KR19990022315A - Fibroblast Growth Factor 13 - Google Patents

Abstract

Fibroblast growth factor 13 polypeptides and DNA (RNA) encoding the polypeptides are described. Also provided are methods of making such polypeptides by recombinant techniques. Also to prevent nerve damage caused by stroke-related neurological disorders, to propagate nerve growth, to inhibit skin aging, hair damage, and to promote angiogenesis and mesodermal induction during early backpack and limb remodeling, eg For example, a method of using the polypeptide for promoting wound healing due to burns and ulcers is described in detail. An antagonist against the polypeptide and its use as a therapeutic agent for inhibiting abnormal cell proliferation, hypertensive disorders and epithelial lens cell proliferation are described. Also described are diagnostic methods that detect changes in the concentration of polypeptides in a sample derived from mutations and hosts in the darkened sequence.

Description

Fibroblast Growth Factor 13

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and methods of making such polynucleotides and polypeptides. More particularly, polypeptides of the invention have been presumably identified as fibroblast growth factor / heparin binding growth factor (described below as "FGF-13"). The invention also relates to the inhibition of the action of such polypeptides.

Fibroblast growth factor is also called heparin binding growth factor (HBGF) because it is a protein species characterized by binding to heparin. Expression of other members of these proteins is found in a variety of tissues, and under special temporal and spatial control. The protein includes fibroblasts, corneal and vascular endothelial cells, granulocytes, adrenal cortical cells, chondrocytes, myoblasts, vascular smooth muscle cells, lens epithelial cells, melanin cells, keratinocytes, glial cells, stellate cells, osteoblasts and hematopoietic cells Is a mitotic substance that is effective against a variety of cells of mesoderm, ectoderm and endoderm origin.

Each member has a function that overlaps with other members and also has a unique spectrum of functions. In addition to the ability to promote the proliferation of vascular epithelial cells, FGF-1 and FGF-2 are chemotactic for epithelial cells, and FGF-2 allows them to penetrate into the basement membrane. In comparison with these properties, FGF-1 and FGF-2 have the ability to promote angiogenesis. Another important feature of the growth factor is that it promotes wound healing. Many other members of FGF species share similar activities with FGF-1 and 2, such as promoting angiogenesis and wound healing. Some members of the FGF species induce mesoderm formation and regulate differentiation of neurons, fat globules and skeletal muscle cells.

In addition to the biological activity in normal tissues, FGF proteins promote tumor angiogenesis in cancers and sarcomas and promote tumorigenesis by modifying the protein when their expression is uncontrolled.

The FGF species currently consists of eight structurally related polypeptides: basic FGF, acidic FGF, Ste 2, hst 1 / k-FGF, FGF-5, FGF-6, keratinocyte growth factor, AIGF (FGF-8), It has recently been found that glial-active factor is a novel heparin-binding growth factor purified from the culture supernatant of human glioma cell lines [Ref. Miyamoto, M. et al., Mol. and Cell. Biol., 13 (7): 4251-4259 (1993)]. The genes for each are cloned and sequenced. The two members FGF-1 and FGF-2 are characterized by a number of names, but most often are referred to as acidic and basic fibroblast growth factors, respectively. Normal gene products affect the general proliferative capacity of cells derived from many mesoderm and neuroectodermal layers. The material may induce angiogenesis in vivo and may play an important role in the early stages of development. Burgess, W.H. and Maciag, T., Annu. Rev. Biochem., 58: 575-606, (1989).

Many of the identified members of the FGF species also bind to the same receptor and induce secondary messages through binding to the receptor.

Eukaryotic cell expression vectors encoding the secreted form of FGF-1 are introduced into porcine arteries by gene transfer. This model defines the function of genes in arterial vessel walls in vivo. Expression of FGF-1 after 21 days of transduction leads to endovascular thickening in porcine arteries. Nabel, E.G., et al., Nature, 362: 844-6 (1993). In addition, basic fibroblast growth factor can regulate the growth and progression of glioma regardless of its role in tumor angiogenesis, exemplifying the release or secretion of basic fibroblast growth factor may be necessary for this action. ; Morrison, R. S., et al., J. Neurosci. Res., 34: 502-9 (1993).

Fibroblast growth factors such as basic FGF further induce the growth of Kaposi's sarcoma cells in vitro [Ref. Huang, Y. Q., et al., J. Clin. Invest., 91: 1191-7 (1993). In addition, the cDNA sequence encoding human basic fibroblast growth factor is cloned downstream of the transcriptional promoter recognized as bacterial phage T7 RNA polymerase. The obtained basic fibroblast growth factor was found to have biological activity indistinguishable from fibroblast growth factor in human placenta in the synthesis and angiogenesis assay of mitotic gene, plasminogen activator [Ref. Squires, C. H., et al., J. Biol. Chem., 263: 16297-302 (1988).

US Pat. No. 5,155,214 describes basic fibroblast growth factors and their production of substantially pure mammalian cells. In addition to the DNA sequences encoding bovine species polypeptides, amino acid sequences of bovine and human basic fibroblast growth factors are described.

The newly discovered FGF-9 has about 30% sequence similarity with other members of the FGF species. The FGF-9 sequence also contains sequences consistent with the two cysteine residues of the species member. FGF-9 does not have a typical signal sequence, similar to the N terminal of acidic and basic FGFs. However, despite the absence of the typical signal sequence FGF, FGF-9 was found to be secreted from the cells after synthesis [Ref. Miyamoto, M. et al., Mol. and Cell. Biol., 13 (7): 4251-4259 (1993)]. In addition, FGF-9 promotes cell growth of oligodendrosite type 2, dendritic progenitor cells, BALB / c3T3, and PC-12 cells but does not promote the growth of venous epithelial cells in the human navel [Ref. Naruo, K., et al., J. Biol. Chem., 268: 2857-2864 (1993).

Basic and acidic FGFs are effective regulators of cell proliferation, cell motility, differentiation and survival and act on cell types from endoderm, mesodermitis, ectoderm. Both FGFs together with KGF and AIGF are identified by protein purification. However, four other members have been identified as oncogenes, the expression of which is limited to certain types of embryonic formation and cancer. FGF-9 is exemplified as a dividing promoter for glioma cells. Members of FGF species have been reported to have the potential of oncogenes. FGF-9 exhibits a transformation potential when transformed into BALB / c3T3 cells. Miyamoto, M., et al., Mol. Cell. Biol., 13 (7): 4251-4259 (1993)].

Androgen derived growth factor (AIGF), also known as FGF-8, is purified from conditioned mediators of mouse mammalian carcinoma cells (SC-3) simulated with testosterone. AIGF is an apparent FGF-like growth factor that has an estimated signal peptide and shares 30-40% homology with known members of the FGF species. Mammalian cells transformed with AIGF show an excellent promoting effect on the growth of SC-3 cells in the absence of androgens. Hence, AIGF regulates androgen-induced growth of SC-3 cells, perhaps other cells, because they are secreted by tumor cells themselves.

Polypeptides of the invention were putatively identified as members of FGF species as a result of amino acid sequence homology with other members of FGF species.

In accordance with an aspect of the present invention, novel mature polypeptides and fragments, homologs and derivatives thereof are biologically active and diagnostically or therapeutically useful. Polypeptides of the invention are of human origin.

According to another aspect of the invention, an isolated nucleic acid molecule encoding a polypeptide of the invention, including mRNA, DNA, cDNA and genomic DNA, as well as its antisense homologs and fragments thereof which are biologically active and diagnostic or therapeutically useful. To provide.

According to another aspect of the invention, a recombinant prokaryotic and / or eukaryotic host cell containing a recombinant vector, such as a cloning and expression plasmid, useful as a reagent in the recombinant preparation of a polypeptide of the invention, and a nucleic acid sequence encoding the polypeptide of the invention. It provides a method for producing the polypeptide by recombinant technology using.

According to a further aspect of the invention, the polypeptide, or polynucleotide encoding the polypeptide, is searched for agents and antagonists thereof, to promote wound healing as a result of therapeutic purposes such as burns and ulcers, Used to inhibit nerve damage caused by neurological disease, promote nerve growth, inhibit skin aging and hair damage associated with seizures, promote angiogenesis, induction of mesoderm early in embryos, and limb regeneration Provide a method.

