MXPA97001783A - C3 human protein modifies - Google Patents

Abstract

The present invention relates to modified native complement pathway proteins, such that the protein is capable of forming a stable C3 convertase. Preferably, the modified protein is a modified human C3 protein. DNA sequences encoding these proteins are also provided, along with DNA constructs. Also described are conjugates comprising these proteins and a specific binding moiety, for example an antibody, as well as uses of these proteins and / or conjugates in therapeutic

Description

C3 MODIFIED HUMAN PROTEINS The present invention relates to new modified proteins capable of forming stable C3 convertases, to DNA sequences encoding said protein and to the use of said proteins as therapeutic agents, particularly for use in complement pathway protein depletion levels. The complement system works in the immune response of humans and other vertebrates, being of great importance in the functions of effectors such as phagocytosis, cytolysis and recruitment of cells that induce local inflammatory responses [15]. These properties are desirable for the elimination of invading pathogens, such as bacteria, but undesirable when triggered to act against host tissues (for example in post-ischemic reperfusion injury [3]) or against foreign therapeutic material (eg, hyperacute rejection of xenoinj ertos [7]). Attempts have been made to eliminate these undesirable properties by exploiting complement-regulating protein derivatives whose normal function is to suppress complement activation [10, 18]. The complement system comprises proteins both on the surface of cells, (receptors and regulators) as well as in the fluid phase (blood plasma and other extracellular environments). The critical step for the generation of responses in the proteolytic conversion of C3 to the C3b and C3a fragments. C3a is an anaphylatoxin that, like C5a, attracts mast cells to the stimulation site, which results in the local release of histamine, vasodilation and other inflammatory effects. The nascent C3b has the ability to attach to the surrounding surfaces at its generation site. Thus, this C3b focuses on the attack by the complement's cytolytic components (C5-C9). Surface-bound C3b, as well as its degradation products, also function as ligands for C3 receptors mediating, for example, phagocytosis [15]. There are two different trajectories of complement activation that result both in the conversion of C3 to C3b and in the subsequent responses. The classical pathway is commonly triggered by antibody complexes with antigen, initiating a cascade of enzymes involving Clq, Clr, Cls, C2 and C4 proteins. The alternative path depends on an activation cycle that includes C3 itself and requires factors B and D. The conversion of C3 to C3b (or C3i) generates a product that can be combined with factor B, to obtain C2bB ( or C3iB). Factor D acts on these complexes to generate C3bBb, which is a C3 convertase capable of dissociating more C3 to C3b, which leads to more C3bBb and an even higher conversion of C3.

Under certain circumstances the C3bBb complex is stabilized by association with the properdin positive regulator (P). However, this positive feedback cycle is usually limited to a slow march by regulatory proteins, notably factor H and factor I. Factor H (and molecules associated with structurally related cells) (i) displaces B and Bb from C3b, and (ii) acts as a cofactor for factor I that dissociates C3b in iC3b, thereby preventing any recombination with factor B to form more C3 convertases. The trajectory is "triggered" to the amplified generation of C3b in the presence of surfaces, such as many bacterial cell walls, which bind nascent C3b and prevent its regulation by means of factors H and I. The nascent C3b is also capable of binding to cells endogenous Therefore, the surfaces of endogenous cells normally exposed to complement are further protected by membrane-bound regulators such as MCP, DAF and CR1 that act in a manner similar to factor H. There are a small number of conditions that rarely occur naturally in those that the regulation of normal fluid phase can not occur and the spontaneous conversion of C- finally results in the generalized exhaustion of C3 in the circulation: (i) genetic deficiencies of factor H or I [13], (ii) the presence of antibodies (nephritic factors) that bind to C3bBb and prevent dissociation [4] and (iii) contact with a protein in cobra venom, called cobra venom factor (FVC), which combines with factor B and forms a C3 convertase enzyme that does not contain C3b and is not affected by factors H and I [14]. This illustrates the normal physiological importance of downregulation of complement in the absence of specific activation. There are also circumstances in which specific activation occurs, but it is undesirable, particularly when directed against host tissues (eg, tissue damaged by ischemia or surgery) or against foreign material deliberately administered for therapeutic purposes (such as a xenograft, artificial organ). or a dialysis membrane). The activation of the complement results in an undesirable attack and greater damage, so in these cases it would be beneficial to block or inhibit the activation and response. The existing methods to avoid complement-mediated damage have aimed at the use of down-regulation proteins (CR1, MCP, DAF and factors H and I) to inhibit complement activation. The complement inhibitors such as factor I, factor H and the soluble derivatives of the membrane-bound proteins CR1, DAF, MCP suppress the fluid phase amplification cycle of the alternative path. Therefore, attempts have been made to use these molecules, particularly CR1 (which appears to be the most potent) to reduce complement-mediated damage in physiological situation models [10, 18]. Factor H is present endogenously in blood plasma at high concentrations (typically 0.3 - 0.5 mg / ml [15]), so that although increased levels of inhibitors effectively decrease fluid phase reactions, its potency is weak, what would be necessary to administer large amounts of purified proteins in vivo (for example, probably more than 5 mg / kg body weight of soluble CR1). In addition, the alternative path is activated by the surfaces on which the effect of the H factor has already been prevented. Although this does not necessarily reduce concomitantly the activities of other inhibitors, the same factors suggest that they are unlikely to be complete or universally effective. The Cobra Ponce Factor (CVF) has the property of generating a stable C3 convertase that can be used experimentally to deplete complement in animals in vivo, and in other samples (eg, human blood plasma) in vitro. CVF is potent (for example 40 μg / kg can destroy the complement activity of a mouse [16]). However, there are disadvantages that make it inappropriate for therapeutic use in humans. First, it is obtained from the cobra poison (a difficult source to obtain and dangerous to manipulate) and, therefore, it must be carefully purified from venom neurotoxins. There is also the obvious difficulty of obtaining supplies. This problem can not be resolved quickly by cloning and expressing the ex vivo gene, because there are post-translational modifications that occur in the snake (specific proteolytic processing) that can be difficult (or impossible) to reproduce in vitro. In addition, the enzymes and digestion conditions required for this processing are currently unknown. Second, the protein is of foreign origin (for humans) and, therefore, immunogenic. This prevents its repeated therapeutic use, as would be required to eliminate a patient's complement for many weeks (for example, to allow the survival of a xenograft). Although CVF presents some structural and functional homologies with human C3 [17], it also presents important differences in both aspects (for example, chain structure, biosynthesis site, insensitivity to complement regulators, formation of a stable C3 convertase). It is not derived from the cobra equivalent of C3 that is known, cloned and sequenced, and in general structure and function resembles human C3 in a narrower way than FVC [8]. CVF is a specific product of the venom of an animal that is at great evolutionary distance from homo sapiens. Accordingly, it is not possible to use genetic manipulation to modify this protein in a product that can be used in a non-immunogenic manner in humans. Now we have devised an alternative strategy that is based on omitting the physiological regulation and that, instead of inhibiting the activation of the complement, it causes the super-activation of the system. This has two applications. First, it can be used in vivo to activate the complement until one or more components become depleted, resulting in the loss of the ability to produce local responses to any subsequent stimulation (such as a xenograft). Second, unregulated super-activation for a particular target (for example, a virus or a virally infected cell) can be deliberately located to increase the sensitivity of that target to complement-mediated destructive responses. The term "complement activation regulators" is used herein to include all proteins that act to inhibit C3 conversion amplification and is not intended to restrict its meaning to proteins whose genes are located at the RCA genetic site. However, it does not include "up-regulators" as properdin. "C3 conversion" is defined as the proteolytic conversion of C3 into C3b and C3a, unless otherwise indicated, and "C3 convertase" (or simply "convertase") is defined as an enzyme (typically a complex of two or more protein components; for example C3bBb, C3iBb, CVFBv or C4b2a) that catalyzes the reaction. Therefore, a first aspect of the invention provides a pathway of the native complement modified by protein so that the protein is capable of forming a stable C3 convertase. The term "native" means that it occurs naturally, that is, it is obtained in nature. Thus, the definition comprises any path of the complement that occurs in the nature modified by proteins, as previously defined. It is not intended to be restricted to species-specific proteins. In other words, a modified human protein can be used as a stable C3 convertase in another species of mammals, for example. Typically, modified proteins from the complement pathway of the same species will be used. Modification of the coding sequence of the C3 DNA, for example, using site-directed mutagenesis, can produce a variant of C3 that is resistant to complement regulatory proteins, while retaining positive functional properties (dissociation to C3b by C3 convertase) and structural integrity characteristics (correct structure of chain and presence of a thiol ester link). The invention described herein refers to genetically modified forms of native complement proteins, for example human C3, whose C3b fragment acquires the property of being resistant to physiological regulation of complement. Due to this resistance, these molecules can generate stabilized forms of the corresponding C3 convertase that produces amplified conversion of C3 to C3b and the subsequent degradation products, in physiological environments (for example, in vivo). In a preferred embodiment, the invention provides a modified human C3 protein that is resistant to dissociation by factor I. The foregoing can be achieved by modifying protein residues at proteolytic sites. A particularly preferred embodiment of the invention relates to a modified human C3 protein which is characterized in that the protein is modified by the replacement of Arg-1303, Arg-1320 or both by another amino acid. The other amino acid can be Tyrosia, Cystine, Tryptophan, Glutamine, Glutamic Acid or Glycine. Preferably, Argl303 is replaced by Glutamic Acid or Glycine (less preferred by Glutamine). Arg-1320 is preferably replaced by Glutamine. Other strategies for producing appropriate modified proteins of the invention include: i) Reduced susceptibility to inhibitory actions of factor H and related proteins (e.g., MCP, DAF, CR1). For example, in human C3 residues 767-776 and 1209-1271 have been implicated in the binding of factor H [20, 24], and the substitution of one or more of these residues or other residues also associated with the action of these proteins , could reduce the fixation of one more of these regulatory proteins. ii) Reduced percentage of dissociation of C3bBb.

