KR19990008319A - Fibroblast Growth Factor 15 - Google Patents

Abstract

The present invention describes human fibroblast growth factor 15 polypeptides and DNA (RNA) encoding such polypeptides. Also provided are methods of producing such polypeptides by recombinant techniques. Also described are methods for using such polypeptides to stimulate vasodilation, treat wounds and prevent neuronal damage. Antagonists against such polypeptides and their use as therapeutic agents in inhibiting aberrant cell proliferation, hyper-vascular disease and epithelial lens cell proliferation are also described. Also described are diagnostic methods for detecting concentration changes in polypeptides in samples derived from mutations and hosts in coding sequences.

Description

Fibroblast Growth Factor 15

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides and methods of producing such polynucleotides and polypeptides. More specifically, the polypeptides of the present invention have been presumably identified as fibroblast growth factor / heparin binding growth factor (hereinafter referred to as FGF-15). The present invention also relates to inhibiting the action of such polypeptides.

Fibroblast growth factor is a class of proteins that is characteristic for binding to heparin and is therefore also called heparin binding growth factor (HBGF). Expression of different members of these proteins in various tissues has been found, especially under temporal and spatial control. These proteins include fibroblasts, corneal and vascular endothelial cells, granulocytes, adrenal cortical cells, chondrocytes, myoblasts, vascular smooth muscle cells, lens epithelial cells, black blood cells, keratinocytes, glycidoid neuroglial cells, astrocytes, osteoblasts And mitotics for a variety of cells of mesoderm, ectoderm and endoderm origin, including hematopoietic cells.

Each member has a function that overlaps each other, and also has a unique range of functions. In addition to the ability to stimulate proliferation of vascular endothelial cells, both FGF-1 and 2 are chemotactic for endothelial cells, and FGF-2 has been shown to allow endothelial cells to penetrate the underlying membrane. Consistent with these properties, both FGF-1 and 2 have the ability to stimulate angiogenesis. Another important property of these growth factors is their ability to promote wound healing. Many other members of the FGF family share similar activities as FGF-1 and 2, such as to promote angiogenesis and wound healing. Several members of the FGF family have been shown to induce mesoderm formation and to regulate the differentiation of neurons, adipocytes and skeletal muscle cells.

In addition to their biological activity in normal tissues, FGF proteins are thought to promote tumor vasculogenesis and to promote tumorigenicity in carcinomas and sarcomas by transforming the proteins when their expression is degraded.

Currently, the FGF class consists of eight structurally related polypeptides: basic FGF, acidic FGF, int 2, hst 1 / k-FGF, FGF-5, FGF-6, keratinocyte growth factor, AIGF (FGF-8). Glia-activating factor has recently been found to be a novel heparin-binding growth factor purified from the culture supernatant of human glioma cell lines. Miyamoto, M. et al., Mol. and Cell. Biol., 13 (7): 4251-4259 (1993)]. Each gene is cloned and sequenced. The two members, FGF-1 and FGF-2, are characterized by a number of names, but are most frequently characterized as acidic and basic fibroblast growth factors, respectively. Normal gene products affect the general proliferative performance of mesoderm and neuroectodermal-derived cell residues. They may induce angiogenesis in vivo and may play an important role in early growth. Burgess, W. H. and Maciag, T., Annu. Rev. Biochem., 58: 575-606, (1989).

In addition, many of the identified members of the FGF family bind to the same receptors and induce secondary messages through binding to these receptors.

Eukaryotic expressing cells encoding the secreted form of FGF-1 are introduced by gene transfer into porcine arteries. This model defines the gene function in the artery wall in vivo. FGF-1 expression induces endothelial thickening in porcine arteries 21 days after gene transfer (Nabel, E. g., Et al., Nature, 362: 844-6 (1993)). In addition, basic fibroblast growth factors are able to regulate glioma growth and progression independently of their role in tumor angiogenesis and it has been demonstrated that basic fibroblast growth factor release or secretion is required for these actions. Morrison , RS, et al., J. Neurosci. Res., 34: 502-9 (1993).

Fibroblast growth factors such as basic FGF are further associated with the growth of Kaposi's sarcoma in vitro. Huang, Y. Q., et al., J. Clin. Invest., 91: 1191-7 (1993). In addition, the cDNA sequence encoding human basic fibroblast growth factor was cloned underneath the transcriptional promoter recognized by bacteriophage T77 RNA polymerase. The basic fibroblast growth factor thus obtained was found to have a biological activity that is distinct from human placental fibroblast growth factor in assays of mitosis, synthesis of plasminogen activator and angiogenesis. Squires, CH, et al. , J. Biol. Chem., 263: 16297-302 (1988).

U. S. Patent No. 5,155, 214 describes basic growth factors and methods for their preparation in substantially pure mammals. DNA sequences encoding bovine species polypeptides as well as amino acid sequences of bovine and human basic fibroblast growth factors are described.

The newly discovered FGF-9 has about 30% sequence similarity with other members of the FGF class. Two cysteine residues and other consensus sequences in the class member are also conserved in the FGF-9 sequence. FGF-9 lacks a typical signal sequence at its N terminus as in acidic and basic FGFs. However, FGF-9 has been found to be secreted from cells after synthesis despite the deletion of the typical signal sequence FGF [Miyamoto, M. et al., Mol. and Cell. Biol., 13 (7): 4251-4259 (1993)]. In addition, FGF-9 has been shown to stimulate cell growth of GdG neuron cell type 2 in glial primitive cells, BALB / c3T3 and PC-12 cells, but not human umbilical vein endothelial cells. Naruo, K. , et al., J. Biol. Chem., 268: 2857-2864 (1993).

Basic and acidic FGFs are potent modulators of cell proliferation, cell death, differentiation and survival and act on cell morphology from ectoderm, mesoderm and endoderm. These two FGFs along with KGF and AIGF were identified by protein purification. However, the other four members have been isolated as tumor sources and their expression is limited by embryogenesis and certain types of cancer. FGF-9 has been shown to be a mitotic material for glial cells. Members of the FGF class are reported to have oncogenic efficacy. FGF-9 showed transformation efficacy when transformed into BALB / c3T3 cells. See Miyamoto, M., et al., Mol. Cell. Biol., 13 (7): 4251-4259 (1993)].

Androgen induced growth factor (AIGF), also known as FGF-8, is purified from controlled media of mouse breast cancer cells (SC-3) stimulated with tetosterone. AIGF is a unique FGF-like growth factor, with putative signal peptides and sharing 30-40% sequence homology with known members of the FGF class. Mammalian cells transformed with AIGF show significant stimulatory effects on the growth of SC-3 cells in the absence of androgens. Thus, AIGF regulates androgen-induced growth of SC-3 cells and other cells because they are secreted by the tumor cells themselves.

Polypeptides of the invention have been presumably identified as members of the FGF class as a result of amino acid sequence homology with other members of the FGF class.