According to a further aspect of the invention, an antibody against said polypeptide is provided.

According to another aspect of the invention, for the reduction of wounds and for the treatment of hypertensive diseases, in order to inhibit the action of the antagonist against the polypeptide and, for example, the polypeptide in the treatment of a cell transformation (eg tumor). Methods of using these antagonists are provided.

According to another aspect of the present invention, a nucleic acid probe is provided comprising a nucleic acid molecule of sufficient length to specifically hybridize with a polynucleotide encoding a polypeptide of the invention.

According to another aspect of the present invention, there is provided a diagnostic assay for detecting susceptibility to a disease or condition associated with a mutation of a nucleic acid sequence of the invention and overexpression of a polypeptide encoded with the sequence.

According to another aspect of the present invention, there is provided a method of using said polypeptide or polynucleotide encoding said polypeptide for in vitro purposes relating to scientific research investigations, DNA synthesis and preparation of DNA vectors.

All aspects of the invention will be apparent to those skilled in the art from the teachings herein.

The following drawings illustrate certain aspects of the invention but are not intended to be limiting in any way.

1 illustrates the cDNA sequence of FGF-13 and the corresponding deduced amino acid sequence. The first 21 amino acid residues refer to the putative leader sequence.

According to an aspect of the present invention, a mature polypeptide having the deduced amino acid sequence (SEQ ID NO: 2) of FIG. 1 or a cloned mature polypeptide encoded by ATCC Accession No. 97147 on May 12, 1995 is encoded. An isolated nucleic acid molecule (polynucleotide) is provided.

FGF-13 encoding polynucleotides of the present invention have been found in cDNA libraries derived from human ovarian cancer tissue. The FGF-13 polypeptide is structurally related to all members of the fibroblast growth factor species, and the first 21 amino acids are open to encode a polypeptide of 212 amino acids, which is the putative leader sequence such that the mature polypeptide contains 191 amino acids. Contains an open reading frame. Among the consensus 1) 69% homology and 81% similarity with mouse AIGF to 185 amino acids; 2) 30% homology and 56% similarity with FGF-4 from chicken of 82 amino acid sites; 3) It has 42% homology and 64% similarity with human KGF for 78 amino acids.

FGF / HBGF species signal, GXLX (S, T, A, G) X6 (D, E) CXFXE is conserved in the polypeptide of the invention (X means specific amino acid residues, and (D, E) is D or E Residues, X6 means 6 amino acid residues).

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA including cDNA, genomic DNA and synthetic DNA. Such DNA may be double stranded or single stranded. The coding sequence encoding the mature polypeptide is the same as the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone, or the DNA sequence of FIG. 1 (SEQ ID NO: 1) as a result of the redundancy or degeneracy of the genetic code. Or a different coding sequence that encodes the same mature polypeptide as the deposited cDNA.

Polynucleotides encoding the mature polypeptide (SEQ ID NO: 2) of FIG. 1 or the mature polypeptide encoded by the deposited cDNA may only contain the coding sequence for the mature polypeptide; Additional coding sequences, such as coding sequences for mature polypeptides and leader or secretory sequences or proprotein sequences; Coding sequences for mature polypeptides (and any additional coding sequences) and non-coding sequences such as non-coding sequences 5 'and / or 3' of coding sequences for introns or mature polypeptides.

Thus, the term "polynucleotide encoding a polypeptide" encompasses not only polynucleotides comprising coding sequences for polypeptides, but also polynucleotides comprising additional coding and / or non-coding sequences.

The present invention further relates to variants of the above-mentioned polynucleotides encoding fragments, homologs and derivatives of polypeptides encoded by cDNAs of polypeptides having a deduced amino acid sequence (SEQ ID NO: 2) or deposited clones. Variants of such polynucleotides may be natural allelic variants of the polynucleotides or non-natural variants of the polynucleotides.

Accordingly, the present invention is directed to the polypeptide of FIG. 1 (SEQ ID NO: 2) or the deposited clone, as well as to the polynucleotide encoding the same mature polypeptide or the same mature polypeptide encoded by the cDNA of the deposited clone as shown in FIG. And variants of the polynucleotide encoding fragments, derivatives or homologs of the polypeptide encoded by cDNA of. Such nucleotide variants include deletion variants, substitutional variants and addition or insertion variants.

As noted above, the polynucleotide may have a coding sequence that is a natural allele variant of the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone. As is known in the art, allelic variants are alternative forms of polynucleotide sequences in which one or more nucleotides may be substituted, deleted or added without substantially modifying the function of the encoded polypeptide.

The invention also provides a polynucleotide sequence in which the coding sequence for the mature polypeptide assists in the expression and secretion of the polypeptide from the host cell, eg, a leader sequence that acts as a secretory sequence that regulates the transport of the polypeptide from the host cell. Polynucleotides that can be fused in the same reading frame as. A polypeptide having a leader sequence is a preprotein and may have a leader sequence that is cleaved by the host cell to form a mature form of the polypeptide. The polynucleotide may also encode a proprotein, which is a mature protein plus an additional 5 'amino acid residue. Mature proteins with prosequences are proproteins and are inactive forms of the protein. When the prosequence is cleaved, the active mature protein remains.

Thus, for example, the polynucleotide of the present invention can encode a mature protein, a protein having a prosequence, or a protein having both a prosequence and a presequence (leader sequence).

The polynucleotides of the invention may also have coding sequences fused within the frame to marker sequences that allow for purification of the polypeptides of the invention. This marker sequence may be a hexahistidine tag supplied by a pQE-9 vector provided for purification of a mature polypeptide fused with the marker in the case of a bacterial host, or a mammalian host such as, for example, a COS-7 cell. If used, it may be a hemagglutinin (HA) tag. HA tags correspond to epitopes derived from influenza hemagglutinin proteins (Wilson, I., et al., Cell, 37: 767 (1984)).

The term “gene” refers to a segment of DNA involved in producing a polypeptide chain; It includes insertion sequences (introns) between individual coding segments (exons) as well as front and rear regions (leaders and trailers) of the coding region.

Fragments of the full-length FGF-13 gene can be used as hybridization probes for the cDNA library to isolate full-length genes and to isolate other genes with high similarity sequences or similar biological activities to the genes. . Probes of this type preferably have about 30 or more bases and may contain, for example, 50 or more bases. The probe can be used to identify genomic clones or clone (s) containing cDNA clones corresponding to full length transcripts and complete FGF-13 genes including regulatory and promoter regions, exons and introns. One example of the screen involves separating the coding region of the FGF-13 gene by using known DNA sequences to synthesize oligonucleotide probes. Labeled oligonucleotides having sequences complementary to the gene sequences of the present invention are used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The present invention also relates to polynucleotides which hybridize with the above-mentioned sequences when at least 70%, preferably at least 90% and more preferably at least 95% homology exists between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions with the above-mentioned polynucleotides. As used herein, the term “strict conditions” means that hybridization occurs only when there is at least 95%, preferably at least 97%, homology between the sequences. In a preferred embodiment the polynucleotide hybridizing with the above-mentioned polynucleotide encodes a polypeptide substantially retaining the same biological function or activity as the cDNA of FIG. 1 (SEQ ID NO: 1) or the mature polypeptide encoded by the deposited cDNA.

Alternatively, the polynucleotide is at least 20, preferably at least 30, more preferably hybridized with the polynucleotide of the present invention and having the same homology as mentioned above and may or may not retain activity. It may contain more than 50 bases. For example, such polynucleotides can be used, for example, as probes for polynucleotides of SEQ ID NO: 1 for recovering polynucleotides or as diagnostic probes or as PCR primers.

Accordingly, the present invention provides a polynucleotide encoding not only a polypeptide of SEQ ID NO: 2 but a fragment thereof (the fragment having at least 30, preferably at least 50 bases) and at least 70%, preferably at least 90%, more preferably Preferably a polynucleotide having at least 95% homology.