Mutations can be introduced that could strengthen the interaction between C3b and Bb. This would result in both a reduction of the spontaneous decomposition of the enzyme and a decrease in the efficacy of factor H (and associated regulators) to displace Bb from C3b. These mutations are convenient to reduce the percentages of C3bBb decomposition both spontaneous and that mediated by factor H. Even in the absence of factor H, the C3bBb complex of the fluid phase has a half-life of only about 10 minutes at 37 ° C in the presence of properdin [6]. iii) Residues 752-761 of human C3 are involved in the binding of factor B. It is a highly conserved region in C3, and in C4 a closely related sequence is found. Since C4 fixes C2 homologue of factor B, the great similarity of this region between C3 and C4, together with its high conservation in C3, additionally supports its role in C3 as a binding site for factor B. Therefore, changes in this region could have effects on B affinity and on the stability of C3bBb. IV) It would also be convenient to obtain resistance to other regulators of complement activation such as CR1, DAF and MCP. The modes of action of these regulators are all similar to that of factor H, so additional mutagenesis would not necessarily be required. Likewise, some pathogenic organisms express their own complement activation inhibitors that are often structurally and functionally homologous to factor H (eg, Vaccinia virus [] secretion peptide. These molecules protect invaders against immune responses and it would be convenient to attack them with C3 convertase enzymes targeting a target resistant to these defenses. v) Mutations that increase the stabilization of C3 convertase by properdin. The activity of properdin is to stabilize the C3bBb complex, delaying spontaneous dissociation and factor H dependent. This stabilization is not effective in the fluid phase, but it seems to be more important in the amplification of the process once it has already started on an appropriate activation surface [5]. By incrng its activity (by incrng its affinity) it can alter the balance in the fluid phase and, thereby, promote the spontaneous conversion of C3. This would be particularly useful in combination with the other modifications previously described. vi) Mutations that prevent C3bBb from possessing C5 convertase activity. When used to deplete active C3 in circulation, an undesirable side effect could be the generation of large amounts of anaphylactic peptides. The most potent of these is C5a, which is dissociated from C5 by some C3 convertase enzymes. This reaction probably depends on the affinity of the convertase for another C3b molecule [11] and, thus, may be subject to suppression by mutations to C3 that eliminates this interaction. vii) Improved activity of C3 convertase. The active site of the C3 converting enzyme C3bBb resides in the Bb portion. Presumably, the component C3b functions to impose an active conformation on Bb and / or to fix and orient the substrate on which Bb will act. This is unknown, but in any case there must be possibility of improving the activity of convertase through mutations in C3. viii) Expression in a functional way. Wild type C3 requires C3b conversion before it can be combined into a new C3 convertase complex. When used in vivo, the conversion requirement to C3b (or C3i) would retard the action of modified C3. Accordingly, it would be convenient to administer the protein in a form capable of immediate convertase formation, or administer pre-formed convertase complexes. Therefore, it is convenient to generate ex vivo a reagent with functionality similar to C3b. This could be achieved in vitro (for example, by proteolysis). ix) Modifications to the native protein that serve to introduce new dissociation sites in a way that retains the peptide regions required for the binding of factor B, but can specifically remove those that are required exclusively to fix the factor H. For example , sites can be introduced so that the C3b-like form of the modified C3 can be further dissociated to a form that still sets the B factor but is less susceptible to inactivation by factors H and I. x) Modifications in other regions that can affect the C3b interaction with factor B and / or factor H. The invention is based on the reversion of the traditional method by promoting conversion C3 to exhaust C3 and, thereby, disable the system. A further application of the invention is the potential to promote C3 conversion at a particular site, and thus recruit the mechanisms of the complement-dependent effector to attack a specific target. Accordingly, the final effect would be to incr the amount of C3 conversion when the modified protein is administered to the physiological medium (eg, blood) containing complement-activating regulators. This activity can be used to deplete the native C3 medium or to locate the C3 conversion at a desired target. The C3 analogue whose C3b fragment is resistant to the actions of factor I (for example, the derivative described in example 1) would fix factor B, which would then be dissociated by factor D and finally dissociated into an inactive form. In the absence of inactivation by factor I, modified C3b would be able to repeatedly fix new B-factor molecules and thereby promote their inactivation. Therefore, another potential application of the modifications described in the present invention would be the inactivation of the alternative path by the consumption of the activity of the factor B. An analogous method could also be used to modify C4 to promote the consumption of C2 and with this will disable the classic trajectory of activation of the complement. The invention includes any other prot used analogously to the C3bBb enzyme that leads to the dissociation of C3 in C3b, despite the presence of complement activation regulators.

Also, the invention includes DNA sequences encoding a protein of the invention, as well as DNA constructs comprising said DNA sequences. "DNA sequences" include all other nucleic acid sequences which, by virtue of the degeneracy of the genetic code, also encode the determined amino acid sequence or which are substantially homologous to this sequence. Therefore, these sequences are also included within the scope of the present invention. Nucleic acid sequences that are "substantially homologous" are also within the scope of the present invention. "Substantial homology" can be established both at the level of nucleic acids and at the amino acid level. At the level of nucleic acids, the sequences having substantial homology can be considered as those which hybridize to the nucleic acid sequences of the invention under stringent conditions (for example, from 35 to 65 ° C in a saline solution of about 0.9M. ). At the amino acid level, a protein sequence can be considered as substantially homologous to another protein sequence if a significant number of the constituent amino acids exhibit homology. At least 55%, 60%, 70%, 80%, 90%, 95% or up to 99%, in increasing order of preference, of the amino acids can be homologous.

As previously described, the proteins of the invention can be used to obtain localized effects of complement activation. One way to ensure this is to conjugate the protein to the fraction that will bind to the desired target. Therefore, in another aspect, the invention provides a conjugate comprising a protein of the invention linked to a specific binding moiety, for example a specific binding protein. An example of such a protein would be an antibody or an antigen binding fragment thereof. The proteins of the invention are intended to be administered to a subject to develop a desired therapeutic effect. Accordingly, for this purpose the invention also provides: a) A protein of the invention for use in therapy; b) The use of a protein or a conjugate of the invention in the manufacture of a medicament for use at levels of complement pathway protein depletion and, in particular, to be used to prevent rejection of foreign matter; c) A pharmaceutical formulation comprising one or more proteins or conjugates of the invention together with one or more pharmaceutically acceptable carriers and / or excipients; and d) A method for reducing the complement pathway protein in a mammal comprising administering a protein of the invention to the mammal, preferably in the form of a pharmaceutical formulation. Pharmaceutical formulations can be presented in dosage forms of units containing a predetermined amount of active ingredient per dose. Said unit may contain at least, for example, 1 mg of active ingredient and, preferably, 2-3 mg. The upper limit that said dose of unit can contain will depend on many factors such as the condition to be treated, the route of administration and the age, weight and condition of the patient, as well as economic considerations. As an example, a unit dosage form can contain as many as 10 mg or more than 100 mg of active ingredient. The proteins of the invention can be used in vivo to disable the complement system. Circumstances in which this may be desirable include the following: (a) Prevent destruction or damage mediated by the complement to a transplant, particularly a xenograft (material transplanted from a different animal species) and especially a discordant xenograft (in the that the donor and recipient species are discordantly related). The complement of the recipient must be disqualified before the operation and kept in this state until the transplant has been adapted or has been replaced by a more compatible organ. The initial treatment would be done a few days before the transplant. An additional elimination of the complement could be required in cases of rejection crises. Treatments may be accompanied by the use of antihistamine reagents to control general inflammatory responses (eg, vasodilatation) that will probably result from the generation of C3a and / or C5a. The elimination of the complement can also be beneficial in the use of artificial organs or tissues (for example, dialysis membranes of artificial kidneys) that activate the complement system. As previously described, the protein can be administered in non-activated form, in a form of functionality similar to C3b or a preformed active C3 convertase (such as C3bBb). These can be administered by any route by which the active convertase finds the circulating C3 (for example, intravenously, subcutaneously, etc.). Another alternative would be an ex vivo treatment, for example by transfusion into the circulation through a matrix containing the active convertase. This could have the advantage of allowing the elimination (eg, by dialysis) of anaphylactic peptides (C3a and C5a) and other low molecular weight inflammatory mediators (eg, histamine and nitric oxide) before the blood (or plasma) ) without supplement is returned to the patient. (b) Avoid damage mediated by the complement derived from major surgery. The patient's complement, as previously described, would be eliminated preferably before the operation (but, if necessary, subsequently) and would remain in this state until the danger of additional internal damage due to the complement-dependent immune attack has diminished. . (c) Minimize the damage mediated by the complement derived from non-surgical injury. In these cases the elimination of the complement should be carried out after the initial injury, but it is likely that the formulations and methods of administration are similar to those previously described. This could be particularly useful when recovery involves reperfusion of an ischemic tissue through the circulation (eg, myocardial ischemia, freezing, burns, etc.). (d) Minimize the damage mediated by the complement resulting from antibody-antigen interactions. The defensive responses mediated by the complement are particularly undesirable in autoimmune diseases that may include glomerulonephritis, hemolytic anemia, myasthenia gravis and arthritis induced by type II collagen. Disabling the complement system during severe episodes of the disease can alleviate the condition. (e) Make a specific pathogen target more susceptible to immune mechanisms mediated by complement. In this method, the goal is to not use the superactive C3 convertase to produce generalized depletion of C3, but instead to use the convertase locally to concentrate the C3 conversion to a desired target. The target may be a pathogenic organism, such as a bacterium, virus or other parasite, or a harmful host cell or tissue, such as tumor cells or virally infected cells. C3 convertase can be localized to the target by local administration (for example, direct injection, possibly in a medium that retards its dispersion in the general circulation) or by its combination with a target fraction, for example, an antibody. Therefore, the modified protein can be bound to a specific immunoglobulin either by chemical cross-linking of proteins or by binding of DNA coding sequences and expression (and purification) of the fusion protein (eg, in case of IgG, the heavy or light chain could be linked to C3 and co-expressed with C3, or both chains could be combined within a complete fusion polypeptide), or by incorporation of specific coding sequences (e.g. for domains in the form of "leucine zipper") to the DNA of both fusion partners (eg, modified C3 and specific antibody) so that the expressed products, upon mixing, self-associate to form stable conjugates. Subsequently, the fusion protein could be administered locally or in the general circulation. Liposomes could also be used (supporting the antibody on the surface with the modified protein either on the surface or within the liposome) and / or virions (e.g., designed to express the proteins on its surface) for the co-delivery of the antibody and the modified protein. This strategy could be used directly, alone or in combination with other treatments, at any stage of the disease process. It would be particularly appropriate for use in the elimination of any cancer cells that remain in the circulation after the surgical removal of a tumor. Protein-modified protein conjugates could also be used ex vivo to remove pathogenic tissue. For example, to kill leukemic cells from an extracted bone marrow and then return the remaining healthy cells to the patient. Alternatively, lymphocytes that are not compatible with the MHC types of the recipient could be removed from a bone marrow before transplantation. Also, the modified protein could be bound to an antigen and its combination could be used, either in vivo or ex vivo, to attack lymphocytes of undesirable reactivities (eg, against tissue from the transplant or from the tissue itself). The same technology would be applicable for the treatment of other species, using a derivative of modified human protein or a similar analog made for said species. The preferred features of each aspect of the invention are as for every other aspect mutatis mutandis. The invention will now be described by the following examples, which should not be considered in any way as limiting the invention. The examples refer to the accompanying drawings, in which: Figure 1. Predicted sequence of human C3 protein as encoded in PC3; (using the standard one-letter code for amino acids). Figure 2. Illustration of the cDNA sequence in PC3; (using the standard one letter code for deoxynucleotides for the sense strand, written 5 '-3'). Figure 3. Illustration of a display of modified proteins of the invention. Figure 4. Illustration of the effect of various mutations to human C3 replacing Arg 1303 or Arg 1320 in dissociation measured by factor I in these sites. N.B. 1. Samples [35S] -biosynthetic marked. 2. Reactions performed at a normal ionic strength. 3. Immunoprecipitated with anti-C3. 4. SDS-PAGE under reducing conditions. 5. Autoradiography. Figure 5. Illustration of improved resistance of human C3 incorporating the mutation Arg 1303 - > Gln 1303 at inactivation by factors I and H. Figure 6. Illustration of an analysis of the dissociation of a mutated C3 convertase at amino acid residues 752-754 and 758-760. This is a photograph of a Western Blot developed of a 7.5% SDS-PAGE gel of polyacrylamide (reducing conditions), after electrophoretic transfer in nitrocellulose, probed with a sheep C3 antibody, and development with anti-sheep immunoglobulin antibody coupled to horseradish peroxidase and Chemiluminescence Improvement (method and detection reagents from Amersham, United Kingdom) recorded on X-ray film. The dissociation reactions and the detection procedure were carried out as described in Example 4 with reference to the results illustrated in Figure 3. Key: Tracks 1-4: Wild type C3 (expressed in COS cells) Tracks 5-8: Mutant C3 (residues 752-754 changed to Gly-Ser-Gly and residues 758-760 also changed to Gly-Ser-Gly) (expressed in COS cells) Tracks 1.5: no addition Tracks 2, 6: + CVFBb Tracks 3.7: + factors H + I Tracks 4.8: + CVFBb + factors H + I The bands indicated by the arrows are: A: C3 alpha chain B: C3 chain alpha1 C: C3 chain beta D : 68 kDa dissociation product of C3 alpha chain E: Heavy chain IgG Figure 7. Illustration of the analysis of the dissociation of radiolabeled factor B factor D, in the presence of wild type C3 and the C3 mutant (C3i) The autoradiography photograph of the SDS-PAGE gel is illustrated. All samples contained factor D and factor B labeled with 125I, and incubated for 3 hours at 37 ° C.

