strong similarity between C3 and C4 to this region and its high retention at C3 further support its function within C3 as the factor B binding site. Thus, changing this region can affect B affinity and stability of C3bBb.

(iv) Resistance to other modulators of complement activation, such as CR1, DAF, MCP and the like, will also be desirable. Both modes of action of these modulators are similar to factor H, so no further mutagenesis will be necessary. Similarly, some pathogenic organisms express their own complement activation inhibitors that are structurally and functionally homologous to Factor H (eg, vaccinia virus secreting peptides). These molecules protect the intruders from immune responses and it would be advantageous to be able to attack the intruders with targeted C3 convertase enzymes that are resistant to these defenses.

(v) mutations that increase the stabilization of C3 convertase by propperdine. The activity of properdin is to stabilize the C3bBb complex, delaying spontaneous dissociation and factor H dependent dissociation. Although this stabilization is not effective in the fluidized bed, it is presumed to be very important in amplifying this process once initiated on a suitable activation surface [5]. Increasing its activity (by increasing affinity) can disrupt the balance in the fluidized bed and promote spontaneous C3 conversion. This will be particularly useful when combined with the other variations described above.

(vi) mutations that prevent C3bBb from having C5 convertase activity. When used to deplete active C3 in the circulation, an unwanted side effect that can be caused is the production of large amounts of anaphylactic peptides. The most powerful of these is C5a, which is cleaved from C5 by some C3 convertase enzymes. This response depends on the affinity of the convertase for another molecule of C3b [11] and can also be inhibited by mutations to C3 that eliminate this interaction.

(vii) improving the activity of C3 convertases. The active site of the C3bBb C3 convertase enzyme is in the Bb moiety. It is presumed that the C3b component probably functions to allow Bb to maintain active conformation and / or to bind and orient with the substrate to be activated by Bb. This has not been revealed, but in any case there is room to enhance the activity of the convertase through mutation of C3.

(viii) expression in functional form. Wild species C3 must be converted to C3b before binding to the new C3 convertase complex. The need for conversion to C3b (or C3i) when used in vivo will delay the action of modified C3. Therefore, it would be desirable to administer the protein in a form capable of immediate convertase formation or to administer the preformed convertase complex. As such, it would be advantageous to produce C3b-like reactants functionally in vitro. This can be achieved in vitro (eg, protein hydrolysis).

(ix) Modifications of natural proteins that introduce new cleavage sites that can only specifically remove the sites necessary for factor H conjugates while maintaining the peptide sites necessary for factor B binding. For example, a cleavage site can be introduced so that a C3b-like form of modified C3 can be further cleaved into a form that is still less bound to inactivation by Factors H and I while still binding to Factor B.

(x) Modifications at other sites that may affect factor B and / or factor H and C3b interactions.

The present invention is based on reversing the traditional approach by promoting C3 conversion to deplete C3 and neutralize complement systems. Further application of the present invention may facilitate the complement dependent effector mechanisms that attack specific targets by promoting C3 conversion at specific locations.

Thus, the ultimate effect would be to increase the amount of C3 conversion when the modified protein is administered to a physiological medium (eg blood) containing a modulator of complement activation. This activity may soon deplete the natural C3 of the medium or position the C3 conversion at the desired target.

If the C3b fragment binds factor B to a C3 analog that is resistant to the action of factor I (derived as described in Example 1), factor B will be cleaved by factor D and dissociate into substantially activated form. In the absence of inactivation by factor I, the modified C3b will be able to bind to new molecules of factor B repeatedly to facilitate its inactivation. Another potential application of the modifications described herein will be inactivation of the second pathway by consumption of factor B activity. Using a similar approach to modifying C4 to facilitate the consumption of C2 would defeat the classical pathway of complement activation.

The present invention encompasses any other protease used in a manner similar to the C3bBb enzyme cleaved from C3 to C3b despite the presence of complement activation modulators.

The invention also encompasses DNA sequences encoding the proteins of the invention and DNA constructs comprising such DNA sequences.

"DNA sequence" encompasses all other nucleic acid sequences that encode a given amino acid sequence or all nucleic acid sequences substantially homologous to this sequence due to the degeneracy of the gene codon. These sequences are therefore included within the scope of the present invention.

Nucleic acid sequences that are “substantially homologous” are also within the scope of the present invention. "Substantial homology" can be assessed at the nucleic acid level or at the amino acid level. Sequences with substantial homology at the nucleic acid level can be considered to hybridize to the nucleic acid sequences of the present invention in stringent conditions (eg, about 0.9 M salt solution, 35-65 ° C.). At the amino acid level, one protein can be considered substantially homologous if it shows homology to a number of constituent amino acids with another protein. At least 55%, 60%, 70%, 80%, 90% or even 99% (in increasing order of preference) of amino acids may be homologous.

As disclosed above, the proteins of the present invention can be used to obtain local complement activation effects. One way to reliably achieve this is to conjugate the protein to the moiety that will bind to the desired target. Thus, in another aspect the invention provides a conjugate comprising a protein of the invention bound to a specific binding moiety, for example a specific binding protein. Examples of such proteins would be antibodies or antigen binding fragments thereof.

Proteins of the invention are for administration to a patient to induce a desired therapeutic effect. The present invention therefore also

(a) a protein of the invention for use in therapy,

(b) the use of a protein or conjugate of the invention in the manufacture of a medicament for use in depleting the amount of complement pathway protein, in particular for inhibiting rejection of foreign substances,

(c) a pharmaceutical formulation containing one or more proteins or conjugates of the invention together with one or more pharmaceutically acceptable carriers and / or excipients,

(d) The present invention provides a method of reducing the complement pathway protein in a mammal comprising administering the protein to the mammal, preferably in the form of a pharmaceutical formulation.

Pharmaceutical formulations may be presented in unit dose form containing a predetermined amount of active ingredient per dose. One such unit may contain a minimum amount, for example 1 mg of the active ingredient, preferably 2-3 mg. The maximum amount that can be contained in such a unit dose will vary depending on the condition being treated, the route of administration, the age, weight, condition and economic considerations of the patient. For example, unit dosage forms may contain as much as 10 mg or even 100 mg of active ingredient.

Proteins of the invention can be used in vivo to neutralize the complement system. The situation where this is necessary is as follows.

(a) to inhibit complement mediated destruction or damage to implants, in particular xenografts (grafted from other species of animals), especially mismatched xenografts (when there is a mismatch between the donor and the recipient); Occation. The recipient must be depleted of complement before surgery and be able to remain in this state until the implant is adapted or replaced with a more suitable organ.

Initial treatment can be done within a few days prior to transplantation. Additional complement depletion may be needed in the event of a denial crisis. This treatment can be performed using antihistamines to modulate a general inflammatory response (eg vasodilation) that may result from the production of C3a and / or C5a.

Complement depletion may also be beneficial when using artificial organs or tissues that activate the complement system (eg, artificial kidney dialysis membranes). As noted above, the protein may be provided in an inactivated form, functionally in a C3b like form or as a preformed active C3 convertase (such as C3bBb). They can be administered by any route (eg, intravenous, subcutaneous, etc.) that allows the active convertase to encounter circulating C3.

Alternatively alternatively, ex vivo treatments are possible, for example incorporating into the circulation via a matrix containing active convertase. This has the advantage of removing anaphylactic peptides (C3a and C5a) and other low molecular weight inflammatory mediators (eg histamine and nitric oxide) before returning complement depleted blood (or plasma) to the patient.

(b) to inhibit complement mediated damage arising from major surgery. The patient should preferably deplete complement before (but if necessary after surgery), as described above, and will remain in this state until the risk of further internal damage due to complement dependent immune attacks is reduced.

(c) To reduce complement mediated damage resulting from nonsurgical damage. In this case complement depletion should be performed after the initial injury, but the formulation and method of administration will be similar to those described above unless otherwise indicated. This may be particularly useful when recovery involves reperfusion of ischemic tissue by the circulatory system (eg myocardial ischemia, alumni, burns, etc.).

(d) To minimize complement mediated damage resulting from antibody-antigen interactions. Complement-mediated defense responses are particularly undesirable in autoimmune diseases such as glomerulonephritis, hemolytic anemia, asthma, paralysis of type I diabetes, rheumatoid arthritis and multiple sclerosis. Disabling the complement system in severe conditions of the disease can improve the condition, for example by topical administration to the joints in rheumatoid arthritis.

(e) to make certain pathogenic targets more sensitive to complement mediated immune mechanisms. In this approach, the aim is not to use a hyperactive C3 convertase that depletes C3 as a whole, but rather to focus the C3 convertase locally on the desired target instead of using the convertase. The target may be a pathogenic organism such as a bacterium, virus or other parasite or harmful host cell or tissue such as tumor cell or virus infected cell or the like. C3 convertases can be targeted by topical administration (eg, direct injection into a medium that slows their dispersion into the general circulation) or by binding to targeting sites such as antibodies. Thus, the modified protein may be through chemical crosslinking of the protein, or by linking DNA coding sequences and expressing (and purifying) the fusion protein (eg, in the case of IgG, the heavy and light chains may be attached to C3 or Two chains can be bound within one complete fusion polypeptide, or a specific coding sequence (eg, a "leucine zipper" type domain) is added to both fusion partners (eg, modified C3 and specific antibodies). By introducing into the DNA of), the expressed products, when mixed with each other, form a stable conjugate through self-bonding. The fusion protein can then be administered locally or in the general circulation.

Liposomes (containing antibodies on a surface with or with modified proteins on or within liposomes) and / or byrons (eg genetically modified to express proteins on their surfaces) are also concomitant with antibodies and modified proteins. Can be used for transport. This strategy can be used directly or in combination with other treatments at any stage of the disease. After surgical removal of the tumor, it may be particularly suitable for use in removing any cancer cells remaining in the circulatory system. Antibody modified protein conjugates may also be used ex vivo to remove pathogenic tissue. For example, this is the case for killing leukaemic cells from the extracted bone marrow to return the remaining healthy cells to the patient.

Also, lymphocytes that do not match the recipient's MHC form may be removed from the bone marrow prior to transplantation. Modified proteins can also be linked to antigens, and such combinations can also be used in vivo or ex vivo to attack lymphocytes with undesirable reactivity (eg, on implants or self tissues).

The same technique can be applied to the treatment of other species using human modified protein derivatives or similar analogs designed for other species.

Preferred features of each aspect of the invention are different aspects with the necessary modifications being made to each.

The present invention will now be described through the following examples. However, this example should not be considered as limiting the invention in any way. Embodiments are described with reference to the accompanying drawings.

1 shows the putative protein sequence of human C3 encoded in PC3 (using the standard one letter amino acid code).

2 shows the cDNA sequence of PC3 (using the standard one letter deoxynucleotide code for sense strand 5′-3 ′).

Figure 3 is a visual of the modified protein of the present invention.

4 shows the effect of factor I treatment cleavage of various mutations on human C3 replacing Arg 1303 or Arg 1320.

N.B.

1. [35S] -biosynthetic label sample

2. Reactions performed at normal ionic strength

3. Immunoprecipitation Using Anti-C3

4. SDS-PAGE in the reduced state

5. Magnetic radioactivity picture

5 shows that by mutating Arg 1303 to Gln 1303, the resistance of human C3 to inactivation by Factors I and H is improved.

6 shows the results of analysis of cleavage of C3 convertases mutated at amino acid residues 752-754 and 758-760.

It was electrophoresed with nitrocellulose, then probed with positive anti-human C3 antibody, horseradish peroxidase coupling anti-sheep immunoglobulin antibody and enhanced ChemiLuminescence (Amersham, UK). Method and detection reagents), followed by Western blot photographs developed from a 7.5% polyacrylamide SDS-PAGE gel (reduced state), taken with an X-ray film. Cleavage reaction and detection procedures were performed as described in Example 4 with reference to the results shown in FIG. 3.

Important note:

Tracks 1-4: Wild type C3 (expressed in COS cells)

Track 5-8: Mutant C3 (residues 752-754 changed to Gly-Ser-Gly, residues 758-760 changed to Gly-Ser-Gly) (expressed in COS cells)

Track 1,5: nothing added

Track 2,6: + CVFBb

Track 3, 7: + factor H + I

Track 4,8: + CVFBb + Factor H + I

The bands indicated by the arrows are as follows.

A: C3 α-chain

B: C3 α'-chain

C: C3 β chain

D: 68 kDa cleavage product of the C3 α'-chain

E: IgG heavy chain

Figure 7 shows the analysis of the cleavage of radiolabeled factor B with factor D in the presence of wild type and mutant C3 (C3i).

The magnetic radiograph of the SDS-PAGE gel is shown. All samples contained Factor D and ¹²⁵ I-labeled Factor B and were incubated at 37 ° C. for 3 hours.

Samples of each number track contained the following contents:

1.Buffer only

1/125 wild type C3

3. 1/25 wild type C3

4. 1/5 Wild C3

5. 1/25 mutant C3 (residues 1427 Gln, 1431 Asp and 1433 Gln)

6. 1/5 Mutant C3

7. Undiluted Mutant C3

The bands indicated by the arrows are as follows.

A. Uncleaved ¹²⁵ I-labeled Factor B (93 kDa)

B. 60 kDa Cleavage Product ("Bb")

C. 33 kDa Cleavage Product ("Ba")

FIG. 8 shows SDS-PAGE studies showing conjugate formation between C3i and IgG.

This is the result of Coomasie staining with a 4% acrylamide SDS-PAGE gel run in a non-reduced state. Each numbered track contains the following samples.