The deposits referred to in the present invention are maintained under the Convention of the Budapest Treaty on the International Approval of Microbial Deposits in Patent Procedures. These deposits are merely to provide convenience to those skilled in the art, and the deposits are subject to 35 U.S.C. It is not an approval requirement to meet § 112 regulations. The sequence of the polynucleotide contained in the deposited material, and the amino acid sequence of the polypeptide encoded thereby, is adjusted in the event of a conflict with the sequence cited herein by reference and described herein. A license may be required to manufacture, use or sell the deposited material, no license is granted by this application.

The invention further relates to FGF polypeptides having an inferred amino acid sequence of SEQ ID NO. 1 (SEQ ID NO: 2) or an amino acid sequence encoded by deposited cDNA, as well as fragments, homologs and derivatives of such polypeptides.

When referring to the polypeptide of Figure 1 (SEQ ID NO: 2) or a polypeptide encoded by a deposited cDNA, the terms "fragment", "derivative" and "homolog" refer to a polypeptide that substantially retains the same biological function or activity as the polypeptide. Means. Thus, homologues include proproteins that are activated by cleavage of the proprotein moiety to produce a mature polypeptide having activity.

The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

Fragments, derivatives or homologues of the polypeptide of Figure 1 (SEQ ID NO: 2) or polypeptide encoded by a deposited cDNA are (i) substituted with an amino acid residue (preferably a conserved amino acid residue) in which one or more amino acid residues are conserved or not. And the amino acid residue thus substituted may or may not be encoded by the genetic code, or (ii) one or more amino acid residues comprise a substituent group, or (iii) the mature polypeptide is another compound, for example Fused with a compound that increases the half-life of the polypeptide (eg, polyethylene glycol), or (iii) a leader or secretory sequence; Sequences used for purification of mature polypeptides; Or an additional amino acid, such as a proprotein sequence, may be fused with a mature polypeptide. One of ordinary skill in the art, from the teachings herein, may consider that such fragments, derivatives and homologues are within the scope of the present invention.

Polypeptides and polynucleotides of the invention are preferably provided in isolated form and are preferably purified homogeneously.

The term "isolated" means removing a substance from its original environment (eg, the natural environment if it is a natural substance). For example, native polynucleotides or polypeptides present in living animals are not isolated, but identical polynucleotides or polypeptides isolated from some or all of the materials that coexist in the natural system are isolated. Such polynucleotides may be part of a vector and / or the polynucleotide or polypeptide may be part of a composition and may be separated when the vector or composition is not part of its natural environment.

Polypeptides of the invention have at least 70% similarity (preferably at least 70% homology) with the polypeptide of SEQ ID NO: 2 as well as the polypeptide of SEQ ID NO: 2, preferably with at least 90% similarity with the polypeptide of SEQ ID NO: 2 Preferably at least 90% homology), more preferably at least 95% similarity (more preferably at least 95% homology) with the polypeptide of SEQ ID NO: 2, and generally at least 30 amino acids, More preferably a portion of said polypeptide having said portion of a polypeptide containing at least 50 amino acids.

As known in the art, “similarity” between two polypeptides is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substituents to the sequence of the second polypeptide.

Fragments or portions of the polypeptides of the invention can be used to prepare corresponding full length polypeptides by peptide synthesis, and thus such fragments can be used as intermediates for making full length polypeptides. Fragments or portions of the polypeptides of the invention can be used to synthesize the full length polynucleotides of the invention.

The invention also relates to the production of a vector comprising a polynucleotide of the invention, a host cell genetically engineered using the vector of the invention, and a polypeptide of the invention by recombinant technology.

Host cells are genetically engineered (transduced, transformed or transfected) using vectors of the invention, which can be, for example, cloning vectors or expression vectors. Such vectors may be in the form of, for example, plasmids, viral particles, phages, and the like. The host cell engineered as described above can be cultured in a conventional nutrient medium modified to be suitable for activation of a promoter, selection of transformants or amplification of the FGF gene. Culture conditions such as temperature, pH and the like have been used previously with the host cell selected for expression and will be apparent to those skilled in the art.

Polynucleotides of the invention can be used to prepare polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of various expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV40; Bacterial plasmids; Phage DNA; Baculovirus; Yeast plasmids; Vectors derived from the combination of plasmid and phage DNA, vice versa, such as vaccinia, adenovirus, poultry pox virus, and pseudorabies. However, any other vector can be used if it is replicable and viable in the host.

Appropriate DNA sequences can be inserted into the vector by a variety of methods. Generally, such DNA sequences are inserted into suitable restriction endonuclease sites by methods well known in the art. Such and other methods are considered to be within the scope of those skilled in the art.

DNA sequences in expression vectors are operably linked to appropriate expression control sequences (promoters) to direct mRNA synthesis. Representative examples of such promoters include the LTR or SV40 promoter, E. E. coli lac or trp, phage lambda P _L promoters, and other promoters known to modulate gene expression in prokaryotic or eukaryotic cells or their viruses may be mentioned. The expression vector also contains a ribosomal binding site and transcription terminator for initiation of translation. The vector may comprise a sequence suitable for amplifying expression.

In addition, the expression vector is preferably dihydrofolate reductase or neomycin resistance, or E. coli for eukaryotic cell culture. It contains one or more selectable marker genes that provide phenotypic properties for the selection of transformed host cells, such as tetracycline or ampicillin resistance in E. coli.

As well as suitable DNA sequences as mentioned above, vectors containing the appropriate promoter or regulatory sequences can be used to transform the appropriate host so that the host can express the protein. Representative examples of suitable hosts include: Bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium; Fungal cells such as yeast; Insectoid cells such as Drosophila S2 and Spodoptera Sf9; Animal cells such as CHO, COS or Bowes melanoma; Adenovirus; Plant cells and the like can be mentioned. Selection of suitable hosts is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also encompasses recombinant constructs comprising one or more of the sequences as broadly described above. Such constructs include vectors such as plasmids or viral vectors in which the sequences of the invention have been inserted in a forward or backward direction. In a preferred aspect of this embodiment, the construct further comprises a regulatory sequence, for example comprising a promoter operably linked to the sequence. Many suitable vectors and promoters are known to those skilled in the art and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (source: Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Source: Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Source: Stratagene), pSVK3, pBPV, pMSG, pSVL (Source: Pharmacia). However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

Promoter regions can be selected from any desired gene using a CAT (Chloramphenicol transferase) vector or other vector with a selectable marker. Two suitable vectors are PKK232-8 and PCM7. Particularly named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P _R , P _L and trp. Eukaryotic promoters include CMV early intermediate, HSV thymidine kinase, early and late SV40, LTR from retrovirus, and mouse metallothionein-I. Selection of suitable vectors and promoters is within the scope of conventional techniques in the art.

In a further aspect, the present invention relates to a host cell containing the above-mentioned construct. The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into host cells can be performed by calcium phosphate transfection, DEAE-dextran mediated transfection, or electroporation. Davis, L., Dibner, M., Battey , I., Basic Method in Molecular Biology, (1986)].

Constructs in host cells can be used in conventional manner to produce gene products encoded by recombinant sequences. Alternatively, the polypeptides of the invention can be prepared synthetically by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of a suitable promoter. Cell-free translation systems can also be used to make such proteins using RNA derived from the DNA constructs of the invention. Cloning and expression vectors suitable for use with prokaryotic and eukaryotic hosts are described in Sambrook. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), incorporated herein by reference.

Transcription of the DNA encoding a polypeptide of the invention by higher eukaryotic cells is increased by inserting an enhancer sequence into the vector. Enhancers are typically cis-functional elements of DNA that are about 10-300 bp and act on the promoter to increase transcription. Examples include the SV40 enhancer on the terminal side of the origin of replication (bp 100 to 270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the terminal side of the origin of replication, and adenovirus enhancers.

