TW434256B - Antigen non-specific glycosylation inhibiting factor derivatives - Google Patents

Abstract

Antigen non-specific human glycosylation inhibiting factor derivatives having the immunosuppressive activity in which a mutation was introduced for replacement, deletion and/or insertion of a part of the amino acid sequence of SEQ ID NO:1, and/or which has received a chemical modification of one or more amino acid residue(s) in the amino acid sequence of SEQ ID NO:1, wherein the mutation and the chemical modification attenuate the strength of an intermolecular association in the region, which participates in trimerization, of an antigen non-specific human glycosylation inhibiting factor having the amino acid sequence of SEQ ID NO:1; DNAs containing a base sequence encoding the amino acid sequence of the antigen non-specific human glycosylation inhibiting factor derivative; recombinant vectors containing the DNAs; prokaryotic or eukaryotic cells transformed with the DNAs; methods of producing the antigen non-specific human glycosylation inhibiting factor derivatives; pharmaceutical compositions comprising the antigen non-specific human glycosylation inhibiting factor derivative and a pharmaceutically acceptable carrier; and methods of suppressing a human immune response to an antigen are provided.

Description

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 434256 A7 B7 V. Description of the invention (1) Field of the invention The present invention relates to an antigen non-specific glycosylation inhibitory factor (hereinafter referred to as " GIF ") derivative protein, which Can be used to suppress human immune response to antigens; related to DNAs encoding the GIF derivative protein; recombinant expression vectors containing the DNAs; cells transformed with the DNAs; a method of manufacturing the GIF derivative protein; and including the Pharmaceutical composition of GIF derivative protein "BACKGROUND OF THE INVENTION It is known that IgE antibodies to allergens (antigens) cause allergic diseases such as hay fever. The negative color of IgE antibodies in allergic diseases has increased the possibility of IgE antibody formation to regulate and suppress allergens as a basic treatment for allergic diseases. In recent years, clinical allergic patients have been repeatedly injected with small doses of allergens for desensitization. Chemical treatment. Although desensitization therapy can improve clinical signs in some patients, it involves the risk of anaphylactic shock. Therefore, desensitization treatment is only performed on a limited number of patients with adequate follow-up. To solve the foregoing problem, attempts have been made to inject modified antigens of antibodies that do not bind to natural antigens. However, the amount of IgE antibodies did not decrease in patients after treatment. At the same time, it was found that the modified antigen injected not only the helper T cells but also the non-specific suppressor T cells, and the immune non-specific suppressor T cells suppressed metastasis and formed IgE (Takatsu). And Ishizaka Journal of Immunology, 117: 211, 1976) 6 These findings suggest that if antigen-specific repressive T cells (rather than helper T cells) can be selectively induced without expanding the spread of helper T cells, then IgE formation can be suppressed. In the mid-1980s, during the study of the regulation of the formation of IgE, it was found that -4- this paper size applies to the Chinese National Standard (CNS) A4 specification (210X2.97 mm) (Please read the precautions on the back before filling this page )-Loading · 434256 A7 B7 Five 'Invention Description printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Lithium (2) Two types of T-cytokines combined with IgE for selective regulation of IgE formation. One type of IgE-binding factor enhances the formation of IgE and the other type of IgE-binding factor suppresses the formation of IgE. The structure of IgE-fortifying factor and IgE-repressor is the same in the protein part but different in the carbohydrate part. IgE. Fortification factor has high mannose N-linked carbohydrates and binds to ▲ ball aggregates extracted from cowpea. IgE_ has no affinity for gold ball agglutinates extracted from lentils (Yodoi et al., Journal of Immunology, 289, 1982). It shows that lgE · enhancement factor and IgE-repression factor have different biological properties due to different structures of their carbohydrate parts. Under physiological conditions, the glycosylation process of IgE-binding factors is controlled by two T-cytokines that can enhance or inhibit this process. Factors that enhance glycosylation to produce IgE-fortifying factors are confirmed to be glycosylation enhancing factors (GEF) and factors that inhibit glycosylation to produce IgE-repressive factors are confirmed to be glycosylation inhibitory factors (GIF). In experimental animals, GEF is often produced when IgE formation is enhanced and GIF is often produced when IgE formation is suppressed. It is therefore believed that the balance between GEF and GIF can determine the nature of the IgE binding factor and thus control IgE formation. Subsequent research has shown that GIF-produced T cells are antigen-specific repressed T cells (Jardieu et al., Journal of Immunology, 133: 3266, 1984). In studies using ovalbumin (OVA) -specific suppressive T-cell fusion tumors, it was found that the cells can produce GIF and that GIF is not specific for antigen (antigen non-specific GIF). It was also found that the production of GIF (antigen-specific QIF) with affinity for ovalbumin can be slandered by ovalbumin and antigen-existing cells stimulating the cells. The antigen-specific GIF is composed of an antigen-binding polypeptide chain and a non-specific GIF (Jardieu and Ishizaka. The paper size is characterized by the multi-pronged toe, applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the notes on the back before filling this page)

Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 434256 A7 B7 V. Invention Description (3) Immunomodulation, published by Goldstein et al., Published by Alan R. Liss, p. 595, 1987). It shows that antigen-specific GIFs and antigen-specific repressive T-cytokines co-distribute common antigenic determinants (Steele, JK et al., Journal of Immunology, 142: 22Π, 1989) and that antigen-specific GIFs use antigen (vehicle) -Suppress antibody responses in a specific manner (Jardieu, P. et al .; Journal of Immunology, 1M: 1494, 1987). It was also found that the production of ovalbumin · specific GIF was caused by injection of non-specific GIF into ovalbumin-introduced mice and then spleen cells were stimulated with ovalbumin (Akasalci, M. et al., Journal of Immunology, 1M: 3172, 1986). Recently, the present inventors successfully isolated GIF from murine repressed T cells and propagated murine antigen non-specific GIF genes. Furthermore, they have obtained human genes by using the GIF gene as a probe (Mikayama, T. et al., Proc. Natl. Acad. Sci. USA, ㊈: 10056, 1993). When the gene is directly expressed in E. coli or animal cells by genetic recombination technology, the recombinant GIF produced has extremely low biological activity compared to the GIF derived from the repressed T cells. Only when the gene is expressed in an animal host cell as a fusion protein translocated to the endoplasmic reticulum can the resulting recombinant GIF exhibit comparable biological activity to that of GIF derived from the suppressive T cells. Subsequently, it was shown that certain post-translational modifications of GIF peptides are needed to produce sufficiently high biological activity (Liu, Y-C, et al., Proc. Natl. Acad. Sci. USA, Red: 11227, 1994). As for the structure of GIF, it is difficult to complete with a limited amount of purified protein, so the necessary structure for biological activity is still unknown. Antigen-specific GIF injection itself may be used in the treatment of allergies. Anti--6-This paper size applies to China National Standard (CNS) A4 (210X297 mm) (Please read the notes on the back before filling out this page) Bu Gan 434256 A7 B7 V. Description of the invention (4) The non-specific GIF of the T cell of the original specific suppressor is very effective. This type of treatment requires the use of recombinant DN A technology to generate a large number of GIFs with sufficient biological activity. However, as the molecular mechanism for generating highly biologically active GIF is unknown, no one has successfully produced recombinant GIF derivatives with sufficiently high biological activity. . SUMMARY OF THE INVENTION One object of the present invention is to provide a GIF derivative with high biological activity. Another object of the present invention is to provide a material that is not required by programs and hosts and methods to produce a large number of GIF derivatives with high biological activity. The method of the invention 0 Another object of the present invention is to provide a medical composition for suppressing an immune response to an antigen such as an allergic disease. The present invention can produce a GIF derivative protein with high immune and repressive activity on a large scale. The GIF derivative protein can be used for treating and / or preventing allergic diseases and the like. The diagram is simply printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page). Figure i shows the differentiation of pepsin-digested recombinant GIF peptide fragments in super ODS columns Graphic and amino acid sequence of the peptide fragment. Figure 2 shows the molecular weight distributions of recombinant GIF (wild type) and C57A / N106S-GIF as measured by light scattering. Figure 3 shows the differentiation pattern of carboxymethylated recombinant GIF in a CM-5PW column. Figure 4 shows the differentiation of pyridine-ethylated recombinant GIF in the CM-5PW column. -7- This paper size applies the Chinese National Standard (CNS) A4 specification (2! 0X297 mm) 434256 A7 B7 V. Description of the invention ( 5) 阖 -shaped β Figure 5 shows the effect of a GIF derivative (C57A / N106S-GIF) on an allergic reaction (active skin allergen). Figure 6 shows the effect of GIF derivatives (C57A / N106S) on insulin-related diabetes diabetes. Detailed description of the invention " When GIF is produced by heavy body DNA technology, the GIF produced by the former has a lower biological activity than the GIF produced by the suppressive T cell fusion tumor, but when GIF is produced in mammalian host cells, Except for the secretion and expression of the protein form of a single peptide for secretion. The inventors have discovered that this does not originate from unwanted intramolecular disulfide bonds that often occur in heavy carcass proteins, but GIF molecules form trimers by linking to themselves in a way that is not regulated by disulfide bonds. Thing. In addition, it was found that GIF derivatives with high biological activity can be obtained by introducing mutations and / or chemical modifications. The present invention has been completed based on these findings. The objectives of the present invention are as follows: Printed by the Consumers' Cooperative of the Ministry of Health and Economics of China (1) An antigen non-specific human glycosylation inhibitory factor derivative with immunosuppressive activity, in which mutations are introduced to replace, Deletion and / or insertion of the amino acid sequence portion of SEQ ID No. 1 and / or chemical modification of one or more amino acid residues in the amino acid sequence of SEQ ID No. 1; Mutation and / or chemical modification can enhance the biological activity and immunosuppressive effect of wild-type non-specific human glycosylation inhibitory factor 4 with amino acid sequence of SEQ ID No. 1 (2) — a kind containing immunosuppression Active Antigen Non-specific Human Glycosylation Inhibitory Factor Derivative Amino Acid Sequence Encoding Nucleotide Sequence -8- This paper size applies to China National Standard (CNS) 8-4 (210X297 mm) 43425 6 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (6) DNA, in which mutations are introduced to replace, delete and / or insert the amino acid sequence portion of SEQ ID No. 1 and / or Its S EQ ID No. 1 amino acid sequence accepts chemical modification of one or more amino acid residues; wherein mutation and / or chemical modification can enhance wild type non-specificity with amino acid sequence of SEQ ID No. 1 Biological activity and immunosuppressive effect of human glycosylation inhibitory factor. (3)-a recombinant vector containing the DNA of (2). (4) — A kind of prokaryotic or nucleus nuclear cell transformed with the DNA of (2). (5) A method for producing non-specific antigen-specific human glycofenation-inhibiting derivative, including culturing prokaryotic or sclerotinic cells of (4) and isolating and purifying the generated non-specific human glycocalyx Derivatives of chelation inhibitors. (6) A method for producing a non-specific antigenic human glycosylation inhibitory factor derivative, including a method of weakening the strength of the intermolecular synergy in the region involved in the trimerization of the inhibitory factor or its derivative The chemical modification of the antigen is a non-specific human glycosylation inhibitor or a derivative thereof. (7) A pharmaceutical composition comprising the antigen non-specific human glycation inhibitory factor derivative of (1) and a pharmaceutically acceptable carrier. (8) A method for suppressing the human immune response to an antigen, comprising administering to the human an immunosuppressive effective amount of (1) an antigen non-specific human glycosylation inhibitory factor derivative. The present invention will now be described in more detail. The present invention provides a GIF derivative protein (hereinafter referred to as "the protein of the present invention") having high immunosuppressive activity regardless of the host and the manufacturing method. The immunosuppressive activity of GIF (hereinafter, "GIF activity" is defined as In the living body-9- This paper size is applicable to China National Standard String (CNS) A4 specifications (210 > < 297mm) (Please read the note ^ | ^ on the back before filling this page}