1.PDP-IgG

2. C3i

3. PDP-IgG + C3i Reaction Mixture

The bands marked with arrows mean the following:

A: Probably the C3i-IgG conjugate (350 kDa).

B: C3i (200 kDa)

C: IgG (150 kDa)

9 shows that the conjugate targets C3 convertase activity against both erythrocytes.

This graph is coded with dilutions of C3i-IgG conjugates, PDP-IgG or C3i, as described in the experimental method, followed by washing and finally in CFD / EDTA after production of C3 convertase with propepdin and Factors B and D. Show the rate of lysis of both red blood cells, lysed with NGPS. Only the conjugates cause dissolution, which dissolution depends on the dose.

10 and 11 show cleavage properties of DV-1AM mutant C3 (see Examples 12-14)

With reference to FIG. 10, COS cell supernatants containing the expressed wild type (A) and DV-1AM mutations (B) are: 1)-, 2) CVFBb, 3) 10 μg / ml factor I and 50 μg / ml factor H, or 4) treated with CVFBb + 10 μg / ml factor I and 50 μg / ml factor H, immunoprecipitated, analyzed by SDS-PAGE (in each lane indicated), and as described in Example 4. Electroblotting with nitrocellulose. In this case, this blot is a combination of murine monoclonal antibodies, clone-3 and clone-9, which reacts with the C3dg site of C3 and its fragmentation product (Lachmann, PJ et al., J. Immunol., 41: 503 (1980)) After developing using horseradish peroxidase-coupled anti-rat immunoglobulin (Sigma) in turn, it was detected using the procedure provided by ECL reagent and Amersham.

In connection with FIG. 11, COS cell supernatants containing the expressed DV-1B mutant (A), wild type (B) and DV-6 mutant (C) C3 were subjected to 1)-, 2) 10 μg / ml factor I and 50 μg / ml factor H, 3) CVFBb, 4) CVFBb + 10 μg / ml factor I and 2 μg / ml factor H, 5) CVFBb + 10 μg / ml factor I and 10 μg / ml factor H, 6) CVFBb + 10 μg / ml Factor I and 50 μg / ml Factor H, immunoprecipitated, analyzed by SDS-PAGE (in each lane indicated), electroblotted onto nitrocellulose, polyclonal sheep anti-C3 The antibody was used to detect as described in Example 4.

12 shows the results of analysis of C3-related products caused by frame shift mutations. This product is named HDV-3X. The results for HDV-3X were compared with the results for unmodified DV-3, which, unlike HDV-3X, included the mutations T1031G, E1032N, Q1033H, E1035N and K1036I, like HDV-3X.

COS cell supernatants containing the expressed DV-3 (A) and HDV-3X mutant (B) C3 were subjected to 1)-, 2) CVFBb + 10 μg / ml factor I, 3) CVFBb + 10 μg / ml factor I + 1 μg / ml Factor H, 4) CVFBb + 10 μg / ml Factor I + 5 μg / ml Factor H, 5) CVFBb + 10 μg / ml Factor I + 25 μg / ml Factor H, immunoprecipitation And analyzed by SDS-PAGE (in each lane indicated) and electroblotted onto nitrocellulose as described in Example 4. In this case, this blot is a combination of murine monoclonal antibodies, clone-3 and clone-9, which reacts with the C3dg site of C3 and its fragmentation product (Lachmann, PJ et al., J. Immunol., 41: 503 (1980)) After developing using horseradish peroxidase-coupled anti-rat immunoglobulin (Sigma) in turn, it was detected using the procedure provided by ECL reagent and Amersham.

FIG. 13 shows COS cell supernatants containing expressed E1Q2 (A), E1Q2QG3 (B) and E1Q2E3 (C) mutant C3: 1) CVFBb + 10 μg / ml factor I, 2) CVFBb + 10 μg / ml factor I +50 μg / ml factor H, 3) CVFBb + 10 μg / ml factor I + 25 μg / ml sCR1 for 2.5 hours at 37 ° C., immunoprecipitate and analyze by SDS-PAGE (in each lane indicated) And electroblotting onto nitrocellulose phase as described in Example 4. In this case, this blot consists of a combination of murine monoclonal antibodies, clone-3 and clone-9 as described in Example 12 followed by horseradish peroxidase-coupled anti rat immunoglobulin (Sigma) After development, the solution was detected using the ECL reagent and the procedure provided by Amersham.

The 86 kDa band (arrow) is the product of factor I mediated cleavage at the third position with no preceding cleavage at position 1 or 2.

Figure 14 COS containing expressed NC3 (A), FT-1 (B), FT-2 (C), FT-3 (D), FT-4 (E) and FT-5 (F) mutant C3 Cell supernatants were treated with 1)-, 2) CVFBb + 10 μg / ml factor + 50 μg / ml factor H for 2.5 hours at 37 ° C., immunoprecipitated and analyzed by SDS-PAGE (in each lane indicated) And electroblotting onto nitrocellulose phase as described in Example 4. This blot was developed using a combination of murine monoclonal antibodies, clone-3 and clone-9 as described in Example 12 followed by horseradish peroxidase-coupled anti rat immunoglobulin (Sigma), Detection was made using the ECL reagent and the procedure provided by Amersham.

Figure 15 COS containing expressed NC3 (A), FR-1 (B), FR-2 (C), FR-3 (D), FR-4 (E) and FT-2 (F) mutant C3. Cell supernatants were treated with 1)-, 2) CVFBb + 10 μg / ml factor + 50 μg / ml factor H for 2.5 hours at 37 ° C., immunoprecipitated and analyzed by SDS-PAGE (in each lane indicated) And electroblotting onto nitrocellulose phase as described in Example 4. This blot was developed using a combination of murine monoclonal antibodies, clone-3 and clone-9 as described in Example 12 followed by horseradish peroxidase-coupled anti rat immunoglobulin (Sigma), Detection was made using the ECL reagent and the procedure provided by Amersham.

To facilitate understanding of the relationship, the relationship between specific proteins and examples and tables and claims that can act as down-regulated resistant C3 convertases is shown in the table below.

Claims Site of the amino acid sequence (relative to human C3 convertase) that is considered important for downregulation resistance Example table 5-8 1303/1320 1-6, 11 9-11 758-780 / 752-754 7 12 1427, 1431, 1433 8 I 13-15 992-1005 12, 13 II 16-19 1152-1155 14 II 20-29 1546-1663 15, 17 III 30-34 954-955 16

The following standard methods and definitions are applicable to all embodiments.

All the complement constituents mentioned are from human unless otherwise indicated and use standard nomenclature for all proteins and fragments derived from them (for example, described in Ref. [15]). The term "C3i" also refers to all molecular forms that have no intact thiolester bonds but retain C3a polypeptide on the α chain.

Human C3 cDNA and coding sequences are numbered as shown in FIG. 2 using the numbering system (derived from Ref. [2]) used in the EMBL nucleotide database. The sequence shown is that of our construct ('PC3'), which lacks the first 11 nucleotides of the 5 'untranslated region as documented in Ref. [2], with a first base of 12. Presumed initiation codons are nucleotides 61-63, codons for β chain amino terminal serine residues are nucleotides 127-129 and codons for amino terminal serine residues of the α chain are nucleotides 2074-2076.

Protein sequences are numbered according to the precursor sequences shown in FIG. 1, which are presumed translations of the DNA sequence of Appendix 1 (amino acids 1-22 are signal sequences that are removed during biosynthesis, amino acid 668 -671 is expected to be removed when the precursor is cleaved into alpha and beta chains).

The following abbreviations have the meaning in parentheses. CVF (cobra venom factor), ELISA (enzyme-linked immunosorbent assay), E. coli (Escherichia coli, E. coli), kb (kilobase); HSV-1 (herpes simplex virus type 1), PBS (phosphate buffered saline), COS-1 are cell lines derived from monkey kidney cells. Af1II, DraI, DraIII, EcoRI, EcoRV, HindIII, NaeI, NheI, XbaI are restriction enzymes.

Standard way

Methods for standard molecular biology procedures such as plasmid isolation, agarose gel electrophoresis and DNA ligation can be found in Ref. [2]. Double stranded DNA was sequenced using the "Sequenase version 2.0" kit from United States Biochemicals. C3 expression was measured by ELISA assay in which a culture supernatant sample was added thereto using a plastic plate precoated with affinity purified polyclonal sheep anti-human C3. Binding C3 was detected with monoclonal murine antibodies against C3 conjugated to alkaline phosphatase, color induced substrate, p-nitrophenol phosphate.

Methods of purifying complement proteins and CVFs and methods of preparing affinity purified anti-C3 antibodies used in assays are described in Ref. [28]. Equivalent reactants can be purchased from Sigma Chemical company LTD.

C3 cDNA coding sequence

Our C3 cDNA coding sequence was constructed from two segments isolated from a random-primed human liver cDNA library retained in vector pGEM4 (promega product). Five oligodeoxynucleotides corresponding to known segments in the human C3 coding sequence were radiolabeled with T4 polynucleotide kinase and [γ-32P] ATP and used to probe filter transport of the library from agarose plates. Two clones containing about 4 kb of insert were isolated. Through restriction enzyme digestion, hybridization to specific oligonucleotide probes, partial sequencing, one of these ('A13') contains the 5'-end of the 5.1 kb message, while the other ('B44') is 3 ' -Extended to the end.

Thus, these inserts were overlaid on the order of 3 kb containing the unique EcoRI restriction enzyme site. The incomplete 5 'compartment of A13 was replaced with complete segments isolated from B44 cut with EcoRI and NheI and cut with EcoRI and XbaI. Two pieces were purified by gel electrophoresis with low melting agarose and then ligated with T4 ligase to generate a vector ('PGC3') containing 5.1 kb of DNA encoding the entire C3 precursor protein.

The linker sequence 5 'for the C3 coding region contained two ATGs that were potentially error translation initiation sites. Thus, they used a oligodeoxynucleotide PL-ATC-3 (TAGGGAGACC GGAAGCTTGC CCTCTCCCTC TGTCCCTCTG T) with a deletion of about 50 bp of linker / adapter DNA, as described in Example 1, with a gapped plasmid mutation. Removed in a provoking way The 7.7 kb of this mutated vector containing 5.1 kb of C3 DNA sequence and 2.6 kb of pGEM4 vector (promega) sequence is named PC3.

Fully sequencing the C3 coding region of the PGC3 plasmid revealed only four differences from the previously published human C3 ("S" allele) cDNA sequence [2].

(i) Changes from C2481 to G and C2805 to T do not change the coding.

(ii) T1001 → C encodes the previously described HAV 4-1- (leucine314 → proline) polymorph [20].

(iii) G2716 → A encodes valine 886 → isoleucine, where Ile is found at this position in mouse and rat C3, but has not been previously reported in human C3.

Since our sequences include initiation and termination codons, signal sequences, they encode functional C3.

The amount of wild type C3 expressed in the culture supernatants of COS-1 cells (transfected using lipofectamine and pcDNA3 (Invitrogen) expression vector) was detected to be less than 1.7 μg / ml via ELISA. C3 could not be detected at all by cells transfected with the pcDNA3 vector alone. In addition, after the cleavage reaction analysis by immunoprecipitation SDS-PAGE and immunoblotting,

(i) the primary translation product was correctly processed in full two-chain form,

(ii) this product could be cleaved to C3b by C3 convertase (CVFBb) like native C3,

(iii) The expressed protein was not cleaved by factor H + I like natural C3, but was demonstrated to be cleavable after conversion to C3b by the C3 convertase enzyme. This confirmed that our starting plasmid could be translated into functional C3.

For a further description of the construction and expression of C3 coding sequences see reference [25].

<Example 1>

Production of C3 with arginine residues replaced with glutamine residues at both factor I cleavage sites (amino acid positions 1303 and 1320) to prevent cleavage of the C3b fragment by factor I

a) mutagenesis

Oligonucleotide-induced mutations used deoxynucleotides were QRI1 (CAACTGCCCAGCCAAAGCTCCAAGATCACC), QRI2 (GCCAGCCTCCTGCAATCAGAAGAGACCAAG), and AFL4149 (TAATAAATTCGACCTTAAGGTCACCATAAAAC) and the corresponding anti-sense oligo deoxynucleotides QRIln (GGTGATCTTGGAGCTTTGGCTGGGCAGTTG), QRI2n (CTTGGTCTCTTCTGATTGCAGGAGGCTGGC) and AFL4149n (GTTTTATGGTGACCTTAAGGTCGAATTTATTA) to.

QRIl and QRIln designate the substitution of arginine with glutamine at amino acid residue 1303 (by replacing G3968C3969 with AA in the cDNA sequence) at amino acid residue 1303 in the C3 precursor sequence, and QRI2 and QRI2n are amino acid residue 1320 at the factor cleavage position Performs the same substitution in (nucleotide G4019 is replaced with A).

AFL4149 and AFL4149n introduce a cleavage site of the restriction endonuclease AflII at position 4149 in the cDNA sequence without changing the encoded amino acid sequence (replace C4149 with T). These two primers were used as markers to confirm successful mutagenesis based on cleavage of the DNA product by AflII.