In general, recombinant expression vectors may be of origin of replication; Selective markers that allow transformation of host cells, for example E. Coli and s. Ampicillin resistance gene of the S. cerevisiae TRP1 gene; And a promoter derived from a highly expressed gene directing transcription of the underlying sequence. The promoter may be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock protein. The heterologous structural sequence is assembled in an appropriate phase with translation initiation and termination sequences, and preferably with leader sequences that can direct the translated protein to be secreted into the cytoplasmic space or extracellular medium. Optionally, this heterologous structural sequence can encode a fusion protein comprising an N-terminal identification peptide that provides the desired properties, eg, stabilization or simplified purification of the expressed recombinant product.

Expression vectors useful for use in bacteria are constructed by inserting a structural DNA sequence encoding a protein of interest into an operative reading with a functional promoter, along with a suitable translational initiation and termination signal. The vector can maintain the vector, including one or more phenotypic selectable markers and origins of replication, and provides amplification in the host if necessary. Suitable prokaryotic host cells for transformation are E. coli. There are various species in E. coli, Bacillus subtilis, Valverella typhimurium, and Pseudomanas genus, Streptomyces genus and Staphylococcus genus, but others may be selected and used.

As a representative but non-limiting example, expression vectors useful for use in bacteria can include bacterial markers of origin and selectable markers derived from commercial plasmids comprising the genetic elements of the well-known cloning vector pBR322 (ATCC 37017). have. The commercially available vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, Wis., USA). The pBR322 "backbone" fragment is combined with a suitable promoter and the structural sequence to be expressed.

After transforming a suitable host strain and growing the host strain at a suitable cell density, the selected promoter is induced by a suitable method (eg temperature change or chemical induction) and the cells are cultured for an additional period of time.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

Microbial cells used for the expression of proteins can be disrupted by conventional methods, including methods that are well known to those skilled in the art, such as freeze-thaw circulation, sonication, mechanical disruption, or the use of cell lysates. have.

In addition, various mammalian cell culture systems can be used to express recombinant proteins. Examples of mammalian expression systems include the COS-7 strain of monkey kidney fibroblasts described in Gluzman, Cell, 23: 175 (1981), and other cell lines capable of expressing a conformity vector, for example C127. , 3T3, CHO, HeLa, and BHK cell lines. Mammalian expression vectors include origins of replication, suitable promoters and enhancers, and essential ribosomal binding sites, polyadenylation sites, split donor and acceptor sites, transcription termination sequences, and 5 'flanking non-transcribed sequences. DNA sequences derived from SV40 viral genomes such as SV40 origin, early promoters, enhancers, splits and polyadenylation sites can be used to provide the necessary non-transcriptional genetic elements.

Polypeptides of the invention include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography The method can be recovered and purified from recombinant cell culture. Protein refolding steps can be used to complete the arrangement of mature proteins, if necessary. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

Polypeptides of the invention are naturally purified products or by recombinant techniques from chemical synthesis processes or from prokaryotic or eukaryotic cell hosts (eg, by bacterial, yeast, higher plant, insect and mammalian cells in culture). It may be a manufactured product. Depending on the host used in the recombinant manufacturing process, the polypeptides of the invention may or may not be glycosylated with mammalian or other eukaryotic carbohydrates. Polypeptides of the invention may also comprise initial methionine amino acid residues.

Polypeptides of the present invention can promote vascular endothelial growth and are therefore used in the treatment to promote revascularization of anemia tissue by various diseases such as thrombosis, atherosclerosis, and other cardiovascular conditions. The polypeptide can also be used to promote angiogenesis and limb remodeling.

Polypeptides promote mitosis in many cells of different origins, such as fibroblasts and skeletal muscle cells, making it easier to repair or repair damaged or diseased tissues, resulting in injury, burns, postoperative tissue recovery, and wounds due to ulcers. It can be used to treat.

Polypeptides of the invention also promote nerve growth, are associated with seizures, and nerve damage that occurs in certain neurological disorders or neuro-degenerative conditions such as Alzheimer's disease, Parkinson's disease and AIDS-related complications. It is used to prevent and cure. Since FGF-13 can promote chondrocyte growth, the polypeptide can be used to enhance bone and perivascular remodeling and to assist in tissue transplantation or bone transplantation.

Polypeptides of the invention also promote keratinocyte growth and thus can be used to prevent skin aging by sunburn.

FGF-13 polypeptides can also be used to prevent hair damage because FGF species members activate hair forming cells and promote melanocyte growth. Similarly, when used in combination with other cytokines, the polypeptides of the invention can be used to promote the growth and differentiation of hematopoietic and bone marrow cells.

FGF-13 polypeptides can also be used to maintain organs or support cell culture of primary tissue prior to transplantation.

Polypeptides of the invention can also be used to induce differentiation of tissue of mesodermal origin in early embryos.

Also in accordance with a further aspect of the present invention, the polypeptide or the polypeptide is encoded for the purpose of providing a diagnostic and therapeutic agent for the in vitro purposes associated with scientific research, DNA synthesis and the manufacture of a DNA vector and for the treatment of human diseases. It provides a method of using a polynucleotide.

The present invention provides a method for identifying a receptor for a polypeptide of the invention. Genes encoding such receptors can be identified by a number of methods known to those skilled in the art, such as ligand panning and FACS classification. Coligan, et al., Current Protocols in Immun., 1 (2), Chapter 5, (1991)]. Preferably, polyadenylation RNA is prepared from cells reactive to the polypeptide, eg, NIH3T3 cells, SC-3 cells, which are known to contain multiple receptors for FGF species proteins, and cDNA libraries generated from such RNA are prepared. Expression cloning is used to divide into pools and transfect COS cells or other cells that are not reactive against the polypeptide. Transfected cells grown on glass slides are exposed to labeled polypeptides of the invention. Polypeptides can be labeled in a variety of ways, including iodide or incorporation of a recognition site for site specific protein kinases.

After fixation and incubation, the slides are analyzed using auto-radio photography. Positive pools are identified, sub-pools are prepared, and retransfected using repeated sub-pooling and rescreening methods to yield a single clone that finally encodes the putative receptor.

As another approach to receptor identification, the labeled polypeptide can be photoaffinityly linked with an extract preparation that expresses a cell membrane or receptor molecule. The crosslinked material is split by PAGE and exposed to X-ray film. The labeled complex containing the receptor of the polypeptide is cleaved, split into peptide fragments and protein microsequences. Amino acid sequences obtained from microsequencing can be used to design a set of degenerate oligonucleotide probes for screening cDNA libraries to identify genes encoding putative receptors.

The present invention provides a method for screening a compound for identifying a substance that modulates the action of a polypeptide of the present invention. Examples of such assays include mixing mammalian fibroblasts, polypeptides of the invention, compounds to be screened and ³ [H] thymidine under cell culture conditions in which fibroblasts normally proliferate. Control assays can be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound in each case to determine if ³ [H] thymidine uptake is stimulated. Fibroblast proliferation is measured by liquid scintillation chromatography measuring the incorporation of ³ [H] thymidine. Agonist and antagonist compounds can be identified by this method.

In another method, a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the invention is incubated with the labeled polypeptide of the invention in the presence of a compound. The ability of the compound to enhance or block this interaction is measured. In addition, by measuring the reaction of the known secondary messenger system and the subsequent interaction of the compound to be screened with the FGF-13 receptor, and by measuring the ability of the compound to bind to the receptor and induce a secondary messenger response, Determine the agent and antagonist. Such secondary messenger systems include, but are not limited to, cAMP guanylate cyclase, ion channel or phosphoinositized hydrolysis.

Examples of antagonist compounds include oligonucleotides that bind to a receptor for an antibody, in some cases a polypeptide of the invention but do not induce a secondary messenger response or bind to the FGF-13 polypeptide itself. Efficacy agonists can effectively block the action of polypeptides because they do not induce a mutant or secondary messenger response to a polypeptide that binds to a receptor.