According to one aspect of the present invention, novel mature polypeptides and fragments, homologues and derivatives thereof are biologically active and diagnostically or therapeutically useful. Polypeptides according to the invention are of human origin.

According to another aspect of the invention, not only isolated nucleic acid molecules encoding polypeptides of the invention, including mRNA, DNA, cDNA, genomic DNA, but also antisense homologs thereof and biologically active and diagnostic or therapeutically useful Fragments thereof are provided.

According to a further aspect of the invention, cloning useful as reagents in recombinant production of recombinant prokaryotic and / or eukaryotic host cells containing nucleic acid sequences encoding polypeptides of the invention, as well as polypeptides of the invention, and Methods of producing such polypeptides by recombinant techniques using recombinant vectors such as expression plasmids are provided.

According to another further aspect of the present invention, screening agonists and antagonists therefor, promoting wound healing due to therapeutic purposes such as burns and ulcers, preventing nerve damage due to neurological diseases and Methods of using such polypeptides or polynucleotides encoding such polypeptides to promote growth, to prevent skin aging and hair loss, and to stimulate mesoderm induction in angiogenesis, early embryonic and ligament regeneration This is provided.

According to another further aspect of the invention there is provided an antibody against such a polypeptide.

According to yet another aspect of the present invention, an antagonist against such a polypeptide, and using it to inhibit the action of such a polypeptide, for example in the treatment of cellular transformation (eg a tumor) and to hyper-vascular disease A method of reducing and treating the risk is provided.

According to another further aspect of the invention, a nucleic acid probe is provided comprising a nucleic acid molecule having a length sufficient to substantially hybridize with a polynucleotide encoding a polypeptide of the invention.

According to yet another aspect of the invention, a diagnostic assay for detecting a disease or susceptibility to a mutation associated with a mutation in a nucleic acid sequence of the invention and for detecting over-expression of a polypeptide encoded by such sequence This is provided.

According to another further aspect of the present invention there is provided a method of using said polypeptides or polynucleotides encoding such polypeptides for in vitro purposes associated with scientific research, for the synthesis of DNA and for the preparation of DNA vectors.

These and other aspects of the invention will be apparent to those of ordinary skill in the art from the teachings herein.

The following drawings are only intended to illustrate aspects of the invention and are not intended to limit the scope of the invention in any way.

1 shows the cDNA sequence of FGF-15 and the corresponding putative amino acid sequence.

2 shows amino acid sequence homology between FGF-15 and other FGF family members. Conserved amino acids can be easily identified.

According to one aspect of the invention, the mature polypeptide having the estimated amino acid sequence of SEQ ID NO: 1 (SEQ ID NO: 2) or the mature polypeptide encoded by cDNA of a clone deposited with ATCC Accession No. 97146 dated May 12, 1995. An isolated nucleic acid molecule (polynucleotide) encoding is provided.

Polynucleotides encoding the FGF-15 of the present invention were first discovered in a cDNA library derived from human adrenal tumor tissue. It is structurally related to all members of the fibroblast growth factor family and contains an open reading frame that encodes a polypeptide of 252 amino acids. Among the highest combinations were (1) sequence homology with human FGF-9 for 129 amino acid stretch 41% and sequence similarity 66%, and (2) sequence homology with human KGF for a region of 88 amino acids 37 % And sequence similarity are 59%.

FGF / HBGF class designation GXLX (S, T, A, G) X6 (D, E) CXFXE is conserved in the polypeptide of the present invention, where X is any amino acid residue and (D, E) is D or E residue, X6 is any six amino acid residues).

The polynucleotides of the present invention may exist in the form of RNA or DNA, which includes cDNA, genomic DNA and synthetic DNA. DNA may be double stranded or single stranded. The coding sequence encoding the mature polypeptide is the same as the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone, or due to the abundance or denaturation of the genetic code, the coding sequence has the DNA of FIG. 1 (SEQ ID NO: 1). Or a different coding sequence encoding the same mature polypeptide as the deposited cDNA.

Polynucleotides encoding the mature polypeptide (SEQ ID NO: 2) or the mature polypeptide encoded by the deposited cDNA are only coding sequences for the mature polypeptide; Additional coding sequences, such as coding sequences for mature polypeptides and leader or secretory sequences or proprotein sequences; Coding sequences (and any additional coding sequences) for the mature polypeptide and non-coding sequences such as introns or non-coding sequences 5 'and / or 3' of the coding sequence for the mature polypeptide.

Thus, polynucleotides encoding the term polypeptide include polynucleotides comprising additional coding sequences and / or non-coding sequences as well as polynucleotides comprising only the coding sequence for the polypeptide.

Further, the present invention encodes the fragments, homologues and derivatives of the polypeptide encoded by the polypeptide having the putative amino acid sequence of SEQ ID NO: 1 or cDNA (s) of deposited clone (s). To variants of polynucleotides incorporated. Variants of the polynucleotides may be naturally occurring allelic variants of the polynucleotides or non-naturally occurring variants of the polynucleotides.

Thus, the present invention is directed to a variant comprising the same mature polypeptide (SEQ ID NO: 2) or a polynucleotide encoding the same mature polypeptide encoded by the cDNA (s) of the deposited clone (s). Also included are variants of the polynucleotides encoding fragments, derivatives or homologs of the polypeptide encoded by the polypeptide (SEQ ID NO: 2) or the cDNA (s) of the deposited clone (s). Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As described above, the polynucleotide may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone (s). As is known in the art, allelic variants are another form of polynucleotide sequence in which one or more nucleotides are substituted, deleted or added and the functionality of the encoded polypeptide is substantially unchanged.

The invention also provides that the coding sequence for the mature polypeptide is identical to the polynucleotide sequence that aids in the expression and secretion of the polypeptide from the host cell, e.g., the leader sequence that functions as a secretory sequence for regulating the delivery of the polypeptide from the cell. Polynucleotides that can be fused in the reading frame. Polypeptides with a leader sequence are preproteins and may have a leader sequence cleaved by a host cell to form a polypeptide in mature form. The polynucleotide may also encode a proprotein, which is a mature protein plus an additional 5 'amino acid residue. Mature proteins with prosequences are proproteins and proteins in inactivated form. When the prosequence is cleaved, the active mature protein remains.

Thus, for example, the polynucleotide of the present invention can encode a mature protein, or a protein having a prosequence or a protein having both a prosequence and a presequence (leader sequence).

The polynucleotides of the present invention may also have coding sequences fused in-frame with marker sequences that allow purification of the polypeptides of the present invention. The marker sequence is a hexa-histidine tag supplied by the pQE-9 vector to purify the mature polypeptide fused with the marker in the case of a bacterial host, or for example the marker sequence is a mammalian host, eg COS. Hemagglutinin (HA) may be an option when using -7 cells. HA tags correspond to epitopes derived from influenza hemagglutinin protein (Wilson, I., et al., Cell, 37: 767 (1984)).