434256 Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (7) Represses the activity of specific antibodies formed by immunoglobulins E and G classified as antigens. This activity can be measured by the ability to produce glycosylated IgE-binding factor murine T-cell fusion tumor 12H5 cells in vitro to produce non-glycosylated IgE-knotting factor (Iwata and Ishizaka, Journal of Immunology, 3270, 1988) ° The protein of the present invention is an antigen non-specific human glycosylation inhibitory factor derivative with immunosuppressive activity, in which mutations are introduced to replace, delete and / or insert SEQ ID No. 1 The amino acid sequence portion of the amino acid sequence, and / or accepting chemical modification of one or more amino acid residues in the amino acid sequence of SEQ ID No. 1. The mutation and / or chemical modification results in an enhanced biological activity of the GIF molecule and enables the strength of intermolecular synergy in the region involved in the non-specific human glycosylation inhibitory trimerization of the antigen containing the amino acid sequence of SEQ ID No. 1 Weaken. The intensity of intermolecular synergy can be measured by light scattering, analytical ultracentrifugation, crystallographic analysis, etc. and can exhibit high GIF activity when less than 614. , Deletion and insertion of at least one amino acid residue that can change intermolecular interactions, especially due to hydrogen bonding formation and hydrophobic interactions. Examples of mutations include substitutions, deletions, insertions, and additions that can change the polarity of the regions involved in the synergy (such as replacing natural amino acid residues with charged amino acid residues and vice versa, inserting or deleting charged Amino acid residues, etc.), replacing amino acid residues with amino acids having side chains of different lengths in regions involved in synergy. Another example is to make the paper size outside the area of interest but still within the area that can affect the strength of the weakening synergy -10- This paper size applies the Chinese National Standard (CNS) A4 specification (21 × 297 mm) 1! -nf [-In J «y'r \ (Please read the notes on the back before filling out this page)! r 434256 Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of the invention (8) Amine Mutation of amino acid residues. Preferred mutation positions include amino acid residues in regions that are believed to be involved in intermolecular synergy of trimerization, their near regions, and regions that affect the structure of the region. Examples of regions that are believed to participate in inter-molecular synergy include positions 37-45, 47-50, 94-98, and 106-110 that can participate in the formation of intermolecular hydrogen bonding networks, and the main factors that can participate in the distribution are SEQ ID Specific examples of mutations at positions 39, 48, 50, 57 and 59 due to the hydrophobic interaction of the amino acid sequence of number 1 include a substitution of cysteine at position 57 with an alanine or serine residue Acid residues, replacing the cysteine and aspartate amino residues with alanine and serine residues at positions 57 and 106, respectively. Modifications that weaken intermolecular synergy include hitherto known and can increase or Selective chemical modification of the amino acid residues of the amino acid residues to be modified or the hydrophobic nature of the protein to be modified, such as phosphating and alkylation of cysteine residues, Tritium modification. Specific examples of modification include carboxymethylation, pyridylethylation, and ethylmercury thiosalicylate (EMTS) or 5,5, -di-selective chemical modification of cysteine residues Thiobis (2-nitrobenzoic acid) (DTNB), Acetylation and formazanation of N-terminal modification. Selective chemical modification can be applied not only to GIF proteins containing wild-type amino acid sequences, but also to amino acids introduced with substitution, deletion, and / or insertion of wild-type GIF (SEQ ID No. 1) Sequence-dependent GIF protein. Examples of chemical modification of the mutant GIF protein include (but are not limited to) substitution of the cysteine residue at position 57 with a propionate residue and the cysteine and aspartate ammonia residues at positions 5 7 and 106 Based on the two paper sizes applicable to the Chinese National Standard (CNS) A4 specification (2Ϊ0 × 297 mm) (please read the note on the back before filling this page)

§ A7 B7 5. Description of the invention (9) Carboxymethylation of mutant GIF with amino acid and serine residues. The present invention also provides DNAs (hereinafter referred to as " DNAs of the present invention) that can encode proteins of GIF derivatives having high immunosuppressive activity. The DNAs of the present invention are nucleotide sequences containing amino acid sequences that encode non-specific human glycosylation inhibitory factor derivatives that have immunosuppressive activity against glycosylation inhibitory factors. Deletion and / or insertion of the amino acid sequence portion of SEQ ID No. 1, wherein the mutation causes the inhibition of non-specific human glycosylation, particularly involving antigens containing the amino acid sequence of SEQ ID No. 1 The strength of the intermolecular synergy in the terpolymerized area is reduced. These DNAs can use a known GIF cDNA (Mikayama, T. et al., Above) to guide the genetic position to burst, chemically synthesize a portion of the DNA containing a mutation position of interest and the corresponding position of the GIF cDNA is replaced by synthetic DNA , Or by complete chemical synthesis. Printed by the Consumers' Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back before filling out this page) The DNAs of the present invention include any DNAs that have been degenerate due to gene coding. When the preferred codons of the host to which the protein is to be expressed are selected to use part or all of the GIF-coding region, the degree of protein expression can be improved. In particular, in the case where a better codon system is selected for a part of the GIF coding region, it can be effectively selected for the N-terminal coding region. Examples of DNAs of the present invention include DNAs containing a nucleotide sequence of SEQ ID No. 2, 3, or 20. The DMAs of the present invention can be inserted at a restricted position and / or DNA is added to construct a performance vector to accelerate performance and End position. The present invention provides a vector incorporating the DNA of the present invention, and the place transformed with the vector-12. This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) 434256 A7 B7 V. Description of the invention (10) Main cells And a method for producing a protein of the present invention, which comprises culturing the host cell and isolating and purifying the produced protein of the present invention. As for the host cell, cells of prokaryotic organisms (such as bacteria, preferably Escherichia coli), and prionoid organisms (such as yeast, insects, and mammals) can be used. Examples of mammalian cells include cos cells, Chinese voles ovary cells, X63-6.5.3 cells, C-127 cells, BHK (young voles kidney) cells, human-derived cells (such as HeLa cells), and the like. Examples of the yeast include Saccharomyces cereviside, pichia pastoris, and the like. Examples of insect cells include Bombyx mori culture cells (such as Sf21 cells) and the like. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) The vectors used to transform these host cells include pKC30 (Shimatake Η. And M. Rosenberg's Nature, 292: 128 , 1981) and pTrc99A (Gene of Amanri E et al., Color: 69, 301, 1988), etc. are used for expression in coliform bacteria; pCAGGS (Gene of Niwa et al., 108: 193, 1991) and pcDL_SR〇c296 ( Takebe et al., Mol, Cell · Biol., 466, 1988) and others for expression in mammalian cells; pG-1 (Schena M · and Yamamoto KR, Science, 241_: 965, 1988) and others for expression in yeast And transfer vector pAc3 < 73 for recombinant virus preparation (Luckow et al. Bio / Technology, Color: 47, 1988) and others for silkworm cultured cells. These vectors may contain a source of replication, a selectable marker, a promoter if necessary. Vectors for t-nucleus cell t expression can contain RNA junctions, polyadenylation signals, etc. if needed6 As for the source of replication, those derived from SV40, adenovirus and bovine papilloma virus can be used in mammalian cells The genre of performance is derived from ColEl's -13- This paper size applies the Chinese National Standard (CMS) A4 specification (210X297 mm) 43 42 56? A7 B7 V. Description of the invention (11) The reproduction source can use the R factor and F factor, used as a carrier for E. coli. Replication sources derived from 2mDNA and ARS1 can be used as vectors for expression in yeast. As for the promoter used for gene expression, vectors derived from viruses such as retroviral virus, polymorphovirus, adenovirus, SV40, etc., and chromosomal derived (such as EFloc) for expression in mammalian cells can be used. As a promoter derived from phage lambda trp, lpp, lac, and tac promoters can be used as vectors for expression in coliform bacteria. ADH, PH05, GPD, PGK, and MAF motifs can be used as vectors for expression in S. cerevisiae and AOX1 promoters as vectors for expression in Pichia pastoris. Promoters derived from nuclear succulent virus and the like can be used as vectors for expression in cultured silkworm cells. As for the selectable marker, anti-neomycin (neo) -gene, chest pain bite kinase (TK) gene, dihydrofolate reductase (DHFR) gene, Escherichia coli xanthine urine phosphoribosyl transferase (Ecogpt) can be used Genes are used as vectors for expression in mammalian cells. Anti-kanamycin genes, ampicillin-resistant genes, and tetracycline-resistant genes can be used as vectors for expression in coliform bacteria. Leu2, Trp 1, Ura3 genes and other vectors that can be used for expression in yeast "The protein of the present invention produced by the aforementioned host-vector system can be obtained as follows: printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs at the appropriate location to incorporate the DNA of the present invention The recombinant DNA transforms the host cell and is subsequently cultured, followed by isolation and purification of the protein of the invention from the cultured cell or culture medium. The protein can be produced using a combination of known procedures and techniques. Purification technology includes processes commonly used to purify proteins (ion exchange layer-14- This paper size applies to Chinese National Standard (CNS) A4 specifications (21 × 29? Mm) 434256 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Α7 Β7 V. Description of the invention (12) Analytical method, hydrophobic interaction chromatography, gel permeation chromatography, reverse phase chromatography, isoelectric chromatography, preparative chromatography, isoelectrophoresis, etc.) and combination. The purification method includes an affinity / purification method using a GIF-recognizing antibody (WO 94/26923). The present invention also provides a method for producing a chemically modified protein of the present invention, which comprises making a GIF or a derivative thereof containing a wild-type amino acid sequence to specifically participate in an antigen non-specific human glycosylation inhibitor or a derivative thereof Tertiary polymerization is chemically modified in such a way that the intensity of intermolecular synergy is weakened. More specifically, the protein of the present invention can be prepared by incorporating a modifying group that can increase or decrease the charge or hydrophobic nature of the amino acid residue to be modified into a GIF or a derivative thereof containing a wild-type amino acid sequence, and The product was then isolated and purified. Specific examples of chemical modification include phosphorylation, alkylation, tritiation, EMTS- or DTNB-modification, etc .; more specific examples include carboxymethylation and pyridine ethylation for cysteine residues. Selective chemical modification of the base, acetylation for N-terminal modification, and formazanation. Phosphorylation can be performed by an enzymatic reaction in which the γ group of ATP is transferred to the hydroxyl group of serine, threonine, or tyrosine by a protein kinase. The SH-based delivery reaction may contain a dentified alkyl compound (monoiodoacetic acid and its amines, monobromo-6 acid and its amines, α-iodopropionic acid, bromoethylamine, monoacetic acid, and gas dibenzoyl Ketones, etc.). For example, lipids such as farnesyl can be introduced with farnesyl bromide. Modification of the amine group can be carried out with aliphatic aldehydes, ketones, etc. containing carbonyl groups. It can be carboxylic anhydride, carboxylic acid gas, or dehydration condensation agent such as carboxylic acid and carbon-15. This paper applies Chinese national standards (CNS > Α4) Specifications < 210X297 mm).,-,! --- oiII {Please read the precautions on the back before filling this page) Order 4342 © fei A7 B7 V. Description of the invention (13) (Please read the precautions on the back first (Fill in this page again) The combination of two imines is carried out by a reaction in which a hydrogen atom of a hydroxyl group, a sulfo group, or an amine group is replaced by a fluorenyl group. For example, N-acetamidoimidazole, N-acetamidosuccinimide, and the like can be used for ethylamidine. Condensation of polyethylene glycol having a carboxyl group at the end with N · hydroxybutanediamine through the use of carbodiimide through dehydration can generate an activated PEG that can react with amino acids and the activated PEG can be added to the protein N-terminal. Glycine can be added to the N-terminus of the protein to carry out myristylation; or in the examples of threonine, lysine, cysteine, etc., browning, retinoication, and lipolysis can be performed. . Thiol reagents such as EMTS or DTNB or methyl thiosulfate can be used to modify cysteine residues of proteins. Modifications with macromolecular compounds Specific examples include methods of combining soluble dextrin (Wileman, TE et al. Medicine Journal of Pharmacology, Society: 85, 198! 2) 'Method of using poly-DL-propionic acid (Ur en, J_R_ et al. Cancer Res., 42: 4068, 1982) ^ »Consumption by Employees of Central Bureau of Standards, Ministry of Economic Affairs The extent of the cooperative printing modification can be evaluated by measuring the amount of unreactive reactive groups of the protein. For example, the unreacted SH group can be determined by the Ilmen method (Glazer, AN, Protein, 3rd Edition, II, Research Institute Publication, Japan, 1976). In this case, the free SH group of the cysteine residue Modified with monoiodoacetic acid or 4-vinylpyridine and then S-carboxymethylated or S-pyridylethylated. When threonine residues are modified with iodinating agents (such as triiodide ion (Γ3), iodine gas, etc.), histidine residues are modified with diethyl pyroate, and arginine residues are modified with phenylethylene glycol. In aldehyde modification, the amount of unreacted amino acid residues can be evaluated by amino acid composition analysis or by changes in ultraviolet absorption spectrum. In the case of a large change in the molecular weight of a protein caused by the modification, the degree of modification can be traced to the modified egg- 16- This paper size applies to Chinese national standards (CNS > A4 size (210X297 mm) 43-42 5 6 A7 B7 V. Description of the invention (14) White matter is dodecanosyl sulfate polyacrylamide gel electrophoresis ( SDS-P AGE). The peptide map can be used to determine which amino acid residues are modified. Modified proteins can be isolated and purified by known procedures and techniques and combinations thereof, such as borrowing genes A narrator related to a method for recombination to produce the mutant protein of the present invention. Printed by the Consumer Cooperative of the Central Bureau of the Ministry of Economic Affairs of the People's Republic of China The present invention also provides a medicinal composition containing the protein of the present invention as an active ingredient Doctor (Composition). The pharmaceutical composition of the present invention can be used for immunosuppression, more specifically, it can be used to alleviate and / or prevent unwanted immune response in humans to be treated. The unwanted immune response, that is, the poor response to the antigen Immune response, including rheumatoid arthritis, autoimmune diseases such as multiple sclerosis, diabetes, etc .; allergic diseases to various antigens, host-to-migration (HVG) and graft-to-host rejection, etc. In the specific examples of the present invention, The pharmaceutical composition of the present invention can be used to treat and / or prevent diabetes. The present invention encompasses a pharmaceutical composition including a therapeutically effective amount of the protein of the present invention and a pharmaceutically acceptable carrier. The medical composition may contain a diluent and be antiseptic Agents, stabilizers, emulsifiers and other auxiliaries. The term "therapeutically effective amount" means an amount that can provide a therapeutic effect under given conditions by administration of the drug. The pharmaceutical composition can be in a liquid, lipophilic, or dry form The preparation can be equipped with the following ingredients: selected from buffers with various pH and ionic strength such as Tris-HCl, diluent of acetate and phosphate Additives to prevent surface adsorption such as albumin and gelatin, surfactants such as Tween 20, Tween 80, Pluronic F68 and bile acid salts; stabilizers such as glycerin and polyethylene glycol; antioxidants such as ascorbic acid and sodium metabisulfite;- 17- Chinese National Standard (CNS) A4 size of this paper (210X297 Gongchu) ': 43 42_ Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (15) Preservatives such as thimerosal, benzyl alcohol and Parabens; carriers and tonicity agents such as lactose and mannitol. The protein of the present invention as an active ingredient can form complexes with metal ions, and can be incorporated into polymer compounds such as polylactic acid, polyethanol or hydrogel The granule preparation may be adsorbed on the surface, or may be incorporated into lipids, microemulsions, microcells, monolayer or multilayer carriers, erythrocyte membrane skeletal cells, and spheroidal protoplasts. Since the pharmaceutical composition affects the physiological state, solubility, release rate in the living body and the gap between the protein of the present invention in the living body, the choice of the pharmaceutical composition depends on the physical and chemical properties of the protein as the active ingredient. The pharmaceutical composition can be administered transplumonarily 'nasally, orally' intravenously, intraperitoneally, intramuscularly, subcutaneously, intraorally or percutaneously. It can be granular and can be provided with a protective coating, protease inhibitor or absorption enhancer if necessary, depending on the route of administration. The protein of the present invention is usually administered in a variable dose of 0.001 mg / kg to 2 mg / kg, one or more doses per day, for one or more days, depending on the patient's age, condition, gender, and degree of disease and administration Depending on the route 0 The plastid YN106 containing the human glycosylation inhibitor cDNA of SEQ ID No. 1 inserted into the pBlueScript-SK vector has been deposited with the Food Industry Research and Development Institute under the accession number 94〇110 (registration date: 1996 1 (December 12) The present invention will be described in more detail with reference to the following examples, which are only for illustration purposes and are not intended to limit the scope of the present invention. Example 1 -18- This paper size is applicable to Chinese National Standard (CNS) A4 specification (210X297 mm) ---- 『一 I ^ --- OAI— (Please read the precautions on the back before filling this page) I order 4342S6. A7 B7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (16) Performance of GIF derivatives with cysteine residue substitution in E. coli A. Construction of the performance system This example is related Performance of GIF derivatives with cysteine residue substitution. The three cysteine residues at positions 37 to 60 and 81 of the GIF polypeptide were introduced into nucleotides by introducing mutations into the nucleotides at the relative positions of the GIF gene of SEQ ID No. 1, each of which was replaced with an alanine residue β The expression vector pTMK-hGIF was prepared from deposited plastid YN106 according to the following procedure described in WO 94/26923. The plastid YN106 induces renaturation with oligonucleotide: 5'- AACCTTAAGAAAAACCAAGGAGGTAATAAATAATG CCGATGTTCATCGTAAACACCAACG-3 '3'- CACCCGACCTTGTTGAGGTGGAAGCGGATTATCCCTAGGCAA-5, which are introduced by phosphoramidite method (Tctetrah et al.) ., 24: 245-248, 1983). For better bacterial performance, the 5'-end introduces the sequence containing Shine-Dalgano (Scherer, et al., Nucl_ Acids, Res., 8: 3895-3950, 1980) and each The primers contain AIII and BamHI positions, respectively. The human GIF cDNA was amplified using polymerase chain reaction (PCR) (Mullis et al., Method in Enzymol, 155: 355-3 50, 1987). Unless otherwise stated, the denaturation step was set to 94 in each PCR cycle. ° C for 1 minute and elongation was set at 726C for 2 minutes. The temperature and time of renaturation can vary based on the evaluation requirements of several different PCRs to be performed simultaneously. The self-reaction often represents a compromise. The enlarged cDNA fragment isolated from the fungus gel was digested with Aflll and BamHI-19- --- J --- ^ --- II (Please read the precautions on the back before filling this page) .1 Order_ 1 · This paper size applies Chinese national standard ((: yang) /! 14 size (210/297 mm) 43 42 5 i Printed by A7 B7, Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs, 5. Description of invention (17), and The pST811 vector with a Trp promoter and a TrpA terminator inserted at the unique positions of ΑΠΙΙ and BamHI (Fig. 3, Japanese Patent Application Publication No. 63-269983). This new plastid, called pTMK-hGIF, is transformed to inverse RRI E. coli host-cell. The selection of plastid-containing cells is based on ampicillin resistance (the marker gene contained on the pST8U vector). Synthetic oligonucleotides and the DNA sequence of the entire human GIF gene can be Confirmed by DN A sequencing of plastid DNA. Polymerase bond reaction (PCR, Mullis et al., Method in Enzymol, 155: 355, 1987) uses pTMK-hGIF, which is a plastid expressing agent (WO 94/26923 ibid.) Performed as template DNA, the expression plastid pTMK-hGIF includes the expression vector PST811 inserted for expression in E. coli Human GIF cDNA (Japanese Unexamined Patent Publication No. Sho 63-269983) can also use the following oligonucleotide primers: 5'- aaccttaagaaaaaccaaggaggtaataaAtaatgccgatgttcatcg TAAACACCAACG-3 (primer # 1 *. SEQ1T ^ 14) 3. ·-CTCGGGCGGCGCGAGACGTCGGAC ~ 5 ' (SEQ ID No .: 5) Each PCR cycle includes denaturation at 95 ° C for 1 minute, renaturation at 56 ° C for 2 minutes, and elongation at 72 ° C for 2 minutes. All PCR stages are performed under the same conditions as above. The DNA fragment was recovered from the fungus gel and digested with Aflll and PstI. In another step, pTMK-hGIF was cut with PstI and BamHI and the 31-terminal DNA fragment of the GIF cDNA was recovered. These fragments were inserted using DNA ligase to AfHI and BamHI cut off PST811 »The resulting expression plastid contains a human GIF cDNA in which the cysteine residue at position 57 is replaced with an alanine residue, as shown in SEQ ID No. 2 and it is called pC57A-hGIF. -20- This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling in this purchase)