Samples are also included in the numbered lanes: 1. pH regulator alone 2. C3 wild type 1/125 3. C3 wild type 1/25 4. C3 wild type 1/5 5. C3 mutant 1/25 (residues 1427 Gln, 1431 Asp and 1433 Gln) 6. C3 mutant 1/5 7. C3 mutant undiluted The bands indicated by the arrows are: A. Factor B (93 kDa) undissociated labeled with 125I B. 60 kDa dissociation product (A. "Bb") C. 33 kDa dissociation product ("Ba") Figure 8. Illustration of an SDS-PAGE study showing the formation of a conjugate between C3i and IgG. This is a Coomassie stain of a 4% acrylamide SDS-PAGE gel run under non-reducing conditions. The numbered tracks contain samples of: 1. PDP-IgG 2. C3i 3. PDP-IgG + C3i reaction mixture They are indicated with arrows as follows: A. Probably conjugated C3i-IgG (350 kDa) B. C3i (200 kDa) C. IgG (150 kDa) Figure 9. Shows that the conjugate directs the activity of C3 convertase against sheep erythrocytes. (This graph shows the% of sheep erythrocytes lysed after coating with dilutions of the C3i-IgG conjugate, of PDP-IgG or of C3i followed by washing, generation of C3 convertase with properdin and factors B and D, and finally lysis development by NGPS in CFD / EDTA, as described in the methods.

Only the conjugate produces lysis and this lysis depends on the dose). The following standard methods and definitions are applicable to all examples. All components of the complement referred to are of human origin, unless otherwise specified, using standard terminology for all proteins and their derivative fragments (eg, as contained in reference [15]). In addition, the term "C3i" refers to any molecular form of C3 without an intact thiol ester linkage, but retaining the C3a polypeptide in the alpha chain. The human C3 cDNA and the coding sequence are numbered as shown in Figure 2, using the numbering used in the EMBL nucleotide database (derived from reference [2]). The sequence that is illustrated is that of our construction ('PC3'), which lacks the first 11 nucleotides of the 5 'untranslated region reported in reference [2] and, consequently, the first base is numbered 12. The codon which is called initiation corresponds to nucleotides number 61-63, the codon for the amino-terminal serine residue of the beta chain corresponds to nucleotides 127-129, and the codon for the amino-terminal serine residue of the alpha chain corresponds to nucleotides 2074-2076. The protein sequence is numbered according to the sequence of the precursor as illustrated in Figure 1, which is a predicted translation of the DNA sequence of Appendix 1 (amino acids 1-22 are expected to comprise a signal sequence that is eliminated during biosynthesis and amino acids 668-671 are expected to be eliminated when the precursor is dissociated in the alpha and beta chains). The following abbreviations have the following meanings; cobra venom factor CVF; ELISA; immunoadsorbent assay linked by enzymes; E. coli, Escherichia coli; kb, kilobase; HSV-1, herpes simplex virus type 1; PBS, saline solution with phosphate pH regulator. COS-1 is a cell line derived from monkey kidney cells. The following are restriction endonucleases: AflII, Dral, DralII, EcoRi, EcoRV, HindIII, Nael, Nhel, Xbal. Methods Standard Reference [21] describes methods for standard molecular biological procedures such as plasmid isolations, agarose gel electrophoresis and DNA ligations. A double-stranded DNA sequence was formed using the kit • Sequenase version 2.0 'supplied by' United States Biochemicals •. Expression of C3 was measured through an ELISA using plastic plates precoated with affinity purified polyclonal ovine anti-human C3 to which culture supernatant samples were added. Fixed C3 was detected with a monoclonal rat antibody for C3 conjugated to alkaline phosphatase and the chromogenic substrate, p-nitrophenol phosphate. The assays were calibrated with C3 of purified human plasma. The methods of purification of complement proteins and FVC, and for the preparation of affinity purified anti-C3 antibodies used in the analysis, can be found in the reference [28]. Equivalent reagents can also be purchased from Sigma Chemical Company LTD. C3 cDNA coding sequence Our C3 cDNA coding sequence was constructed from two isolated segments of a randomly primed human liver cDNA library carried in the vector pGEM4 (Promega). Five oligodeoxynucleotides, corresponding to segments known in the human C3 code sequence, were radiolabelled with T4 polynucleotide kinase and [α-32P] ATP and used to probe filter transfers from the agarose library library. Two clones containing inserts of approximately 4 kb were isolated. By means of restriction endonuclease digestion, hybridization to specific oligodeoxynucleotide probes and partial sequence analysis it was shown that one of these ('Al3') included the 5 'end of the 5.1kb message, while the other (' B44 ') extended to the 3 • end.

Accordingly, these inserts overlapped by approximately 3 kb, including a unique EcoRI restriction enzyme site. The incomplete 5 'section of A13 was cut with EcoRI and Nhel, and replaced with the complete isolated segment of B44 by digestion with EcoRI and Xbal. Both fragments were purified by low-melting agarose gel electrophoresis before being ligated with TG4 DNA ligase to produce a vector ('PGC3') containing 5.1 kb of DNA encoding the complete protein of the C3 precursor. The 5 'sequences of the linker to the coding region of C3 contained two ATGs which are potential starting sites of false translation. Therefore, they were removed by hollow plasmid mutagenesis, as described in the method of Example 1, using an oligodeoxynucleotide PL-ATC-3 (tagggagacc ggaagcttgc cctctccctc tgtccctctg t) that depleted approximately 50 base pairs of the linker / adapter DNA , without altering the C3 coding sequence. This mutated vector, 7.7 kb with 5.1 kb of C3 cDNA sequence plus 2.6 kb of PGEM4 vector sequence (Promega) is called PC3. The C3 coding region of plasmid PGC3 was subjected to complete sequencing and revealed only four differences with respect to a previously published human DNA sequence ("S" allele) C3 [2]. (i) changes C2481 - > G, and C2805- > T do not alter the encoding; (ii) T100 - > C encodes the polymorphic form HAV 4-1 - (Leucine314-> Proline) previously described [20]; and (iii) G2716- > A encodes Valina886- > Isoleucine, which has been previously reported in human C3, although lie is in this position in mouse and rat C3. Our sequence includes start and stop codons, with a complete sequence of signals and, therefore, must code for functional C3. Levels of up to 1.7 μg / ml expressed wild-type C3 in culture supernatants of COS-1 cells (transfected using lipofectamine and the pcDNA3 expression vector (Invitrogen)) have been detected by ELISA. The non-detectable C3 was produced by cells transfected with pcDNA3 vector alone. In addition, the analysis of the product expressed by dissociation reactions followed by immunoprecipitation, SDS-PAGE and immunocorridas showed that: (i) the primary translation product had been processed correctly in the mature form of two chains; (ü) this product was, like the native C3, dissociable to C3b by means of the C3 convertase (CVFBb); and (iii) the expressed protein was, like native C3, not dissociable by factor H plus I, but became dissociable after its conversion to C3b by means of the enzyme convertase. This confirms that our starting plasmid can be translated to functional C3. For an alternative description of a construction and expression of a C3 coding sequence, see reference [25]. Example 1; The production of C3 having the arginine residues at both factor I dissociation sites (amino acid positions 1303 and 1320) was converted to glutamine residues to prevent factor I from dissociating the C3b fragment. a) Mutagenesis The mutagenic oligodeoxynucleotides used were QRI1 (caactgcccagccaaagctccaagatcacc), QRI2 (gccagcctcctgcaatcag aagagaccaag), and AFL4149 (taataaattcgaccttaaggtcaccataaaac) and corresponding anti-sense oligodeoxynucleotides QRIln (ggtgatcttggagctttggctgggcagttg), QRI2n (cttgtctcttctgattgcaggaggctgggcagttg), QRI2n (cttggtctctt ctgattgcaggaggctggc) and AFL4149n (gttttatggtgaccttaaggt cgaatttatta). QRI1 and QRIln specify the replacement of arginine by glutamine at the site of dissociation of factor I at amino acid residue 1303 in the sequence of precursor C3 (changing G3968C3969 to AA in the sequence cDNA), and QRI2 and ARI2n effect the same substitution in the site of dissociation of the factor at amino acid residue 1320 (changing nucleotide G4109 to A).