Mutagenesis was performed using the "poor plasmid" method. One batch of uridine-rich PGC3 ('UPGC3') was prepared by propagating E. coli strain CJ236 in the presence of 0.25 μg / ml uridine instead of thymidine. This plasmid was digested with SmaI and 7.2 kb product ('US1') was purified by agarose gel to remove the 0.5 kb fragment (residues 1463-1947) from the C3 sequence. Other components of the tight plasmid ('DN2') were prepared by digesting PGC3 with DraIII and NaeI and purifying 5.1 kb fragments twice with agarose gel electrophoresis. 200 ng DN2 was mixed in approximately 500 ng US1 with 50 μl H ₂ O, heated to 100 ° C., and slowly cooled down below 50 ° C., followed by 2 × T7 buffer (100 mM Tris / HCl / pH 7.4 / 14 mM MgCl ₂ , 20 μl to 25 μl of 100 mM NaCl, 2 mM dithiothreitol, 1 mM of ATP, dATP, dCTP, dTTP, dGTP, respectively, and 5′-phosphorylated mutagenic primers (QRI1, QRI2 and AFL4149 in one reaction) 10 nmol) was added in other reactions using QRIln, QRI2n and AFL4149n). The mixture was reheated to 70 ° C. for 5 minutes and slowly cooled to 20 ° C. (over 30-60 minutes). 10 units of T7 DNA polymerase and 80 units of T4 DNA ligase were added at 0 ° C. The mixture (50 μl total volume) was first incubated for 5 minutes at 0 ° C., then for 5 minutes at room temperature and finally at 37 ° C. for 3 hours. 1 μl of each mixture was used to transform 100 μl of super water soluble supercompetent XLl Escherichia coli (Stratagene) according to the manufacturer's instructions.

Ampicillin resistant colonies were screened for AFlII cleavage, successful mutants were propagated in 100 ml cultures, plasmids isolated from and sequenced (sequencing primers C3pa-3876, CTTCATGGTGTTCCAAGCCT, nucleotides 3876-3895 of C3 cDNA) Paired) Mutations were identified at the factor I cleavage site.

For another protocol of "poor plasmid" mutagenesis, see references [26, 27].

b) transfer of the mutant DNA to a eukaryotic expression vector

Mutant plasmids were digested with HindIII and NaeI to digest C3 coding fragments. DraI was also used to neutralize the remaining plasmids. C3 coding sequences were purified on agarose gels and linearized with HindIII and EcoRV enzymes and then ligated into pcDNA3 vector (Invitrogen) dephosphorylated with bovine intestinal phosphorylase. The ligation mixture was used to transform the supersoluble XL1 Escherichia coli and then plated in a culture plate containing ampicillin.

Ampicillin resistant colonies were randomly selected (3 or 4) to grow in 2-3 ml cultures and plasmid DNA was isolated on a small scale. Plasmids containing the correct inserts were determined by digesting the plasmid DNA with restriction endonucleases EcoRI, HindIII and AflII. Corresponding colonies were incubated in 100 ml culture and plasmids were purified according to standard procedures. Since these mutants were originally constructed from PCG3, there are two ATGs at 5 'of the coding site. Thus, this site (and 5 ′ 3 kb of C3 coding sequence) was cut with HindIII and EcoRI, and the same segment cut from PC3 was ligated and replaced. These rebuilt vectors were purified through standard procedures and used for transfection of COS cells.

c) expression of wild type and mutant C3

Mutations and wild type C3 were transiently expressed from plasmids transfected with COS-1 cells using lipofectamine® (Gibco), according to the manufacturer's instructions. Typically, 1-1.5 × 10 ⁵ cells per well of a standard 6 well culture plate were transfected with plasmid 2-4 μg using 9 μl lipofectamine reagent. Supernatants were analyzed for C3 secretion and typical yields per ml of supernatant were obtained at 0.3-1.7 μg after 3-6 days of transfection.

result

a) generation of mutants

The following mutations, named according to the mutagenic oligodeoxynucleotide sequence introduced, have been isolated to date.

(i) QRI1 and QRI2 mutations plus three mutations with AFL4149: C3M-26, C3M-58 and C3M-61

(ii) 1 mutation with QRI1 and QRI2 but without AFL4149: C3M-8

(iii) 1 mutation with QRI2 and AFL4149 but without QRI1: C3M-51 (used in Example 3)

b) demonstrating that the functional effect is due to a mutation introduced specifically at the factor I cleavage site

Sequencing confirmed that there were no other variations at 178-350 bases around the mutated site of each mutant. The sequence of one mutant, C3M-51 (see Example 3), produced by this procedure was analyzed throughout the entire 'gap' (2463-5067) used for mutagenesis, with no other modifications from the wild-type sequence. Not found.

Representative sequencing of a total of 2922 bases from all mutants revealed no single point mutations that may have been caused by polymerase-mediated errors. The expressed mutations all exhibited a two-chain structure and cleavage by C3 convertase, which is characteristic of native C3. In summary, the mutations used would not have been completely resequenced but would not contain any unwanted changes.

<Example 2>

Production of C3 with arginine residues replaced with glutamine residues at one factor I cleavage site (amino acid position 1303)

The procedure of Example 1 was followed except that mutagenic oligodeoxynucleotides AFL4149 + QRI1 or AFL4149n + QRIln (ie not QRI2 or QRI2n) were used for mutagenesis.

result

a) mutant obtained

Two mutants C3M-I23, 27 with QRI1 and AFL4149 but without QRI2 were isolated. Mutant C3M-I23 was expressed as described in Example 1.

This protein could be cleaved by CVFBb. The C3b like product was relatively resistant (as compared to the wild type) to cleavage at position 1303 by Factors I and H, but could still be cleaved at position 1320. This C3b derivative is therefore partially resistant to factor I.

<Example 3>

Production of C3 with arginine residues replaced with glutamine residues at one factor I cleavage position (amino acid position 1320)

The procedure of Example 1 was followed except that mutagenic oligodeoxynucleotides AFL4149 + QRI2 or AFL4149n + QRI2n (ie not QRI1 or QRIln) were used for mutagenesis. In addition, the method used in Example 1 gave one mutant with QRI2 and AFL4149 but without QRI1.

result

a) mutations obtained

Three mutants C3M-51, C3M-Q2, C3M-Q13 with QRI2 and AFL4149 but without QRI1 were isolated. Mutant C3M-51 was expressed as described in Example 1. This protein could be cleaved by CVFBb. The C3b like product was relatively resistant (compared to the wild type) to cleavage at position 1320 by Factors I and H, but could still be cleaved at position 1303. This C3b derivative is therefore partially resistant to factor I.

<Example 4>

Analysis of the functional impact of the mutation

Supernatants (100-400 μl) obtained from the transfected COS cells were incubated with COS cells transfected with pcDNA3 with the following inserts at 37 ° C. for 2 hours.

1) Unmutated C3 Sequence

2) Mutant C3M-I23 (coding Arg ¹³⁰³ → Gln)

3) Mutant C3M-26 (Arg ¹³⁰³ → Gln, Arg ¹³²⁰ → Gln)

4) Mutant C3M-51 (Arg ¹³²⁰ → Gln)

Three hundred days after transfection, 200 μl of the culture supernatant was pretreated with 2 mM phenylmethanesulfonyl fluoride (0 ° C., 15 min) and then incubated at 37 ° C. for 2 hours with the addition of the following.

A) no addition

B) Preformed C3 convertase, CVFBb (10 μL taken from CVFBb (phosphate buffered saline containing 10 mM MgCl ₂ ) (PBS), 6.6 μg CVF, 100 μg Factor B, 200 μl containing Factor D 1.4 μg, for 15 minutes Preincubation at 37 ° C.)

C) Factor H (5 μg) and Factor I (1 μg)

D) CVFBb + Factors H and I

Next, add 0.6 µg of the affinity-purified sheep anti-human C3 immunoglobulin at room temperature and after 1 hour 20 µl of a 5% suspension of formalin-fixed group C streptococcal species cells (protein G) (from Sigma) Addition was immunoprecipitated. After 45 minutes the particles were washed once with PBS, 5 mM NaN ₃ at room temperature, washed once with 20 mM Tris / HCl, 137 mM NaCl, 0.1% (v / v) Tween 20, pH 7.6, then 1%. Eluted with SDS / 2% 2-mercaptoethanol (90-100 ° C., 5 min). These eluates were separated by SDS-PAGE, electroblotted onto nitrocellulose, affinity-purified sheep anti-human C3 immunoglobulin and horseradish peroxidase-coupled donkey anti-sheep immunoglobulin ( Sigma) were used in turn to probe the C3 band and detected using "Enhanced Chemiluminescence" provided by Amersham. Photographs were obtained for 2 minutes with an X-ray film. Visible C3-derived bands are indicated by labeled arrows and individual samples (1-4, AD) are described. The prominent band (about 50 kDa (between 46 and 68 kDa bands) present in all samples) is the heavy chain of IgG used for immunoprecipitation and is detected by horseradish peroxidase-coupled donkey anti-sheep immunoglobulin do.)

Result (see Figure 3)

1. All untreated samples (1-A, 2-A, 3-A, 4-A) contain bands of precise mobility for the α and β chains of C3, which means that all mutations have been expressed and correctly translated after translation. It means that it is processed. The presence of a 43 or 46 kDa band in these samples indicates the presence of some factor H + factor I-like activity in the culture medium. Spontaneous hydrolysis of C3 during the 3-day biosynthesis period produces C3i cleaved by this activity. In non-mutant C3 this produced 43 kDa and 75 kDa (the 75 kDa band was not visible because (i) it was hidden by the 75 kDa β chain, and (ii) the antibody used to develop the Western blot was C3 α chain). Since there is little activity towards this portion of the gene, its presence was later confirmed by reprobing with a mouse monoclonal antibody "clone-3" specific for this region). Addition of factors H and I without CVFBb (1-C, 2-C, 3-C, 4-C) did not cleave the remaining C3, indicating that it represents active C3 (undamaged thiol ester) .

2. Nonmutant C3 (1) is cleaved by CVFBb, and the C3b product is further cleaved at 1-B by endogenous enzymes or at 1-D by added factors H and I. 43 kDa band means cut at Arg ¹³²⁰ , 68 kDa band (visible at long exposure) indicates cleavage at Arg ¹³⁰³ .

3. Mutant C3M-I23 (Arg ¹³⁰³ → Gln) can be cleaved by CVFBb, the product of which is relatively resistant to endogenous factor H and I like activity (2-B), α 'chain (C3b) Different amounts were maintained, but could still be cleaved when more factors H and I were added (2-D). The 43 kDa product indicates cleavage at Arg ¹³²⁰ (a light band of 71 kDa representing another fragment of the α 'chain could be observed when exposed further) and there was no 68 kDa band, indicating that the mutation was mutated Gln ¹³⁰³ shows resistance to cleavage.

4. Mutant C3M-26 (Arg ¹³⁰³ → Gln, Arg ¹³²⁰ → Gln) could be cleaved by CVFBb and C3b-like product (α ′) was resistant to endogenous factor H and I-like activity (3 -B). It was also very resistant to additional factors H and I (3-D) when compared to nonmutant C3 (1) and other mutations (2 and 4). There was a small amount of 46 kDa product in the mutated Gln ¹³⁰³ indicating some cleavage (68 kDa fragments involved could be seen with longer exposure). Little or no 43 kDa corresponding to cleavage at Gln ¹³²⁰ could be detected.

Thus, the Arg → Gln mutation at position 1303 is less effective at 1320 in interfering with cleavage by Factor I (this slower remaining cleavage may occur at mutant C3M-I23 (Arg ¹³⁰³ → Gln)). However, the 46 kDa intermediate can be rapidly processed to 43 kDa by further cleavage in non-mutated Arg ¹³²⁰ .

5. Mutant C3M-51 (Arg ¹³²⁰ → Gln) could be cleaved by CVFBb, the product was cleaved by endogenous factor H and I-like activity (4-B), further factor H and I ( Cleaved by 4-D). The 46 kDa product (and light 68 kDa band) indicates cleavage at Arg ¹³⁰³ . However, the absence of the 43 kDa band means not cleaved at the mutated Gln ¹³²⁰ .

Example 5

Comparison of Various Amino Acid Substitutions at Position 1303

1. Introduction

The above examples described that Arg ¹³⁰³ and Arg ¹³²⁰ were mutated to glutamine residues. Both of these mutations confer resistance to cleavage at that position by Factor I. However, cleavage at Gln ¹³⁰³ was small but detectable. Therefore, it was substituted and tested with many different amino acids at this position. Cleavage occurs with decreasing efficacy in the order that residue 1303 is Arg>Tyr> [Cys or Trp]>Gln> [Glu or Gly]. This result was unexpected because it would be inferred that the enzyme requires arginine because (i) all known naturally occurring human factor I-mediated cleavage occurs at the C-terminus of the arginine residues, and (ii) If cleaved at residues, it can be predicted that they should be electrostatically similar to Arg, i.e., basic residues (Lys or His) (eg trypsin selectively cleaves the C-terminus of Arg, Lys or His), thus tyrosine substitution The cleavage of could not be predicted.

Thus, substitution of Arg 1303 via glycine or glutamic acid is suitable for the purpose of making C3 derivatives resistant to inactivation by factor I.

2. Experiment Method

2.1 Mutagenicity: The synonymous mutagenic primers used were CAACTGCCCAGC (GT) (AG) (CG) AGCTCCAAGATCACC (letters in parentheses indicate mixing of bases at that position). Mutations can be determined by the tight-plasmid method (described in the preceding examples) or by the "megaprimer method" (V. Picard et al., Nuc. Acid. Res. 22: 2587-91 (1994)). Wherein the upstream primer was CACCAGGAACTGAATCTAGATGTCCCTC and the downstream primer was GTTTTATGGTGACCTTAAGGTCGAATTTATTA. All mutations are performed using a template wherein the C3-encoding DNA is already mutated so that amino acid residue 1320 is glutamine and the restriction position of AflII is introduced at position 4149 (as described in the preceding example) and confirmed by DNA sequencing. did.