Other antagonist compounds for the FGF-13 gene and gene products are antisense constructs prepared using antisense technology. Antisense technology is used to regulate gene expression through triple-helix formation or to control gene expression via antisense DNA or RNA, all of which are based on binding polynucleotides to DNA or RNA. For example, antisense RNA oligonucleotides of about 10 to 40 base pairs in length are designed using the 5 'coding portion of a polynucleotide sequence that encodes a mature polypeptide of the invention. By designing DNA oligonucleotides to be complementary to gene regions involved in transcription [triple helix—Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988); And Dervan et al., Science, 251: 1360 (1991), inhibiting transcription and production of polypeptides of the invention. Antisense RNA oligonucleotides hybridize with mRNA in vivo and block mRNA molecules from being translated into polypeptides [Antisense-Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). In addition, the above-mentioned oligonucleotides are delivered to cells so that antisense RNA or DNA can be expressed in vivo to inhibit the production of polypeptides.

Efficacy antagonist compounds also contain small molecules that bind and occupy the binding site of the receptor, making it difficult for the receptor to reach its polypeptide and inhibiting normal biological activity. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules.

Antagonist compounds inhibit the cell growth and proliferative effects of the compounds of the present invention, ie, the promotion of tumor angiogenesis, in cells and tissues of neoplasms, and thus, for example, to delay or inhibit abnormal cell growth or proliferation in tumor formation or growth. Can be used.

Antagonists can also be used to inhibit hypertension disease and to inhibit the proliferation of epithelial lens cells after extracapsular cataract surgery. In addition, inhibition of mitotic promoting activity of the polypeptides of the present invention may be desirable in cases such as restenosis after balloon angioplasty.

Antagonists may also be used to inhibit the growth of scar tissue during wound treatment.

The antagonist may be used in the composition with a pharmaceutically acceptable carrier as mentioned below.

The polypeptides, agonists and antagonists of the invention can be combined with a suitable pharmaceutical carrier to prepare a pharmaceutical composition for parenteral administration. Such compositions comprise a therapeutically effective amount of the polypeptide, agonist or antagonist compound of interest and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should be suitable for dosage form.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the invention. The matter relating to the container may be a notice in the form prescribed by a government agency regulating the manufacture, use, or sale of a medicament or biological product, which notice is produced, used by the government agency for a product for human administration. Or the approval of the sale. In addition, the pharmaceutical compositions of the present invention can be used with other therapeutic compounds.

The pharmaceutical compositions can be administered by conventional methods, such as oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical composition is administered in an amount effective to treat and / or prevent specific symptoms. In general, it should be administered in an amount of at least about 10 μg / kg body weight per day and in most cases in an amount of no greater than about 8 mg / kg body weight per day. In most cases, the dosage is about 10 μg / kg body weight to about 1 mg / kg body weight per day, taking into account the route of administration, symptoms, and the like. In the specific case of topical administration, the dosage is preferably administered at about 0.1 μg to 9 mg per cm 2.

Polypeptides of the invention, and agonist and antagonist compounds that are polypeptides, may also be used in accordance with the invention by expressing the polypeptide in vivo, which is often referred to as "gene therapy."

Thus, for example, the cells may be genetically engineered with polynucleotides (DNA or RNA) encoding polypeptides in vitro, and then such genetically engineered cells may be provided to a patient to be treated with the polypeptides. Such methods are well known in the art. For example, cells can be manipulated by methods known in the art by using retroviral particles containing RNA encoding a polypeptide of the invention.

Similarly, cells can be manipulated in vivo to express the polypeptide in vivo, for example by methods known in the art. As is known in the art, producer cells for preparing retroviral particles containing RNA encoding a polypeptide of the invention may be administered to a patient to manipulate the cells in vivo and to express the polypeptide in vivo. Can be. Methods and other methods for administering a polypeptide of the present invention by this procedure should be apparent to those skilled in the art from the teachings of the present invention. For example, expression vehicles for manipulating cells may be other than retroviral particles, for example, which may be used to manipulate cells in vivo after binding an adenovirus with a suitable delivery vehicle.

Retroviruses from which the above-mentioned retroviral plasmid vectors can be derived include Moroni murine leukemia virus, spleen necrosis virus, retroviruses such as Loose Sarcoma virus, Harvey Sarcoma virus, avian leukemia virus, gibbon Ape leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus and mammalian tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moroni murine leukemia virus.

The vector contains one or more promoters. Suitable promoters that can be used include retroviral LTRs; SV40 promoter; And in Miller et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), eukaryotic intracellular promoters, including but not limited to human cytomegalovirus (CMV), or other promoters (eg, histone, pol III, and β-actin promoters). Intracellular promoters), but is not limited thereto. Other viral promoters that can be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. Selection of suitable promoters will be apparent to those skilled in the art from the teachings herein.

Nucleic acid sequences encoding polypeptides of the invention are under the control of suitable promoters. Suitable promoters that can be used include adenovirus promoters such as adenovirus major late promoters; Heterologous promoters such as cytomegalovirus (CMV) promoters; Respiratory syncytial virus (RSV) promoter; Inducible promoters such as MMT promoter, metallothionein promoter; Heat shock promoters; Albumin promoter; ApoAI promoter; Human globin promoter; Viral thymidine kinase promoters such as the herpes simplex thymidine kinase promoter; Retroviral LTRs (including modified retroviral LTRs as mentioned above); β-actin promoter; And human growth hormone promoters. Such promoters may also be native promoters that regulate the genes encoding the polypeptide.

Retroviral plasmid vectors can be used to transduce packaging cell lines to form producer cell lines. Examples of packaging cells that can be transfected include Miller, Human Gene Therapy, Vol. 1, p. 5-14 (1990)] PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E-86, GP + envAm12, and DNA cell lines, but are not limited to these. Such vectors can transduce packaging cells through any means known in the art. Such means include, but are not limited to, electrophoresis, the use of liposomes and CaPO ₄ precipitation. In another embodiment, the retroviral plasmid vector can be embedded into liposomes or coupled to a lipid and then administered to a host.

Producer cell lines produce infectious retroviral vector particles comprising nucleic acid sequence (s) encoding the polypeptide. Such retroviral particles can be used to transduce eukaryotic cells in vitro or in vivo. Such transduced eukaryotic cells will express nucleic acid sequence (s) encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, and hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

The present invention also relates to the use of the genes of the present invention as part of a diagnostic test to screen for susceptibility to a disease or condition associated with the presence of a mutation in a nucleic acid sequence encoding a polypeptide of the invention.

Individuals carrying mutations in the genes of the invention can be screened at the DNA level by various techniques. Diagnostic nucleic acids can be obtained from cells of a patient, such as blood, urine, saliva, tissue biopsies, autopsy material. Genomic DNA can be used for direct screening and can be enzymatically amplified using PCR prior to analysis. Saiki et al., Nature, 324: 163-166 (1986). RNA or cDNA can also be used for the same purpose.

By way of example, PCR primers complementary to nucleic acids encoding polypeptides of the invention can be used to identify and analyze mutations. For example, deletions and insertions can be detected by changes in the size of the amplified product compared to normal genotypes. Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively radiolabeled antisense DNA sequences. Fully matched sequences can be distinguished from inconsistent doublets by differences in RNase A degradation or melting temperature.

Genetic testing based on DNA sequence differences can be accomplished by detecting changes in the electrophoretic migration of DNA fragments in the presence or absence of denaturing material on gels. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished by modified formamide gradient gels in which the migration of other DNA fragments is retarded at different locations on the gel depending on the specific melting or partial melting temperature. See, eg, Myers et al., Science, 230: 1242 (1985).

Sequence changes at specific positions can also be indicated by nuclease protection assays or chemical cleavage methods such as RNase and S1 protection (eg Cotton et al., PNAS, USA, 85: 4397-4401 (1985)).

Therefore, detection of specific DNA sequences can be accomplished by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes (eg, Restriction Fragment Length Polymorphism (RFLP)) and Southern blotting of genomic DNA. Can be.

In a more general way, in addition to gel-electrophoresis and DNA sequencing, mutants can also be detected by analysis by themselves.