AFL4149 and AFL4149n introduce a dissociation site for the restriction endonuclease AflII at position 4149 in the cDNA sequence (changing C4149 to T) without altering the encoded amino acid sequence. These two primers were used as markers, allowing to identify the efficient mutagenesis based on the dissociation of the DNA product by AflII. Mutagenesis was performed using the plasmid with gap1 method. A batch of PGC3 ('UPGC3'), enriched in uridine in place of thymidine, was prepared by growth in E. coli strain CJ236 in the presence of 0.25 μg / ml uridine. This plasmid was digested with Smal and the agarose gel of the product 7.2kb ('US1') was purified to remove a 0.5kb fragment of the C3 sequence (residues 1463-1947). The other component of the gap plasmid ('DN2') was prepared by digestion of PGC3 with DralII plus Nael and by purifying the piece 5.1kb twice by agarose gel electrophoresis. 200 ng of DN2 were mixed with approximately 500 ng of USl in 50 μl of H20, heated to 100 ° C and slowly cooled to less than 50 ° C, before adding 20 μl to 25 μl pH buffer 2XT7 (100 μl). mM Tris / HCl / pH 7.4 / 14 mM MgCl2, 100 M NaCl, 2 mM dithiothreitol and 1 mM each of ATP, dATP, dCTP, dTTP and dGTP) plus 10 nmol each of 5'-phosphorylated mutagenic primer ( one reaction used QRI1, QRI2 plus AFL4149, another reaction used QRIln, QRI2n plus AFL4149n). The mixtures were reheated at 70 ° C for 5 minutes and cooled slowly (for 30-60 min) at 20 ° C. At 0 ° C, 10 units of T7 DNA polymerase plus 80 units of T4 DNA ligase were added. The mixture (total volume 50 μl) was first incubated at 0 ° C, for 5 min, then at room temperature for 5 min, and finally at 37 ° C for 3 hours. 1 μl of each mixture was used to transform 100 μl of supercompetent E. coli XL1 (Stratagene) according to the manufacturer's instructions. Ampicillin resistant colonies were investigated for AflII dissociation and effective mutants were developed in 100 ml cultures from which the plasmids were isolated and sequenced (using a C3pa-3876 sequencing primer, cttcatggtgttccaagcct, nucleotides of agreement 3876-3895 of the C3 cDNA) to characterize mutations in the factor I dissociation sites. For an alternative mutagenesis protocol of the "hollow plasmid" see references [26, 27]. b) Transfer of the mutant DNA to the eukaryotic expression vector. The C3 coding fragments of the mutant plasmids were cleaved by means of double digestion with HindIII and Nael. Dral was also included to incapacitate the residual plasmid. The coding sequence of C3 was purified on agarose gel and ligated into the pcDNA3 vector (Invitrogen) which had been linearized with HindIII and the enzymes EcoRV and dephosphorylated with calf intestinal phosphorylase. The ligation mixtures were used to transform supercompetent E. coli XL1, which were placed in culture dishes containing ampicillin. A random selection (three or four) of the ampicillin-resistant colonies was developed in 2-3 ml cultures and small-scale isolation of the plasmid DNA was done. Plasmids containing the correct insert were identified by digestion of the plasmid DNA with restriction endonucleases EcoRI, HindIII and AflII. The corresponding colonies were grown in 100 ml cultures and the plasmids were purified by the standard procedure. These mutants were originally constructed from PGC3 and thus the two 5 'ATGs were retained in the coding region. Therefore, a cleavage of this region (plus the 3kb 5 'of the C3 coding sequence) was made with HindIII plus EcoRI and replaced by ligation of the same cut of the PC3 segment. These reconstructed vectors were prepared by the standard procedure and used for transfection of COS cells. c) Expression of wild-type C3 and mutant C3 mutants and wild-type were expressed temporarily from transfected plasmids in C0S-1 cells using lipofectamine® (GIBCO) in accordance with the manufacturer's instructions. Typically, 1-1.5 x 10 5 cells were transfected per well of a standard 6-well culture plate with 2-4 μg of plasmid using 9 μl of lipofectamine reagent. The supernatants were analyzed for C3 secretion and typical productions of 0.3-1.7 μg supernatant per ml were obtained after 3-6 days of transfection. Results a) Generation of mutants The following mutants, which are named according to the sequences of mutagenic oligodeoxynucleotides that have been incorporated, have been isolated so far: (i) 3 mutants with both QRI1 and QRI2 mutations plus AFL4149: C3M-26, C3M-58 and C3M-61; (ii) 1 mutant with QRI1 and QRI2 but without AFL4149; C3M-8; and (iii) 1 mutant with QR12 and AFL4149, but without QRI1: C3M-51 (used in example 3) b) The validation of these functional effects was due to the mutations introduced specifically in the factor I dissociation sites. The sequencing confirmed the absence of other alterations in bases 178-350 around the mutated region of each mutant The sequence of a mutant produced by this procedure, C3M-51 (see Example 3), has been analyzed throughout the 'gap' (bases 2463-5067) used in mutagenesis, and no other deviation from the sequence was found. of the wild type. In addition, the representative sequencing of a total of 2922 bases of all mutants has not revealed any mutation of a single point that could have been caused by polymerase-mediated errors. The expressed mutants also showed the structure of two chains and dissociation by C3 convertases, characteristic of native C3. In summary, it is unlikely that the mutants used contain any unwanted changes although they have not been completely re-sequenced. Example 2: Production of C3 having arginine residue at a factor I dissociation site (amino acid position 1303) converted to a glutamine residue. The procedure of Example 1 was followed, except that only the mutagenic oligodeoxynucleotides AFL4149 plus QR11 or AFL4149n plus QRI1n were used in mutagenesis (ie, QRI2 or QRI2n were not used).

Results a) Mutants obtained Two mutants were isolated with QRI1 and AFL4149 but without QRI2: C3M-123.27. The C3M-I23 mutant was expressed as described in Example 1. This protein can be dissociated by CVFBb. The product similar to C3b was relatively resistant (compared to the wild type) to dissociation at position 1303 by factors I and H, but could still be dissociated at position 1320. Consequently, this C3b derivative is partially resistant to the factor I. Example 3; Production of C3 having arginine residue at a factor I dissociation site (amino acid position 1320) converted to a glutamine residue. The procedure of Example 1 was followed except that only the mutagenic oligodeoxynucleotides AFL4149 plus QRI2 or AFL4149n plus QRI2n were used in the mutagenesis (ie no QRI1 or QRIln was used). In addition, the method employed in example 1 also produced a mutant with QRI2 and AFL4149, but without QRI1. Results a) Mutants obtained We isolated 3 mutants with QR12 and AFL4149 but without QRI1: C3M-51, C3M-Q2, C3M-Q13. The mutant C3M-51 was expressed as described in Example 1. This protein was dissociable with CVFBb. The product similar to C3b did not dissociate rapidly at position 1320 due to factors I and H, but could still be dissociated at position 1303. Therefore, this derivative of C3b is partially resistant to factor I.

Example 4: Analysis of the functional effects of mutations. Supernatants (100-400 μl) of transfected COS cells were incubated at 37 ° C for 2 hours with: COS cells were transfected with pcDNA3 carrying inserts of: 1) the unmutated C3 sequence; 2) C3M-I23 mutant (encoding Arg1303 -> Gln); 3) C3M-26 mutant (encoding Arg1303 -> Gln, Arg1320-> Gln); and 4) mutant C3M-51 (encoding Arg1320-> Gln). 200 μl of culture supernatants, taken 3 days after transfection, were pretreated with 2 mM phenylmethanesulfonyl fluoride (0 ° C, 15 min) and then incubated at 37 ° C for 2 hours with the following: A) without addition; B) preformed C3 convertase, CVFBb (10 μl of 200 μl containing 6.6 μg CVF, 100 μg of factor B and 1.4 μg of factor D in phosphate buffered saline solution (PBS) containing 10 mM MgCl2, pre-incubated at 37 ° C, 15 minutes); C) factors H (5 μg) and I (l μg); and D) CVFBb plus factors H and I. Subsequently these were immunoprecipitated by the addition of 0.6 μg of immunoglobulin C3 anti-human sheep purified by affinity at room temperature and after 1 hour adding 20 μl of a suspension to 5% of cells of Streptococcus sp. Group C washed and fixed with formalin (G protein) (Sigma). After 45 min at room temperature the particles were washed once in PBS, 5 mM NaN3 and once in 20 mM Tris / HCl, 137 mM NaCl, 0.1% (v / v) Tween 20, pH 7.6 before eluting in 1% SDS / 2% 2-mercap-toethanol ( 90-100 ° C, 5 min). These eluates were separated by SDS-PAGE, electrocuted on nitrocellulose and C3 bands were detected by probing with affinity-purified sheep anti-human immunoglobulin C3 followed by sheep anti-sheep immunoglobulin coupled to horseradish peroxidase (Sigma) and detection using substrates of "Enhanced Chemiluminescence" supplied by Amersham. A photograph of a 2-minute exposure to X-ray film is illustrated. The visible bands derived from C3 are indicated with labeled arrows and the individual samples (1-4, A-D) are those described immediately above. (The predominant band of around 50 kDa (between the 46 and 68 kDa bands) present in all the samples is the IgG heavy chain used in the in unoprecipitation and detected by the sheep anti-sheep immunoglobulin coupled to horseradish peroxidase). Results (see Figure 3) 1. All untreated samples (1-A, 2-A, 3-A, 4-A) contain bands of the correct migration for alpha and beta chains of C3, indicating that all mutants are expressed and processed correctly post-translationally. The presence of the 43 or 46 kDa bands in these samples indicates the presence of some activity similar to factor H + factor I in the culture medium. The spontaneous hydrolysis of C3 during the biosynthetic period of 3 days produces C3i which is dissociated by this activity. In unmutated C3, this generates 43 kDa and 75 kDa bands (the 75 kDa band is invisible because (i) is hidden by the beta chain 75 kDa and (ii) the antibody used to develop the Western run has very little activity to this portion of the alpha chain of C3: its presence was subsequently confirmed by a monoclonal rat annealing, "Clone-3", which is specific for this region). The addition of factors H and I without CVFBb (1-C, 2-C, 3-C, 4-C), did not dissociate the remaining C3, which indicates that it represents active C3 (intact thiol ester).HeN 2. The unmutated C3 (1) is dissociated by CVFBb and the product C3b is further dissociated by endogenous enzymes in 1-B or by factors H and I aggregated in 1-D. The 43 kDa band indicates dissociation at Arg1320 and the 68 kDa band (visible at longer exposures) indicates dissociation at Arg1303. 3. The mutant C3M-I23 (Arg1303-> Gln) was dissociable by CVFBb and the product was relatively resistant to endogenous activity similar to factors H and I (2-B), with different amounts of alpha 'chain persisting (C3b ), but it was still dissociable wadding factor H and I extra (2-D). The 43 kDa product indicates dissociation in Arg1320, (a weak band at 71 kDa representing the other fragment of the alpha chain could be seen at longer exposures) but the 68 kDa band was not present, showing that this mutant is resistant to dissociation in the mutated Gln1303. 4. The mutant C3M-26 (Arg1303-> Gln, Arg1320-> Gln) was dissociable by CVFBb and the product similar to C3b (alpha ') was resistant to endogenous activity similar to factor H and I (3 -B). It was also very resistant to the additional factors H and I (3-D) compared to the unmutated C3 (1) and other mutants (2 and 4). A small amount of 46 kDa product was observed indicating some dissociation in the mutated Gln1303 (the accompanying 68 kDa fragment was also visible at longer exposures). Very little 43 kDa was observed, or was not detectable, which would have corresponded to the dissociation in Gln1320. Accordingly, the mutation Arg- > Gln at position 1303 was less effective than at position 1320 to prevent dissociation by factor I. (This slow residual dissociation could also be occurring in mutant C3M-I23 (Arg1303-> Gln), but probably the intermediate 46 kDa is being processed rapidly at 43 kDa by means of additional dissociation in the unmutated Arg1320).