The term gene refers to a segment of DNA involved in the production of a polypeptide chain and includes intervening sequences (introns) between individual coding segments (exons) as well as regions before and after the coding region (leader and trailer).

Fragments of the full length FGF-15 gene can be used as hybridization probes for the cDNA library to isolate full length genes and to isolate genes with other sequences with high sequence similarity or similar biological activity. This type of probe preferably has at least 30 bases and may contain, for example, at least 50 bases. In addition, the probes can be used to identify cDNA clones corresponding to clones containing full length transcripts and genomic clones or complete FGF-15 genes including regulatory regions and promoter regions, exons and introns. Examples of screening include synthesizing oligonucleotide probes by separating the coding region of the FGF-15 gene using known DNA sequences. Using labeled oligonucleotides having sequences complementary to the gene sequences of the present invention, a library of human cDNA, genomic DNA or mRNA is screened to determine which member of the library the probe hybridizes to.

The present invention also relates to polynucleotides which hybridize with said sequence having at least 70%, preferably at least 90% and more preferably at least 95% homology between sequences. The present invention relates in particular to polynucleotides which hybridize with the above-described polynucleotides under stringent conditions. As used herein, the term stringent conditions means that hybridization occurs only if the homology between the sequences is at least 95% and preferably at least 97%. In a preferred embodiment the polynucleotide hybridizing with the polynucleotides described above comprises a polypeptide substantially retaining the same biological function or activity as the mature polypeptide encoded by the cDNA (SEQ ID NO: 1) or deposited cDNA (s) of FIG. Encrypt

On the other hand, the polynucleotides are at least 20 bases, preferably at least 30, and more, which hybridize with the polynucleotides of the present invention and are homologous to the polynucleotides of the present invention and with or without activity as described above. It may preferably have 50 or more bases. For example, such polynucleotides can be used as probes for the recovery of the polynucleotides of SEQ ID NO: 1, for example polynucleotides or as diagnostic probes or as PCR primers.

Accordingly, the present invention provides polynucleotides having at least 70%, preferably at least 90% and more preferably at least 95% homology with the polynucleotides encoding the polypeptide of SEQ ID NO: 2, as well as at least 30 bases and preferably Relates to fragments thereof having 50 or more bases and to polypeptides encoded by such polynucleotides.

The deposit (s) referred to herein will be maintained under the Budapest Treaty on International Approval of Microbial Deposits under Patent Procedure. These deposits are provided for convenience only to those of ordinary skill in the art, and the deposits are subject to 35 U.S.C. It is not an authorization required under § 112. The sequences of the polynucleotides contained in the deposited microorganisms and the amino acid sequences of the polypeptides encoded thereby are incorporated herein by reference and are controlled in case of conflict with respect to all sequence techniques herein. Licenses will be required for the manufacture, use or sale of deposited microorganisms, and no such license is granted by this document.

The invention also relates to FGF polypeptides having the amino acid sequence encoded by the putative amino acid sequence (SEQ ID NO: 2) or deposited cDNA (s) of FIG. 1 as well as fragments, homologs and derivatives of such polypeptides.

When referring to a polypeptide encoded by the polypeptide (SEQ ID NO: 2) or deposited cDNA (s) of Figure 1, the terms fragments, derivatives and homologues essentially retain the same biological function or activity as such polypeptides. Means a polypeptide. Thus, homologues include preproteins that can be activated by cleavage of the protein moiety to produce an active mature polypeptide.

The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

Fragments, derivatives or homologues of polypeptides encoded by the polypeptide (SEQ ID NO: 2) or deposited cDNA (s) of FIG. 1 may comprise (i) amino acid residues (preferably wherein one or more Conserved amino acid residues), and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) one or more amino acid residues comprise a substituent group, or (iii) The mature polypeptide is fused with another compound, eg, a compound for increasing the half-life of the polypeptide (eg polyethylene glycol), or (iv) additional amino acids are mature polypeptides, eg leader or secretion It may be fused with a sequence or proprotein sequence used for purification of the sequence or mature polypeptide. Such fragments, derivatives and homologues are included within the scope of one of ordinary skill in the art from the teachings herein.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form and are preferably purified until homogeneous.

The term isolated means that the substance is removed from its original environment, such as the natural environment if it is naturally occurring. For example, naturally-occurring polynucleotides or polypeptides present in living animals are not isolated, but identical polynucleotides or DNAs or polypeptides isolated from some or all of the coexisting materials in the natural system are isolated. Such polynucleotides may be part of a vector and / or such polynucleotides or polypeptides may be part of a composition, and may also be separated in that such vector or composition is not part of its natural environment.

Polypeptides of the present invention include polypeptides of SEQ ID NO: 2 (particularly mature polypeptides) as well as polypeptides having at least 70% similarity to the polypeptide of SEQ ID NO: 2 (preferably at least 70% homology) and more preferably of SEQ ID NO: 2 A polypeptide having at least 90% similarity to the polypeptide (more preferably at least 90% homology) and more particularly preferably a polypeptide having at least 95% similarity to the polypeptide of SEQ ID NO: 2 (more preferably at least 95% homology) And portions of such polypeptides generally include portions of polypeptides containing at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art, the similarity between two polypeptides is determined by comparing the sequence of the second polypeptide with the amino acid sequence of any polypeptide and its conserved amino acid substituents.

Fragments or portions of the polypeptides of the invention can be used to produce corresponding full-length polypeptides by peptide synthesis, and thus the fragments can be used as intermediates to produce full length polypeptides. Fragments or portions of the polynucleotides of the present invention can be used to synthesize the full length polynucleotides of the present invention.

The present invention further relates to vectors comprising the polynucleotides of the invention, host cells genetically engineered using the vectors of the invention and methods of producing the polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfected) using the vectors of the invention, which can be, for example, cloning vectors or expression vectors. The vector may be in the form of, for example, a plasmid, viral particles, phage, or the like. Genetically engineered host cells can be cultured in conventional nutrient media suitably modified for activation of promoters, selection of transformants or amplification of the FGF gene. Culture conditions such as temperature, pH and the like are those already used with selected host cells for expression and will be apparent to those of ordinary skill in the art.

The polynucleotides of the present invention can be used to produce polypeptides by recombinant techniques. Thus, for example, polynucleotide sequences can be included in any of a variety of expression vehicles, in particular in a variety of expression vectors that express polypeptides. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV 40; Bacterial plasmids; Phage DNA; Yeast plasmids; Viral DNAs such as vectors derived from the combination of plasmid and phage DNA, vaccinia, adenovirus, chicken pox virus and pseudorabies. However, any other vector or plasmid can be used as long as it can replicate and survive in the host.