4342 © @ Printed by A7 B7, Consumer Cooperatives, Central Standards Bureau, Ministry of Economic Affairs 5. Description of the Invention (18) In a similar method, a human having a cysteine residue at position 60 in which the cysteine residue is replaced by an alanine residue is constructed in the following manner. GIF cDNA expression plasmid pC60A-hGIF ^ PCR was performed using pTMK-hGIE as a template, but primer # 1 and the following oligonucleotide primers can also be used: 3, -CGCGAGCGATCGGACGTGTCGTAG-5 '(SEQ ID No .: 6) Recovered The enlarged DNA fragment was digested with Aflll and Nhel. The 3'-end DNA fragment was prepared using the following primers: 5'-GQGCTCGCTAGCCTGCACAGCATC-3 '(SEQ ID No .: 7) S ^ CACCCGACCTTGTTGAGGTGGAAGCGGATTATCCCTAGGCAA-S' ^ l Sub # 2: (SEQ ID No .: 8) The enlarged DNA fragments were recovered and digested with Nhel and BamHI, and these fragments were inserted into the vector pST811 which had been cut by Aflll and BamHI. Construct a plastid pC81A-hGIF containing a human GIF cDNA in which the cysteine residue at position 81 is replaced with an alanine residue as follows: PCR was performed using pTMK-hGIF as a template, but primer # 1 can also be used And the following primers: 3, -GGCCAGCAGGCCGGCTAGCAGCTT-5i (SEQ ID No .: 9) The enlarged DNA fragment was recovered and digested with AIII and Nhel. The 3 · -terminal DNA fragment was prepared using primer # 2 and the following primers: 5, -AAGCTGCTAGCCGGOCTGCTGGCC-3 '(SEQ ID No .: 10) The enlarged DNA fragment was recovered and digested with Nhel and BamHI. These fragments were inserted into Aflll And the BamHI cut vector pST811, "each expressed plastid transformed into a reactive RR1 E. coli host cell. -21-The A degree of this paper applies the Chinese national standard (CNS > A4 size (210X 297 mm) nn (tl (nn nf r—44 J ^ '* 1 ^ m 1,, J /. (Please read the back first Please pay attention to this page before filling in this page) Order 4342SS 'Printed by A7 B7, Shellfish Consumer Cooperative, Central Bureau of Standards, Ministry of Economic Affairs 5. Description of the invention (19) DNA sequence of primers used to construct the expression system and DNA of DNA fragments enlarged by PCR The sequence is confirmed by the conventional DNA sequencing method. Β Β. Culture of E. coli producing GIF derivatives. E. coli containing pC57A-hGIF, pC60A-hGIF or pC81 A-hGIF at 37 ° C. 50 mg / L ampicillin was cultured overnight in 20 ml of Luria broth. The inoculum medium was moved to 0.8% glucose, 0.4% casaminoacid, 10 mg / L seromine And 1 mg of M9 broth made of glucosamine and 50 mg / L ampicillin and cultured at 37 SC for 3 hours. At the end of the initial culture, add "5 丨 inulin and culture the medium at 37 ° C for another 5 Hour 0 Example 2 Purification of Recombinant GIF Derivative Products This example relates to the purification of recombinant GIF derivatives expressed in coliform bacteria The method of injecting protein into the living body to the extent that about 5 grams of wet weight of the E. coli cells cultured in Example 1 was collected and suspended in 30 ml of water, followed by French-Press (repeat 4 times at 8000 psi) Disruption. Centrifuge at 15000Xg for 1 minute to separate the supernatant and the ruptured cell pellets. Recover the supernatant. Determine the performance of the GIF derivative protein by SDS-PAGE. Name the GIF derivative protein encoded in the plastid pC57A-hGIF It is C57A-GIF. Similarly, GIF derivative proteins encoded in pC60A-hGIF and pC81A-hGIF expressing plastids are named C60 A-GIF and C81A-GIF, respectively. For GIF derivative protein_add sodium acetate Buffer solution (PH 5.5) to final concentration -22- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before filling this page) Order 434250 A7 B7 V. Invention Explanation (20). The degree of 20 mM and the resulting solution was applied to a CM-Sepharose Fast Flow (Pharmacia) column (5 X 18 cm) which had been equilibrated with the same buffer solution. The column was 20 mM sodium acetate buffer (pH 5.5) and 0_3 M NaCl in 20 mM sodium acetate The washing solution (pH 5.5) was washed at a flow rate of 2 ml / min. The GIF derivative protein was dissolved with 0-5 M NaCl in 20 mM sodium acetate buffer solution (pH 5.5). The dissociation was dialyzed against 100 volumes of 20 mM sodium 6 buffer (pH 5.5) and applied to a TOSOH CM-5PW (TOSOH) column (0.75 x 75 cm) equilibrated with the same buffer solution. The flow rate in ml / min was washed with 20 mM sodium acetate buffer (pH 5.5) and the GIF derivative protein was isolated at room temperature with a gradient of 0 to 0.5 M NaCl. Determination of the differentiation of proteins containing GIF derivatives by SDS-PAGE and Western blotting techniques using anti-GIF antibodies (WO 94/26923, ibid.) The purity of C57A-GIF, C60A-GIF and C81A-GIF obtained by the above procedure The determination is higher than 99%. After the buffer solution was replaced by dialysis PBS solution, the samples were stored. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. In order to completely remove endotoxin derived from E. coli, 1/10 volume of PyroSep C was added to the purified sample. (DAICEL Chemical Industries) and the mixture is stirred for 1-12 hours if necessary. The supernatant liquid was recovered and the amount of endotoxin was determined by Limulus ES-II single test (Wako Pure Chemical Industries, Ltd.). The concentration of the GIF derivative protein was determined by measuring the absorbance at a wavelength of 280 nm and calculating using the Mohr extinction coefficient of each derivative obtained from the amino acid combination analysis. Example 3 Biological Activity of GIF Derivatives of Children's Organs-23- This paper size applies to Chinese National Standard (CNS) A4 (210 X 297 mm) 4 ϊ 4.2 Bismuth © Α7 Β7 V. Description of the Invention (21) (please first (Please read the notes on the back and fill in this page again) This example is related to the in vivo activity of the recombinant GIF derivative prepared in Example 2. The in vivo IgE antibody formation inhibitory activity of the recombinant GIF derivative was evaluated. The control group used in the activity comparison was a recombinant human GIF protein derived from E. coli containing a wild-type amino acid sequence that has been found to have in vivo IgE and IgG1 antibody formation inhibitory activity, according to Examples 1B and 2 It was prepared by the same procedure, but the plastid was pTMK-hGIF (W0 94/26923, ibid.) ° BDF1 mice were immunized by intraperineal injection of 0.1 microgram DNP-ovalbumin adsorbed to 1 mg of alum. Recombinant GIF and its derivatives were injected i.p. 1 day before immunization and at 0, 1, 2, 3, 4, 6, 8 and 10 days. Control mice received only PBS. After two and three weeks of immunization, blood was collected from each mouse and the amounts of anti-DNP-IgE and anti-DNP-IgG1 in the serum were measured by ELISA. The results showed that C57A-GIF was more active than the control recombinant GIF (Table 1). The Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs printed this cytokine to switch the formation of glycosylated IgE-binding factor to the formation of unglycosylated IgE-binding factor. The ability of the murine T cell fusion tumor 12H5 cells to analyze the same GIF biological activity of preparations (Iwata et al., Journal of Immunology, 2534, 1988). The entire fused tumor cell supernatant was cultured at 10 µg / ml mouse IgE for 24 hours in the presence of the sample to be tested. The supernatant on the medium was filtered through a CF5GA membrane and the IgE-binding factor in the filtrate was partitioned on the exogenous lectin Sepharose (Yodoi et al., Journal of Immunology, 125: 1436, 1980). The flower-shaped inhibition technique is used to analyze the factors that pass through the differentiation and the factors that remain on the column. If a sufficient amount of GIF is present in the test sample, the main IgE-binding factor formed by 12H5 cells lacks affinity for lentin exogenous lectin ^ 24-This paper size applies to Chinese National Standard (CNS) A4 (2 丨 0X297mm) 3 4