. The mutant C3M-51 (Arg1320-> Gln) was dissociable by CVFBb and the product was dissociated by means of endogenous activity similar to that of factors H and I (4-B), and by additional factors H and I (4 -D). The 46 kDa product (and a weak 68 kDa band) indicate dissociation in Arg 1303. However, the absence of a 43 kDa band indicates that it does not dissociate in the mutated Gln1320. Example 5: Comparison of various amino acid substitutions at position 1303. 1. Introduction The previous examples describe mutations of arg 1303 and arg 1320 to glutamine residues. Both mutations imparted resistance to factor I dissociation at these positions. However, a small, but detectable, degree of dissociation was found in gln 1303. Accordingly, a series of substitutions of other amino acids has been made and tested in this position. Dissociation occurs, in descending order of effectiveness, wresidue 1303 is: Arg > Tyr > [Cys or Trp] > Gln > [Glu or Gly] These results are unexpected because (i) all known dissociations that occur naturally mediated by human factor I occur in C-terminal arginine residues, so it could be deduced that the enzyme has an arginine requirement; and (ii) if dissociated into other residues one could predict that they would have to be electrostatically similar to arg, that is, a basic residue (lys or his), for example, trypsin selectively dissociates C-terminal for arg, lys or his ), so the dissociation of tyrosine substitution could not have been predicted. Therefore, substitution of arg is preferred 1303 with glycine or glutamic acid for the purpose of creating a C3 derivative resistant to inactivation by factor I. 2. Methods 2.1 Mutagenesis: the degenerate mutagenic primer used was: caactgcccagc (gt) (ag) (cg) agctccaagatcacc ( the letters that appear in parentheses indicate a mixture of bases in that position). The mutants were constructed by the plasmid with holes method (as described in the previous examples) or by the "mega-primer method" (V. Picard et al., Nuc Acid Res 22: 2587-91, (1994)), where the upstream primer was caccaggaactgaatctagatgtgtccctc and the downstream primer was gttttatggtgaccttaaggtcg aatttatta. All the mutations were performed in templates in which the DNA coding for C3 had already been mutated so that amino acid residue 1320 was glutamine and a restriction site for AflIII had been introduced at position 4149 (as described in FIGS. previous examples) and were confirmed by DNA sequencing. 2. 2 Expression: the mutants were expressed in COS cells using the pcDNA3 vector as described in the previous examples, biosynthetically labeled with [35 S] methionine in serum-free medium. 2.3 Assay: the supernatants were treated with CVFBb (formed by reaction of FVC with factors B and D in a pH regulator containing magnesium) and factors H and I, followed by immunoprecipitation with anti-C3 and separation by SDS- gel electrophoresis polyacrylamide carried out under reducing conditions (as described in the previous examples). The gel was fixed, treated with Amersham "Amplifier" reagent, dried and exposed to autoradiography film to obtain the result illustrated in the figure. 3. Results The dissociation mediated by factor I at position 1303 (site 1), without dissociation at 1320 (site 2) (when it has been mutated to glutamine) produces bands of 46 and 68 kDa. It can be seen that dissociation occurs in the following order: arg (R) > tyr (Y) > cys (C) and trp (W) > gln (Q) > gly (G) and glu (E). The wild type (arginine in both positions) dissociates in both positions to produce fragments of 43 (too small to be visible in this gel) and 68 kDa. 4. Figure The results are illustrated in Figure 4. Residues at site 1 (position 1303) and site 2 (1320) are indicated above the respective tracks. Example 6: Demonstration of improved resistance to inactivation by factors Ii and H after mutation from arg 1303 to gln 1. Introduction The above examples demonstrated that the conversion of arg 1303 or arg 1320 to glutamine towards the dissociation resistant site by factor I. The mutation of both sites makes a molecule that is resistant to dissociation at any of the sites. Here, we further demonstrate that the mutation of arg 1303 to gln alone (without alteration of arg 1320) results in considerable resistance, as compared to the wild type, for functional inactivation by factors I and H. 2. Method 2.1 Expression : The mutation preparation 1303- > gln was described in a previous example. This was transfected into CHO (a common line of Chinese hamster ovary cell laboratory cells) by the calcium phosphate method and the stable transfectants selected based on resistance to G418 ("Geneticin" available in Sigma). Supernatants from the cell culture were collected, and the expressed C3 was partially purified by sodium sulphate precipitation (10-20% (w / v) fraction) and ion exchange chromatography in Q-sepharose and mono-Q-sepharose (AW Dodds Methods Enzymnol 223: 46 (1993)). 2.2 Assay: Sheep erythrocytes were coated with S016 monoclonal antibody (RA Harrison and PJ Lachmann Handbook of Experimental Immunology 4th Edition, Chapter 39 (1986)) and 4.4 ml of a 5% (v / v) suspension was subsequently incubated with approximately 10 μg C2, 24 μ C4 and 1 μg Cl (purified human components) for 10 min at 37 ° C in CFD (RA Harrison and PJ Lachmann supra). 0.8 ml of this mixture were then incubated for 105 min with 0.25 ml containing the semi-purified mutant C3 or the wild type and EDTA to a final concentration of 12.4 mM. Subsequently the cells were washed in CFD and used in CFD containing 0.1% (w / v) gelatin (CFD-gel). Fixation of the radioligand with anti-C3 monoclonal antibody clone 4 [135I] -marking was used to confirm that similar amounts of wild-type or mutant C3b were deposited. For the assay, 40 μl of a 5% suspension of cells was diluted in 150 μl of CFD-gel and aliquots of 50 μl were incubated with 50 μl of CFD-gel containing dilutions of factors I and H at final concentrations of 100, 10, 1 and 0 μg / ml each, at 37 ° C for 30 min. Then 0.9 ml of CFD were added, the cells were agglomerated by centrifugation and washed twice more with 1 ml of CFD each time. Subsequently, the cells were resuspended in 100 μl CFD-gel containing 100 μg / ml factor B, 100 μg / ml properdin, 1 μg / ml factor D and 0.3 mM NiCl2. After 10 minutes at 37 ° C, 0.9 ml of CFD containing 10 mM EDTA and 2% serum (v / amp) were added.; v) normal guinea pig. After an additional 30 min at 37 ° C, unlissed cells were agglomerated by centrifugation and the degree of lysis was determined by measuring the absorbance of the supernatant at 412 nm. The absorbance equivalent of 100% lysis was determined in an aliquot of cells lysed in water, and thus the percent lysis was calculated. This assay measures the capacity of the deposited C3b to form a functional C3bBbP convertase. Conversion to iC3b prevents the formation of convertase and subsequent lysis in serum / EDTA. 3. Results The result shown in the figure indicates that more than ten times factor I and factor H are required to eliminate the hemolytic activity of the arg 1303-> mutant. gln, compared to the wild type. Therefore, this mutation is suitable for the creation of a derivative of C3 whose product C3b is resistant to inactivation by factors H and I. The effect may be due to the greater resistance to dissociation at position 1303 (when arg is mutated to gln), or to the highest resistance to dissociation at position 1320 when the dissociation can be carried out first at position 1303. 4. Figure The results are illustrated in Figure 5. The x-axis indicates the concentration of the factors H and I. Ql represents the mutation arg 1303- > gln. The% lysis is measured as described in the methods. Discussion The essential characteristics of Human C3, with respect to the modified variants described herein are as follows: (i) The molecule has a derivative functionally similar to C3b in that it can be combined with functionally active human factor B, which subsequently can be dissociate into human factor D to form an enzyme capable of dissociating human C3. (ii) The amino acid sequences of derivatives are more homologous to C3 of humans than to C3 of any other species for which a sequence is currently known or for any other currently known protein sequence. The structural characteristics of C3 present in the wild-type protein, but not necessarily in modified derivatives, include the following: (a) The sequence encoding DNA and the translational protein sequence for the human C3 variant used in the examples of The invention described herein are illustrated in Figures 2 and 1 respectively. This protein sequence differs from the published sequence [2] only in two amino acids (details are shown in the examples). It is assumed that many more variations are compatible with the C3 function, even though most will not be present in the population. (b) The primary translation product is proteolytically processed into two disulfide linked chains, alpha (residues 672-1663) and beta (residues 23-667), with removal of the signal sequence (residues 1-22). (c) The mature protein contains a thiol ester linkage between the CyslOlO and Glnl013 residues. (d) C3 convertases dissociate C4 to remove C3a (residues 672-748). This reaction is followed by the breakdown of the thiol ester linkage. (e) In the presence of factor H, factor I dissociates C3b between the residues Argl303 and Serl304, and between Argl320 and Serl321.