Appropriate DNA sequences can be inserted into the vector by a variety of processes. Generally, DNA sequences are inserted at appropriate restriction endonuclease sites by processes known in the art. Such and other processes will be included within the scope of one of ordinary skill in the art.

The DNA sequence in the expression vector is operably linked to appropriate expression control sequence (s) (promoter) to induce mRNA synthesis. Representative examples of such promoters may be mentioned: LTR or SV40 promoters, e. E. coli lac or trp, phage lambda P _L promoter and other promoters known to modulate the expression of genes in prokaryotic or eukaryotic cells or viruses thereof. In addition, the expression vector contains a ribosomal binding site for initiation of translation and termination of transcription. In addition, these vectors may include appropriate sequences for amplifying expression.

In addition, the expression vector preferably contains a gene such that dihydrofolate reductase or neomycin resistance to eukaryotic cell culture or E. coli. Phenotypic properties for selection of transformed host cells such as tetracycline or ampicillin resistance in E. coli.

A vector containing an appropriate DNA sequence as described above and an appropriate promoter or regulatory sequence can be used to transform the appropriate host to express the protein. Representative examples of suitable hosts may include the following: E. coli, Salmolnella typhimurium, Streptomyces; Fungal cells such as yeast; Insect cells such as Drosophila S2 and Spodoptera Sf9; Animal cells such as CHO, COS or Bow melanoma; Adenovirus; Plant cells etc. Selection of appropriate hosts will be included within the scope of one of ordinary skill in the art from the teachings herein.

More particularly, the present invention also encompasses recombinant constructs comprising one or more sequences as broadly described above. Such constructs include vectors, such as plasmids or viral vectors, in which the sequences of the invention are inserted in either the forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises a regulatory sequence, for example comprising a promoter operably linked to the sequence. Many suitable vectors and promoters are known to those of ordinary skill in the art and are commercially available. Examples of vectors are as follows: bacteria: pQE70, pQE60, pQE-9 (Qiagen), pBS, pagscript, psiX174, pbluescript SK, pBsKs, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 from Pharmacia; Eukaryotic cells: pWLneo, pSV2cat, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL from Pharmacia. However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two suitable vectors are pKK232-8 and pCM7. Particularly named bacterial promoters are lacI, lacZ, T3, T7, gpt, lambda P _R , P _L and trp. Eukaryotic cell promoters include CMV media early, HSV thymidine kinase, early and late SV40, LTR from retrovirus and mouse metallothionein-I. Selection of suitable vectors and promoters is within the scope of one of ordinary skill in the art.

In a further aspect, the present invention relates to a host cell containing the construct described above. The host cell may be a lower eukaryotic cell, for example a highly eukaryotic cell such as a mammalian cell or a yeast cell, or a prokaryotic cell, such as a bacterial cell. Incorporation of the construct into host cells can be accomplished by calcium phosphate transfection, DEAE-dextran mediated transfection or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986). )].

Constructs in host cells can be used to produce gene products encoded by recombinant sequences in conventional manner. On the other hand, polypeptides of the invention can be produced synthetically by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria or other cells under the control of appropriate promoters. Cell-free translation systems can also be used to produce such proteins with RNA derived from the DNA constructs of the invention. Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989), This document is incorporated herein by reference.

Transcription of the DNA encoding the polypeptide of the invention by highly eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, generally about 10 to 300 bp, that act on the promoter to increase its transcription. Examples include SV40 enhancers on rate sites of origin of replication (bp 100 to 270), cytomegalovirus early promoter enhancers, polyoma enhancers on rate sites of origin of replication and adenovirus enhancers.

In general, recombinant expression vectors are those of origin and selectable markers of replication that enable the transformation of host cells, such as E. coli. Coli and s. Ampicillin resistance genes of the S. cerevisiae TRP1 gene, and promoters derived from highly expressed genes to induce transcription of down-structure sequences. Such promoters may be derived from operon or heat shock proteins encoding glycolysis enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, among others. The heterologous structural sequence is assembled with a leader sequence capable of directing the translation of the translated, initiating and terminating sequences, preferably the translated protein, into the foreign space or extracellular medium in the appropriate phase. Optionally, the heterologous sequence can encode a fusion protein comprising an N-terminal identifying peptide that confers desired properties, eg, stabilization or simple purification of the expressed recombinant product.

Expression vectors useful for bacteria can be constructed by inserting a structural DNA sequence encoding a protein of interest into a functional promoter on a reading that is operable with a suitable translation, initiation and termination signal. The vector will contain one or more phenotypic selectable markers and origins of replication, to maintain the vector and to amplify it in the host if necessary. Suitable prokaryotic hosts for transformation are E. coli. E. coli, Bacillus subtilis, Salmonella typhimurium and Pseudomonas, Streptomyces and Staphylococcus spp. Can be used.

As a non-limiting example, expression vectors useful for bacteria can include selectable markers derived from commercially available plasmids containing the genetic elements of the known cloning vector pBR322 (ATCC 37017) and bacterial replication origin. Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA). These pBR322 backbone moieties are combined with appropriate promoters and structural sequences to be expressed.

Suitable host strains are transformed and host strains are propagated to appropriate cell densities, followed by induction of selected promoters by appropriate means (eg, temperature shift or chemical induction), and the cells are incubated for an additional period of time.

Cells are typically harvested by centrifugation, milled by physical or chemical means, and the crude extract obtained is stored for further purification.

Microbial cells used for expression of the protein can be pulverized by conventional methods including freeze-thaw cycling, sonication, mechanical grinding, or the use of cell lysates.

In addition, various mammalian cell culture systems can be used to express recombinant proteins. Examples of mammalian expression systems include the COS-7 cell line of monkey kidney fibroblasts described in Gluzman, Cell, 23: 175 (1981) and other cell lines capable of expressing suitable vectors, for example C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will include origins of replication, suitable promoters and enhancers, and also include all necessary ribosomal binding sites, polyadenylation sites, splicing donor and receptor sites, transcription termination sequences and 5 'flanking non-transcribed sequences. Will include. DNA sequences derived from the SV40 viral genome, such as the SV40 origin, early promoter, enhancer, splicing and polyadenylation sites, can be used to provide the necessary non-transcribed genetic elements.

Polypeptides of the invention are recovered, and ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography Purification from recombinant cell culture can be accomplished by the methods used above, including by chromatography. If necessary, protein reconstitution steps can be used to complete the arrangement of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for the last purification step.

Polypeptides of the invention are produced by recombinant techniques from naturally purified products, or from chemical synthesis processes, or from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plant, insect, and mammalian cells in the medium). It may be a product. Depending on the host used in the recombinant production process, the polypeptides of the invention can be glycosylated or non-glycosylated with mammalian or other eukaryotic carbohydrates. In addition, the polypeptides of the invention may comprise original methionine amino acid residues.