42 © I A7 B7 V. Description of the invention (22) (please read the notes on the back before filling out this page) and recover and pass through the distinctions (Iwata and Ishizaka, Journal of Immunology 141: 3270, 1988). The minimum concentrations of wild-type GIF or its derivatives for detecting GIF biological activity are included in Table 1.

i__L Activity of recombinant GIF and its derivatives Minimum concentration of GIF biological activity in vitro Sample N Anti-DNP-IgE (ng / ml) (ng / ml) PBS (control group) 6 409 + 75 -... GIF 4 345 + 125 > 1000 C57A-GIF 4 197 soil 74 125 C60A-GIF 4 304 ± 110 250 C81A-GIF 4 375 soil 155 > 1000 example 4

No intramolecular SS bond in the recombinant GIF and its derivatives This example proves that the recombinant GIF and its derivatives do not have any intramolecular SS bonds. 0 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 1) The biological activity has been shown in the example The recombinant GIF or its derivative (2.4 μg) determined in 3 was dissolved in 0.2 M sodium acetate buffer solution (pH 4.0), and 1 / i25 of pepsin (Sigma) was added to the solution, and the mixture was at room temperature. Let stand for 7 hours to digest the protein. This sample solution was applied to a super ODS (TOSOH) column (0.2%) with 95% solution A (0.05% trifluoroacetic acid) and 5% solution B (0.02% trifluoroacetic acid, 70% isopropanol, and 30% acetonitrile). X 5 cm). The tube was washed at a flow rate of 0.2 ml / min for 5 minutes. Proportion line of solution B within 40 minutes -25- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 434256 A7 B7 V. Description of invention (23) Increase to 25% and increase within 5 minutes Up to 100% of the recovered peptides were separated using a gas phase amino acid sequencer PPSQ 10 (Ujin) to determine the amino acid sequence of all recovered peptides. The results showed that the three peptides containing one cysteine residue were distinguished, and that the cysteine residues were not connected to each other via an S-S bond. The peptide differentiation pattern and peptide amino acid sequence obtained by treating the recombinant GIF or its derivative with pepsin are shown in Fig. 1. To confirm, the following experiments were performed. Add dithiothreitol to the final concentration of 10 mM in the pepsin-digested sample and let the mixture stand at 30 ° C for 30 minutes. The sample solution was applied to the ultra-ODS column and the above procedure was repeated. The peptide has the same dissociation pattern as all recombinant GIF and its derivatives. 2)-It is generally known that disulfide bonds play an important role in maintaining protein stability. If a disulfide bond is present in the molecule, the replacement of cysteine with alanine can make the protein molecule significantly unstable. Among the recombinant GIFs, the mutant proteins C57A-GIF and 081 octa-() 1 [were replaced by alanine in 1/3 of the cysteine residues in the recombinant GIF. 115.5) are 68.7 and 71.6 respectively. These temperatures are almost the same as those of the wild type (70.9). This means that the three cysteine residues form any disulfide bond. Consumption by employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by the cooperative (please read the notes on the back before filling out this page) 3) Among the three human cysteine residues in the recombinant human GIF protein containing wild-type amino acid sequences produced by E. coli The distances between the ionized atoms, that is, S- (Cys57) -S (Cys60), S (Cys57) -S (Cys81), and S (Cys60) -S (Cys81), are determined by X-ray crystallography. 10A, 13A and 8A. The formation of a disulfide bond requires an interatomic distance of about 2.0 A or more. X-ray crystallography showed that the three cysteine residues were more than about 2.0A apart in the tertiary structure, indicating that GIF did not form any disulfide bonds in the molecule. -26- This paper size is in accordance with Chinese National Standard (CNS) A4 specification (2! 0 X 297 mm) 4342 ㈣ A7 B7 V. Description of the invention (24) Example 5

Recombinant GIF as a trimer A. Evaluation of the molecular weight of the recombinant GIF In Example 3, a recombinant GIF containing a wild-type amino acid sequence as a control group for comparison was dissolved in PBS at a concentration of 1_2 mg / milliwell. The sample solution was applied to Shodex KW803 (Showa Denko K · K.) Equilibrated with 0.1 M NaCl in 50 mM phosphate buffer (pH 6.8). A WYATT DAWNDSP-F light scattering spectrophotometer (Wyatt) was used to measure the absolute molecular weight of the protein that dissolves rapidly at a flow rate of 1-0 ml / min. The graph shows the measured molecular weight distribution of the calculated results of dn / dc = 0.180 cm 3 / g and A2 = 0. The molecular weight was estimated to be 36,490. Subsequently, the recombinant GIF was dissolved in PBS at a concentration of 0.68 mg / ml. The sample solution was centrifuged for 15 hours at 20 ° C and 17000 rpm using an analytical ultracentrifuge Optima XL (Beckman) to determine the average molecular weight. As a result, the average molecular weight of the GIF protein was 32013. The affinity constant was calculated as 614 · I8. These results show that the recombinant GIF protein exists as a trimer. B. Reconstituted CHF Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Crystallography (Please read the precautions on the back before filling this page) Reconstituted GIF is crystallized by vapor diffusion method. More specifically, GIF protein (20 mg / Ml) was dissolved in 100 »11 \ 111 £? £ 8 buffer (1) 117.5) containing 2.0 M ammonium sulfate and 2% (w / v) PEG 400 and the resulting solution was left at 4 ° (: stand still. At A crystal with a length of about 0.5 mm was obtained in about 1-2 weeks. A crystal of a heavy atom derivative was prepared from the above-mentioned recombinant GIF crystal by immersion method. By infiltrating the recombinant GIF crystal with 0.2 mM HgCl2, 2.6 M

Ammonium sulfate and 2% (w / v) PEG 400 in 100 mM HEPES buffer solution (pH -27- This paper applies the Chinese National Standard (CNS) A4 specification (210X297 mm) 434ig © A7 B7 V. Description of the invention (25 ) One of the crystals was prepared for 5 days in 7.5). The other crystals were prepared in the same way, but 1.0 mM ethylmercurithis salicylate (hereinafter referred to as " EMTS ") was used instead of 0.2 mM HgCl2 in the HEPES buffer solution. All reactions were performed at 4 ° C. Data were obtained using an IP diffractometer. A portable X-ray generator (4 KW) was used. The recombinant GIF crystals were measured for 30 hours under 2.3A resolution. 2.5A for 25 hours, and EMTS-treated heavy atom derivatives for 2.7A for 40 hours. For structural analysis, multiple isomorph substitution methods were used for phase calculations, and solvent planarization methods and molecular averaging methods were used for the phases. Modification. Based on the obtained data, molecular structure analysis (main chain tracking and side chain allocation) and molecular model construction are performed, showing that the recombinant GIF passes between the 37-45 position region and the 47-50 position region, and the 94-98 position region And the formation of intermolecular hydrogen bonding networks between the 106 and 110 positions and tri-polymerization due to the synergistic effect mainly caused by the formation of the lumps of the hydrophobic interactions at the 39, 48, 50 and 57 positions. Example 6 In the large intestine defend Bacterial application for the production of GIF derivatives with substituted amino acid residues other than cysteine, its biological activity and structure 'Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling in (This page) A. Manufacture of a GIF derivative with an amino acid residue substituted at the 106 position in E. coli. Fully synthetic DNA (batch # BBG54) was purchased from BBL. This DNA can be used for sequences other than SEQ ID No. 1. The amino acid sequence is only encoded at 106 positions where the asparagine residue is replaced by a serine residue (SEQ ID No. 11). Among them, the cysteine residue at 57 or 81 is identified by amino acid. Acid extraction-28- This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) 4 3 42 S6 A7 ______B7__ 5. Explanation of the invention (26) The mutation in the same way as in Example 1 was introduced in DNA, And the DNA with this mutation was expressed in E. coli using the expression vector PST811. The expressed recombinant GIF protein was purified by the same method as in Example 2, but the GIF protein was isolated with 0.3 M NaCl. The obtained GIF with two amino acid mutations Derivative named C57A / N 106S-GIF and C81A / N106S-GIF. B. Biological activities of C57A / N106S-GIF and C81A / N106S-GIF. The in vivo analysis of the same recombinant GIF derivative as described in Example 3 was used to evaluate the antibody-forming inhibitory activity of the recombinant GIF derivative, but injection 20 micrograms of recombinant GIF derivative. As a result, C57A / N106S-GIF showed higher activity than C81A / N106S-GIF (Table 2) β 4___2_ Recombinant GIF derivative activity sample N Anti-DNP-IgE (ng / ml) PBS (Control group) 10 84_3 persons 21.0 C57A / N106S-GIF 4 27 · 2 ± 8.2 C81A / N106S-GIF 4 86_3 persons 17_5 The number of injections of GIF derivatives printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs was reduced to 6 times (immunity 1st day, 1st, 3rd, 6th, 8th and 10th days) In another experiment, C57A / N106S-GIF showed higher activity than C57A-GIF (Table 3). ^ _3_ Active sample of group GIF derivative N Anti-DNP-IgE (ng / tnl) PBS (control group) 6 345.1 ± 128.6 C57A-GIF 4 127.1 ± 42.5 C57A / N106S-GIF 4 61.3 ± 20.4 -29-present Paper size applies Chinese national standard (CNS > A4 size (210X297mm) (Please read the note on the back before filling this page)