2.2 Expression: Mutants were expressed in COS cells in serum-free medium using pcDNA3 vectors biosynthetic labeled with [ ³⁵ S] methionine as described in the previous examples.

2.3 Analysis: The supernatants were treated with CVFBb (produced by the reaction of Factors B and D with CVF in magnesium containing buffer) and Factors H and I, followed by immunoprecipitation with anti-C3 (as described in the preceding examples). , SDS-polyacrylamide gel electrophoresis was carried out under reducing conditions to separate. The gels were fixed and treated with Amersham's "Amplify" reagent, dried and exposed to autoradiograph films to yield the results as shown in the figure.

3. Results

Without cleavage at position 1320 (position 2) (which position is mutated to glutamine), factor I-mediated cleavage at position 1303 (position 1) results in bands of 46 and 68 kDa. It can be seen that cleavage occurs in the order Arg (R)> Tyr (Y)> Cys (C) and Trp (W)> Gln (Q)> Gly (G) and Glu (E). Wild-type (arginine in both positions) is cleaved at both positions to produce 43 (too small to be visible in this gel) and 68 kDa fragments.

4. Drawings

The results are shown in FIG. The residues at position 1 (position 1303) and position 2 (position 1320) are indicated above each track.

<Example 6>

Demonstration of Increased Resistance to Inactivation by Factors I and H After Arg1303 Mutated to Gln

1. Introduction

The preceding example demonstrated that the conversion of Arg1303 or Arg1320 to glutamine is resistant to cleavage of Factor I at that location. Mutations in both positions make the molecule resistant to cleavage at both positions. Here we further demonstrated that Arg1303 alone (without mutations in Arg1320) with Gln causes significant resistance to functional inactivation by factors I and H when compared to wild type.

2. How to

2.1 Expression: Preparation of the Arg1303 → Gln mutations is as described in the previous examples. It was transfected into the CHO (common laboratory cell line derived from Chinese hamster ovary cells) by the calcium phosphate method, and stable transformants were selected based on resistance to G418 ("Geneticin", Sigma). The cell culture supernatants are collected and the expressed C3 is sodium sulfate precipitation (10-20% (w / v) fraction), and ion exchange chromatography on Q-Sepharose and mono-Q-Sepharose (AW Dodds Methods Enzymol 223: 46 (1993)).

2.2 Analysis: Positive red blood cells were coated with SO16 monoclonal antibodies (RA Harrison and PJ Lachmann Handbook of Experimental Immunology, 4th edition 39 (1986)), and 4.4 ml of a 5% (v / v) suspension was approximately 10 μg of C2. , Incubated for 10 min at 37 ° C. in CFD (RA Harrison and PJ Lachmann, supra) with 24 μg C4, 1 μg C1 (purified human component). 0.8 ml of this mixture was then incubated for 105 minutes with a semi-purified mutant or 0.25 ml containing wild type C3 and EDTA at a final concentration of 12.5 mM. Cells were then washed in CFD and used in CFD containing 0.1% (w / v) gelatin (CFD-gel). Radioligand binding using [ ¹²⁵ I] -labeled clone 4 monoclonal anti-C3 antibody was used to confirm that similar amounts of wild type or mutant C3b were deposited.

For analysis, 40 μl of a 5% suspension of cells was diluted with 250 μl of CFD-gel, and 50 μl aliquots contained dilutions containing Factor I and H at final concentrations of 100, 10, 1, 0 μg / ml, respectively. Incubate with 50 μl of CFD-gel at 37 ° C. for 30 minutes. 0.9 ml of CFD was then added and the cells were pelleted by centrifugation and washed twice with 1 ml of CFD. Cells were then resuspended in 100 μl of CFD-gel containing 100 μg / ml Factor B, 100 μg / ml Properdine, 1 μg / ml Factor D and 0.3 mM NiCl ₂ . After 10 minutes at 37 ° C., 0.9 ml of CFD containing 10 mM EDTA and 2% (v / v) normal pig-guig-serum was added. After 30 more minutes at 37 ° C., the unlyzed cells were pelleted by centrifugation and the lysis rate was determined by measuring the absorbance of the supernatant at 412 nm. Absorbance equivalent to 100% lysis was determined from cell fractions lysed in water, thus calculating the percent lysis.

This assay measures the ability of deposited C3b to form functional C3bBbP convertases. Conversion to iC3b interferes with convertase production and subsequent lysis in serum / EDTA.

3. Results

The results in the figures indicate that at least 10-fold factors I and H are required to discard the hemolytic activity of the Arg1303 → Gln mutant compared to the wild type. Thus, this mutation is advantageous for preparing derivatives of C3 where the C3b product is resistant to inactivation by factors H and I. This effect may be due to increased resistance to cleavage at position 1303 (when Arg is mutated to Gln), or to greater resistance to cleavage at position 1320 if cleavage may occur first at position 1303. Can be.

4. Drawing

The results are shown in FIG. X-axis indicates the concentration of factors H and I. Q1 represents an Arg1303 → Gln mutation. Dissolution rate (%) is measured as described in the above method.

debate

The essential features of human C3 in connection with the modified variants described above are as follows.

(i) The molecule is functionally similar to C3b in that it can bind to human factor B, which is functionally active, and then factor B can be cleaved by human factor D to form an enzyme capable of cleaving human C3. Has derivatives.

(ii) The amino acid sequence of the derivative is more homologous to C3 obtained from humans than to any other species of C3 currently known in sequence or to any other protein sequence currently known. Structural features of C3, which are present in wild-type proteins but not necessarily in modified derivatives, include:

(a) The DNA coding sequence and the translated protein sequence of human C3 used in the examples of the present invention are given in FIGS. 2 and 1, respectively. This protein sequence differs from published sequence [2] only by two amino acids (details are provided in the Examples). More variations are thought to be compatible with C3 function, although most of them do not exist as populations.

(b) The primary translation product is proteolytically processed into two disulfide-binding chains, α (residue 672-1663) and β (residue 23-667), with the signal sequence (residue 1-22) removed. .

(c) The mature protein contains a thiol ester bond between residues Cys1010 and Gln1013.

(d) C3 convertase cleaves C3 to remove C3a (residues 672-748). After this reaction, the thiol ester bond is broken.

(e) In the presence of Factor H, Factor I cleaves C3b between residues Arg1303 and Ser1304 and between Arg1320 and Ser1321.

Modifications to Natural C3 Molecules

Substitution of Arg1303 by Gln

This modification occurs at one of the cleavage sites of C3b by factor I. The effect is a reduction in cutting speed by factor I at this position. The change to glutamine was chosen to eliminate the positive charge of arginine, which is predicted to be important for the serine protease activity of factor I, while maintaining hydrophobicity and similar side chain size to minimize disruption to protein tertiary structure. Evidence supporting this assumption is that the mutation did not interfere with processing into a two-chain structure, the production of thiol esters or cleavage of C3 by C3 convertase. Mutations from Arg1303 to other amino acids can achieve similar or even superior effects, as demonstrated in Example 5.

Mutations in Ser1304 (the other side of the cleavage site) or other residues involved in enzyme-substrate interactions can also be reduced.

Substitution of Arg1320 by Gln

This modification occurs at another position of cleavage of C3b by factor I. The effect dramatically reduces the rate of cleavage by Factor I at this location (virtually does not occur). Changes to glutamine were made on the same criteria as described above, and these mutations also did not interfere with processing into two-chain structures, formation of thiol esters, or cleavage of C3 by C3 convertase. In addition, mutations to other amino acids, as well as mutations in Ser1321 or other amino acids involved in enzyme-substrate interactions, can achieve the same effect.

When combining the two mutations, Arg1303-Gln and Arg1320-Gln maintain their ability to form part of an active C3bBb convertase by preventing C3b from inactivation. Other mutations (including combinations of mutations) that block both cleavage reactions can be used (eg Arg1303 Glu or Arg 1303 Gly can be used in combination with Arg 1320 Gln).

<Example 7>

Various mutations reduce the interaction of factor H with C3b / C3i

7.1 introduction

Other laboratories have shown the effects of synthetic peptides (Ganu, VS and Muller-Eberhard, HJ, 1985, Complement 2:27; Becherer, JD et al., 1992, Biochemistry 31: 1787-1794) or limited mutagenesis (Taniguchi-Sidle, A and Based on Isenman, DE, 1994, J. Immunol. 153: 5285-5302, it is noted that residues of 752-761 in the primary sequence of the C3 transcript (see FIG. 1) may be involved in the interaction with Factor H. I have found evidence that means. However, other published evidence suggests that only residues 767-776 are involved in the interaction with factor H, while residues 752-761 are important for interaction with factor B (Fishelson 1991, Mol. Immunol. 28: 545-552). We speculated that more extended mutagenesis of this region could reduce the affinity for factor H and would therefore be desirable for the purpose of making C3 derivatives resistant to factor H. We also thought that the important residues to be mutated may be prominent acidic residues (aspartic acid and glutamic acid), and it is desirable to change them to neutral residues that will not mediate strong interactions. In this example, we changed residues 752-754 from Asp-Glu-Asp to Gly-Ser-Gly, and in parallel, residues 758-760 from Glu-Glu-Asn to Gly-Ser-Gly. The product shown reduced the cleavage properties with a decrease in sensitivity to factor H. This provides evidence that alteration of C3 can reduce the binding of factor H and thus the sensitivity to factors H and I. Such modifications are desirable for the production of C3 convertases that are stable under physiological conditions.

7.2 method

Mutagenesis, expression and analysis methods were described in the preceding examples. The sequence of the mutagenic oligonucleotides synthesized was AGTAACCTGGGTTCGGGCATCATTGCAGGATCGGGCATCGTTTCC.

7.3 Results

The results of the cleavage reaction are shown in FIG. 6. These mean the following:

1. The addition of CVFBb to wild type C3 removes the α chain because the C3b formed is sensitive to low concentrations of factors I and H in the culture supernatant (track 2). The C3i generated during this subsequent incubation was split into iC3i in the same way. The addition of exogenous factors I and H (tracks 3 and 4) is no different from track 1 and track 2, respectively, because the medium itself contains sufficient factor H and I activity to effect complete cleavage.

2. In contrast, treatment of mutant C3 with CVFBb (track 6) did not disappear the α chain. Some α 'corresponding to C3b is produced but some or all of it remains, indicating that the persistence of the α chain is not the result of a failure of the cleavage of CVFBb. The uncleaved α chain remaining in Track 2 may not be cleaved by the endogenous activity of Factors H and I, although the mutant may have exhibited native C3 remaining in part if the mutant had acquired partial resistance to CVFBb. It may be to indicate. The addition of high concentrations of exogenous factors H and I (tracks 7 and 8) deplete the α and α 'chains, which means that (i) the mutants are not completely resistant to these factors and (ii) by CVFBb in track 2 Truncated α chains are derived primarily from C3i (cut by factors H and I but not by CVFBb) rather than native C3 (which can be cleaved by CVFBb but not by factors H and I) do. In Track 8, not all α chains are still cleaved due to resistance to factors H and I.

Thus mutations of residues 752-754 and residues 758-760 produce C3 molecules that can be cleaved by C3 convertases, but are partially resistant to the action of factors H and I. This may be because, in other published data, mutations reduce the affinity for factor H by modifying the sites involved in interacting with factor H.

<Example 8>

Location within C3 that can be mutated to change the interaction of factor B with C3i

8.1 introduction

This example demonstrated that mutations to C3 can alter the interaction with factors H and I. To find other positions in C3 that interact with factor B, we compared the known sequences of C3 molecules from different species with the available sequences for C4 and other homologous proteins. We have identified sites corresponding to residues 1427-1433 of human C3, which may be involved in C3 and C4 specific functions. This may include interaction with Factor B (or its homologues, for C2, C4), but other potential functions include thiol ester formation, conversion to C3b (or C4b form), substrate C3 and / or in convertase activity. ) Interactions with C5 and factor I and its cofactors, but not necessarily. Thus, the selected moiety was mutated to another homologous protein, in this case the corresponding moiety found in human C5 (based on the sequence sequence). Thus, residue 1427 changed from Arg to Gln, residue 1431 from Lys to Asp, and residue 1433 from Glu to Gln. The resulting mutants were found to be sensitive to cleavage by C3 convertase (CVFBb) and the C3b product could be cleaved by factor H and I. However, this mutant did not help convert Factor B to Bb and Ba, which conversion depends on the binding of Factor B to C3i (or C3b). Thus, we obtained evidence that mutations at this site reduced interaction with factor B. While this is undesirable for the production of hyperactive C3 convertases, other modifications to the site of C3 also alter the interaction with Factor B, some of which provide indications that may possibly increase affinity. As a result, such mutations can also increase the stability and activity of the bimolecular convertase enzyme C3bBb (or C3iBb).

8.2 Method

The arrangement shown in Table I below shows why we thought this site was a candidate for mutagenesis. We thought that the properties of certain residues were well preserved in C3 and C4, but distinctly different in other proteins. Residues 1427, 1431 and 1433 were chosen because their charged properties may indicate a group involved in protein-protein interactions. Because they exhibited very different electrostatic properties, the corresponding residues in human C5 were changed within the context of some other conserved residues that may exhibit similar local structures.