Modifications to the native C3 molecule Replacement of Argl303 by Gln This modification is effected by factor I at a dissociation site of C3b. The effect is to reduce the dissociation speed by the factor I to its position. The change to glutamine was selected to eliminate the positive charge of arginine, which is probably important for the activity of the factor I serine protease, while retaining a hydrophilic character and a similar size of side chain that should minimize any interruption to the structure of the tertiary protein. The evidence supporting this assumption is that the mutation does not prevent processing in a two-chain structure, the formation of a thiol ester or the dissociation of C3 by the C3 convertase. The muting of Argl303 to another amino acid can achieve a similar or even higher effect, as demonstrated in Example 5. It is also possible to reduce this dissociation by mutation of Serl304 (the other side of the dissociation site) or other residues involved in the enzyme-substrate interaction.

Replacement of Argl320 by Gln This modification is in the other dissociation site of C3b by the factor I. The effect is to drastically reduce (virtually cancel out) the dissociation speed by the factor I to its position. The change to glutamine was made according to the same criteria described above, and this mutation also did not prevent processing in a two-chain structure, the formation of a thiol ester or the dissociation of C3 by the C3 convertase. Again, the mutation to another amino acid can achieve the same effect as the mutation of Serl321 or other residues involved in the enzyme-substrate interaction. When combining the two mutations, Argl303-Gln and Argl320-Gln, they protect the C3b against deactivation and, therefore, maintain their ability to be part of an active C3bBb convertase. Other mutations (including combinations of mutations) that cancel out both dissociation reactions can also be used (for example Arg 1303 Glu or Arg 1303 Gly can be used in combination with Arg 1320 Gln). Example 7: Various mutations that reduce the interaction of C3b / C3i with factor H 7. i Introduction Other laboratories have produced evidence based on the effects of synthetic peptides (Ganu, VS and Muller-Eberhard, HJ, 1985, Complement 2: 27; Becherer, JD et al., 1992, Biochemistry 31: 1787-1794), or on the basis of limited mutagenesis (Taniguchi-Sidle, A. and Isenman, DE, 1994 J. Immunol., 153: 5285-5302) to suggest that residues 752-761 in the primary sequence of C3 transcription (see Figure 1) could be involved in the interaction with factor H. However, other published evidence suggests that only residues 767-776 are involved in the interaction with factor H, while residues 752-761 are important for the interaction with factor B (Fishelson, 1991, Mol.Immunol.28: 545-552).

We hypothesize that a more extensive mutagenesis of this region could reduce the affinity for factor H and, consequently, that it is convenient for the purpose of creating a C3 derivative that is resistant to factor H. Furthermore, we assumed that residues important for mutation they could be prominent acid residues (aspartic and glutamic acids) and it would be convenient to change them to neutral residues that are less likely to mediate strong interactions. In this example we changed residue 752-754 from Asp-Glu-Asp to Gly-Ser-Gly, in combination with the change of residues 758-760 from Glu-Glu-Asn to Gly-Ser-Gly. The product obtained reduced the dissociation characteristics in a manner consistent with a reduction in susceptibility to factor H. This is evidence that C3 can be modified to reduce the fixation of factor H and, therefore, the susceptibility to factors H I. These modifications are desirable for the creation of a stable C3 convertase under physiological conditions. 7.2 Method In the previous examples the methods of mutagenesis were described, expression and analysis. The mutagenic oligonucleotide that was synthesized had the sequence: agtaacctgggttcgggcatcattgcaggatcgggcatcgtttcc. 7.3 Results The results of the dissociation reactions are illustrated in Figure 6. These indicate that: 1. The addition of CVFBb to wild type C3 results in the elimination of the alpha chain (lane 2) because C3b is formed is susceptible to low concentrations of factors I and H in the culture supernatant. The C3i formed during the expression of this subsequent incubation is decomposed in iC3i in the same way. Therefore, the addition of exogenous factors I and H (lanes 3 and 4) are not different to lanes 1 and 2, respectively, because the medium itself contains sufficient activity of the H and I factors to effect complete dissociation. 2. In contrast, treatment of the mutant C3 with CVFBb (lane 6) does not result in the disappearance of the alpha chain. There is some generation of alpha ', which corresponds to C3b, but the total or some part of it remains, which indicates that the persistence of the alpha chain is not merely the result of the lack of dissociation on the part of CVFBb. The remaining alpha chain not dissociated in track 2, therefore, may represent C3i that has not been dissociated by the endogenous activities of factors H and I, although it is also possible that a little of it represents the persistence of native C3 if the mutant has acquired partial resistance to CVFBb. The addition of high concentrations of exogenous factors H and I (lanes 7 and 8) produces the depletion of alpha and alpha 'chains, indicating that (i) the mutant is not completely resistant to these factors, and (ii) the alpha chain does not dissociated by CVFBb in track 2 is derived predominantly from C3i (which can be dissociated by factors H and I, but not by CVFBb) and not from native C3 (which can be dissociated by CVFBb, but not by factors H and I ). Even not all the alpha chain is dissociated, even on track 8, probably due to resistance to factors H and I. Consequently, the mutation of residues 752-754 and residues 758-760 can generate a molecule of C3 that can still be dissociated by C3 convertases, but that is partially resistant to factors H and I. Based on other published data, this is more likely because the mutations have modified a region that is involved in the interaction with the factor H, and, therefore, has resulted in a reduced affinity for factor H. Example 8: A site in C3 that can be mutated to modify the interaction of C3i with factor B. 8.1 Introduction The previous examples have shown that mutations to C3 can modulate the interactions with factors H and I. In order to discover other sites in C3 that can interact with factor B, we compare the known sequences of the C3 molecules of different species, as well as with sequences available for C4 and other homologous proteins. We identify the region corresponding to residues 1427-1433 of human C3 that could be involved in the specific functions of C3 and C4. This could include interaction with factor B (or its counterpart C2, in case C4), but not necessarily because other potential functions include thiol ester formation, with C3b version (or C4b form), interaction with C3 substrates and / or C5 in the convertase activity and in the interaction with factor I and its cofactors. Therefore, the selected residues were mutated in the corresponding residues (based on the sequence alignments) found in another homologous protein, in this case human C5. Thus, residue 1427 was changed from an Arg to a Gln, residue 1431 from a Lys to an Asp, and residue 1433 from Glu to a Gln. It was found that the resulting mutant was susceptible to being dissociated by C3 convertase (CVFBb) and the C3b product could be dissociated by the H and I factors., this mutant did not support the conversion of factor B to Bb plus Ba, which depends on the binding of factor B to C3i (or C3b). Therefore, we have evidence that the mutation of this region decreased the interaction with factor B. Although this is not convenient for the generation of a super-active C3 convertase, it provides an indication that other modifications to this region of C3 also they will alter the interaction with factor B, and probably some of these will increase affinity. As a consequence, said mutations can increase the stability and activity of the bimolecular convertase enzyme, C3bBb (or C3iBb). 8.2 Methods The alignments shown in Table 1 illustrate the reason why we consider this region to be a candidate for mutagenesis. We assumed that the characters of certain residues were well conserved in C3 and C4, but that they were very different in other proteins. Residues 1427, 1431 and 1433 were selected because their nature could be indicative of groups involved in protein-protein interactions. Changes were made to the corresponding residues in human C5 because they showed very different electrostatic properties, but within the context of some other conserved residues that could indicate a similar local structure.