The present invention also relates to diagnostic assays for detecting levels of change in FGF-13 protein in various tissues as overexpression of proteins compared to normal regulatory tissue samples can detect abnormal cell proliferation, eg, the presence of tumors. Assays used to screen the levels of polypeptides of the invention in samples extracted from a host are known to those skilled in the art and include radioimmunoassays, competitive-binding assays, Western blot analysis, ELISA assays, and "Sandwich". Contains the assay. ELISA assays (Coligan, et al., Current Protocols in Immunology, 1 (2), ghapter 6, (1991)) are first described antibodies specific for antigens, preferably monoclonal antibodies, to the polypeptides of the invention. It includes the preparation of. Reporter antibodies are also prepared against monoclonal antibodies. The reporter antibody is attached with a detectable reagent such as radioactive, fluorescence (eg horseradish peroxidase enzyme). The sample is removed from the host and incubated on a solid support (eg polystyrene dish) bound to the protein of the sample. The binding site of a particular free protein on the dish is then masked because it is incubated with a nonspecific protein such as BSA. The monoclonal antibody is then incubated in the dish for the time that the monoclonal antibody attaches to the particular polypeptide of the invention attached to the polystyrene dish. All unbound monoclonal antibodies are washed with buffer. The reporter antibody bound to horseradish peroxidase was placed on a dish and the reporter antibody binds to the monoclonal antibody bound to the protein of interest.

The unattached reporter antibody is then washed. Peroxidase substrate is then added to the dish and the amount of color developed for a given time when compared to the standard curve is determined by the amount of polypeptide of the invention present in the volume of the patient sample.

Competitive assay methods can be used, wherein an antibody specific for a polypeptide of the invention is attached to a solid support, a sample derived from a labeled FGF-13 polypeptide and a host is passed over the solid support, for example liquid scintillation chromatography. The amount of label detected graphically can be correlated with the amount of polypeptide of the invention in the sample.

The "sandwich" assay is similar to the ELISA assay. In a "sandwich" assay, a polypeptide of the invention is passed over a solid support to bind an antibody attached to that solid support. The second antibody is then bound to the polypeptide of interest. A third antibody specifically labeled with a second antibody can be passed over the solid support and bound to the second antibody and then quantified.

The sequences of the invention are also useful for chromosomal identification. The sequence can be specifically targeted to and hybridized to a specific location on an individual human chromosome. Moreover, there is a need to identify specific sites on the current chromosome. Very few chromosome labeling reagents are currently available based on actual sequence data (repeat polymorphism) for marking chromosomal positions. Indicating the gene location of the DNA relative to the chromosome according to the invention (mapping) is an important first step in correlating these sequences with the genes associated with the disease.

Briefly, sequences can be mapped to chromosomes by making PCR primers (preferably 15-25 bp) from cDNA. Computational analysis of the 3 'non-translated region is used to quickly select one or more exons in the genomic DNA to complicate the amplification process. The primers are then used for PCR screening of celiac cell hybrids containing individual human chromosomes. Only hybrids containing human genes corresponding to the primers can produce amplified fragments.

PCR mapping of celiac cell hybrids is a rapid method for distributing specific DNA to specific chromosomes. Using the same oligonucleotide primers in the present invention, sublocalization can be achieved in a similar manner using panels of fragments from pools of specific chromosomes or large genomic clones. Other mapping methods that can be similarly used to map to their chromosomes include hybridization in situ, prescreening and hybridization using labeled flow-classified chromosomes to construct chromosomal specific-cDNA libraries. There is a preliminary selection method.

The cDNA clones can be fluorescently hybridized (FISH) in situ with mid-term chromosomal diffusion cultures to provide the correct chromosome location in one step. This technique can use cDNAs as short as 50 or 60 bases. For a review of these techniques, reference may be made to Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man, available online via the Johns Hopkins University Welch Medical Library. Next, the relationship between the gene and the disease mapped to the same chromosomal region is identified through binding analysis (physically adjacent co-genomics).

Next, it is necessary to determine the cDNA or genomic sequence differences between the infected and non-infected. If mutations are observed in some or all infected individuals but not in normal individuals, these mutations are probably the causative agent of the disease.

Depending on the current resolution of conventional physical mapping and genetic mapping techniques, cDNA accurately localized to the chromosomal region associated with the disease can be one of 50 to 500 potent causative genes (this is a 1 megabase) Mapping resolution and one gene per 20 kb).

The polypeptides, fragments or other derivatives thereof, homologs thereof, or cells expressing them can be used as immunogens to generate antibodies to them. These antibodies can be, for example, polyclonal or monoclonal antibodies. The invention also encompasses chimeric, single chain, and humanized antibodies as well as products of Fab fragments, or Fab expression libraries. Various methods known in the art can be used to prepare the antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by injecting the polypeptide directly into an animal or by administering the polypeptide to an animal, preferably a non-human animal. The antibody thus obtained will then be bound to the polypeptide itself. In this way, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind to a fully native polypeptide. The antibody can then be used to isolate the polypeptide from tissue expressing the polypeptide.

For the preparation of monoclonal antibodies, any technique that provides antibodies produced by continuous cell line culture can be used. Examples thereof include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B-cell hybridoma technology (Kozbor et. al., 1983, Immunology Today 4:72, and EBV-hybridoma technology for preparing human monoclonal antibodies (Cole, et al., 1985, Monoclonal Antibodies and Caner Therapy, Alan R. Liss , Inc., pp. 77-96].

Techniques described for the production of single chain antibodies [US Pat. No. 4,946,778] can be applied to prepare single chain antibodies against the immunogenic polypeptide products of the invention. In addition, transgenic mice can be used to express humanized antibodies against the immunogenic polypeptide products of the invention.

The invention will be further described with reference to the following examples; It should be appreciated that the present invention is not limited to these examples. Unless otherwise specified, all parts or amounts are by weight.

In order to facilitate understanding of the following examples, specific methods and / or terminologies are often described.

"Plasmids" are written first in lowercase p and / or in uppercase and / or numerals. Starting plasmids in the present invention are commercially available for open purchase under unrestricted conditions or can be constructed according to methods published from commercial plasmids. In addition, plasmids equivalent to those described herein are known in the art and will be apparent to those skilled in the art.

"Digestion" of DNA refers to catalytic cleavage of DNA with restriction enzymes that act only on specific sequences of DNA. Various restriction enzymes used in the present invention are commercially available and their reaction conditions, cofactors and other requirements are used as known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA is used with about 2 units of enzyme in about 20 μl of buffer. If DNA fragments are to be isolated for plasmid construction, typically 5-50 μg of DNA is digested into larger volumes using 20-250 units of enzyme. The amount of buffer and substrate suitable for the particular restriction enzyme is specified by the manufacturer. Incubation times of about 1 hour at 37 ° C. are conventionally used but may be varied as directed by the supplier. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to separate the desired fragments.

Size separation of the cleaved fragments is performed using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980).

"Oligonucleotide" refers to single-chain polydeoxynucleotides or two complementary polydeoxynucleotide chains that can be chemically synthesized. Such synthetic oligonucleotides do not have 5 'phosphate and thus are not linked to another oligonucleotide unless phosphate is added with ATP in the presence of a kinase. Synthetic oligonucleotides will be linked to fragments that are not dephosphorylated.

"Ligation" refers to a method of forming a phosphodiester bond between two double-stranded nucleic acid fragments. Maniatis, T., et al., Id., P. 146]. Unless otherwise provided, the ligation is carried out using well known buffers and conditions using about 10 equimolar amounts of 10 units of T4 DNA ligase (“ligase”) per 0.5 μg of DNA fragment to be linked.

Unless stated otherwise, transformation is carried out as described in Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1

Bacterial Expression and Purification of FGF-13 Protein

DNA sequence ATCC # 97147 encoding FGF-13 is initially amplified using PCR oligonucleotide primers corresponding to the 5 'sequence (-signal peptide sequence) of the processed protein and the 3' vector sequence for the gene. Additional nucleotides corresponding to the gene are added to the 5 'and 3' sequences, respectively. 5 'Oligonucleotide Primer 5' GCCAGACCATGGAGAATCACCCGTCTGGTAAT 3 '(SEQ ID NO: 3) contains an Nco restriction enzyme site. 3 'SEQ ID NO: 5' GATTTAAGATCTCGAGGGGCTGGGGCCG 3 '(SEQ ID NO: 4) contains the sequence corresponding to the BglII site and is followed by 18 nucleotides of the FGF-13 coding sequence.