Array of C3 Sequences and Related Molecules for Residue 1427-1435 Region of Human C3 protein Bell Residue (human) 1427 1428 1429 1430 1431 1432 1433 1434 1435 C3 Person R Y I S K Y E L D mouse R Y I S K Y E M N rat R Y I S K Y E M D Pig rat R Y I S K Y E L D rabbit R Y I S K Y E L N cobra R Y I S K F E I D toad K Y I S K Y E V N trout R Y I E K F E M D C4 Person R Y V S H F E T E mouse R Y V S H F E T D Slp mouse R Y V S H F E T D Similar to C3 / C4 Eel N Y I V Q Y E I R Seven-growth K Y I S N Y E I T C5 Person Q L F T D L Q I K mouse Q L L T D L Q I K A2M Person P T V K M L E R S mouse P S V K R L Q D Q rat P T V K M L E R S PZP Person P T V K M L E R S Murino globulin mouse P T V K K L E R L A1M rat P S V K K L Q D Q A1M hamster P T V K K L E R S A1I3 rat P T V K K L E R L

Mutagenesis methods, expression methods, and methods of analyzing C3 cleavage reactions were as described in the previous examples (Examples 1-4). Mutagenic oligonucleotides were synthesized with the sequence TGGTGTTGACCAATACATCTCCGACTATCAGCTGGACAA.

Analysis of Conversion of Factor B

The expressed product was purified via affinity purification from a COS cell medium into a clone-3-sepharose column as described in Example 9. This method resulted in a significant conversion of thiol ester breakdown form, C3i. Wild type C3 was isolated via the same procedure. Dilutions of wild type C3 (1/5, 1/25, 1/125) were electrophoresed with mutant C3 on an SDS-PAGE gel (reduction conditions) and silver stained, indicating that the mutant was found to be 1/25 of wild type. It was slightly smaller than the diluent and much larger than the 1/125 dilution. The same dilution was used for the analysis for Factor B conversion. 5 μl of these C3s were incubated at 37 ° C. for 3 hours with 25 μl of CFD-G containing 5 μg / ml factor D and approximately 1.6 μg / ml ¹²⁵ I-labeling factor B (about 1000-2000 dpm / μl). . The samples were then analyzed by SDS-PAGE (reduction conditions) and magnetic radiographs of the dried gel. The results are shown in FIG.

8.3 Results

As shown in FIG. 7, different cleavage of factor B is also seen at 1/125 dilution of wild type C3 (C3i). Conversely, very little cleavage was observed even when mutant C3 was not diluted and higher in concentration than 1/125 samples of wild type.

Thus, this mutant probably appears to be impaired in its ability to aid cleavage of Factor B, possibly due to a decrease in its binding affinity for Factor B. It is therefore the site of C3 that can be mutated to regulate the interaction between C3i (or C3b) and Factor B and also the stability of the convertase (C3iBb or C3bBb).

Example 9

Purification of Expressed Mutant C3 Molecules

9.1 Introduction

This example shows how mutant C3 molecules can be isolated from expression media such as culture medium of transfected eukaryotic cells. C3 molecules are obtained with sufficient purity for conjugation of the antibody in a functional test and as described in Example 10 even by simple affinity purification. Although elution from the antibody is accompanied by substantial hydrolysis of internal thiol esters, the C3i product is still a stable precursor for the production of active C3 convertases and for the production of C3i-antibody conjugates. This approach may also be useful as part of a formulation required for in vivo use.

9.2 Method

Affinity Purification on Clone-3-Sepharose

Clone-3 is a murine monoclonal antibody specific for C3 and its derivatives, including C3b and C3i (Lachmann, PJ et al., 1980, J. Immunol. 41: 503-515). Other monoclonal antibodies against C3 can also be used, and in some cases successfully used to isolate C3 in small amounts of human plasma (Dodds, AW, 1993, Methods Enzymol. 223: 46-61), which are expressed ex vivo. It may be applied to isolation of molecules. IgG fractions were coupled to Sepharose CL-4B using cyanogen bromide (Harrison and Lachmann, 1986, Handbook of Experimental Immunology, 4th edition, (Part) Weir, Herzenberg, Blackwell and Herzenberg; Blackwell, Oxford) Method is described in the following). The culture supernatant was passed directly through this resin column (recycle) or first precipitated with 25% (w / v) Na ₂ SO ₄ , concentrated, re-dissolved and dialyzed with PBS, 5 mM NaN ₃ . The column was then washed sequentially with PBS containing (i) PBS, 5 mM NaN ₃ and (ii) 1 M NaCl. Bound C3 is eluted with 50 mM Na borate buffer, pH 10.5, and immediately neutralized by combining 0.9 ml fractions with 0.1 ml 1 M Tris / HCl pH 7. This material is then dialyzed with PBS, 5 mM NaN ₃ .

Preparation of C3 with "His-Tag"

"His-Tag" is a series of histidine residues that show affinity for columns with nickel ions. This method was used to assist in isolating the expressed protein. We thought that this could be useful for isolating expressed mutant C3 molecules, so that the plasmid encoding the C3 causes an insertion mutation such that the plasmid encoding C3 has the tail of six histidine residues at the carboxy terminus (carboxy-terminus immediately adjacent to residue 1663). did. Locations for His tags were chosen to minimize interference with initial C3 synthesis, folding, processing and disulfide bond generation. Residue 1661 is a cysteine residue that is involved in disulfide bonds with residues earlier in the sequence (possibly Cys 1537; Dolmer, K and Sottrup-Jensen, L., 1993, FEBS-Lett 315; 85-90), and thus this structural feature Beyond inserting had to be cautious. Mutations were introduced using mutagenic oligonucleotides synthesized with the sequence TGGGTGCCCCAACCATCATCATCATCATCATTGACCACACCCCC via the "poor-plasmid" method used in Example 1.

Whether the correct sequence was introduced was confirmed by DNA sequencing. This DNA sequence can now be transferred to an expression vector. After transfection of eukaryotic cells, the expressed C3 may be isolated using affinity for a column with nickel ions or using any other matrix with specific affinity for "His-Tag".

9.3 Results

Many mutant C3s were purified on clone-3-sepharose, including those described in Examples 1 and 2 expressed in CHO cells. The product retained the ability to help cleavage factor B by factor D. The same method was also used to isolate the mutants described in Example B2 expressed in COS cells. Silver staining of the SDS-PAGE gel showed that the isolated product was usually not 100% pure but usually at least 50% pure. It comes from starting materials that generally contain up to 10 μg / ml C3 and other intracellular proteins in 10% (v / v) fetal calf serum. In addition, C3 did not degrade upon isolation and endogenous factor H and I activity appeared to have been eliminated.

Purification with “His-Tag” involves softer elution conditions from nickel ion containing columns. For example, EDTA was used. Applying this method to C3 should be able to isolate without breaking the internal thiol ester bond.

<Example 10>

Conjugation of C3i with Antibodies and Uses to Target C3 Convertase Activity Against Specific Cells

10.1 Introduction

One aspect of the present invention is that stable C3 convertases derived from mutant C3 molecules will enhance the C3 conversion rate that promotes complement dependent attack of that target if located at a particular target site. An advantageous way to target this reaction is to couple the mutant C3 molecule with an antibody specific for the desired target as a C3i or C3b derivative. In this example, we demonstrate a method of implementation for the production of such conjugates, which method is applicable to mutant C3i or C3b molecules and affinity-purification from the expression system even if thiol esters of C3 are destroyed in this process. It can be used for the material. By coupling C3i with an antibody that specifically binds to both red blood cells, we also found that the conjugate immobilized C3i on the surface of red blood cells, so that the convertase, C3iBbP, can be formed, which means that other complement components (such as those of C3 convertase It is demonstrated that when fed in the form of normal pig serum (in EDTA) to prevent new formation, it will trigger the lysis of these cells. Therefore, conjugation with antibodies can be used to target C3i molecules to trigger complement dependent attacks of specific cell types. This example uses wild type C3i obtained from human plasma, which forms C3 convertases in vitro. In vivo, wild type C3i and C3b are destroyed by factors H and I. Thus, mutant C3, which is constructed according to the methods of the present application and which is resistant to Factors H and I and forms a stable C3 convertase, will be advantageous in physiological terms.

10.2 Method

(i) Generation and Purification of C3i- Antibody Conjugates

The antibody used was an IgG fraction isolated from polyclonal rabbit anti-sheep erythrocyte antiserum. 1.1 mg was incubated for 2 hours at room temperature with 75 nmol of SPDP in conjugate buffer (pH 7.5, 20 mM KH ₂ PO ₄ , 60 mM Na ₂ HPO ₄ , 0.12 M NaCl). PDP-IgG was purified via gel-filtration on a SuperRose-6 column (Pharmacia), containing phosphate buffer, pH 7.4, 0.5 M NaCl. Samples were reduced to dithiothreitol to assess 4 coupled PDP groups per molecule of IgG. C3i was prepared by treating purified C3 with 0.1 M methylamine (pH 7.2, 2 h at 37 ° C). Excess methylamine was removed by gel-filtration followed by dialysis with conjugation buffer. 18 nmol of C3i was mixed with 1.7 nmol of PDP-IgG in 1.26 ml conjugation buffer and incubated for 1 day at room temperature and 1.5 days at 4 ° C. FIG. 8 shows a blue stained SDS-PAGE gel in Coomassie of the conjugation reaction mixture, showing the production of approximately 350 kDa that is not present in PDP-IgG or C3i. This was partially purified by gel-filtration on a Phorose-6 column with phosphate buffer (pH 7.4) containing 0.5 M NaCl and dialyzed into PBS. It was eluted before C3 at a volume of 300-400 kDa as measured by a spherical molecular weight standard. Concentrations of the conjugate, free antibody and uncoupled C3 were estimated from Cumagie-stained SDS-PAGE gels (non-reducing conditions). Two-dimensional SDS-PAGE (first axis is non-reducing condition, second axis is reducing condition) showed a pattern consistent with the 1: 1 conjugate between IgG and C3i.

(ii) Demonstrating that C3-antibody conjugates can be used to target convertase activity against specific cells.

20 μl of the dilution of the conjugate (0 (no conjugate), 1/100, 1/50, 1/10) was 100 μl of approximately 1% (v / v) sheep red blood cells at 37 ° C. for 1 hour (pre-washed in CFD). And incubated with. Equal amounts of PDP-IgG (without C3) and C3 alone were equally incubated. Cells were then washed four times with CFD and resuspended in 100 μl in CFD-G. 50 μl of this suspension was dissolved in 150 μl of H ₂ O, followed by addition of 800 μl of CFD containing 10 mM EDTA and 2% (v / v) NGPS. Another 50 μl of cells coated with the conjugate were mixed for 15 minutes at 37 ° C. with 50 μl of CFD-G containing 190 μg / ml Factor B, 2 μg / ml Factor D, 20 μg / ml Properidine and 0.6 mM NiCl ₂ . During incubation. After 30 minutes at 37 ° C., cells were pelleted by centrifugation (2000 × g, about 3 minutes) and the absorbance of the supernatant was measured at 412 nm. Dissolution rate (%) was calculated as shown in FIG. 9 using a sample treated with H ₂ O (100% dissolution rate) and a cell free buffer blank. Conjugates resulted in dose dependent lysis, while in the case of PDP-IgG and C3i alone, no cell lysis observed without any such treatment occurred significantly.

10.3 Summary of results

The method used was successful in coupling C3i to IgG for the following reasons.

1. Generation of bands of appropriate size (about 350 kDa) for 1: 1 C3: IgG shown via SDS-PAGE in FIG.

2. Two-dimensional SDS-PAGE indicating that this species contained IgG and C3i (first axis is non-reducing condition, second axis is reducing condition).

3. In gel filtration, the elution characteristics of this class correspond again with molecules of about 350 kDa.

4. The conjugate shows hemolytic activity not shown by PDP-IgG or C3i (FIG. 9).

Hemolysis analysis (FIG. 9) also demonstrates the following.

1. Specific anti-positive erythrocyte antibodies placed C3i on the target cell (positive erythrocytes) membrane to prevent C3i from being washed away (as opposed to free C3i).

2. The conjugate retains the activity of C3i in that it can still form C3 convertases by reaction with propane and factors B and D.

3. This convertase can trigger the complement-dependent attack of the target, in which case it activates the lysis pathway (C5-9) that can lyse red blood cells.

Additional data from other laboratories shows that cobra venom factor can be coupled with antibodies, and that the conjugates can target complement activation for specific cell types (Vogel, 1988, Targeted. Diagn. Ther., 1: 191-224; Muller, B. and Muller-Rucholtz, W., 1987, Leuk.Res. 11: 461-468; Parker, CJ, White, VF and Falk, RJ, 1986, Complement 3: 223-235 Petrella, EC et al., 1987, J. Immunol.Methods 104: 159-172). These data support that C3 modified to form stable C3 convertases can target the complement mediated response outlined in the present invention as well as the Cobra venom factor.

<Example 11>

Demonstrating that mutant C3 molecules induce factor B conversion in normal human serum.

11.1 Introduction

The primary object of the invention described herein is to consume and deplete complement activity from biological fluids. The present invention describes a method for preparing a C3 molecule that is resistant to downregulation of factors H and I. In this state, the C3 molecule will bind factor B to produce an active C3 convertase. The activity of these convertases is demonstrated by the hemolysis assay used in Example 6. Such a convertase will therefore consume C3. If the convertase is unstable, it will dissociate without much C3 conversion. However, this will enable the binding of new factor B and the conversion to Bb and Ba. Thus, mutant C3 will promote the consumption of factor B, ultimately rendering it incapable of amplifying the second pathway and amplifying the classical pathway stimulus. If a stable C3 convertase is formed, the conversion of factor B will be reduced, but the consumption of C3 will be increased. Thus, both situations may be desirable. In this example we demonstrate that mutant C3 molecules modified to be resistant to Factor I without modification to alter the stability of the convertase promote conversion of Factor B in human serum. Wild type C3, on the contrary, causes little conversion, probably because wild type C3i is rapidly degraded by factors H and I.