The polypeptides of the present invention can be used for the treatment to stimulate revascularization of ischemic tissues due to various diseases such as thrombosis, atherosclerosis and other cardiovascular diseases due to their ability to stimulate vascular endothelial cell growth. In addition, these polypeptides can be used to stimulate angiogenesis and fingertip regeneration.

In addition, the polypeptides of the present invention are mitotic to various cells of different origins such as fibroblasts and skeletal muscle cells, and thus promote repair or replacement of damaged or diseased tissues, thereby preventing damage, burns, postoperative tissue repair and ulcers. Can heal wounds caused

In addition, the polypeptides of the invention can be used to stimulate neuronal growth and to treat and prevent neuronal damage that occurs in certain neuronal diseases or neuro-degenerative conditions such as Alzheimer's disease, Parkinson's disease and AIDS-related complications. FGF-15 has the ability to stimulate chondrocyte growth and can therefore be used to enhance bone and root fascia regeneration and assist in tissue or bone graft.

Alternatively, the polypeptide of the present invention can be used to stimulate keratinocyte growth to prevent skin aging due to burns.

FGF-15 polypeptides can also be used to prevent hair loss because FGF family members activate hair forming cells and promote black blood cell growth. On the same line, the polypeptides of the invention can be used to promote the growth and differentiation of hematopoietic and bone marrow cells when used in combination with other cytokines.

In addition, FGF-15 polypeptides can be used to maintain organs prior to transplantation and support cell cultures of native tissues.

The polypeptides of the invention can also be used to differentiate early embryos by inducing tissue of mesodermal origin.

According to another further aspect of the present invention, methods for using the polypeptide or polynucleotides encoding such polypeptides for in vitro purposes associated with scientific research, for the synthesis of DNA and for the production of DNA vectors, and for human diseases Therapeutic agents for treatment are provided.

The present invention provides a method for identifying a receptor for a polypeptide of the invention. Genes encoding such receptors have been described in a number of methods known in the art, including ligand extension and FACS classification [Coligan, et al., Current Protocols in Immun., 1 (2), Chapter 5, (1991). )]. Preferably, expression cloning is used, wherein the polyadenylation RNA is prepared from cells reactive with the polypeptide, eg, NIH3T3 cells and SC-3 cells known to contain multiple receptors for FGF class proteins, CDNA libraries constructed from this RNA are separated into pools and used to transfect COS cells or other cells that are not reactive with the polypeptide. Transfected cells grown on glass slides are exposed to the polypeptides of the invention after they are labeled. The polypeptide is labeled by a variety of methods, including inclusion of recognition sites for iodide or site-specific protein kinases.

After immobilization and incubation, the slides are analyzed by auto-radiography. Positive pools are identified, sub-pools are prepared, and re-transfected using an iterative sub-pooling and re-screening process to finally obtain a single clone encoding the putative receptor.

As another method for receptor identification, the labeled polypeptide can be photoaffinity linked to a cell membrane or extract preparation that expresses the receptor molecule. Cross-linking material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptor of the polypeptide is cleaved and digested into peptide fragments followed by protein microsequencing. A set of denatured oligonucleotide probes is designed using amino acid sequences obtained by microsequencing and then screened for cDNA libraries to identify genes encoding putative receptors.

The present invention provides methods for screening compounds to identify those that modulate the action of the polypeptides of the invention. Examples of such assay methods are combining mammalian fibroblasts, polypeptides of the invention, compounds to be screened and ³ [H] thymidine under cell culture conditions in which fibroblasts can normally proliferate. Control assays are performed in the absence of the compound being screened and determine whether the compound stimulates proliferation by measuring the uptake of ³ [H] thymidine in each case as compared to the amount of fibroblasts grown in the presence of the compound. The amount of fibroblast proliferation is measured by liquid scintillation chromatography measuring the incorporation of ³ [H] thymidine. This method can identify all agonist and antagonist compounds.

In another method, a mammalian cell or membrane preparation that expresses a receptor for a polypeptide of the invention is cultured in the presence of a labeled polypeptide of the invention with the compound. The ability of the compound to enhance or inhibit interaction can then be determined. In addition, the reaction of the known second messenger system after the interaction of the FGF-15 receptor with the compound being screened is measured, and the ability of the compound to bind to the receptor and induce a second messenger response to determine the compound is a potential agonist. Or antagonist. Such second messenger systems include, but are not limited to, cAMP guanylate cyclase, ion channel or phosphonoinotide hydrolysis.

Efficacy antagonist compounds include antibodies, or in some cases oligopeptides that bind to receptors for the polypeptides of the invention but do not induce a second messenger response or bind to the FGF-15 polypeptide itself. On the other hand, an effective antagonist may be a polypeptide in variant form that binds to a receptor but does not induce a second messenger response, thus effectively blocking the action of the polypeptide.

Another antagonist compound for the FGF-15 gene and gene product is an antisense construct prepared using antisense technology. Antisense technology can be used to regulate gene expression by triple-helix formation or antisense DNA or RNA, both methods based on the binding of polynucleotides to DNA or RNA. For example, antisense RNA oligonucleotides of about 10 to 40 base pairs in length are constructed using the 5 'coding portion of a polynucleotide sequence encoding a mature polypeptide of the invention. DNA oligonucleotides are designed to be complementary to gene regions involved in transcription [Triple Helix-Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988); and Dervan et al., Science, 251: 1360 (1991), thereby preventing the transcription and production of the polypeptides of the invention. Antisense RNA oligonucleotides hybridize with mRNA in vivo and block the translation of mRNA molecules into polypeptides. Antisense-Okano, J. Neurochem., 56: 3 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)]. In addition, the oligonucleotides described above can be delivered to cells such that antisense RNA or DNA can be expressed in vivo to inhibit the production of the polypeptides of the invention.

In addition, antagonist compounds include small molecules that bind to the polypeptide of the invention and occupy the binding site of the receptor, thereby preventing the receptor from accessing its polypeptide such that normal biological activity is prevented. Examples of low molecular weight compounds include, but are not limited to, small peptides or peptide-like molecules.

Antagonist compounds can be used to inhibit the cellular growth and proliferation effects of the polypeptides of the invention on neoplastic cells and tissues, i.e., the stimulation of tumor angiogenesis, and thus for example abnormal cell growth and proliferation in tumor formation or growth. Can be delayed or prevented.

In addition, the antagonists of the present invention can be used to prevent hyper-vascular disease and to prevent proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of mitotic activity of the polypeptides of the invention may also be required in cases such as restenosis after instrumental angiogenesis.

In addition, the antagonist of the present invention can be used to prevent the growth of scar cells upon wound healing.

Antagonists of the invention can be used, for example, in compositions with pharmaceutically acceptable carriers, as described below.

The polypeptides, agonists or antagonist compounds of the invention may be used in combination with a suitable pharmaceutical carrier to constitute a pharmaceutical composition for oral administration. Such compositions comprise a therapeutically effective amount of a polypeptide, agonist or antagonist and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should be suitable for the mode of administration.