Printed by the Central Laboratories of the Ministry of Economic Affairs, Consumer Cooperatives A7 B7 V. Description of Invention (27) C. C57A / N106S-GIF Stereo Structure Using a light scattering photometer, measure the molecular weight distribution of C57A / N106S-GIF in the same manner as in Example 5. The results show that the C57A / N106S-GIF is tripolymerized and the molecular weight distribution is shifted to the lower side (时 2) in the wild-type gif case. Example 7 shows that the trimer structure is more unstable. Biological activity of mammalian cell-derived recombinant mutant strain GIFS A. Construction of mutant strain GIFS in mammalian cells and expression in SEQ ID No. 1 for the coding sequence of position 57, 60 or 81 cysteine residues, respectively PCR changes the coding sequence (AGC) of a pair of serine residues. One residue was mutated using two sets of PCR primers. For the first set of primers, the meaningful primer is relatively human GIF * 5 coding sequence with ribosome binding position (ATC) and other EcoRI positions upstream (primer A), and the anti-meaning primer can target mutation positions (primer 1). , 2, 3). 5'-GAATTCATCATGCCGATGTTCATCG-3X Primer A: SEqiD number: 12) y-CTCGGCTCGCGCGAGACGTCGGACG-5 * (primer 1: SEQID number: 13) 3f-CTCGGCACGCGCGCGAGTCGTCGGACG-5 yin primer 2: SEQID number: 14) 3. · TCGACGACTCGCCGGACG -5 '(primer 3: SEQ ID number: 15) For the second set of primers, the meaningful primers can encode the sequence of the mutation position, overlapping the anti-meaningful primers of the first set of primers (primers 4, 5, 6 ), And the anti-meaningful primer can encode a human GIF 3. coding sequence (primer B), and has a stop codon (T AA) and other EcoRI positions downstream. 5M3AGCCGAGCGCGCGCTGTGCAGCCTGC-3 '(introduced 4 · SEQ1D number: 16) -30- This paper size applies to Chinese National Standard (CNS) A4 specifications < 210X297 mm) (Please read the precautions on the back before filling this page)

Central Standards Bureau of the Ministry of Economic Affairs *; printed by industrial and consumer cooperatives 4I4 ^ § © ▲ 乂 · ν · Α7 _____ Β7 V. Description of the invention (28) 5 '~ GAGCCGTGCGCGCTCAGCAGCCTGC »3' (Citation 5: SEQID No .: Π) 5'- AGCTGCTGAGCGGCCTGCTGGCCGA-3 · (Reference 6: SEQ ID No .: 18) 3'-TTGAGGTGGAAGCGGATTCTTAAG-5XH Sub-B: SEq ID No .: 19) Using human GIF cDNA as a template, use PCR to make two eDNA fragments and use Bio -Rad kit purification. Due to the overlapping sequences in the two cdn A fragments, the two fragments were subsequently restored and used as templates for the second round of PCR, but primers A and B were used as primers to generate a full-length human GIF with mutations. For C57S-GIF which produces a cysteine residue at position 57 with a serine residue, use primers A, 1, 4, and 0 to replace a cysteine residue at position 60 with a serine residue. For C60S-GIF, use primers A, 2, 5 and B ». For C81S-GIF whose cysteine residue at position 81 is replaced with serine residue, use primers A, 3, 6 and B. The mutated _cDNA fragment was then ligated into a TA purified line (Invitrogen) and the sequence was verified by DNA sequencing. A human GIF-encoded EcoRI fragment containing one residue mutation can be inserted into the mammalian expression vector pEFneo at the EcoRI position (Liu et al., Proc. Natl. Acad. Sci. USA, Press: 11227, 1994). The resulting plastids were then transfected into BMT10 cells and stable transfected strains were selected by G418 resistance. The supernatant of the culture medium of the selected transfection strain was recovered and concentrated and adsorbed with an anti-GIF multi-cell line antibody-coupled affinity gel or with an anti-GIF single-cell line antibody 388F1-coupled affinity gel (WO 94/26923, The protein remaining in the immunoadsorbent is dissociated at acidic pH as above and the GIF concentration in the eluate fraction is determined by SDS-PAGE and silver staining. B. Biological activity of mutant GIF-31-This paper applies Chinese National Standard (CNS) A4 size (210X297mm) ^ ^ ο Pack—I (please read the note on the back before filling this page) —Order 4 3 4256 A7 B7 V. Description of the invention (29 T cell fusion tumor 12H5 cell detection GIF activity (Iwata, et al., Journal of Immunology, M2: 2534, 1988). A suspension of fusion tumor cells was mixed with an equal volume of test sample, and the cell suspension was cultured at 10 μg / ml mouse IgE for 24 hours. Via CF50A The liquid on the membrane filtration medium was cleared, and the ligum containing IgE-binding factor (IgE-BF) was divided on the lentin exogenous lectin Sepharose (Yodoi et al., Journal of Immunology, m 1436, 1980). Bound protein .2 Mα-methylmannose lysate eluate (dissolved liquid) analysis of the presence of IgE-BF. If a sufficient amount of GIF and mouse IgE are added together with 12H5 cell culture medium, the main IgE-BF formed by the cell Lack of affinity to lentin exogenous lectin and was recovered in the effluent compartment (Iwata and Ishizaka's Journal of Immunology, 141: 3270, 1988), so if the percentage of flower shape inhibition between the effluent / lysate fraction is 3. At 0 or higher, GIF is considered (+). The minimum concentration required for GIF activity is shown in Table 4. Table 4 The minimum concentration required for GIF activity of the GIF derivative shown in the sample in BMT10 cells Ministry of Economic Affairs Central Standards Bureau Shellfish Consumer Cooperative printed wild type (purified multi-cell line anti-GIF) C57S (purified multi-cell line Ab) (purified 388F1-) C60S (purified multi-cell line Ab) C81S L purified as Cell line am_ > 1000ng / ml 62.5 ng / ml 33.0 ng / ml 500ng / ml > 500ng / ml -32- (Please read the precautions on the back before filling this page)

This paper size applies to China's National Standards (CNS) M specifications (210X297 mm). The consumer cooperation of the Central Standards Bureau of the Ministry of Economic Affairs. Du Yin 4 3 42 ^ 6 a7 _ B7 V. Description of the invention (3〇) Example 8 Modified Preparation and biological activity of E. coli-derived recombinant GIFs This example relates to the preparation of recombinant GIF derivatives in which cysteine residues are modified. A. Preparation of carboxymethylated recombinant GIF Recombinant GIF (2.5 mg) containing wild-type amino acid sequences as a comparative control group in Example 3 was dissolved in 1.25 ml of PBS *. To the obtained solution, 20 µl of monoiodoacetic acid dissolved in 1N sodium hydroxide at a concentration of 240 mg / ml was added, and the mixture was allowed to stand at room temperature overnight. At the end of the reaction, replace the solvent with 20 mM sodium acetate buffer (pH 5.5) by using NAP-25 (Pharmacia), and apply the resulting solution to a TOSOH CM-5PW column (0,75 X 7.5 cm) equilibrated with the same buffer solution. ). The NaCl concentration was linearly increased to 0.5 M at a flow rate of 1.0 ml / min to dissociate the protein. The divisional graph shows four GIF derivative protein peaks (Figure 3). The unreacted pediatric GIF produced a single peak in the same division as the fourth peak of the reacted GIF. The El SH method was used to determine the free SH groups of GIF derivatives in the peaks 1 to 4 (Glazer et al., Ibid.) Were 2.1, 2.4, 2.7, and 3.0, respectively. This result shows that the first peak corresponds to a trimer of three GIF molecules in which one cysteine residue is alkylated; the second peak is 2 GIF in which one cysteine residue is alkylated A terpolymer of a molecule with a GIF molecule in which cysteine is not stewed; the third peak is a GIF molecule in which one cysteine is tritiated and one in which cysteine is not alkylated A trimer of three GIF molecules; and the fourth peak is a trimer of three GIF molecules in which cysteine is not alkylated. The GIF molecules of the first to fourth peaks are named CM3-GIF, CM2-GIF, CM1-GIF, and CM0-GIF. ** 33 ^ standard applies to China * ^ standard (CMS) A4 specification (210 X 297 mm > {Please read the precautions on the back before filling this page)

Printed by the Central Standards Bureau of the Ministry of Economic Affairs, Shellfish Consumer Cooperative, 4 3 42 Meiweng A7 B7 _ V. Description of the invention (31) The peptide map performed as described in Example 4 shows that the cysteine residues at position 60 are Monoiodoacetic acid modification. B. Biological activity of carboxymethylated recombinant GIF The in vivo antibody formation inhibitory activity of CM3-GIF, CM2-GIF, CM1-GIF and CM0-GIF was analyzed by the same method as in Example 3. As a result, the degree of activity varies depending on the degree of cysteine residue modification. Table 5 Active samples of recombinant GIF with chrome decoration N Anti-DNP_IgGl (μg / ml) PBS (control group) 10 35 · 3 ± 3 · 21 CM0-GIF 4 19.8 ± 5.54 CM1-GIF 4 14.9 ± 4.86 CM2 -GIF 4 9,5 ± 0.97 CM3-GIF 4 30.1 ± 4.92 C. Preparation of pyridoethylated recombinant GIF In Example 3, a recombinant GIF (2.5 Mg) dissolved in 1.25 ml PBS. To the resulting solution, 0.2 µl of 4-vinylpyridine was added and the mixture was left at room temperature overnight. At the end of the reaction, replace the solvent with 20 mM sodium acetate buffer (pH 5.5) and divide the resulting solution using TOSOH CM-5PW tube. As in the case of carboxymethylation, the distinguishing pattern contains 4 GIF derivative protein peaks (circles 4). Determine the 1st to 4th peaks by the Elmont method. The free SH groups of the GIF derivatives are 2.1, 2.4, 2.7, and 3.0 respectively. »The GIF molecules of the 1st to 4th peaks are named -34- 5 ^. China National Standards (CNs) M specifications (210x297 mm) (Please read the note ^^ on the back before filling this page)

4 3 4256 ^ A7 __B7 V. Description of the invention (32) PE3-GIF, PE2-GIF, PEhGIF and PEO-GIF. As in the case of carboxymethylation, the cysteine residue is ethylated with pyridine only at the 60 position. D. Biological activity of pyridylethylated recombinant GIF The in vivo antibody formation inhibitory activity of PE3-GIF, PE2-GIF, PE1-GIF and PE0-GIF was analyzed in the same manner as in Example 3. The results were not completely consistent with the carboxymethylated GIF, and this inconsistency is believed to be due to the difference in the chemical properties of the modifiers β. An increased degree of activity was observed for all modified GIFs (Table 6). i ^ Modified recombinant GIF activity (please read the precautions on the reverse side before filling out this page) Sample N anti-DNP-IgGUwg / ml) PBS (control group) 10 35.3 ± 3.21 PE0-GIF 4 25.5 ± 7.90 PE1-GIF 4 24.5 5.6 5.67 PE2-GIF 4 21.3 ± 3 · 71 PE3-GIF 4 13_2 ± 2 · 09 Ordered by the Central Government Bureau of the Ministry of Economic Affairs of the People's Republic of China for consumer cooperation printing example 9 Anti-allergic activity of recombinant GIF derivatives This example shows The strong ability of the recombinant GIF derivative in inhibiting allergic reactions was examined. Examine the inhibition of C57A / N106S-GIF for allergic reactions induced by immune effects. BDF1 mice were immunized by injection of 0.1 μg DNP-ovalbumin (OVA) adsorbed to 1 mg of alum. One day before immunization and at 0, 1, 2, 3, 4, 6, 8, 10, and 12 夭 to i , p. Injection of C57A / N106S-GIF (20 μg). The control group mice received PBS only. On the 14th day after immunization, 0.1 micrograms of DNP-BSA was injected into the ears of the mice through -35. This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm). Printed by the Staff Standards Cooperative of the Standards Bureau