11.2 Method

Mutants are prepared as follows.

Q1R2 Arg1303 changed to Gln (Example 2)

Q1Q2 Arg1303 changes to Gln and Arg1320 changes to Gln (Example 1)

E1Q2 Arg1303 changes to Glu and Arg1320 changes to Gln (Example 5)

All these mutations were expressed in CHO cells, then precipitated with Na ₂ SO ₄ and purified via affinity purification as described in Example B3 with clone-3-sepharose. Wild type C3 (R1R2) was similarly isolated. By silver-staining SDS-PAGE, the concentration of Q1 was between 1/5 and 1/25 of the wild type, the concentration of Q1Q2 was about 1/5 of the wild type, and the concentration of E1Q2 was 1/25 and 1/125 of the wild type. Was between. All formulations probably contained most thiol ester-destructive molecules (C3i).

10 μl of these C3 preparations were added at 10 ° C. with 10 μl of 20% (v / v) normal human serum solution in PBS containing 1 mM MgCl ₂ and approximately 300 ng ¹²⁵ I-labeling factor B (approximately 2-300,000 dpm). Incubate for 1 hour. 5 μl was then analyzed by SDS-PAGE (reduction conditions). Exposure of the dried gel to the autoradiograph film revealed the location of the bands corresponding to the intact Factor B and its cleavage product. This band was then cut out and counted to accurately determine the degree of cut. Values obtained only with the buffer itself are subtracted to default values (including degradation products and other impurities present in the basic cleavage and radioligand formulations).

11.3 Results

The resulting degree of cleavage of factor B was as follows.

1/25 wild type 1.49%

1/5 Wild type 2.74%

Q1R2 6.19%

Q1Q2 7.41%

E1Q2 6.42%

Thus, all Factor I resistant mutants result in greater levels of Factor B cleavage than equivalent amounts of wild type C3 (C3i). The larger the capacity and the longer the incubation is performed, the more likely the second path will be completely disabled.

Abbreviations used in the above examples have the following meanings.

CFD (complementary fixed diluent; Harrison and Lachmann, 1986, Handbook of Experimental Immunology, 4th edition (ed) Weir, Herzenberg, Blackwell and Herzenberg, Blackwell, Oxford), CFD-G (0.1% (w / v) containing gelatin CFD), PBS (phosphate buffered saline), NGPS (normal pig serum), SDS-PAGE (SDS-polyacrylamide gel electrophoresis), SPDP (N-succinimidyl-3- [2-pyridyldithio] Propionate)

<Example 12>

Mutations of residues 992-1000

1. Introduction

Other studies have obtained evidence based on the effects of synthetic peptides presenting several residues of human C3b that may be involved in interacting with factor H (Ganu, VS and Muller-Eberhard, HJ, 1985, Complement 2:27). Becherer, JD et al., 1992, Biochemistry 31: 1787-1794; Fishelson, Z., 1991, Molecular Immunology 28: 545-552; Lambris, JD, Ganu, VS, Hirani, S. and Muller-Eberhard, HJ, 1988; J. Biol. Chem. 263; 12147-12150). We used a comparison of sequences from different approaches to predict residues involved in C3-specific function. Positional mutations were performed to indicate that most of these candidates had little or no effect on functional sensitivity to factor H. However, some mutations reduced the sensitivity to factor H. These mutations have been applied to portions of the molecule that have not previously been found to interact with or regulate the binding of factor H. Thus, mutagenesis of these defined residues can be used to prepare mutant derivatives of C3 that are partially or fully resistant to inhibition by Factor H in a physiological environment, and complex C3 that is similarly resistant to inactivation by Factor H. Will form a convertase enzyme (C3bBb, etc.).

Factor H is structurally homologous to other complement inhibitory proteins including CR1, MCP and DAF. Given this clear evolutionary relevance and mutual competition in binding, they will interact with C3b in a structurally similar manner to Factor H (Farries et al., 1990, Complement Inflamm. 7: 30-41). Such mutations that modulate sensitivity to factor H can be used to modulate interactions with these other proteins, particularly for the purpose of avoiding their complement downregulation activity. They can also be applied to modify interactions with SCR domains in factor B (and homologous domains in C2 involved in binding to C4b). Mutations to the corresponding sites of C4 and C5 may also be useful for modifying the interaction with SCR domains in C1r and C1s (C4), C4b binding protein (C4b), and C6 and C7 (C5b).

2. How to.

2.1 Search for residues involved in C3-specific function

Predictions were made from the arrangement of human C3 and all homologous proteins with sequences available through public databases. Homologous proteins include functionally equivalent molecules of mice, rats, pigs, rabbits, cobras, toads, chickens, and trout, human and mouse C4, human and mouse C5, chilfish and blackfish, C3-like proteins, cobra venom factor (CVF), human α-2-macroglobulin and its analogs. Different sequences were searched for homologs (mainly C5 and CVF) that were conserved among the different C3s but lacked the C3 specific function of interest. Some of these were mutated to encode the corresponding residues in C5 or CVF, expressed in COS cells, and the secreted product was tested for cleavage in the presence of CVFBb and factors H and I. All methods are as described in the standard method and Example 1. The results are summarized in Table II.

2.2 Construction and Analysis of Mutant DV-1AM

This mutant was prepared in the same manner as other mutants using the "megaprimer method" as described in V. Picard et al., 1994, Nuc. Acid.Res. 22: 2587-2591. The sequence of mutagenic primers was CCAGATGACAAGTGCTGCCGTCAGCCAGTCAGGGCTGAAGCACC, which encodes mutations E992S, D993A, D996S, A997Q, E998S, R999G. The sequence of the upstream primer was TGTCATCGTGCCGCTAAAGA (corresponding to deoxynucleotide 2754-2773) and the sequence of the downstream primer was GTTTTATGGTGACCTTAAGGTCGAATTTATTA (complementary to deoxynucleotide 4130-4165, cutting position introduction for restriction enzyme Afl II at position 4149). Cut the DNA fragment mutated into a vector comprising the coding sequence of C3 with the position introduced for Afl II at position 4149, cut the two into Afl II and EcoRI (cut at position 2997) and purify the desired product, and T4 DNA ligase Was ligated using. Plasmid DNA was isolated from transformed bacterial colonies, and unmistakable mutations were determined by DNA sequence analysis. At this time, it was found that the DNA sequence was further mutated to encode the mutant L1000M. COS cells were transfected with the resulting expression vectors and the secreted expression products were analyzed for cleavage reactions as described above.

3. Properties of Mutant DV-1AM

Analysis of the expression product with the DV-1AM mutation is shown in FIG. Note the following:

(i) Western blots detect precursors, α, α ', 77 and 68 kDa fragments, and develop β, 43 or 46 kDa fragments with monoclonal antibodies directed against the C3dg site of C3 which it does not detect.

(ii) All bands of the DV-1AM product (lane B1-4) appear slightly below the equivalent wild type band (lane A1-4). The change in mobility is the result of the mutations added.

(iii) Cleavage of wild type C3 with CVFBb resulted in some α 'chain from C3b and more 68 kDa from cleavage from C3b to iC3b by endogenous factor H and I activity (lane A3). Exogenous H and I were added to complete the conversion from C3b to iC3b (lane A4). In contrast, cleavage of the DV-1AM product by CVFBb produced higher amounts of α 'chain and only a small amount of 68 kDa fragment (lane B3). The addition of exogenous H and I converted this C3b to iC3b (lane B4). Thus, although resistance is not complete, as indicated by the sensitivity to cleavage by high concentrations of H and I added exogenously, mutant C3b is more resistant to endogenous H and I than the wild type.

4. Conclusion

DV-1AM mutations induce resistance to Factor H dependent cleavage by Factor I. Since the modified moiety is far from the cleavage site by Factor I (in the primary structure), the damage is likely to be interaction with Factor H, but the mechanism is not certain. In this case, the mutation will also confer resistance to other inhibitory activities of Factor H, such as (i) competition with Factor B in binding to C3b (or C3i) and (ii) accelerated dissociation of C3bBb and C3bBbP convertases. will be. DV-1AM mutations modified residues directly or indirectly involved in maintaining affinity for factor H. Many other mutations of the same residue will probably have a similar effect, and not only some modified residues, but also mutations of other residues within this segment of the primary structure may achieve that effect.

Example 13

Mutation of residues 1001-1005

1. Introduction

As described in the examples above, residues 1001, 1002 and 1005 have also been identified as candidates that may be essential for C3-specific function. Mutations confirm that modification of these residues can be used to confer resistance to factor H.

2. How to

2.1 Construction and Analysis of Mutant DV-1B

The method used was as described for the previous example, except that the sequence of the mutagenic primers was AACGGCTGAACATATTAATTCATACCCCCTCGGGC encoding the mutations K1001N, H1002I and V1005H. Isolated plasmid DNA was sequenced to confirm that the correct mutations were introduced. No other mutations were detected.

3. Characterization of Mutant DV-1B

Analysis of expression products with DV-1B mutations is shown in FIG. 11. Note the following:

(i) Western blot strongly detects precursor, α, α ', β, 43 and 46 kDa fragments, and develops 77 and 68 kDa fragments with polyclonal antibodies against C3 which only detect weakly. Note that the α and α ′ chains do not move and are not detected with 100% efficiency, and the intensity of these bands is lower than expected and is an inadequate indicator of the actual amount present.

(ii) Cleavage of wild type C3 with CVFBb results in some α 'chain from C3b, but most of them are lost from cleavage from C3b to iC3b by endogenous factor H and I activity (lane B3). It appears mostly as a 43 kDa fragment, with a small amount of the 46 kDa intermediate as well. Addition of 2 μg / ml of exogenous H (lane B4) with factor I results in a further noticeable cleavage, and 10-50 μg / ml of exogenous H (lane B5, B6) results in a complete cleavage of C3b (α ' Or no 46 kDa band) conversion to iC3b. Cleavage of the DV-1B product by CVFBb produced a small amount of α 'chain (lane A3, the total amount of C3 present is too small, and the α and α' bands are very soft). Importantly, the amount of 43 kDa chain produced in the absence of exogenous H and I was smaller than in the wild type, and the 46 kDa intermediate fragments appeared relatively larger, meaning that cleavage was less effective. Exogenous H and I (lane A4-6) were added to complete this C3b to iC3b conversion, but when 46 kDa was still evident, the 43 kDa product appeared to increase in dose dependent up to 50 μg / ml H (lane A6 ). Thus, although resistance is not complete, as indicated by the sensitivity to cleavage by high concentrations of H and I added exogenously, mutant C3b is more resistant than wild type to endogenous and exogenous H and I.

4. Conclusion

DV-1B mutations induce resistance to Factor H-dependent cleavage by Factor I. The mechanism of interaction with Factor H is not clear because the modified residue is away from the cleavage site by Factor I (in the primary structure) and its effect depends on the dose of Factor H added. In this case, the mutation will also confer resistance to other inhibitory activities of Factor H, such as (i) competition with Factor B in binding to C3b (or C3i) and (ii) accelerated dissociation of C3bBb and C3bBbP convertases. will be. DV-1B mutations modified residues directly or indirectly involved in maintaining affinity for factor H. Many other mutations of the same residue will probably have a similar effect, and not only some modified residues, but also mutations of other residues within this segment of the primary structure may achieve that effect.

<Example 14>

Mutations of residues 1152-1155

1. Introduction

As described in the examples above, residues 1152, 1153 and 1155 may also be essential for C3-specific function. Mutations confirm that modification of these residues can be used to confer resistance to factor H.

2. How to

2.1 Construction and Analysis of Mutant DV-6

The method used was as described for the previous example, except that the sequence of the mutagenic primers was ATCTCGCTGCGCAAGGCTTTCGATATTTGCGAG encoding the mutations Q1152R, E1153K and K1155F. Isolated plasmid DNA was sequenced to confirm that the correct mutations were introduced. No other mutations were detected.

3. Characterization of Mutant DV-6

Analysis of the expression product with the DV-6 mutation is shown in FIG. 11. Note the following:

(i) As described in the Examples above, Western blot strongly detects precursor, α, α ', β, 43 and 46 kDa fragments, and 77 and 68 kDa fragments only for C3 Development with polyclonal antibody. Note that the α and α ′ chains do not move and are not detected with 100% efficiency, and the intensity of these bands is lower than expected and is an inadequate indicator of the actual amount present.

(ii) Cleavage of wild type C3 with CVFBb results in a small amount of α 'chain from C3b, but most of them are lost from cleavage from C3b to iC3b by endogenous factor H and I activity (lane B3). It appears mostly as a 43 kDa fragment, with a small amount of the 46 kDa intermediate as well. Addition of 2 μg / ml of exogenous H (lane B4) with factor I results in a further noticeable cleavage, and 10-50 μg / ml of exogenous H (lane B5, B6) results in a complete cleavage of C3b (α ' Or no 46 kDa band) conversion to iC3b. Cleavage of the DV-6 product by CVFBb produced a small amount of α 'chain (lane C). Importantly, the amount of 43 kDa chain produced in the absence of exogenous H and I is smaller than in the wild type, and the amount of 46 kDa intermediate is relatively larger, meaning that cleavage was less effective. Exogenous H and I (lane C4-6) are added to complete this C3b to iC3b conversion. However, for wild-type 46 kDa intermediates were eliminated by 10 μg / ml H, indicating complete cleavage (lane B5), while these species still had mutations at this H concentration (lane C5), while complete cleavage was It appeared only when 50 μg / ml H was used. Thus, although resistance is not complete, as indicated by the sensitivity to cleavage by high concentrations of H and I added exogenously, mutant C3b is more resistant than wild type to endogenous and exogenous H and I.