Table l Alignments of C3 sequences and related molecules for region 1427-1435 of human C3. WASTE (Human) In the previous examples (Examples 1-4) methods of mutagenesis, expression and analysis of C3 dissociation reactions were described. Mutagenic oligonucleotide was synthesized with the following sequence: tggtgttgaccaatacatctccgactatcagctggacaa. Assay for production of factor B. The expressed product was purified from the COS cell medium by affinity purification on a Clone-3-Sepharose column as described in Example 9. This method results in a considerable conversion of the fractionated form of thiol ester, C3i. Wild type C3 is isolated by the same procedure. Dilutions of wild-type C3 (1/5, 1/25 and 1/125) were run on an SDS-PAGE gel (reducing conditions) together with the mutant C3, and silver staining indicated that the mutant was present at a concentration equivalent to a slightly lower amount of 1/25, but much higher than the 1/125 dilution of the wild type. The same dilutions were used in the factor B production assay. 5 μl of C3 were incubated with 25 μl of CFD-G containing 5 μg / ml factor D and about 1.6 μg / ml of factor B labeled with 125 I (approximately 1000 -2000 dpm / μl) for 3 h at 37 ° C. Subsequently, the samples were analyzed by SDS-PAGE (reducing conditions) with dry gel autoradiography. The results are shown in Fig. 7. 8. 3 Results As shown in Figure 7, the different dissociation of factor B is still present at a 1/125 dilution of wild type C3 (C3i). In contrast, no significant dissociation was observed in the presence of mutant C3, still undiluted, which should be at a concentration higher than the 1/125 wild-type sample. This mutant therefore appears to have an impaired ability to support the dissociation of factor B, most likely due to a reduction in its binding affinity for factor B. Therefore, this is a region of C3 that can be mutated to modulate the interaction between C3i or C3b) and factor B, and probably also the stability of the convertase (C3iBb or C3bBb). Example 9: Purification of mutant C3 molecules 9.1 Introduction The present example demonstrates the way in which mutant C3 molecules can be isolated from an expression medium such as for example the culture medium of transfected eukaryotic cells. By simple affinity purification, C3 molecules of sufficient purity are obtained for functional tests and conjugation with antibodies by the method described in Example 10. Although the elution of an antibody is accompanied by hydrolysis of a considerable proportion of the internal thiol ester , the product of C3i is still a suitable precursor for the generation of an active C3 convertase, as well as for the production of C3 antibody conjugates. It is likely that this method is also useful as part of the preparation required for in vivo use. 9.2 Method Affinity purification in Clone-3-Sepharose. Clone-3 is a rat onoclonic antibody that is specific for C3 and its derivatives, including C3b and C3i (Lachmann, P. J. et al., 1980, J. Immunol., 41: 503-515). Other monoclonal antibodies against C3 are available, and in some cases have been used effectively to isolate C3 from small amounts of human plasma (Dodds, AW, 1993, Methods Enzymol, 223: 46-61) and therefore are likely to be applicable for the isolation of expressed molecules ex vivo. The IgG fraction was coupled to Sepharose CL-4B using cyanogen bromide (the methodology can be found in Harrison and Lachmann, 1986, Handbook of Experimental Immunology, Fourth Edition, Ed.s Weir, Herzenberg, Blackwell and Herzenberg, Blackwell, Oxford) . The supernatants of the culture were passed directly through a column of this resin (recirculated) or were first concentrated by precipitation with 35% (w / v) Na2S04, and resolubilization and dialysis in PBS, 5 mM NaN3. Subsequently the column was washed successively with (i) PBS, 5 mM NaN3, and (ii) PBS with 1 M NaCl. Fixed C3 is eluted with 50 mM Na borate buffer, pH 10.5, and is immediately neutralized by collection of fractions of 0.9 mi in 0.1. mi of Tris / HCl 1 M pH 7. The material is subsequently dialysed in PBS, 5 mM NaN3. Preparation of C3 Carrier of a "His Mark" A "His Mark" is a row of histidine residues that show affinity for the nickel ion carrier columns. This method has been used to aid in the isolation of expressed proteins. We consider that the above could be useful for the isolation of mutant C3 molecules expressed in such a way that we have used insert mutagenesis to generate a plasmid encoding C3 with a tail of 6 histidine residues at the carboxy terminus (immediately carboxy terminal for the residue 1663). This location was selected for the his mark to minimize interference with the synthesis, doubling, processing and formation of nascent C3 disulfide ligatures. Residue 1661 is a cysteine residue that participates in a disulfide ligation to a previous residue in the sequence (probably Cis 1537; Dol er, K. and Sottrup-Jensen, L., 1993, FEBS-Lett 315: 85-90) and therefore it seemed prudent to make the insertion beyond this structural feature. The mutation was introduced using the "Gapped-Plamis" technique that was used in Example 1, using the mutagenic oligonucleotide synthesized with the sequence: tgggtgccccaaccatcatcatcatcatcattgaccacaccccc. The incorporation of the correct sequence was confirmed by DNA sequencing. This DNA sequence can now be transferred to an expression vector. After transfection of eukaryotic cells, it should be possible to isolate C3 expressed by affinity to a nickel ion carrier column, or by any other matrix with specific affinity for the "His Mark". 9.3 Results An amount of mutant C3 was purified in Clone-3 Sepharose, including those described in Examples 1 and 2 expressed in Chinese hamster ovary cells. The products retained the ability to support the dissociation of factor B by factor D. The same method was used to isolate the mutant described in Example B2, expressed in COS cells. SDS-PAGE gel silver staining indicated that the isolates were not 100% pure, but often appeared to have a purity greater than or equal to 50%. This comes from starting materials that generally contain less than 10 μg / ml of C3 in 10% (v / v) fetal calf serum plus other cellular proteins. In addition, C3s were not degraded during isolation, and the endogenous activity of factors H and I appeared to have been eliminated. Purification by virtue of the "His Mark" involves more moderate elution conditions of a column carrying nickel ions. For example, EDTA was used. The application of this method in C3 should therefore allow the isolation without rupture of the internal ligature thiol ester. Example 10: Conjugation of C3i with antibody and use for the target C3 convertase activity against a particular cell. 10.1 Introduction One aspect of the invention is that stable C3 convertases derived from mutant C3 molecules will produce an improved conversion of C3, which, if located at a particular target site, will promote a complement-dependent attack on that target. The improved method for directing the response is to couple the mutant C3 molecule, either as the C3i or C3B derivative, to an antibody specific for the desired target. In this example, we demonstrate a functional methodology for the formation of said conjugates, which is applicable to mutant C3i or C3b molecules and can be used in material purified by affinity of an expression system, even when the thiol ester of C3 has not been fractionated in the process. When coupling C3i to an antibody that binds specifically to erythrocytes of sheep, we further show that the fixed conjugate C3i on the surface of the erythrocyte in such a way that a convertase, C3iBbP, can be formed, which initiates the lysis of these cells when other components of the complement in the form of normal guinea pig serum (in EDTA to prevent the new formation of C3 convertases). Accordingly, conjugation with antibodies can be used to direct a C3 molecule to initiate a complement-dependent attack of a particular cell type. In this example wild-type C3i, of human plasma, which forms a C3 convertase in vitro, is used. In vivo, wild type C3i and C3b are decomposed into factor H and I. Accordingly, a mutant C3 produced in accordance with the plans of the present patent, which is resistant to factors H and I and therefore forms a C3 convertase stable, would be useful in a physiological context. 10.2 Method (i) Generation and purification of C3i antibody conjugate. The antibody that was used was the IgG fraction isolated from a polyclonal anti-sheep erythrocyte rabbit antiserum. 1.1 mg were incubated with 75 nmol SPDP in conjugation buffer, pH 7.5 (20 mM KH2P04, 60 mM Na2HP04, 0.12 M NaCl) for 2 h at room temperature. PDP-IgG was purified by gene filtration on a Superosa-6 column (Pharmacia) (in a phosphate buffer, pH 7.4, with 0.5 M NaCl). The reduction of a sample with dithiothreitol was used to estimate 4 coupled PDP groups per IgG molecule. C3i was prepared by treatment of purified C3 with 0.1 M methylamine, pH 7.2 (2h at 37 ° C). Excess methylamine was removed by gel filtration followed by dialysis in conjugation buffer. 18 nmol of C3i were mixed with 1.7 nmol of PDP-IgG in 1.26 ml of conjugation buffer and incubated for 1 day at room temperature followed by 1.5 days at 4 ° C. Figure 8 shows the Coomassie Blue staining of SDS-PAGE gel of the conjugation reaction mixture showing the appearance of a species of approximately 350 kDa that was not present in PDP-IgG, nor in C3i. This species was partially purified by gel filtration on the Superosa-6 column in a phosphate buffer, pH 7.4, containing 0.5 M NaCl and subsequently dialyzed in PBS. It eluted before C3, in a volume whose molecular weight was estimated at 300-400 kDa by calibration with globular molecular weight standards. The concentrations of conjugate, antibody-free and uncoupled C3, of a Coomassie gel stain were estimated. SDS-PAGE (non-reducing conditions). Two-dimensional SDS-PAGE (the first unreduced dimension, the second reduced dimension) revealed a pattern compatible with a 1: 1 conjugate between IgG and C3i. (ii) Demonstration that the C3 antibody conjugate can be used to direct the activity of the convertase against a particular cell. μl of conjugate dilutions (0 (unconjugated), 1/100, 1/50, 1/10) were incubated with 100 μl of about 1% (v / v) sheep erythrocytes (prewashed in CFD) for one week. hour at 37 ° C. Parallel incubations were carried out with equivalent amounts of PDP-IgG (not C3) and C3 alone. The cells were then washed four times in CFD and resuspended in 100 μl of CFD-G. 50 μl of the above was lysed with 150 μl of H20, followed by the addition of 800 μl of CFD with 10 mM EDTA and guinea pig serum normal at 2% (v / v). The other 50 μl of the cells coated per conjugate were incubated for 15 minutes at 37 ° C with 50 μl of CFD-G with 190 μg / ml of factor B, 2 μg / 1 of factor D, 20 μg / 1 of properdin and 0.6 mM NiCl2, followed by lysis with 900 μl of CFD with 10 M EDTA and guinea pig serum normal at 2% (v / v). After 30 minutes at 37 ° C, the cells were agglomerated by centrifugation (2000 X g, approximately 3 minutes) and the optical absorbance of the supernatant was measured at 412 nm. As shown in Figure 9, the percentage of lysis was calculated using the samples treated with H20 as 100% lysis and a cell-free pH regulator target. The conjugate produced dose-dependent lysis, whereas PDP-IgG or C3i alone did not generate any lysis significantly higher than that observed in the absence of any such treatment. . 3 Summary of Results It was found that the method used is useful for coupling C3i to IgG, as shown by: 1. The formation of a band of adequate size (approximately 350 kDa) for a conjugate of 1: 1 C3: IgG that is sample by SDS-PAGE in Figure 8. 2. Two-dimensional SDS-PAGE (first unreduced dimension, second reduced dimension) indicated that this species contains both IgG, and C3i. 3. The elution characteristic of this species in gel filtration is consistent with a molecule of approximately 350 kDa. 4. The conjugate exhibits • a hemolytic activity that PDP-IgG or C3i do not exhibit. The hemolytic assay (Figure 9) further demonstrates that: 1. The specific anti-sheep erythrocyte antibody located C3i on the membrane of the target cell (sheep erythrocyte), preventing it from being eliminated by washing (in contrast to the C3i free). 2. The conjugate retains the activity of C3i because it is still capable of forming a C3 convertase by reaction with properdin and factors B and D. 3. This convertase can initiate an attack dependent on the complement of the target, in this case through the active -thod of the lithic path (C5-9) to lyse the erythrocyte.