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more pharmaceutical composition ingredients of the present invention. Attention is drawn to the form prescribed by the governmental authority governing the manufacture, use or sale of pharmaceuticals or biological products in connection with such container (s), which reflects approval by the manufacturing, use or sales agency for human administration. will be. In addition, the polypeptides, agonists and antagonists of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical compositions can be administered by conventional methods such as oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or transdermal routes. The pharmaceutical composition is administered in an amount effective to treat and / or prevent certain indications. In general, they will be administered in an amount of at least about 10 μg / kg body weight, and in most cases will be administered in an amount of no greater than about 8 mg / kg body weight per day. In most cases, the dosage is from about 10 μg to about 1 mg per kg of body weight per day, depending on the route of administration, signs, and the like. For local administration in certain cases, the dose is preferably administered at about 0.1 μg to 9 mg / cm ² .

In addition, the polypeptides and agonists and antagonist compounds of the invention can be used according to the invention by expressing such polypeptides in vivo, often referred to as gene therapy.

Thus, for example, cells may be genetically engineered with polynucleotides (DNA or RNA) encoding polypeptides ex vivo, and then genetically engineered cells may be provided to a patient for treatment with a polypeptide. Such methods are known in the art. For example, cells can be genetically engineered using RNA-containing retroviral plasmid vectors encoding polypeptides of the invention.

Similarly, cells can be genetically engineered in vivo according to methods known in the art, for example, to express the polypeptide in vivo. As is known in the art, producer cells producing RNA-containing retroviruses encoding polypeptides of the invention can be administered to a patient to genetically engineer the cells in vivo and to express the polypeptide in vivo. . These and other methods of administering the polypeptides of the present invention by such methods will be apparent to those of ordinary skill in the art from the teachings of the present invention. For example, the expression vehicle for genetically engineering the cells can be other than retroviral particles, such as adenoviruses, which can be combined with a suitable delivery vehicle and then used to genetically engineer the cells in vivo.

Retroviruses capable of inducing the above-mentioned retroviral plasmid vectors include, but are not limited to, Moroni rat leukocyte virus, splenic necrosis virus, retroviruses such as Loew's sarcoma virus, Harvey's sarcoma virus, apes leukocyte virus, Gibbon leukocyte virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus and breast tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moroni murine leukocyte virus.

The vector contains one or more promoters. Suitable promoters that can be used include, but are not limited to, retrovirus LTRs; SV40 promoter and human cytomegalovirus (CMV) promoter [Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989)], or any other promoter (such as but not limited to cellular promoters such as eukaryotic cell promoters including histone, pol III, and β-actin promoters). Other viral promoters that can be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters and B19 parvovirus promoters. Selection of suitable promoters will be apparent to those of ordinary skill in the art from the teachings herein.

Nucleic acid sequences encoding polypeptides of the invention are present under the control of a suitable promoter. Suitable promoters that can be used include, but are not limited to, adenovirus promoters such as adenovirus major rate promoters; Or heterologous promoters such as the cytomegalovirus (CMV) promoter; Respiratory synchronic virus (RSV) promoter; Inducible promoters such as the MMT promoter, metallothionein promoter; Heat shock promoters; Albumin promoter; ApoAI promoter; Human globin promoter; Viral thymidine kinase promoters such as the herpes simplex thymidine kinase promoter; Retroviral LTRs (including modified retrovirus LTRs as described above); β-actin promoter and human growth hormone promoter. In addition, the promoter may be a natural promoter that regulates the gene encoding the polypeptide.

Retroviral plasmid vectors can be used to transduce packaging cell lines to form producer cell lines. Packaging cell lines that can be transfected include, but are not limited to, PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E- 86, GP + env Am12 and in Miller, Human Gene Therapy, vol. 1, pgs. 5-14 (1990), incorporated herein by reference, which is incorporated herein by reference. Vectors can transduce packaging cells by any method known in the art. Such methods include, but are not limited to, electroporation, use of liposomes, and CaPO ₄ precipitation. On the other hand, retroviral plasmid vectors can be encapsulated into liposomes or combined with lipids and then administered to a host.

Producer cell lines produce infectious retroviral vector particles comprising nucleic acid sequence (s) encoding a polypeptide. Such retroviral vector particles can then be used to transduce eukaryotic cells in vivo or in vitro. Transduced eukaryotic cells can express nucleic acid sequence (s) encoding a polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic liver cells, embryonic sarcoma cells and hematopoietic stem cells, blood cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells and bronchial epithelial cells.

The invention also relates to the use of the genes of the invention as part of a diagnostic assay for detecting a disease or susceptibility to the presence of a mutation in a nucleic acid sequence encoding a polypeptide of the invention.

Variants containing each of the genes of the present invention can be detected at the DNA level by various techniques. Diagnostic nucleic acids can be obtained from cells of a patient, such as blood, urine, saliva, tissue biopsy and autopsy material. Genomic DNA can be used directly for detection and can also be enzymatically amplified using PCR (Saiki et al., Nature, 324: 163-166 (1986)) prior to analysis. RNA or cDNA can also be used for the same purpose. For example, PCR primers complementary to nucleic acids encoding polypeptides of the invention can be used to identify and analyze their mutants. For example, deletions and inserts can be detected as changes in the size of the amplified product compared to normal genotypes. Point mutations can be identified by hybridizing amplified DNA with radiolabeled RNA or radiolabeled antisense DNA sequences. Fully matched sequences can be distinguished from mismatched double strands by RNase A digestion or differences in melting points.

Genetic testing based on DNA sequence differences can be accomplished by detecting changes in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and inserts can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished by denaturation of formamide gradient gels where the migration of different DNA fragments is delayed in the gel at different locations depending on their specific melting or partial melting points. See, Myers et al., Science, 230: 1242 (1985).

In addition, sequence changes at specific positions may be indicated by nuclease protection assays or chemical cleavage methods such as RNase and S1 protection (Cotton et al., PNAS, USA, 85: 4397-4401 (1985)). .

Thus, the detection of specific DNA sequences may include methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes (eg, restriction fragment length polymorphism (RFLP)) and Southern blotting of genomic DNA. It can be achieved by the method.

In addition to the more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by self analysis.