4. Conclusion

DV-6 mutations induce resistance to Factor H-dependent cleavage by Factor I. Although the altered residues are separated from the cleavage site by factor I (in the primary structure) and the effect is dependent on the dose of factor H added, damage to the factor H interacts with that factor H, though This mechanism is not clear. In this case, the mutation will also confer resistance to other inhibitory activities of Factor H, such as (i) competition with Factor B in binding to C3b (or C3i) and (ii) accelerated dissociation of C3bBb and C3bBbP convertases. will be. DV-6 mutations modified residues directly or indirectly involved in maintaining affinity for factor H. Many other mutations of the same residue will probably have a similar effect, and not only some modified residues, but also mutations of other residues within this segment of the primary structure may achieve that effect.

Summary of Effect of Mutations on Sensitivity to Factor H Mutation Amino acid changes Inhibition of factor H dependent cleavage by factor H CV-2 E776K - CV-1 P963K, P964A, A965R, D966K - DV-1AM E992S, D993A, D996S, A997Q, E998S, R999G, L1000M ++ DV-1B K1001N, H1002I, V1005H + DV-3 T1031G, E1032N, Q1033H, E1035N, K1036I - DV-4 V1070K, K1071G, R1072G, A1073S, P1074A - CV-5 R1134Q - DV-6 Q1152R, E1153K, K1155F + DV-7N D1174N - DV-9 D1216G, K1217E, N1218D, R1219H - CV-4 R1260N, G1264E - RY-1 R1427Q, K1431D, E1433Q - -No suppression detected at all, + slight suppression, ++ greater inhibitory effect

<Example 15>

Variation of Residues 1546-1663

1. Introduction

Unlike Examples 12-14 above, modifications of residues 1546-1663 were not based on consideration of sequence comparisons between C3 and related proteins. Instead such modifications were obtained by chance and were the result of unintended nucleotide deletions leading to frame shifts in the translation of C-terminal residues. The resulting product showed significant resistance to Factor H dependent cleavage by Factor I. Thus, similar modifications intentionally induced can be useful for conferring resistance to the regulatory actions of Factor H and / or Factor I.

2. How to

Restriction enzyme Pvu I (vector sequence, which is equivalent to NC3 but has additional mutations 3151G, 3152G, 3154A, 3156C, 3159C, 3163A, 3165T, 3167T, 3168T, translated into amino acid changes T1031G, E1032N, Q1033H, E1035N and K1036I) Cut) and BsrG I (cut at nucleotide 4962), and 6.1 kb bands were isolated by agarose gel electrophoresis. Another vector carrying the insertion of CATCATCATCATCATCAT followed by nucleotide 5049, which is equivalent to NC3 but encodes the insertion of amino acid HHHHHH at the C-terminus, was cut similarly to Pvu I and BsrG I and the 4.4 kb fragment was isolated. These two DNA fragments were ligated together and isolated the complete plasmid. DNA sequencing revealed the loss of one nucleotide (A4696 or A4697). The expected result is that amino acids 1546-1663 cannot be translated in frame. Instead, there will be 48 residues read from the normal frame until the stop codon is reached.

The product "HDV-3X" was expressed in COS cells and tested as described in the previous examples.

3. Characterization of Mutant HDV-3X

The result of analyzing the expressed product containing the HDV-3X modification is shown in FIG. 12. Note the following:

(i) Western blots detect precursors, α, α ', 77 and 68 kDa fragments, and develop β, 43 or 46 kDa fragments with monoclonal antibodies directed against the C3dg site of C3 which it does not detect.

(ii) HDV-3X was compared to DV-3, an equivalent product without further C-terminal modifications. HDV-3X shows smaller α, but shows 68 kDa and 77 kDa products of normal size consistent with truncation at the C-terminus.

(iii) Cleavage of DV-3 C3 with CVFBb resulted in more 68 kDa resulting from cleavage from C3b to iC3b with some α 'chain from C3b and endogenous factor H and I activity (lane A2). Exogenous H and I were added to complete the conversion from C3b to iC3b (lane A3-5). The conversion is visually perfect with only 1 μg / ml factor H (lane A3). In contrast, cleavage of the HDV-3X product by CVFBb resulted in a higher amount of α 'chain and only a small amount of 68 kDa fragment (lane B2). The addition of exogenous H has no effect on converting C3b to iC3b (lane B3-5). Only slight production of 68 kDa and 77 kDa products can also be detected with H 25 μg / ml (lane A5). Thus, HDV-3X C3b is more resistant to endogenous H and I than wild type. The fact that resistance is partially overcome by large amounts of factor H means that the affinity for factor H can be greatly reduced.

4. Conclusion

HDV-3X modification results in resistance to Factor H dependent cleavage by Factor I. Since the modified moiety is far from the cleavage site by Factor I (in the primary structure), the damage is likely to be interaction with Factor H, but the mechanism is not certain. In this case, the mutation will also confer resistance to other inhibitory activities of Factor H, such as (i) competition with Factor B in binding to C3b (or C3i) and (ii) accelerated dissociation of C3bBb and C3bBbP convertases. will be. HDV-3X mutations modified residues directly or indirectly involved in maintaining affinity for factor H. Many other deletions or mutations of the same residue will probably have a similar effect, and only deletions or mutations of some residues may achieve that effect.

HDV-3X modifications were not intentional. However, the method chosen for this and related modifications will be the specific method of site mutagenesis, including those described in the previous examples.

<Example 16>

Modifications at this position that inhibit factor I mediated cleavage at residues 954 and 955

1. Introduction

Previous mutations at the P1 residues 1303 and 1320 confer resistance to cleavage by Factor I in the first two positions (Examples 1-6). It is not known that inhibition of cleavage at these two positions will also inhibit cleavage at the third position involved in the release of C3c from C3dg. The third cleavage, which normally depends on the cofactor CR1 (membrane receptor engineered in soluble form, sCR1), is relatively slow and was previously observed on iC3b (or iC3i) (ie after cleavage at positions 1 and 2). It was not observed on, C3i or C3b. To test this, an E1Q2 mutant (described in Example 11) that was very resistant to cleavage at positions 1 and 2 was used. If this mutation is still sensitive to cleavage at position 3, it would be desirable to mutate this position to inhibit the degradation of molecules in biological fluids. However, as to whether cleavage occurs exclusively at 954-955 binding (Davis, AE 3d. Harrison, RA & Lachmann, PJ, 1984, J. Immunol., 132: 1960-6) or other positions such as 959-960 Whether or not cleavage also occurs in (Harrison, RA et al., 1996 Molecular Immunology 33, Suppl. 1, 59, abstract 235; Ekdahl, KN, Nilsson, UR & Nilsson, B., 1990, J. Immunol. 144: 4269- 74 Confusion results have been reported in the literature. Initially we mutated residue 954 from arginine to glutamic acid (E1Q2E3). Because (i) this document indicated that this was the P1 residue of one of the cleavage sites, and (ii) that the mutation from Example 5 at position 1 to glutamic acid confers greater resistance to cleavage than other substitutions. to be. Also, instead of the arginine and glutamic acid of human C3, other mammalian species of C3 (mouse, rats, pigs, rabbits) have glutamine and glycine as residues equivalent to 954 and 955 (eg, Mavroidis, M. Sunyer, JO & Lambris, JD, 1995, J. Immunol. 154: 2164-2174. These data suggest that cleavage is less likely at this location (954-955) of other species, and that other locations, such as 959-960, may be more important (Harrison, RA et al., 1996, Molecular Immunology 33, Suppl. 1, 59, abstract 235). Equivalent mutations from Arg954 to Gln and from Glu955 to Gly were thus added to humans to create E1Q2QG3 mutations.

2. How to

The sequence of mutagenic primers for the E1Q2E3 mutation is GAACGCCTGGGCGAAGAAGGAGTGCG encoding the mutation R954E, and the sequence of mutagenic primers for the E1Q2QG3 mutation is used for mutagenesis except for the use of AACGCCTGGGCCAAGGAGGAGTGCGAA encoding the mutations R954Q, E995G. Are as described in the preceding examples. The product was ligated into a construct comprising a mutation encoding E1Q2 (E1303, Q1320 as described in Examples 5 and 11). The isolated plasmid DNA was sequenced to confirm that the correct mutation was introduced. No other mutations were detected. COS cells were transfected with the resulting expression vectors and the secreted expression products were analyzed for cleavage reactions as described above.

3. Factor I-Mediated Cleavage of the E1Q2, E1Q2E3, and E1Q2G3 Mutations

Analysis of the expressed product is shown in FIG. 13. Note the following:

(i) Western blots detect precursors, α, α ', 77 and 68 kDa fragments, and develop β, 43 or 46 kDa fragments with monoclonal antibodies directed against the C3dg site of C3 which it does not detect. Also, no cleavage at position 1 or 2 will occur and 86 kDa product cleaved at position 3 will be detected.

(ii) The figure shows that the 86 kDa product is virtually produced by factor I-mediated cleavage of E1Q2 in the presence of sCR1 (lane A3) and not when factor H is a cofactor (lane A3).

(iii) The 86 kDa product is not produced with either E1Q2E3 (C) or E1Q2QG3 (B) mutations even when sCR1 (C3 and B3) is present.

4. Conclusion

(i) Factor I-mediated cleavage at position 3 may still occur if cleavage at positions 1 and 2 is blocked. Thus, additional blocking of cleavage at position 3 is otherwise desirable to prevent degradation of all mutant products that are resistant only at positions 1 and 2 when used in a physiological environment.

(ii) cleavage at position 3 can be blocked by mutating residues 954 with Glu and 954 and 955 with Gln and Gly. However, other mutations in residues 954 and / or 955 may confer resistance to cleavage at position 3.

(iii) The mutations shown were prevented from cleaving at other putative positions of the third position cleavage (eg, 959-960). This means that 954-955 is the only important cleavage site or that other cleavage requires pre-cracking at 954-955 or that these residues are cleaved at other positions by different mechanisms (eg, distorted conformation). It will mean interfering. In any case, mutations of 954 and / or 955 are effective means to inhibit degradation of C3b or C3i-like products.

<Example 17>

Mutations at the C-terminal site of C3 that inhibit cleavage by factor I

1. Introduction

Example 15 provided evidence that a mutation or deletion of residues 1546-1663 confers resistance to cleavage by Factor I. This example provides small mutants that confer such resistance, as well as various mutations that confer no resistance.

2. How to

The mutagenesis method as described for the previous example was used except that the mutagenic primers had the sequence of Table 3 encoding the indicated mutations. Sequencing of the isolated plasmid DNA confirmed that the correct mutation was introduced. No other mutations were detected. COS cells were transfected with the resulting expression vectors, and the secreted expression products were analyzed for cleavage reactions as described above.

3. Resistance of various mutations to cleavage by factor I

Cleavage assays performed using Factors I and H for these mutations are shown in FIGS. 14 and 15. It should be noted that Western blots are developed with monoclonal antibodies against the C3dg site of C3, which detect precursors, α, α ', 77 and 68 kDa fragments but do not detect β, 43 or 46 kDa fragments.

FIG. 14 shows that wild type (NC3, A), FT-3 (D), FT-4 (E) and FT-5 (F) products are cleaved by Factor I, which is a 77 kDa and / or 68 kDa band Appears and is confirmed by the disappearance of the α chain. In contrast, FT-1 and FT-2 are not cleaved.

FIG. 15 shows that wild type (NC3, A), FR-1 (B), FR-2 (C), FR-3 (D) and FR-4 (E) products were cleaved while FT-2 product (F) Shows no cleavage.

4. Conclusion

(i) A small truncation of FT-2 is sufficient to provide resistance to cleavage by factor I. Such resistance can thus be achieved through the deletion of some or all of residues 1636-1663. This conclusion is supported by the resistance seen by FT-1 with deletions of residues 1636-1663 and further deletions / modifications of residues 1591-1635.

(ii) Since residues 1636-1663 are required for factor I-mediated cleavage, many other modifications of these residues can lead to resistance.

(iii) Not all modifications of these residues can confer resistance. Ineffective modifications include those defined by FT-5, FR-1, FR-2, FR-3, and FR-4 and those defined by FT-3 and FT-4 that modify residues other than 1636-1663. There is this.

(iv) These data suggest that the residues in 1636-1663 required for cleavage are those not modified by FT-5, FR-1, FR-2, FR-3 or FR-4. Thus, some of residues 1649-1660 may be critically important.

Mutations Used in Example 17 Mutation Sequence of Mutagenic Primers Substituted Sequence Residue Substituting Sequence FT-1 REA 1591-1593 TN Termination FT-2 E 1636 closing FT-3 LSSDFWGE 1607-1614 KEALQI FT-4 IIGKD 1621-1625 RYIYPLDSL FT-5 C 1661 S FR-1 EEDE 1633-1636 RDTT FR-2 QDEENQKG 1638-1645 SS FR-3 QDEENQKG 1638-1645 RSTRQRAA FR-4 D 1648 AFLAN

<Reference>

Bergmann, M. & Fruton, J. S. (1941) Adv. Enzymol., 1: 63-98.