Additional information from other laboratories shows that the cobra venom factor can be coupled to an antibody and that these conjugates can be directed to complement activation against a particular type of cell (Vogel, 1988, Targeted, Diagn. Ther., 1: 191-224; Muller, B. and Muller-Ruchholtz, W., 1987, Leuk, Res. 11: 461-468; Parker, CJ, White, VF and Falk, RJ, 1986, Complement 3: 223-235; Petrella , EC et al, 1987, J. Immunol, Methods 104: 159-172). As described in the present invention, these data support the argument that C3 modified to be capable of forming a stable C3 convertase, like the cobra venom factor, could be used to direct the complement-mediated response. Example 11: Demonstration that mutant C3 molecules induce the production of factor B in normal human serum. 11.1 Introduction An important purpose of the invention described herein is the depletion of the consumption of the activity of the complement of biological fluids. In the invention, methods for the manufacture of C3 molecules resistant to down-regulation of the H and I factors are described. Thus, they will fix the B factor and generate active C3 convertases. The activity of these convertases is demonstrated by the hemolytic assay employed in Example 6. A convertase of this type will therefore consume C3. If the convertase is unstable, will dissociate without a large conversion of C3. However, this will allow the fixation of fresh factor B and its conversion to Bb and Ba. Therefore, the mutant C3 will promote the consumption of factor B, finally causing the disabling of the alternating trajectory, and its inability to amplify the stimulation of the classical trajectory. If a stable C3 convertase is formed, the production of factor B will be reduced, but the consumption of C3 will be increased. Therefore, both situations may be desirable. In this example, we demonstrate that mutant C3 molecules that are modified to make them resistant to factor I, but without any alteration to modify the stability of convertase, promote the accelerated production of factor B in human serum. Wild type C3, in contrast, does not cause significant production, probably because the wild-type C3i is rapidly degraded by factors H and I. 11.2 Method Mutants were prepared as follows: Q1R2 Argl303 changed to Gln (Example 2) Q1Q2 Argl303 changed to Gln, and Argl320 changed to Gln (Example 1) E1Q2 Argl303 changed to Glu, and Argl320 changed to Gln (Example 5) As described in Example B3, all of these mutants were expressed in Chinese hamster ovary cells and subsequently purified by precipitation with Na2SO4, followed by affinity purification in Clone-3-Sepharose. The C3 wild type. (R1R2) was isolated in a similar manner. By SDS-PAGE with silver staining, the concentration of Ql was between 1/5 and 1/25 of the wild type, the concentration of Q1Q2 was approximately 1/5 with respect to that of the wild type, and the concentration of E1Q2 it was between 1/25 and 1/25 with respect to the wild type. All preparations probably contained a majority of fractionated thiol ester molecules (C3i). 10 μl of these C3 preparations were incubated with 10 μl of a 20% normal (v / v) human serum solution in PBS with 1 mM MgCl2 and approximately 300 ng of factor B labeled with 1 5 I (approximately 2-300,000 dpm) for one hour at 37 ° C. Subsequently, 5 μl was analyzed by SDS-PAGE (reducing conditions). The dried gel was exposed to the autoradiographic film to indicate the positions of the bands corresponding to the intact factor B and its cleavage products. Subsequently, they were excised and counted to determine precisely the degrees of dissociation. As background, the value obtained in the pH regulator alone was subtracted (covering not only the essential dissociation, but also the degradation products and other impurities present in the radioligand preparation). 11.3 Results The resulting degrees of factor B dissociation appear below: 1/25 wild type 1.49% 1/5 wild type 2.74% Q1R2 6.19% Q1Q2 7.41% E1Q2 6.42% Therefore, all factor resistant mutants I produce factor B dissociation levels higher than the equivalent amounts of wild type C3 (C3i). With higher doses or prolonged incubations, the total disqualification of the alternating trajectory must be produced. Abbreviations used in the previous examples include: CFD, complement fixation diluent (defined in Harrison and Lachmann, 1986, Handbook of Experimental Immunology, Fourth Edition, Ed.s Weir, Herzenberg, Blackwell and Herzenberg; Blackwell, Oxford); CFD-G, CFD with 0.1% gelatin (w / v); PBS, saline solution with phosphate buffer; NGPS, normal guinea pig serum; SDS-PAGE, SDS-polyacrylamide gel electrophoresis; SPDP, N-Succinimidyl-3- [2-pyridyldithio] propionate.

REFERENCES: 1. Bermann, M. and Fruton, J.S. (1941) Adv. Enzymol., 1: 63-98. 2. de Bruijn, MH and Frey, G.H. (1985) Prot. Nati. Acad. Sci. E.U. 82: 708-702. 3. Crawford-MH et al. (1988) Circulation. 78: 1449-58. 4. Daha, M.R. and go Es.L.A. (1982) Immunol. 43: 33-38.

. Farries, TC: Lachmann, P.J. and Harrison RA (1988) Bioche. J. 252: 47-54. 6. Farries, TC: Lachmann, P.J. and Harrison RA (1988) Biochem. J. 253: 667-75. 7. Forty, J; Hasan, R: Cary, N; White, DJ and Wall ork, J. (1992) Transplant. Proc. 24: 488-9. 8. Fritzinger, D.C. and collaborators (1992) J. Immunol. 149: 3554-3562. 9. Harrison, R.A. and Lachmann, P.J. (1980) Mol. Immunol. 17: 9-20. 10. Kalli, K.R., Hsu, P. and Fearon, D.T. (1994) Springer Semin. Immunolopathol. 15: 417-431. 11. Kinoshita, T., Takata, Y., Kozono, H., Takeda, J., Hong, KS and Inoue, K (1988) J. Immunol. 141: 3895-901. 12. McNearney, TA; Odell, C; Holers, VM; Spear, PG; Atkinson, JP (1987) J. Exp. Med. 1966: 1525-35. 13. Nicole, P.A.E. and Lachmann, P.J. (1973) Immunol. 24: 259-275. 14. Pangburn, MK and Muller-Eberhard, HJ (1984) Springer Semin. Immunopathol. 7: 163-92. 15. Rother, K. and Till, G.O. (eds) (1988) "Dicomplement System" (Springer-Verlag Berlin Heidelberg, Germany) . 16. Van den Berg, C.W. , Aerts, P.C. and Van Dijk, H. (1991) J. Immunol. Methods 136: 287-294. 17. Vogel, CW; Smith, CA, and Muller-Eberhard, HJ (1984) J. Immunol. 133: 3235-41 18. Weisman, HF et al. (1990) Science 249: 146-51. 19. Wu, R. (ed.) (1993) Methods Enzymol. 217: ch.s 12-14 (Academic Press, San Diego, E.U.) 20. Botto, M, Fong, K.Y., So, A.K. , Koch, C. and Walport, M.J. (1990) J. Exp. Med. 172: 1011-7 21. Sambrook, J., Fritsch, E.F. and Maniatis, T (1989) "Molecular Cloning, A Laboratory Manual" Second Edition (Cold Spring Harbor Laboratory Press). 22. Fishelson, Z. (1991) Mol. Immunol. 28: 545-52. 23. Taniguchi-Sidle, A and Isen an, D.E. (1993) Mol. Immunol. 30:54. 24. Bris, J. D., Avila, D., Becherer, J. D. and Muller, Eberhard, H.J. (1988) J. Biol. Chem. 263: 12147-50. 25. Taniguchi-Sidle, A and Isenman, D.E. (1993) Biol.

Chem. 267: 635-643. 26. Hofer, B. and Kuhlein, B. (1993) Methods Enzymol. 217: 173-189. 27. Morinaga, Y., Franceschini, T., Inouye, S. and Inouye, M. (1984) Bio-Technology 2: 636-639. 28. Harrison, R. A. and Lachmann, P.J. (1986) "Handbook of Experimental Immunology" (eds Weir, Herzenberg, Blackwell and Herzenberg, Blackwell, Oxford) Fourth Edition. 29. Kotwal, G., J., and Moss, B., Nature (1988) 335 (6186): 176-8.

Claims (24)

1. CLAIMS 1. A native protein of the complement pathway modified in such a way that the protein is able to form a stable C3 convertase.
2. 2. A protein according to the claim 1 which is a modified protein.
3. 3. A protein according to the claim 1 or claim 2 which is more resistant to dissociation by factor I than the native protein.
4. 4. A protein according to any of claims 1 to 3, which is a modified C3 protein.
5. 5. A protein according to the claim 4, in which the protein is modified by the replacement of Arg-1303 or Arg-1320, or both, by another amino acid.
6. 6. A protein according to the claim 5, in which Arg-1303 or Arg-1320 is replaced by glutamine, tyrosine, cystine, tryptophan, glutamic acid or glycine.
7. 7. A protein according to claim 6, wherein Arg-1320 is replaced by glutamine.
8. 8. A protein according to claim 6 or 7, wherein Arg-1303 is replaced by glutamic acid, glycine or glutamine.
9. 9. A protein according to any of the preceding claims whose susceptibility to factor H and / or factor I has been reduced relative to human C3 convertase, said protein with one or more amino acid changes related to human C3 convertase in the region corresponding to amino residues 752-754 and / or residues 758-780 of native human C3 convertase.
10. A protein according to claim 9, wherein one or more amino acid changes are changes from acidic residues of amino acids to neutral amino acid residues.
11. 11. A protein according to the claim 9 or 10, in which changes of amino acid residues are changes from Asp-Glu-Asp to Gly-Ser-Gly.
12. 12. A protein according to any of the preceding claims with amino acid changes related to native human C3 convertase in amino acid residues corresponding to residues 1427, 1431 and / or 1433 of the native human C3 convertase.
13. 13. A DNA sequence encoded for a protein according to any of claims 1 to 12.
14. 14. A DNA construct (e.g., a vector) that is characterized by a DNA sequence according to claim 13.
15. A protein according to any of claims 1 to 12, for use in therapy.
16. 16. A conjugate that is characterized as being a protein according to any of claims 1 to 12 linked to a specific binding moiety.
17. 17. A conjugate according to claim 16, wherein the specific binding moiety is a specific binding protein.
18. 18. A conjugate according to claim 17, wherein the specific binding moiety is an antibody or an antigen binding fragment thereof.
19. 19. The use of a protein according to any of claims 12, or of a conjugate according to any of claims 16 to 18 in the manufacture of a medicament for use in depletion levels of the path protein of the complement.
20. 20. The use according to claim 19, wherein the use of the medicament is to prevent rejection of foreign particles.
21. 21. The use according to claim 19, characterized by the use of the drug in the localization and / or extension of the conversion and deposition of the endogenous complement protein at a specific site.
22. 22. A pharmaceutical formulation that is characterized by one or more proteins according to any of claims 1 to 12, or a conjugate according to any of claims 16 to 18 including one or more pharmaceutically acceptable carriers or excipients.
23. 23. A pharmaceutical formulation according to claim 22, which is used in levels of complement pathway protein depletion.
24. 24. A pharmaceutical formulation according to claim 22, whose use is to locate and / or amplify the conversion and deposition of the complement protein in a specific site. 26. A method for reducing the complement pathway protein in a mammal that is characterized by administration to the mammal of a protein according to any of claims 1 to 12. 27. A method according to claim 25, wherein which protein is administered as a pharmaceutical formulation according to claim 22.