The invention also relates to diagnostic assays that detect altered levels of FGF-15 protein in various tissues because overexpression of the protein compared to normal control tissue samples can detect abnormal cell proliferation, eg, the presence of cancer. will be. Assays used to detect protein levels in samples derived from a host are known to those of ordinary skill in the art and include radioimmunoassays, competition-binding assays, western blotting assays, ELISA assays, and sandwich assays. There is this. ELISA assays (Coligan, et al., Current Protocols in Immunology, 1 (2), Chapter 6, (1991)) first determine antibodies specific for antigens of the polypeptides of the invention, preferably monoclonal antibodies. Manufacturing. In addition, reporter antibodies are prepared against monoclonal antibodies. The reporter antibody is attached with a radioactive, fluorescent or detectable reagent such as, for example, horseradish peroxidase enzyme. The sample is then removed from the host and incubated on a solid support such as a polystyrene dish to bind the proteins in the sample. The binding sites of all free proteins on the dish are then covered by incubating with non-specific proteins such as bovine serum albumin. The monoclonal antibody is then incubated in the dish while the monoclonal antibody is attached to all polypeptides of the invention attached to the polystyrene dish. All unbound monoclonal antibodies are removed by washing with buffer. Subsequently, the reporter antibody bound to wasabi peroxidase is placed in a dish to bind the reporter antibody to all monoclonal antibodies bound to the protein of interest.

Subsequently, unattached reporter antibodies are washed away. Subsequently, when the peroxidase substrate is added to the dish and compared to the standard curve, the amount of color developed at a given time is a measure of the amount of polypeptide of the present invention present in the volume of a given patient sample.

In addition, competition assays can be used, which attach an antibody specific for the polypeptide of the invention to the solid support and labeled FGF-13, and pass a sample derived from the host to the solid support, for example liquid scintillation chromatography. The amount of label detected by photography can be related to the amount of polypeptide of the invention in the sample.

Sandwich assays are similar to ELISA assays. In a sandwich assay, the polypeptide of the invention is passed through a solid support and bound with an antibody attached to the solid support. The second antibody is then coupled with the desired polypeptide. The third antibody labeled and specific for the second antibody can then be passed through a solid support, bound with the second antibody and then quantified.

In addition, the sequences of the invention are useful for chromosome identification. The sequence can be specifically targeted to a specific location on an individual human chromosome and hybridized with that location. In addition, it is currently required to identify specific sites on the chromosome. A few chromosomal marking reagents based on actual sequence data (repeat polymorphism) are currently available to indicate chromosomal location. DNA mapping to chromosomes according to the present invention is an important first step in associating genes associated with the disease with these sequences.

In summary, the sequence for the chromosome can be mapped by making PCR primers (preferably 15-25 bp) from cDNA. The amplification process can be complicated by the rapid analysis of primers that do not extend one or more exons in genomic DNA using computer analysis of the 3 'non-translated region. These primers are then used for PCR screening of somatic hydrides containing each human chromosome. Only hybrids containing human genes corresponding to the primers will produce amplified fragments.

PCR mapping of somatic hybrids is a rapid process for assigning specific DNA to specific chromosomes. Using the present invention using identical oligonucleotide primers, a panel of fragments from specific chromosomes or pools of large genomic clones can be sublocalized in the same way. Other mapping methods that may similarly be used to map their chromosomes include site hybridization, which pre-screens with labeled flow-classified chromosomes and prescreens by hybridization to construct chromosome specific-cDNA libraries. will be.

Mid-term chromosome extension can be used to provide accurate chromosomal location in one step using fluorescence specific hybridization (FISH) of cDNA clones. This technique can use short cDNA such as 50 or 60 base pairs. In light of this technology, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence for the correct chromosome location is mapped, the physical location of the sequence on the chromosome can be correlated with the genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (information available through the Johns Hopkins University Welch Medical Library). Subsequently, the correlation between the disease mapped to the gene mapped in the same chromosomal region is confirmed by binding analysis (inheritance of physically adjacent genes).

Subsequently, the difference in cDNA or genomic sequence between affected and non-infected patients should be measured. If the mutation is observed in all or some of the affected patients and not in any normal patient, the mutation is considered to be the trigger of the disease.

With respect to current analysis of physical mapping and genetic mapping techniques, a correctly localized cDNA in the chromosomal region associated with a disease may be one of 50 to 500 potential trigger genes (this is a 1 megabase mapping analysis and 20 kb). One gene per estimate).

Polypeptides, fragments or other derivatives thereof, or homologues thereof, or cells expressing the same can be used as an immunogen for generating antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The invention also encompasses the products of chimeric single-chain human antibodies and Fab fragments, or Fab expression libraries. Various processes known in the art can be used for the production of such antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by directly injecting the polypeptide into an animal or by administering the polypeptide to an animal, preferably a non-human animal. The antibody thus obtained will then bind to the polypeptide itself. In this method, sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind the entire pure polypeptide. Such an antibody can then be used to separate the polypeptide from tissue expressing the polypeptide.

To prepare monoclonal antibodies, any technique that provides antibodies produced by continuous cell line culture can be used. Examples thereof include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B-cell hybridoma technology (Kozbor et al., 1983, Immunology Today 4). : 72], and EBV-hybridoma technology for producing human monoclonal antibodies [Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96].

Techniques described for the production of single chain antibodies (US Pat. No. 4,946,778) can be applied to produce single chain antibodies against the immunogenic polypeptide products of the invention. In addition, transgenic mice can be used to express human antibodies against the immunogenic polypeptide products of the invention.

The invention will be further described with reference to the following examples. However, it should be understood that the present invention is not limited to these examples. Unless otherwise stated, all parts and amounts are by weight.

In order to help the understanding of the following examples, particularly frequently appearing methods and / or terms will be described.

Plasmids are represented by a lowercase p before and after an uppercase letter and / or a number. The starting plasmids herein can be constructed from plasmids that are commercially available on a commercially available and non-limiting basis, or which are available according to published methods. In addition, plasmids equivalent to the described plasmids are known in the art and will be apparent to those of ordinary skill in the art.

Degradation of DNA refers to catalytic cleavage of DNA using restriction enzymes that act only on specific sequences in the DNA. Various restriction enzymes as used herein are commercially available and their reaction conditions, cofactors and other requirements are used as known to those of ordinary skill in the art. For analysis, 1 μg of plasmid or DNA fragment is typically used with about 2 units of enzyme in about 20 μl of buffer. To isolate DNA fragments to plasmid constructs, 5-50 μg of DNA is typically degraded into 20-250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 ° C. are conventionally used but may be varied as directed by the supplier. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to separate the desired fragments.

Size fractionation of cleaved fragments is performed using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980).

Oligonucleotides refer to single-chain polydeoxynucleotides or two complementary polydeoxynucleotides that can be chemically synthesized. Such synthetic oligonucleotides do not contain 5 'phosphate and must be linked to another oligonucleotide by adding phosphate with ATP in the presence of a kinase. Synthetic oligonucleotides will be linked to fragments that are not dephosphorylated.

Linking refers to a method of forming phosphodiester bonds between two double-stranded nucleic acid fragments. See Maniatis, T., et al., Id., P. 146]. Unless otherwise indicated, ligation can be performed using known buffers and conditions with 10 units of T4 DNA ligase (ligase) per 0.5 μg of approximately equal molar DNA fragments to be linked.