2. de Bruijn, M. H. & Fey, G. H. (1985), Proc. Natl. Acad. Sci. U.S.A. 82: 708-712

3. Crawford-MH et al., (1988) Circulation. 78: 1449-58

4. Daha, M. R. & van Es, L.A. (1982) Immunol. 43: 33-38.

5. Farries, TC; Lachmann, PJ & Harrison, RA (1988) Biochem. J. 252: 47-54

6. Farries, TC; Lachmann, PJ & Harrison, RA (1988) Biochem. J. 253: 667-75

7. Forty, J; Hasan, R; Cary, N; White, DJ & Wallwork, J (1992) Transplant. Proc. 24: 488-9

8. Fritzinger, D. C. et al. (1992) J. Immunol. 149: 3554-3562

9. Harrison, R. A. & Lachmann, P. J. (1980) Mol. Immunol. 17: 9-20

10. Kalli, K.R., Hsu, P. & Fearon, D. T. (1994) Springer Semin. Immunopathol. 15: 417-431

11. Kinoshita, T; Takata, Y; Kozono, H; Takeda, J; Hong, KS & Inoue, K (1988) J. Immunol. 141: 3895-901

12. McNearney, TA; Odell, C; Holers, VM; Spear, PG; Atkinson, JP (1987) J. Exp. Med. 166: 1525-35

13. Nicol, P.A.E. & Lachmann, P. J. (1973) Immunol. 24: 259-275

14. Pangburn, MK & Muller-Eberhard, HJ (1984) Springer Semin. Immunopathol. 7: 163-92

15. Rother, K & Till, G. O. (ed.) (1988) "The Complement System" (Springer-Verlag Berlin Heidelberg, Germany)

16. Van den Berg, C.W., Aerts, P. C. & Van Dijk, H. (1991) J. Immunol. Methods 136: 287-294

17. Vogel, CW; Smith, CA & Muller-Eberhard, HJ (1984) J. Immunol. 133: 3235-41

18. Weisman, HF et al. (1990) Science 249: 146-51

19. Wu, R. (ed.) (1993) Methods Enzymol. 217: ch.s 12-14 (Academic Press, San Diego, U.S.A.)

20.Botto, M, Fong, K.Y., So, A.K., Koch. C. & Walport, M. J. (1990) J. Exp. Med. 172: 1011-7

21.Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) "Molecular Cloning. A Laboratory Manual" 2nd Ed. (Cold Spring Harbor Laboratory Press)

22. Fishelson, Z. (1991) Mol. Immunol., 28: 545-52

23. Taniguchi-Sidle, A & Isenman, D.E. (1993) Mol. Immunol. 30:54

24. Lambris, J. D., Avila, D., Becherer, J. D. & Muller, Eberhard, H. J. (1988) J. Biol. Chem. 263: 12 147-50

25. Taniguchi-Sidle, A. and Isenman, D. E. (1992) J. Biol. Chem. 267: 635-643

26. Hofer, B. and Kuhlein, B. (1993) Methods Enzymol. 217: 173-189

27. Morinaga, Y., Franceschini, T., Inouye, S. and Inouye, M. (1984) Bio-technology 2: 636-639

28. Harrison, R. A. And Lachmann, P.J. (1986) "Handbook of Experimental Immunology" (ed. Weir, Herzenberg, Blackwell and Herzenberg; Blackwell, Oxford) 4th Ed.

29. Kotwal, G. J., and Moss, B., Nature (1988) 335 (6186): 176-8

<Sequence table>

(1) General Information:

(i) Applicant:

(A) Recipient: Immutan Limited

(B) Street: Douglas House, 18 Trumpington Road

(C) City: Cambridge

(D) Note: Cambridge

(E) Country: United Kingdom

(F) ZIP Code: BC2 2H

(A) Recipients: Paris, Timothy, Charles

(B) Street: MC Center, Hills Road

(C) City: Cambridge

(D) Note: Cambridge

(E) Country: United Kingdom

(F) ZIP Code: BC2 2Q

(A) To: Harrison, Richard Alexander

(B) Street: MC Center, Hills Road

(C) City: Cambridge

(D) Note: Cambridge

(E) Country: United Kingdom

(F) ZIP Code: BC2 2Q

(ii) Name of invention: modified protein

(iii) SEQ ID NO: 23

(iv) computer-readable form

(A) Media Type: Floppy Diskette

(B) Computer: IBM PC Compatible

(C) working system: PC-DOS / MS-DOS

(D) Software: Patterned Release # 1.0, Version # 1.30 (EPO)

(2) Information about SEQ ID NO: 1

(i) Sequence Features:

(A) Length: 41 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) Information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 32 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) Information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 7

(i) Sequence Features:

(A) Length: 32 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 8:

(i) Sequence Features:

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 9:

(i) Sequence Features:

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) Information about SEQ ID NO: 10:

(i) Sequence Features:

(A) Length: 32 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 45 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 12:

(i) Sequence Features:

(A) Length: 39 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO:

(i) Sequence Features:

(A) Length: 44 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO: 14:

(i) Sequence Features:

(A) Length: 44 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) Information about SEQ ID NO: 15:

(i) Sequence Features:

(A) Length: 20 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 16:

(i) Sequence Features:

(A) Length: 32 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 17:

(i) Sequence Features:

(A) Length: 35 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 18:

(i) Sequence Features:

(A) Length: 33 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information for SEQ ID NO: 19:

(i) Sequence Features:

(A) Length: 27 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO: 20:

(i) Sequence Features:

(A) Length: 28 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

(2) information about SEQ ID NO: 21:

(i) Sequence Features:

(A) Length: 14 amino acids

(B) Type: Amino Acid

(C) strands: single

(D) topology: linear

(ii) molecular form: peptide

(xi) Sequence description:

(2) information for SEQ ID NO: 22:

(i) Sequence Features:

(A) Length: 1663 amino acids

(B) Type: Amino Acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: Protein

(xi) Sequence description:

(2) information for SEQ ID NO: 23:

(i) Sequence Features:

(A) Length: 5067 base pairs

(B) Type: nucleic acid

(C) strands: single

(D) topology: linear

(ii) Molecular Form: cDNA

(xi) Sequence description:

Claims (50)

Natural complement pathway protein modified to form down-regulated resistant C3 convertase. The protein of claim 1 which is a modified human protein. 3. The protein of claim 1 or 2, which is more resistant to cleavage by Factor I than the native protein. The protein of any one of claims 1-3, which is a modified C3 protein. The protein of claim 4, wherein the protein is Arg-1303, Arg-1320 or both modified by different amino acids. The protein of claim 5, wherein Arg-1303, Arg-1320 or both are substituted by glutamine, tyrosine, cystine, tryptophan, glutamic acid or glycine. The protein of claim 6, wherein Arg-1320 is substituted by glutamine. 8. The protein of claim 6 or 7, wherein Arg-1303 is substituted by glutamic acid, glycine or glutamine. The method according to any one of claims 1 to 8, wherein the sensitivity to factor H and / or factor I is less than that of natural human C3, and corresponds to amino acid residues 752-754 and / or residues 758-780 of natural human C3. A protein in which at least one amino acid has changed in comparison with native human C3. The protein of claim 9, wherein said at least one amino acid change is a change from an acidic amino acid residue to a neutral amino acid residue. The protein of claim 9 or 10, wherein said amino acid residue change is a change from Asp-Glu-Asp to Gly-Ser-Gly. The protein of claim 1, wherein the amino acid has changed at amino acid residues corresponding to residues 1427, 1431 and / or 1433 of native human C3 when compared to native human C3. The amino acid residues 992-1005 (EDAVDAERLKHLIV) of human C3 according to any one of claims 1 to 12, such that the C3b and C3i products or their derived C3 convertases are resistant to the complement inhibitory activity of Factor H. Proteins containing one or more mutations. The amino acid residues of human C3 992 (E), 993 (D), 996 (D), 997 (A), 998 (E), 999 (R), 1000 (L), 1001 (K) Protein comprising at least one mutation for 1002 (H), 1005 (V). The protein of claim 14 comprising at least one mutation selected from E992S, D993A, D996S, A997Q, E998S, R999G, L1000M, K1001N, H1002I, V1005H. The amino acid residues 1152-1155 (QEAK) of human C3 according to any one of claims 1 to 15, so that the C3b and C3i products or their derived C3 convertases are resistant to the complement inhibitory activity of Factor H. Proteins containing one or more mutations. The protein of claim 16 comprising one or more mutations for amino acid residues 1152 (Q), 1153 (E), 1155 (K) in C3. The protein of claim 17 comprising one or more mutations selected from Q1152R, E1153K, K1155F. The protein according to any one of claims 13 to 18, which is resistant to the complement inhibitory activity of CR1, MCP and / or DAF. 20. The method according to any one of claims 1 to 19, wherein the sensitivity to factor H and / or factor I is less than that of natural human C3, and one or more amino acids are deleted or substituted for amino acid residues 1546-1663 of natural human C3. Inserted protein. The protein of claim 20, wherein one or more amino acids are deleted for amino acids 1546-1663 of natural human C3. The protein of claim 20 or 21, wherein all of the amino acids corresponding to amino acids 1546-1663 of natural human C3 are deleted. 21. The protein of claim 20, wherein the protein corresponding to amino acid residues 1546-1663 of natural human C3 differs from the natural human C3 by at least one amino acid. The protein of claim 23, wherein the amino acid at the site corresponding to amino acids 1546-1663 of native human C3 may result from a frame-shift mutation in the DNA encoding the native human C3. 25. The method according to any one of claims 20 to 24, wherein the sensitivity to factor H and / or factor I is less than that of natural human C3 and one or more amino acids are deleted or substituted or inserted for amino acids 1636-1663 of natural human C3. Protein. The protein of claim 25, wherein one or more amino acids are deleted for amino acids 1636-1663 of natural human C3. 27. The protein of claim 25 or 26, wherein all amino acids corresponding to amino acids 1636-1663 of native C3 are deleted. The protein of claim 25, wherein at least one amino acid is different from the native human C3 at a site corresponding to amino acid residues 1636-1663 of the native human C3. The protein of claim 25, wherein said protein is less susceptible to Factor H and / or I as compared to native human C3 and wherein one or more amino acids are deleted, substituted or inserted for amino acids 1649-1660 of native human C3. The method of any one of claims 1-29, wherein one or more amino acids are deleted, substituted, or inserted relative to amino acid residues 954 and / or 955 of native human C3 and cofactor dependent (eg, CR1 or Factor H) Proteins with reduced susceptibility to factor I-mediated cleavage. 32. The method of claim 30, wherein the amino acid residue at the position corresponding to residue 954 of human C3 is different from residue 954 of human C3, and at this position is a cofactor dependent (e.g. CR1 or Factor H) factor I-mediated cleavage. Reduced sensitivity to proteins. The protein of claim 31, wherein said amino acid is glutamine and reduced sensitivity to cofactor dependent (CR1 or Factor H) factor I-mediated cleavage at this position. 31. The method of claim 30, wherein the amino acids at positions corresponding to residues 954 and 955 of human C3 are glutamic acid and glycine, respectively, and are susceptible to cofactor dependent (eg, CR1 or factor H) factor I-mediated cleavage at this position. This reduced protein. 32. The method of claim 30, wherein the amino acid residue at the position corresponding to residue 955 of human C3 is different from residue 955 of human C3, and at this position is a cofactor dependent (eg CR1 or Factor H) factor I-mediated cleavage. Reduced sensitivity to proteins. The fragment or variant of the protein according to any one of claims 1 to 34, having C3 convertase activity and also resistance to the complement inhibitory activity of Factor H, Factor I, CR1, MCP and / or DAF. A DNA sequence encoding a protein according to any one of claims 1 to 34 or a fragment or variant according to claim 35. A DNA construct comprising a DNA sequence as defined in claim 36 (eg, a vector). A protein as defined in any one of claims 1 to 34 or a fragment or variant as defined in claim 35 for use in therapy. A conjugate comprising a protein as defined in any one of claims 1 to 34 or a fragment or variant as defined in claim 35 linked to a specific binding moiety. 40. The conjugate of claim 39, wherein said specific binding moiety is a specific binding protein. 41. The conjugate of claim 40, wherein said specific binding protein is an antibody or antigen binding fragment of an antibody. A medicament for use in depleting the amount of a protein as defined in any one of claims 1 to 34 or a fragment or variant as defined in claim 35 or a complement pathway protein as defined in any one of claims 39 to 41 Use in manufacture. 43. The use of claim 42, wherein the medicament is for use in inhibiting rejection of a foreign substance. 43. The use of claim 42, wherein the medicament is for use in localizing and / or amplifying endogenous complement protein conversion and deposition at specific locations. At least one or more proteins as defined in any one of claims 1 to 34, or a fragment or variant as defined in claim 35, or a conjugate as defined in any one of claims 39 to 41 Pharmaceutical formulations containing together with a carrier or excipient. 46. The pharmaceutical formulation of claim 45 for use in depleting the amount of complement pathway protein. 46. A pharmaceutical formulation according to claim 45 for use in inhibiting foreign substance rejection. 46. The pharmaceutical formulation of claim 45 for use in localizing and / or amplifying complement protein conversion and deposition at a particular location. 35. A mammal comprising administering to a mammal a protein as defined in any one of claims 1 to 34, or a fragment or variant as defined in claim 35, or a conjugate as defined in any one of claims 39 to 41. How to reduce complement pathway protein in animals. The method of claim 49, which is administered using the pharmaceutical formulation as defined in claim 45.