43 42SjS A7 ____B7__ 5. Description of the invention (33) i.v. Inject 0.25 ml of 0.5% Avon Blue solution. After 30 minutes, the old rats were killed and their ears were cut. The cut ears were soaked in 0.7 ml of a 1 N potassium hydroxide solution and incubated overnight at 37 ° C. To the cultivated solution was added 9.3 ml of a mixed solution of 0.6 N phosphoric acid and acetone (5:13) and the mixture was stirred. The amount of dye in the supernatant was determined by measuring the absorbance at a wavelength of 620 nm. In the control group, rats received only 1 mg / kg of the anti-allergic agent ketotifeu & the experiment was repeated twice (Experiments 1 and 2). The results showed that the rats receiving C57A / N106S-GIF showed less dye exudation, indicating that C57A / N106S-GIF had higher anti-allergic activity than the commercially available anti-allergic agent ketotifen (Figure 5). Example 1 10 Preparation and biological activity of modified E. coli-derived GIF derivatives A. Preparation of carboxymethylated recombinant GIF derivatives Cytoplasmic GIF (C57A / or C57A / N106S) (0.2 mg) soluble In 10 ml of PBS, 5 µl of monoiodoacetic acid dissolved in 1N sodium hydroxide at a concentration of 240 mg / ml was added to the GIF derivative solution, and the mixture was allowed to stand overnight at room temperature. At the end of the reaction, the solvent was rolled to 1 ml using a YM3 membrane (Amicon), and 50 ml of 20 mM sodium acetate buffer solution (pH 5.5) was added to the resulting solution and rolled to 1 milliwell. This step was repeated once more and the resulting solution was applied to a 1'0800811 <: \ ^ 51)% column (0.75 x 7.0 cm) equilibrated with 20 111 ^ 1 sodium acetate (? 115.5). The NaCl concentration was linear at a flow rate of 1,0 ml / min. Add 0.5M mushroom to dissolve the protein. The first peak corresponds to a trimer of three GIF mutant molecules (C57A / or C57A / N106S) in which one cysteine residue is alkylated and collected and named as C57A-CM3 or -36- Paper size applies to China National Standard (CNS) A4 specifications _ (_ 2! 〇X297mm) ~~~ — (Please read the precautions on the back before filling out this page) /) _ Order 434256 bu A7 B7 V. Description of the invention (34) C57A / N106S-CM. (Please read the precautions on the back before filling this page.) The peptide map results performed as described in Example 4 show that the cysteine residues at position 60 and / or 81 are modified with a few methyl groups. B. Biological Activity of Carboxymethylated Recombinant GIF Derivatives In a similar manner to Example 3, the in vivo antibody formation inhibitory activity of C57A-CM3 or C57A / N106S-CM was analyzed.夭 3 doses instead of 9 doses. As a result, carboxymethylated GIF derivatives showed higher activity than C57A or C57A / N106S (Table 7). The in vitro bioactivity analysis (see Example 3) of the same preparation shown in Table 7 also showed that the carboxymethylation of C57A and C57A / N106 significantly increased the activity. Table 7 Activity of modified GIF derivatives · Sample N Anti-DNP-IgE (ngZml) Minimum roll of GIF activity in vitro (ng / ml) PBS (control group) 6 2684.1 ± 675.9 — C57A 4 1750.2 ± 491.5 100 C57A- CM3 4 200.2 ± 52.5 10 C57A / N106S 4 397.2 ± 214.0 100 C57A / N106S-CM 4 126.5 ± 48.9 Example 1 1 10 Printed on the NOD rat Chinese recombinant GIF derivative to prevent spontaneity Diabetes This example shows the potent ability of recombinant gif derivatives to prevent insulin-related diabetes. NOD (non-obese) female rats (Serreze, DV, et al., Journal of Autoimmunity-37- Zhang Jixiang uses the Chinese National Standard (CNS) A4 specification (2! 0X297 mm)> Consumers ’Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 434256 A7 B7 V. Description of the Invention (35) 759, 1989), Browman, MA, et al., Immunology Today, 15, 3, 115-120 (1994)), 10 micrograms 3 times a week C57A / N106S is treated with IP from 5 to 38 weeks of age. Test strips and cards were used to analyze the diabetic chasing mice once a week. Diabetes is diagnosed when permanent and rapid diabetes occurs above 200 mg / dl. Almost complete prevention of spontaneous diabetes was observed in mice treated with C57A / N106S. Example 1 2 Preparation and biological activity of EMTS or DTNB-modified recombinant GIF A. Preparation of EMTS-modified GIF 100 μg / ml recombinant wild-type GIF was used as a control group in Example 3 and dissolved in PBS and mixed with various Ethylmercury thiosalicylate (EMTS) was incubated at 4 ° C for 24 hours. After PBS epitaxial dialysis, the concentration of the derivative was measured by ELISA to determine the biological activity of the preparation. To isolate EMTS-modified GIF, samples were divided on a CM-5PW column equilibrated with 10 mM phosphate buffer (pH 6 · 5). The NaCl concentration was linearly increased to 0.5 M at a flow rate of 0.5 ml / min to dissociate the protein and obtain two main peaks. Comparison of the dissociation profile with unreacted GIF dissociated from the same column shows that the latter protein peak was recovered in 36-38 minutes, which is equivalent to unmodified GIF, while the former peak was recovered in 31-34 minutes, and was not stored in the original GIF preparation in. B. The biological activity of EMTS-modified recombinant GIF was analyzed as described in Example 3 by analyzing the switch from the formation of glycosylated IgE-binding factor to the formation of unglycosylated IgE-binding factor murine T cell fusion tumor 1 2 Η The ability of 5 cells to analyze the GIF biological activity of EMTS-treated GIFs and differentiated GIFs. The minimum concentrations of GIF derivatives for detecting GIF biological activity are shown in Table 8. -38- This paper size applies to Chinese National Standard (CNS) A4 (210X2.97mm) (Please read the precautions on the back before filling in this page)

V. Description of the invention (36) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 434256 A7 B7 A__ EMTS · Modified GIF Activity EMTS Yi (mM) CM-5W Minimum Rolling Degree of Biological Activity (ng / ml) Untreated Untreated Division> 1000 0.05 Undivided 10 0.25 Undivided 5 0.25 Front peak 2 0.25 Back peak 500 This result clearly shows that the protein showing the front peak represents a biologically active derivative of GIF. In order to confirm that the biologically active GIF was caused by the sulfhydryl modification effect, the protein of the biologically active GIF derivative prepared by EMTS treatment was incubated overnight with 5 mM dithiothreitol. After epitaxial dialysis, measuring the GIF biological activity of the reducing substance shows that the detection of GIF biological activity requires 1 microgram / ml of reduced GIF, indicating that the effect of EMTS treatment on GIF biological activity is due to the reaction between EMTS and cysteine residues. . C. Preparation of DTNB-modified GIF In order to avoid the production of highly biologically active derivatives, the only possibility for SH-based peptide formation is to use another thiol reagent 5,5'-dithiobis (2-nitrate Benzoic acid) (DTNB) treated recombinant wild-type GIF. A 130 μg / ml GIF solution in PBS was incubated at 4 ° C. with various concentrations of DTNB for 24 hours and dialyzed against the outer edge of PBS. The resulting DTNB-treated GIF was then divided on the CM-5PW column described in A. Chromatograms show a major peak recovered between 26 and 29 minutes, indicating that unmodified GIF that dissolves at 46-48 minutes under this experimental condition was not detected. -39- This paper size applies Chinese National Standard (CMS) Λ4 specification (2 ί 0 X 297 mm) (Please read the precautions on the back before filling this page)

Printed by the Consumer Standards Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs This result indicates that the incorporation of mercury is not necessary to produce highly bioactive GIF ° A portion of the bioactive GIF derivative was incubated overnight at 4 ° C with 5 mM dithiothreitol. Measurement of GIF biological activity revealed that GIF activity was not exhibited even at 1 g / ml reduced from GIF. The results show that modification of SH groups in inactive / quot; GIF with DTNB can result in high GIF biological activity. Examples of pharmaceutical preparations will now be described. Formulation Example 1 A solution containing the C57A-GIF obtained in Example 2 was sterile-filtered and filled with 1 mL of ammonium to prepare an injection. Formulation Example 2 The solution of C57A-GIF obtained in Example 2 was aseptically filtered and concentrated. 5 ml of this concentrated solution was filled into 10 ml ampoules under aseptic conditions. The ampoule of the dried product is prepared by injection with a rubber stopper. -40-4 3 42 5 0 A7 ______B7 V. Description of the invention (37) D. Biological activity of DTNB-modified recombinant GIF DTNB-modification was measured by the method described in B The GIF biological activity of the GIF derivatives is shown in Table 9. 4__9 DTNB-modified GIF activity ZDTNB (_ CM-5PW divided minimum biological activity (ng / ml) untreated undivided > 1000 0.10 undivided 10. 0.25 undivided 8 0.25 main peak 5 paper size applicable China National Standard (CNS) A4 (210 X 297 mm) (Please read the notes on the back before filling this page)

6 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (38 doses) Preparation Example 3 The solution containing the C57A / N106S-GIF obtained in Example 6 was sterile filtered and filled into a milliliter ampoule to prepare an injection. Preparation Example 4 The solution containing the C5? A / N106S-GIF obtained in Example 6 was sterile filtered and shrunk, and 5 ml of this concentrated solution was poured into 10 ml ampoules under aseptic conditions. After lyophilizing at -20 ° C, the solution containing the The ampule of the lyophilized product was stoppered with a rubber stopper to prepare an injection. Formulation Example 5 A solution containing the CM2-GIF obtained in Example 8 was sterile filtered and filled into a 10 ml ampule to prepare an injection. Formulation Example 6 contains the CM2-GIF obtained in Example 8. The solution was sterile filtered and concentrated, and 5 ml of the concentrate was filled into 10 ml ampoules under aseptic conditions. After -20 lyophilization, the ampoules containing the lyophilized product were stoppered with rubber stoppers to prepare injections. Example 7 The solution containing p E 3 -GIF obtained in Example 8 was sterile filtered and filled into 10 ml ampoules to prepare an injection. Formulation Example 8 The solution containing PE3-GIF obtained in Example 8 was sterile filtered and concentrated under sterile conditions. 5 ml of this concentrate Fill into a 10 ml ampoule. After lyophilization at -20 ° C, the ampoule containing the lyophilized product is plugged with a rubber stopper to prepare an injection -41-This paper size applies to China National Standard (CNS) 8-4 (210X297) Li) (Please read the notes on the back before filling in this page)

434256 A? B7 V. Description of the invention (39) Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Preparation Example 9 The solution containing the C57S-GIF obtained in Example 7 was sterile filtered and filled into a 10 ml ampoule to prepare an injection. Formulation Example 10 A solution containing the C57S-GIF obtained in Example 7 was aseptically filtered and concentrated, and 5 ml of this concentrate was filled into 10 ml ampoules under aseptic conditions. After -20 t lyophilization, the ampule containing the lyophilized product was stoppered with a rubber stopper to prepare an injection 0 Formulation Example 11 The solution containing the C57A-CM3 obtained in Example 10 was sterile filtered and filled into a 10 ml ampule to prepare an injection. Formulation Example 12 The solution containing C57A-CM3 obtained in Example 10 was sterile filtered and concentrated, and 5 ml of this concentrated solution was filled into 10 ml ampoules under aseptic conditions. After lyophilization at -20 ° C, an ampoule containing the lyophilized product was stoppered with a rubber stopper to prepare an injection. Formulation Example 13 The solution containing the C57A / N106S-CM obtained in Example 10 was sterilized and filled into a 10 ml ampoule to prepare an injection. Formulation Example 14 The solution containing the C57A / N106S-CM obtained in Example 10 was sterile filtered and concentrated, and 5 ml of this concentrate was filled into 10 ml ampoules under aseptic conditions. After lyophilizing at -20eC, the ampule containing the lyophilized product was stoppered with a rubber stopper -42- (Please read the note on the back before filling in this page)

This paper size applies to China National Standard (CNS) A4 (210X297 mm) 4 3 42 5 6 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (40) Preparation of injections. Formulation Example 15 A solution containing the EMTS-modified GIF (CM-; previous peak in the 5PW cut) obtained in Example i2A was aseptically filtered and poured into a 10 ml ampoule to prepare an injection. Formulation Example 16 A solution containing the EMTS-modified GIF (the previous peak in the CM-5PW classification) obtained in Example 12 was sterile-filtered and concentrated, and 5 ml of this concentrated solution was filled into 10 ml ampoules under aseptic conditions. After lyophilization at -20 ° C, an ampoule containing the lyophilized product was stoppered with a rubber stopper to prepare an injection. Formulation Example 17 A solution containing the DTNS-modified GIF (the main peak in the CM-5PW division) obtained in Example 12C was aseptically filtered and poured into a 10 ml ampoule to prepare an injection. Formulation Example 18 A solution containing the DTNB-modified OIF (the main peak in the CM-5PW division) obtained in Example 12C was sterile filtered and concentrated, and 5 ml of this concentrate was filled into 10 ml ampoules under aseptic conditions. After lyophilization at -20aC, an ampoule containing the lyophilized product was stoppered with a rubber stopper to prepare an injection. Although the present invention has been described with specific examples, it should be understood that for those skilled in the art, various changes and modifications can be made without departing from the spirit of the present invention. Therefore, the scope of the present invention is only defined by the following patent application parks. . -43- This paper size applies to Chinese national standards (CNS > Λ4 size (210X297 mm) (Please read the notes on the back before filling out this page) 4 3 42 5 δ Α7 Β7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economy Fifth, the description of the invention (41) Sequence Listing (1)-general information: (i) Applicant: Misakiyama Shuntodo Village, Gao Wendu Association Haoshi Kuroki Kuroki Kato Yoichi Ishizaka Kosei Shinno Ryoji (ii) Name of the Invention: Antigen Non-specific Glycosylation Inhibitor Derivative (Hi) Sequence Number: 20 (iv) Corresponding Address: (A) Recipient: Fish & RichardsoivP. C. (B) Street: 4225 Executive Square, Suite 1400 ( C) City: La Jolla (D) State: CA (E) Country: USA- (F) Zip code: 92037 (v) Computer read type: (A) Media type: Floppy disc (B) Computer: IBM PC Compatible (C) Operating system: PC-DOC / MS-DOS (D) Software: Patentin Release # 1.0, Version # 1,30-44 * (Please read the notes on the back before filling this page) This paper Standards apply Chinese National Standard (CNS) Α4 specifications (2 [0 × 297 mm) 43 42 & 6 A7 B7 Central Ministry of Economic Affairs Printed by the Consumers' Cooperative of the Associate Bureau. 5. Description of Invention (42) (Vi) Current Application Information: (A) Application Number: US (B) Application for EM (C) Classification: (viii) Agent Information: (A) Name: Haile, Lisa A. (B) Registration number: 38, 347 (C) Reference number: 07246 / 01300i (ix) Telecommunication information: (A) Phone: 619 / 678-5070 (B) Fax: 619 / 678- 5099 (2) Information of SEQ ID No .: (1) Sequence characteristics: (A) Length: 348 base pairs (B) Type: Nucleic acid (C) Strand: Double strand (D) Topology: Straight chain (ii) Molecular state: cDNA to mRNA (vi) Origin: (A) Organism: Homo sapiens (Η) Cell line: Suppressed T-cell fusion tumor AC5 (No. HE 10473) (ix) Features: (A) Name / Search form: CDS -45-This paper size is applicable to China National Standard (CNS) A4 specification (210X297 mm) ---- ^ ----- D Pack— (Please read the precautions on the back before filling the book Page) order