The restriction enzyme site corresponds to the restriction enzyme site of the bacterial expression vector pQE-60 (Qiagen, Inc. Chatsworth, Ca 91311). pQE-60 contains antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), IPTG-regulated promoter effector (P / O), ribosomal binding site (RBS), 6-His tag, and restriction enzyme site. Encrypt PQE-60 is then digested with NcoI and BglII. The amplified sequence is linked to pQE-60 and inserted into the same frame using sequences encoding histidine tags and ribosomal binding sites (RBS). Then, using the linking mixture, this method was described by Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). E. coli strain M15 / rep 4 (Source: Qiagen, Inc.) is transformed. M15 / rep 4 contains multiple copies of plasmid pREP4, which expresses the lacI inhibitor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 ug / ml) and Kan (25 ug / ml). O / N cultures are used to inoculate large cultures at a ratio of 1: 100 to 1: 250. The cells are grown to an optical density of 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. Then IPTG (“isopropyl-BD-thiogalacto pyranoside”) is added to bring the final concentration to 1 mM. IPTG is induced by inactivating the lacI inhibitors, making it clear that P / O causes increased gene expression. The cells are further grown 3 to 4 hours to allow for exponential growth culture. The cells are then harvested by centrifugation. The cell pellet is dissolved in chaotropic 6 molal guanidine HCl. After clarification of the liquid, the dissolved FGF-13 was purified from the solution by chromatography on a Nickel-chelate column under tight conditions of the protein containing the 6-His tag. Hochuli, E. et al. J. Chromatography 411: 177-184 (1984). The protein is eluted from the column at 6M guanidine HCl pH 5.0 and adjusted with 3 mM guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced) and 2 mM glutathione (oxidized) for protein regeneration. After incubation in the solution for 12 hours, the protein is dialyzed with 10 mM sodium phosphate.

Example 2

Cloning and Expression of FGF-13 Using a Baculovirus Expression System

DNA sequences encoding full length FGF-13 protein (ATCC # 97147) are amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene.

The FGF-13 5 'primer has a 5' CTAGTGGATCCCGAGAATCACCCGTCTCCT 3 '(SEQ ID NO: 5) and a baculovirus starting sequence with 18 nucleotides of the FGF-13 gene in frame is downstream of the estimated FGF-13 signal peptide cleavage site. It contains the BamHI restriction enzyme site (dark) that is left to clone.

The 3 'primer is SEQ ID NO: 5' CGACTTCTAGAACCTCGGGGATCTGGCTCC 3 '(SEQ ID NO: 6), which contains 18 nucleotides complementary to the cleavage site for the restriction endonuclease XbaI and the 3' non-toxin sequence of the gene.

Amplified sequences are separated from 1% agarose gels using a commercially available kit (trade name: “Geneclean”, BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with endonucleases and purified again on 1% agarose gel. Name this fragment F2.

The vector pA2gp (variant of the pVL941 vector described below) is used for the expression of proteins using the baculovirus expression system (Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555]. The expression vector contains a potent polyhedrin promoter of Autographa californica nuclear polyhedrosis virus followed by a recognition site for restriction endonucleases BamHI and XbaI. The polyadenylation site of monkey virus (SV) 40 is used for efficient polyadenylation. For easy selection of recombinant viruses, E. coli. Beta-galactosidase from E. coli is inserted in the same direction as the polyadenylation signal of the polyhedrin gene followed by the polyhedrin promoter. Polyhedrin sequences can be flanked on both sides by viral sequences for cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors can be used in place of pA2, for example pRG1, pAc373, pVL941 and pAcIM1. Luckow, V.A. and Summers, M.D., Virology, 170: 31-39.

The plasmid is digested with restriction enzymes and then dephosphorylated by methods known in the art using calf phosphatase. DNA is then isolated from 1% agarose gel using a commercial kit (trade name: "Geneclean", source: BIO 101 Inc., La Jolla, Ca.). This vector DNA is named V2.

Fragment F2 and dephosphorylated plasmid V2 are linked using T4 DNA ligase. Then, this. E. coli DH5α cells were transformed and bacteria contained in the plasmid (pBacFGF-13) were identified using the respective restriction enzymes. The sequence of such cloned fragments is confirmed by DNA sequencing.

5 μg of the plasmid pBacFGF-13 was subjected to lipofection method [Felgner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)], commercialized linearized baculovirus (trade name: “BaculoGold ^™ baculovirus DNA”, source: Pharmingen, San Diego, CA.) 1.0 μg Co-transfection.

1 μg of baculogold ^TM virus DNA and 5 μg of plasmid are mixed in sterile wells of microtiter plates containing 50 μl of serum-free Grace medium (Life Technologies Inc., Gaithersburg, MD). After adding 10 μl of lipofectin and 90 μl of Grace's medium, mix and incubate for 15 minutes at room temperature. The transfection mixture is then added dropwise with 1 ml of serum-free medium to Sf9 insect cells (ATCC CRL 1711) inoculated in a 35 mm tissue culture plate. The plate is shaken back and forth to mix the newly added solution. The plates are then incubated at 27 ° C. for 5 hours. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. The plate is placed in an incubator and incubated at 27 ° C. for 4 days.

After 4 days the supernatant is collected and plaque assays are performed similarly as described above by the Summers and Smith. As a variant, an agarose gel with “Blue Gal” (Life Technologies Inc., Gaithersburg) is used that facilitates the separation of blue stained plaques. (Detailed description of “Plaque Assay” may be found in User Guides on pages 9-10 of Insect Cell Culture and Baculovirology distributed by the supplier (Life Technologies Inc., Gaithersburg).

Four days after a series of dilutions are performed, the virus is added to the cells and the blue stained plaques are picked out with an Eppendorf pipette tip. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by short centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells inoculated in 35 mm dishes. After 4 days the supernatant of the culture dish is collected and stored at 4 ° C.

Sf9 cells are grown in Grace medium supplemented with 10% heat-inactivated FBS. The cells are infected with recombinant baculovirus V-FGF-13 at multiplicity of infection (MOI) 2. After 6 hours the medium is removed and replaced with SF900 II medium without methionine and cysteine [Life Technologies Inc., Gaithersburg]. After 42 hours ³⁵ S- methionine and ³⁵ S cysteine 5μCi 5μCi: it is a (source Amersham). The cells are further incubated for 16 hours before harvesting by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 3

Expression of Recombinant FGF-13 in COS Cells

The expression of the plasmid, FGF-13-HA, is 1) the SV40 origin of replication, 2) the ampicillin resistance gene, 3) E. Collie replication origin, 4) derived from the vector pcDNAI / Amp (Invitrogen) containing the CMV promoter followed by the Polyringer site, the SV40 intron and the polyadenylation site. Recombinant protein expression is directed under the CMV promoter because all FGF-13 precursors and DNA fragments encoding the HA tag fused to its 3 'end in frame replicate to the polylinker site of the vector. The HA tag corresponds to epitopes derived from the influenza hemagglutinin protein described above (I. Wilson, H. Niman, R. Heighten, A. Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767. Fusion of an HA tag to a protein of interest is readily detected as a recombinant protein with an antibody that recognizes an HA epitope.

DNA fragments and vectors, pcDNA3 / Amp, amplified by PCR are digested and linked with restriction enzymes. The coupling mixture is E. coli strains are transformed with SURE (Stratagene Cloning System, La Jolla, Calif.), And the transformed culture is plated in ampicillin-containing plates. Plismid DNA is isolated from the transformants and assayed by restriction analysis for the presence of the modified fragment. For expression of recombinant FGF-13, COS cells are transfected with expression vectors by the DEAE-DEXTRAN method. J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press , (1989). Expression of the FGF-13 HA protein is examined by radiolabeling and immunoprecipitation (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988)). Cells are then labeled with ³⁵ S-cysteine for 8 hours and transfected after 2 days. The cultures are then recovered and the cells are fused with a surfactant (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5)). Wilson, I. et al., Id. 37: 767 (1984)] Cell lysates and culture media are precipitated with HA specific monoclonal antibodies The precipitated proteins are analyzed on a 15% SDS-PAGE gel.