4 3 42SJ A7 B7 V. Description of the invention (43) (B) Address: 1..346 (xi) Sequence summary: SEQ ID number: ATG CCG ATG TTC ATC GTA AAC ACC AAC GTG CCC CGC CCC TCC OTG CCG Mtet Ρϊό Met Phe 工 le V ^ i Λ3ϊΐ Thx Asn Val ΡϊΌ Arg Ala Sear Vftl Pro 1 5 IQ 15 GAC GGG TTC CTC TCC 〇W3 CTC ACC CA < 3 CftG CTG QCG CAG < 3CC ACC GGC Asp Gly Phe lieu Ser Glu Leu Thr Gin Gin Leu Ala Gin Ala Thr Gly 20 25 30 AAG CCC CCC CAG TAC ATC GGG GIG CAC GTO GTC COG G ^ C CAG CTC ATG tiys Pro Pxo Gin Tyr lie Ala Val His Val v ^ Sro Asp 6ln Leu Met: 35 40 45 48 96 X44 GCC TTC GGC GQC TCJC AGC GftG CCG TOC GCG CTC TSC AiJC CTG CAG AGC Ala Phe Gly Gly Ser Ser Qlu Pro Cys Ala Xj6u Cys Ser Leu His Ser 50 55 € 0 X92 (Please read the note on the back first Please fill in this page again for details) ::-ATC GCC AAG ATC GGC GGC GC5G CAG ARC CGC TOC TAC AflC AM CTG CTG He Gly Lys lie Gly Gly Ala Gin Arg fier-Tyr Ser Lys Leu Lou 65 70 7S 80 TGC GGG CTG CTG GCC GAG CGC ClG CGC ATG J ^ SC C0C GAC AGG < STC TSVC Cys Gly Leu Leu Ala < 5iu Arg Leu Arg T ie Ser ftro Asp Arg Val Tyr 8S 90 $ S fCXC AAC TAT TAC SAC ATG ίΛ £ GOG GCC AAX GIG GOG TQG AAC AAC «Κ: lie Asn Tyr Tyr Asp Met Asn Ala Ala Αεη Val Gly Trp Aen Asn Ser 100 105 1X0 ACX : TTC acc T TΑ Thr Phe Ala 115 26d 33 € 348 Order-Printed by the Shellfish Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (2) SEQ ID number: 2 Information: (i) Sequence characteristics: (A) Length ·· 348 Base pair (B) type: nucleic acid (C) strand: double strand (D) topology: linear (ii) molecular state: other nucleic acids (A) enemy description: / desc = H synthetic DNA1 -46 not The paper ruler is specifically applicable to the Chinese National Standard (CNS) A4 specification (2 丨 〇'〆297 mm) 4342 if A7 B7 V. Description of the invention (44) (ix) Features: (A) Name / Retrieval Form · CDS ( B) Address: 1..346 (xi) sequence rescue ♦ 'SEQID number: 2: ATG CCG ATG TTC ATC GTA AAC ACC AAC CCC CGC G〇C TCC GTG CCG 40 Mftt Pro Met He Val Asn Thr Asn val Pro Arg Ala Ser Val Pro ° 5 10 is GAG GGG TTC CTC TCC GAS CTC ACC CAG CAfi CTG GCC CAG GCC ACC GGC 36 Asp Gly Ph ^ s Leu Ser Glu Leu Thr Gin Ola Leu Al ^ Gin Ala Thr Qly 20 25 30 AAG CCC CCC CAG TAG ATC QOG OTG CAC GTG 〇TC CCG GftC CAS CTC ATG X44 Lys Pro? Ro Qln Tyr lie Ala Val His Val Val Pro Asp Gin Le \ i Met 3S 40 45 CCC TTC GGC TOC AGC G ^ JS COO GCC GiGGf CTC TGC AGC CTC CAC AiSC Ala Phe < 51y Gly Ser fier Olu Pro Ala AlA lieu Cya 5er Leu Hie Ser 50 SS 60 ATC G < SC AM ATC GGC GGC GCG CAG AAC OGC XCC MC AA & CTG CTG 240 Xle Gly Lye lie Gly Gly Ala Gin Asn Arg Ser Tyt Ser Lys Lew I «eu € 5 70 7S 80 TGC GGC CTG CTG GCC < 33« 5 CGC CTG CGC ATC AiSC CCG < 3ftC AGG GTC TAC 288 Cys Gly lieu Leu Ala Glu Apg Arg He Pro Asp AifgVal Tyr fiS 90 9S ATC A3VC TAT HAC GAC ATG AAC GOG GOC AAT GTS GCC TOG AAC AAC TCC 336 He Asn Tyr Tyr A «p Met Asn Ala Ala Asn Val Gly Trp Asa Asn Ser 100 105 XlQ ACC TTC GCG T AA 34th Thr Phe Ala 115 (Please read the precautions on the back before filling out this page) / Packing--Bookmark. Printed by the Central Standards Bureau of the Ministry of Economic Affairs and Consumer Cooperatives (2) SEQ Information of ID number * 3: ⑴Sequence characteristics ... (A) Length: 348 base pairs (B) type ' Nucleic acid (C) Properties: Double-stranded (D) Topology: Straight-chain-47- This paper size applies to China National Standards (CNS) Eight Aunts? ^ (21〇X 297mm) 4S4i Employees of the Central Standards Bureau of the Ministry of Economic Affairs Printed by Consumer Cooperative A7 B7 V. Description of the invention (45) (H) Molecular state: other nucleic acids. (A) Description: / desc = " Synthetic DNA "(ix) Features:

(A) Name / Search table: CDS (B) Address: 1 " 346 (xi) Sequence description: SEQID number: 3: ATG CCQ ATS TTC ATC GTA ΑΑΓ ΛΟ: ARC GTG CCC CQA < 3CC TCC GTC CCG 48

Met Pro Met Pha lie Val Asn Thr Asn. Va.1 pro Al «Ser Val 5jt〇 s 10 15 GAC GGG TTC CTC TCC GJW3 CTC RCC CSG OW3 CTG GCG CAS GCC ftCC G6C S6

Asp Gly Phe Leu Ser Glu Leu Thr Gin Qln lieu Ala Cln Ala Tbx Qly 20 25. 3〇 AAG CCT (¾¾ CM ΪΪΜ: ATC GCS < SXG CAC Gitt GxC CCG Ql «: CW3 CTC ATG 144

Lys Pro Pro Gin Tyr He Ala Val Hie Val Val Pro Asp Gin Leu Met 35 40 45 GCC TTC GGC GQC TCC ASC OAiS COS GOC GOG CTC TGC AGC CTG CftC AGC 192

Ala. Phe 61y < 31y & er Ser < 31u Prc Ala Ala Leu cy «$ er I <« u His 50 55 60 ATC < 3GC AAG ATC Qk3C GGC GCG CAG AAC OGC TCC TAC A〇C AAG CTG CTG 240

Zie Gly Lys He Gly Gly Ala Gin Asn Arg Ser Tyr Ser Lys Leu ireu 6S 70 7S β〇 TGC QSC CTG CTG GCC GSA CS3G CTT CGC ATC AGC CCG GAc AGG (STC TAC 288

Cys < 31y teu lieu Ala elu Arg Leu Arg lie Sei: Pro Asp Axg Val i * yx 85 SO 95 ATC ARC TAT TAC GAC ftTG AAC GOG GCT ASC GTG GGG T $ G AAC AAC TCC 336

He Asn Tyr Tyr Asp Met Asn Ala Ala Ser Val Gly Trp Aan Asn Ser 100 105 110 ACC TTC GCC T AA 348

Thr Phe Ala 11S (2) SEQ ID No .: 4: (i) Sequence characteristics: (A) Length: 60 base pairs (B) Type: Nucleic acid-Ad- This paper applies Chinese National Standard (CNS) A4 specification (2 〖0X297mm） (Please read the precautions on the back before filling this page) ^ 'β -V-

434211 A7 B7 Employee Cooperative Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs _ System V. Description of the Invention (46). (C) Shareability: Single strand (D) Topology: Linear (ii) Molecular State: Other Nucleic Acids (A) Description: / desc = "Synthetic DNA" (xi) Sequence description: SEQ ID number: 4: AftCCITCaAiSA AJAACCAfti3 (5 AGGTSAXMiA T2ATGCCGAT GTTCHjrCGTA AACACCAACG 60 (2) Information of SEQ ID number: 5 (i) Sequence characteristics: (A) Length: 24 base pair (B) type: nucleic acid (C) strand property: single strand (D) topology: linear (H) molecular state: other nucleic acid (A) description: / desc = " synthetic DNA "〇〇 Sequence description: SEQID number: 5: CAGGCTGCAG AGCGCGGCCG GCTC 24 (2) Information of SEQ ID number: 6: (i) Sequence characteristics: (A) Length: 24 base pairs (B) Type: Nucleic acid (C) Symmetry : Single strand (D) Topology: Straight-chain (ii) Molecular state: Other nucleic acids -49- (Please read the precautions on the back before filling out this page) y Packing. The size of the paper used for the edition is subject to the Chinese National Standard (CNS) A4 specification (210X2.97 mm). 434iie Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _B7_ V. Description of Invention (47) (A) : / Desc = ”Synthetic DNA” (xi) Sequence description: SEQ ID number: 6: GATGCTGTGC AGGCTAGCGA GCGC 24 ¢ 2) Data of SEQ ID number: 7: (i) Sequence characteristics: (A) Length: 24 bases For (B) type: nucleic acid (C) strand: single strand (D) topology: linear (ii) molecular state: other nucleic acids (A) summary: / desc = "synthetic DNA" (xi) sequence description : SEQID number: 7: GCGCTCGCTA GCCTGCACAG CATC 24 (2) Information of SEQ ID number: 8: (i) Sequence characteristics: (A) Length: 42 base pairs (B) Type: Nucleic acid (C) Share property: Single strand (D) topology: linear (ii) molecular state: other nucleic acids (A) description: / desc = ”synthetic DNA” (xi) sequence description: SEQID number: 8: AACGGATCCC TATTAGGCGA AGGTGGAGTT GTTCCAGCCC AC 42 (2 ) SEQ ID No .: 9: -50 ^ This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before filling this page)

4 3 42 5S, printed by the I Industrial and Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 _._ B7_ V. Description of the invention (48) ⑴ Sequence characteristics: (A) Length: 24 base pairs (B) Type: Nucleic acid (C) Properties: single strand (D) topology: linear (ii) molecular state: other nucleic acids (A) description: / desc = " synthetic DNA "(xi) sequence description: SEQID number: 9: TTCGACGATC GGCCGGACGA CCGG 24 (2) Information of SEQ ID No .: 10: (i) Sequence characteristics: (A) Length: 24 base pairs (B) Type: Nucleic acid (C) Strandability: Single strand (D) Topology: Straight chain (ii) Molecular state: Other nucleic acids (A) Narration: / desc = ”Synthetic DNA” (xi) Sequence description: SEQID number: 10: AAGCTGCTAG CCGGCCTGCT GGCC 24 (2) SEQ ID number: 1 1 Information: (i) Sequence features: (A) Length: 348 base pairs (B) Type: Nucleic acid (C) Strand: Single-51-(Please read the notes on the back before filling this page)