Example 5

Expression through gene therapy

Fibroblasts are obtained from certain subjects by skin necropsy. The resulting tissue is placed in tissue culture medium and separated into small pieces. This small piece is placed on the wet surface of the tissue culture flask, about 10 pieces are placed in each flask. The flask is inverted, tightly sealed and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted and the tissue pieces are fixed at the bottom of the flask and fresh medium (eg F12 medium of ham with 10% FBS, penicillin and streptomycin) is added. It is then incubated at 37 ° C. for about 1 week. At this time, fresh medium is added and replacement is continued every few days. After two more weeks of culture, a monolayer of fibroblasts appears. This monolayer is treated with trypsin and stretched into larger flasks.

PMV-7 (Kirschmeier, PT et al., DNA, 7: 219-25 (1988)) flanked by long terminal repeats of the Moroni murine sarcoma virus was digested with EcoRI and HindIII and subsequently calf Treated with intestinal phosphatase. Linear vectors are fractionated on agarose gels and purified using glass beads.

CDNA encoding the polypeptides of the invention are amplified using PCR primers corresponding to the 5 'and 3' terminal sequences, respectively. The 5 'primer contains the EcoRI site and the 3' primer also contains the HindIII site. Moroni murine sarcoma virus linear shrinkage and equivalent amounts of amplified EcoRI and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for joining the two fragments. The ligation mixture is used to transform bacterial HB101 and plated onto agar containing kanamycin to determine whether the vector contains the gene of interest, as appropriately inserted.

Ampotropic pA317 or GP + am12 packaging cells are grown in tissue culture to join densities in Dulbeckco modified Eagles medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. MSV vectors containing the genes are added to the medium and packaging cells are transduced with the vectors. The packaging cells then produce infectious viral particles containing the gene (packaging cells are referred to herein as producer cells).

Fresh medium is added to the transduced producer cells and the medium is harvested from 10 cm plates of serially joined producer cells. The spent medium containing the infectious viral particles is filtered through a microporous filter to remove isolated producer cells and the medium is used to infect fibroblasts. The medium is removed from the sub-fused plates of fibroblasts and quickly replaced with medium from producer cells. Remove this medium and replace with fresh medium. If the titer of the virus is high, substantially all fibroblasts will be infected and no selection is necessary. If the titer is extremely low, it is necessary to use retroviral vectors with selectable markers such as neo or his.

The engineered fibroblasts are then grown alone or until confluence on cytodex 3 microcarrier beads and then injected into the host. Fibroblasts then produce protein products.

Many modifications and variations of the present invention are possible in light of the above teachings, and therefore, the invention may be practiced otherwise than as specifically described in the appended claims.

Sequence list

(1) General Information:

(Iii) Applicant: Hu etc.

(Ii) Name of the Invention: Fibroblast Growth Factor-13

(Iii) SEQ ID NO: 8

(Ⅳ) Letter address:

(A) Recipients: Karella, Byrne, Vine, Gilphylan, Chech, Stewart & Olstein

(B) Street: Becker Farm Road 6

(C) City: Roseland

(D) State: New Jersey

(E) Country: United States

(F) ZIP Code: 07068

(Iii) computer-readable

(A) Media type: 3.5 inch diskette

(B) Computer: IBM PS / 2

(C) operating system: MS-DOS

(D) Software: WordPerfect 5.1

(Iii) Current application data:

(A) Application number:

(B) filing date: submitted together with the present application

(C) Classification:

(Iii) previous application data;

(A) Application number: 08 / 207,412

(B) Application date: March 8, 1994

(Iii) Attorney / Agent Information:

(A) Statement: Ferraro Gregory D.

(B) registration number: 36,134

(C) Reference / Litigation Number: 325800-364

(Iii) telecommunication information:

(A) Phone: 201-994-1700

(B) facsimile: 201-994-1744

(2) Information about SEQ ID NO: 1

(Iii) sequence characteristics

(A) Length: 641 base pairs

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: cDNA

(Xi) sequence description:

(2) Information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: 212 amino acids

(B) Type: Amino Acid

(C) chain:

(D) mode: linear

(Ii) Molecular Type: Protein

(Xi) sequence description:

(2) information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: 32 base pairs

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(Xi) sequence description:

(2) information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(Xi) sequence description:

(2) information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(Xi) sequence description:

(2) Information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(Xi) sequence description:

(2) information for SEQ ID NO: 7

(Iii) sequence characteristics

(A) Length: base pair

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(Xi) sequence description:

(2) information for SEQ ID NO: 8:

(Iii) sequence characteristics

(A) Length: 30 base pairs

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(Xi) sequence description:

For international offices

Claims (20)

(a) a polynucleotide encoding a polypeptide comprising amino acid 191 to amino acid -21 shown in SEQ ID NO: 2; (b) a polynucleotide encoding a polypeptide comprising amino acid 191 to amino acid 1 as set forth in SEQ ID NO: 2; (c) a polynucleotide capable of hybridizing with the polynucleotide of (a) or (b) and having at least 70% homology with said polynucleotide; And (d) An isolated polynucleotide comprising a member selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). The polynucleotide of claim 1 which is DNA. The polynucleotide of claim 1 comprising nucleotides 65 to 641 shown in SEQ ID NO: 1. (a) a polynucleotide encoding a mature polypeptide encoded with DNA contained in ATCC Accession No. 97147; (b) a polynucleotide encoding a polypeptide expressed with DNA contained in ATCC Accession No. 97147; (c) a polynucleotide capable of hybridizing with the polynucleotide of (a) or (b) and having at least 70% homology with said polynucleotide; And (d) An isolated polynucleotide comprising one member selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). A vector containing the DNA according to claim 2. A host cell genetically engineered using the vector according to claim 5. A method for producing a polypeptide comprising expressing the polypeptide encoded by the DNA in a host cell according to claim 6. A method for producing a cell capable of expressing a polypeptide, comprising genetically manipulating the cell using the vector according to claim 5. (Iii) a polypeptide having an inferred amino acid sequence of SEQ ID NO: 2, and fragments, homologs and derivatives thereof, and (ii) a polypeptide encoded by cDNA of ATCC Accession No. 97147, and fragments, homologs and derivatives thereof A polypeptide comprising one member selected. An antibody against the polypeptide of claim 9. A compound that inhibits the biological action of the polypeptide of claim 9. An agent that mimics the polypeptide of claim 9. A method of treating a patient in need of an FGF-13 polypeptide, comprising administering to the patient a therapeutically effective amount of the polypeptide of claim 9. A method of treating a patient in need of inhibition of the FGF-13 polypeptide, comprising administering to the patient a therapeutically effective amount of the polypeptide of claim 11. The method of claim 13, wherein the therapeutically effective amount of the polypeptide is administered by providing a patient with DNA encoding the polypeptide and expressing the polypeptide in vivo. The method of claim 14, wherein the compound is a polypeptide and a therapeutically effective amount of the compound is administered by encoding the antagonist in vivo and providing DNA to the patient expressing the antagonist. (a) the compound to be screened is mixed with a cell comprising a reaction mixture containing a label to be incorporated into the cell with proliferation, under conditions where the cell is normally stimulated by the polypeptide, (b) identifying a compound that acts as an agonist for the polypeptide of claim 9, including determining whether the compound is an effective agonist by measuring the extent of proliferation of the cell. (a) mixing the compound and polypeptide to be screened with a cell comprising a reaction mixture containing a label to be incorporated into the cell with proliferation under conditions in which the cell is normally stimulated by the polypeptide, (b) A method of identifying a compound that acts as an antagonist against the polypeptide of claim 9, including determining whether the compound is an effective antagonist by measuring the extent of proliferation of the cell. A method for diagnosing a disease or susceptibility to a low expression of a polypeptide of claim 9 comprising determining a mutation in a nucleic acid sequence encoding the polypeptide. A diagnostic method comprising assaying for the presence of the polypeptide of claim 9 in a sample derived from a host.