This paper size applies Chinese National Standard (CNS) A4 specification (2) .297 × 297 mm) 434aa g, A7B7 V. Description of the invention (49). (D) Topology: linear (ii) molecular state: other nucleic acids ( A) Narrative: / desc = " Synthetic DNA " (ix) Features: (A) Name / Search Table: CDS (B) Address: 1..346 (xi) Sequence rescue: SEQID number: 11 i AK3 COG ATC CTC ATC GXA · ΜΪ ACC AAC Gte OCC OGA OCC TCC GTG CC6 Met Pro Met Phe He v ^ l Aen Thr Asn Val Pro Arg Ala Ser val Pro 5 10 20 GAC GGG 1CTC CTC TCC CSflG CPC ACC CAG CAG C * G GCG CAS GCC ACC GGC Asp Gly Phe Leu $ er Glu Leu Thr Gin Gin Leu Ala Gin Ala Thr Gly 48 I ^ 7--0 pack— (Please read the precautions on the back before filling this tile) 30 35 40 AM OCT GCA CAQ TAG AIC GOS GTG CJW: < STG OTC CCS GAC CAiS CTC ATO lys Pro l? Ro Gin Tyr lie Ala Val His Val Val Pro Asp Gin Leu Met 4S 50 55 144: TCC A3G GAG CCG TCG GCA CTC TCC AE3C CTG CAC Ala Phe Gly < 51y Ser S Fenr Glu Pro Cys Ala Leu Cys Ser Le GCC TTC GGC f > h €

His $ er 192 65

7C ATC GQC AAG ATC GGC GGC GCG CAG A71C CGC TGG TAC AAO CTO CTG He < 31y Lys Gly Gly Ala Gin Asn Aifg Ser Tyr Ser Lye X * eu Leu 75 80 85. 90 TGC QQC CTG CTG < 5CC GAA CSC CTT CGC ATC JW3C CCG GfieC AGG GTC TAC Cys Gly Leu i ^ u Ala Glu Arg Leu Arg lie Ser Pro ABp Arg Val Tyr 240 288 95 100 \ 05 Printed by ATC AAC TAT TAC G ^ C ATG AAC GCG GCT AGC GT (3 GGC TGG AAC AAC TCC 11¾ Asn Tyr Tyr Asp Met Asn Ala Ala Ser Val Gly Trp Asn Asn Ser 110 IIS 120 ACC TTC GCC T AA Thr Phe Ala X25 (2) SEQ ID No .: 12 of (I) Sequence characteristics: (A) Length: 25 base pairs -52- This paper size applies Chinese National Standard (CNS) A4 specification (2 OX297 mm). 336 346 43 42 ^ A7 B7 V. Description of the invention ( so) (B) type: nucleic acid (C) strand: single strand (D) topology: linear (ii) molecular state: other nucleic acids (A) Narration: / desc = " synthetic DNA "(xi) sequence Description: SEQ ID number: 12: GAATTCATCA TGCCGATGTT CATCG 25 (2) Information of SEQ ID number: 13: (〇 Sequence characteristics: (A) Length: 25 salts For (B) type: nucleic acid (C) strand: single strand (D) topology: linear (ii) molecular state: other nucleic acid (A) description: / desc = ”synthetic DNA” (xi) sequence description: SEQ ID number: 1 3: GCAGGCTGCA GAGCGCGCTC GGCTC 25 (2) Information of SEQ ID number: 14: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling this page) (i) Sequence Features: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strand: Single strand (D) Topology: Straight chain (ii) Molecular state: Other nucleic acids -53- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) 4 3 42 5 8: A7 B7 V. Description of invention (51) (A) Narration: / desc = n synthetic DNA " (xi) Sequence description: SEQ ID number: 14 : GCAGGCTGCT GAGCGCGCAC GGCTC 25 (2) Information of SEQ ID number: 15: (i) Sequence characteristics: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strand: Single strand (D) Extension Pu Xue: linear (ii) molecular state: other nucleic acid (A) description: / desc = ”synthetic DNA” (xi) sequence description: SEQ ID number: i5: TCGGCCAGCA GGCCGCTC AG C AGCT 25 (2) SEQ ID No. 16: Information: (i) Sequence characteristics: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Share property: Printed by the buyer ’s consumer cooperative of Zhongli Standard Bureau of the Ministry of Economic Affairs (Please read the notes on the back before filling this page) (D) Topology: Linear (ii) Molecular State: Other Nucleic Acids (A) Narrative: / desc = ”Synthetic DNA” (xi) Sequence Narrative: SEQID Number: 16: GAGCCGAGCG CGCTCTGCAG CCTGC 25 (2) SEQ ID No .: 1 7 Information: -54-This paper size uses the Chinese National Standard (CNS) A4 size (210 X 2 mm) Duo Yin, employee consumption cooperation of the Central Standards Bureau of the Ministry of Economic Affairs System 43 42 5 6. A7 _B7_ V. Description of the invention (52) (i) Sequence characteristics: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strand: Single strand (D) Topology : Linear (ii) molecular state: other acid-controlling (A) description: / desc = ”synthetic DNA” (xi) sequence description: SEQ ID number: 17: GAGCCGTGCG CGCTCAGCAG CCTGC 25 (2) SEQ ID number: 18 of Information: (i) Sequence characteristics: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Strand: Single strand (D) Topology: Linear (Π) Molecular state: Other nucleic acids (A ) Description: / desc = " Synthetic DNA "(xi) Sequence description: SEQ ID number: 18: AGCTGCTGAG CGGCCTGCTG GCCGA 25 (2) SEQ ID number: 1 9 Information: (i) Sequence characteristics: (A) Length: 24 base pair (B) type: nucleic acid (C) strand property: single strand -55- This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) ---------. -(Please read the notes on the back before filling this page) • JKi Order

43 42 5; S Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7__ V. Description of the Invention (53). (D) Topology: Linear (ii) Molecular State: Other Nucleic Acids (A) Narrative: / desc = " Synthetic DNA " (xi) Sequence description: SEQ ID number: 19: GAATTCTTAG GCGAAGGTGG AGTT 24 (2) Information of SEQ ID number: 20: (i) Sequence characteristics: (A) Length: 348 base pairs (B) Type: Nucleic acid (C) Strand: Single strand (D) Topology: Linear (ii) Molecular state: Other nucleic acids (A) Narrative: / desc = " Synthetic DNA " (ix) Features:

(A) Name / Search table: CDS (B) Address: 1 " 346 (xi) Sequence description: SEQ ID number: 20: ATG CCG ATG 1TC ATC GTA AAC iCC AAC GTG CCC CGC GOC TCC < STG CCG ' «

Met Pro Met Phe lie Val Afln ihr Aen Val Pro Arg Ala Ser Val Pro S 10 15 GAC GGG TTC CTC TCC CTC AjCC CAG CAG CTG GCG CAG GCd ACC GGO Qly Phe Ser Qlu Leu Thr Gin Gin Leu Ala Gin Ala Thr Glv 20 2S 30 AAG CCC CCC CAG TAG ATC GCG GTG CAC GTG GTC CCG GAC CAG CTC ATG 144

Lys Pro Pro Gin Tvr lie Ala Val His Val Val Pro Afip Gin Leu Met 3S 40 4S < 3CC TTC GGC QGC tCC AGC GW3 COG AGC G〇 $ CTC TGC AGC CTO CAC AGC 192

Ala Phe Gly Gly Ser Ser Glu Pro Ser Ala Leu Cys Ser Leu His Ser 50 55 60 -56- This paper size applies to China National Standard (CNS) A4 specification (210x297 mm). · (Please read the precautions on the back first Refill this page) I ------- M ----- 3 Pack ------- tr ------ ok— 一 ----------- «— ^ Ϋ n 43425 ^ A7 B7 V. Description of the invention (μ) ATC GGC AAG ATC GGC GGC GCX3 CAG AAC CSC TCC TAC A5C AAG CTG CTG lie Gly Lye lie Gly Gly Ala Gin Asn Aarg S ^ r Tyr Ser Lys Leu Leu 65 70 75 80 TGC GGC CTG CTG GCC QRG 〇3C CTG CGC ATC AC5C CCG GAC AGG GTC ΤΆΩ Cya ely .Iieu I ^ eu Ala Glu Arg Leu Axg He Ser Pro as potential Arg Val Tya: 240 2dd 85 90 95 ATC AAC TAT TAC GAC ATG AAC GCG GCC AAT GTO GGC TGG AAC AftC TCC Worker Asa Tyr Tyr Asp Met Asn Ala Ala Asn Val Gly Trp Asn Ser 100 ACC TTC GCC 'T Thr Phe Ala 115 105 110 348 (Please read the notes on the back first (Fill in this page again.) (Printed by Shelley Consumer Cooperatives, Central Bureau of Standards, Ministry of Economic Affairs-57- This paper size applies to Chinese National Standard (CNS) A4 specifications {2I〇X2.97 mm)

Claims (1)

43 421¾. Patent Application No. S51 (^ 935)% Chinese Patent Application Amendment (January 1990) VI. -Shen Cao Zhuan ^ Huaiwei Antigen non-specific human glycosylation inhibitor factor derivative, characterized by amino acid substitutions of residues listed at position 57 or 60 in the amino acid sequence of sequence identification number 1; wherein sequence identification number 1 Has the following sequence: ATG CCG ATG TTC ATC GTA AAC ACC AAC GTG CCC CGC GCC TCC GTG CCG Met Pro MeC Phe lie Val Asn Thx Asn Val Pro Arg Ala Ser Val Pro 1 5 10 15 GAC GGG TTC CTC TCC GAG CTC ACC CAG CAG CTG GCG CAG GCC ACC GGC Asp Gly Phe Leu Ser Glu Leu Thr Gin Gin Leu Ala Gin Ala Thr Gly 20 2S 30 AAG CCC CCC CAG TAC ATC GCG GTG CAC GTG GTC CCG GAC CAG CTC ATG Lys Pro Pro Gin Tyr lie Ala Val His Val Val Pro Asp Gin Leu Met 3S 40 45 GCG TTC GGC GGC TGC AGC GAG CCG TGC GCG CTC TGC AGC CTG GAC AGC Ala Phe Gly Gly Sar Ser Glu Pro Cys Ala Leu Cys Ser Leu His Ser SO 55 60 ATC GGC AAG ATC GGC GGC GCG CAG AAC CGC TCC TAC AGC AAG CTG CTG lie Gly Lys lie Gly Gly Ala Gin Asn Arg Ser Tyr Ser Lys Leu Leu 65-70 75 80 TGC GGC CTG CTG CTG GCC GAG CGC CTG CGC ATC AGC CCG GAC AGG GTC TAC Cys Gly Leu Leu Ala Glu Arg Leu Arg lie Ser Pro Asp Arg Val Tyr 35 90 95 ATC AAC TAT TAC GAC ATG AAC GCG GCC AAT GTG GGC TGG AAC AAC TCC Worker Asn Tyr Tyr Asp Met Asn Ala Ala Asn Val · Gly Trp Asn Asn Ser 100 105 HO ACC TTC GCC T AA Thr Phe Ala 115 43 144 192 240 283 22β 343 (Please read the precautions on the back before filling out this page) The Ministry of Economic Affairs ordered the Central Bureau of Consumer Affairs to cooperate with the company, and the policy 2. According to the application Antigen non-specific human glycosylation inhibitory factor derivative of the first paragraph of the patent, which is listed in the 57th position of the amino acid sequence of the amino acid sequence of the sequence identification number 1 of the first patent application The residue is substituted with alanine. 3. According to the antigen # 1 of the scope of the patent application, a specific human glucomannation inhibitory factor derivative, which is listed in the first of the amino acid sequence of the sequence identification number 1 of the first patent application garden The 60-position amino acid standard of this paper is applicable to China National Standards (CNS) A4 specification (210X297 mm) 434381 AS B8 C8 D8 The scope of patent application residues are chemically modified. 4.-Kind of multi-core coded according to the scope of patent application! Antigen of item Non-specific human glycosylation inhibitor derivative. 5. A kind of antigen non-specific human glycosylation inhibitory factor derivative, which is produced by culturing prokaryotic or eukaryotic cells transformed with the polynucleotide of item 4 of the patent application. Antigen non-specific human glycosylation inhibitor factor derivative of the scope item 5, which is the amino acid residue listed at the 60th position of the amino acid sequence of the sequence identification number 1 of the scope of application for patent j It is chemically modified. 7. A pharmaceutical composition for immunosuppressive effects or treatment and / or prevention of diabetes, which comprises an antigen non-specific human glycosylation inhibitor derived according to item 1 or 5 of the scope of patent application ----- ^ ---- Ί. 装 —I (please read the precautions on the back before filling out this page) — Order- 7. 十 Shiyang Jiquan Bureau of the Ministry of Economic Affairs W: Printed by Industrial and Consumer Cooperatives ¾ I-paper A4 M # · Ns C / V