Unless stated otherwise, transformation is performed as described in the methods of Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1

Bacterial Expression and Purification of FGF-15 Protein

DNA sequences encoding FGF-15 (ATCC # 97146) are initially amplified using PCR oligonucleotide primers corresponding to the 5 'sequence of the treated protein (except the signal peptide sequence) and the vector sequence 3' for the gene. Additional nucleotides corresponding to that gene are added to the 5 'and 3' sequences, respectively. The 5 'oligonucleotide primer has the sequence 5' GCCAGACCATGGTAAAACCGGTGCCCCTC 3 '(SEQ ID NO: 3) and contains an NcoI restriction enzyme site (in bold). 3 'SEQ ID NO: 5' GGCAGGAGATCTTGTTGTCTTACTCTTGTTGAC 3 '(SEQ ID NO: 4) contains the complementary sequence (in bold) for the BglII site, followed by the 21 nucleotides of the FGF-15 coding sequence.

The restriction enzyme site corresponds to the restriction enzyme site on the bacterial expression vector pQE-60. See Qiagen, Inc. Chatsworth, CA, 91311. pQE-60 encodes antibiotic resistance (Amp ^r ), bacterial replication origin (ori), IPTG-regulated promoter effector (P / O), ribosomal binding site (RBS), 6-His tag and restriction enzyme sites. Subsequently, pQE-60 is digested with NcoI and BglII. The amplified sequence is linked to pQE-60 and inserted into the sequence encoding the histidine tag and ribosomal binding site (RBS) in frame. Subsequently, using the linking mixture, E. coli by the process described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). E. coli strain M15 / rep 4 (Qiagen, Inc) is transformed. M15 / rep4 contains multiple copies of plasmid pREP4, which expresses a lacI inhibitor and confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml). O / N cultures are used to inoculate large cultures at a ratio of 1: 100 to 1: 250. Cells are grown to an optical density 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. IPTG (isopropyl-BD-thiogalacto pyranoside) is then added at a final concentration of 1 mM. IPTG increases gene expression by activating lacI inhibitors and eliminating P / O. The cells are grown for an additional 3-4 hours. The cells are then harvested by centrifugation. The cell pellet is lysed in 6M guanidine HCl made with chaotropic agent. After fractionation, the dissolved FGF-15 is purified from the solution by chromatography on a nickel-chelate column under conditions that are tightly bound by a protein containing 6-His tack. Hochuli, E. et al., J. Chromatography 411: 177-184 (1984). The protein is eluted from a column in 6M guanidine HCl at pH 5.0 and adjusted for denaturation with 3M guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced) and 2 mM glutathione (oxidized). After incubating the solution for 12 hours, the protein is dialyzed in 10 mM sodium phosphate.

Example 2

Cloning and Expression of FGF-15 Using a Baculovirus Expression System

DNA sequences encoding full length FGF-15 protein (ATCC # 97146) are amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' gene sequences below.

The FGF-15 5 'primer has the sequence 5' CTAGTGGATCCGCCATC ATG GTAAAACCGGTGCCC 3 '(SEQ ID NO: 5), contains the BamHI restriction enzyme site (in bold) and underlines the first 18 nucleotides of the gene (initiation codon ATG for detoxification). Four nucleotides resembling an efficient signal for initiation of translation in eukaryotic cells, which are located immediately behind, are located behind Kozac, M., J. Mol. Biol., 196: 947-950 (1987).

The 3 'primer has the sequence 5' CGACTGGTACCAGCCACGGAGCAGGAATGTCT 3 '(SEQ ID NO: 6) and contains the cleavage site for restriction endonuclease Asp718 (in bold) and 21 nucleotides complementary to the 3'-nontranslated sequence of the gene do.

Amplified sequences are isolated from 1% agarose gels using commercially available kits (Genclean BIO 101 Inc., La Jolla, Ca.). Each of these fragments is then digested with endonucleases and purified again on a 1% agarose gel. Name this fragment F2.

Vector pA2 (variant of pVL941 vector as described below) is used for protein expression using two baculovirus expression systems. Summers, MD and Smith, GE 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555]. This expression vector contains a potent polyhedrin promoter of Autograph California Nuclear Polyhedrosis Virus (AcMNPV), which is located in recognition sites for restriction endonucleases BamHI and XbaI. The polyadenylation site of monkey virus (SV) 40 is used for efficient polyadenylation. For screening recombinant viruses. The beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter preceding the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked by the viral sequences for cell-mediated homologous recombination of co-transfected wild type viral DNA. Many other baculovirus vectors can be used in place of pA2 such as pRG1, pAc373, pVL941 and pAcIM1 (Lukekow, V. A. and Summers, M. D., Virology, 170: 31-39).

Plasmids are digested with restriction enzymes and dephosphorylated using calf intestinal phosphatase by methods known in the art. DNA is then isolated from 1% agarose gel using a commercially available kit (Geneclean BIO 101 Inc., La Jolla, Ca.). This vector DNA is named V2.

Fragment F2 and dephosphorylated plasmid V2 are linked with T4 DNA ligase. Then, this. E. coli DH5α cells are transformed and the respective restriction enzymes are used to identify bacteria containing the plasmid (pBacFGF-15). The sequence of the cloned fragments is confirmed by DNA sequencing.

5 μg of the plasmid pBacFGF-15 was applied to the method of lipofection [Felgner et al. Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)] is co-transfected with commercially available linear baculovirus (BaculoGold ^™ Baculovirus DNA, Pharmingen, San Diego, CA.) 1.0 μg.

1 μg of BaculoGold ^™ virus DNA and 5 μg of plasmid are mixed in sterile wells of microtiter plates containing 50 μl of serum free grace culture (Life Technologies Inc., Gaithersburg, MD). Add 10 μl of Lipofectin + 90 μl of Grace culture, mix and incubate for 15 minutes at room temperature. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates containing serum-free 1 ml Grace culture. Move the plate back and forth to mix the newly added solution. The plate is then incubated at 27 ° C. for 5 hours. After 5 hours, the transfection solution is removed from the plate and 1 ml of Grace insect culture supplemented with 10% calf fetal serum is added. The plate is returned to the incubator and incubated at 27 ° C. for 4 days.

After 4 days, supernatants are collected and plaque assays are performed similar to the methods described in Summers and Smith et al., Supra. Agarose gels, including Blue Gal (Life Technologies Inc., Gaithersburg) as a variant, are readily used to isolate blue stained plaques (see also Life Technologies Inc., Gaithersburg, page 9 for details of plaque assays). Can be found in user guidance on insect cell culture and baculobiology distributed by -10).

Four days after sterile dilution, virus is added to the cells and blue stained plaques are collected with the tip of an Eppendorf pipette. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace culture. Agars are removed by short centrifugation and supernatants containing recombinant baculovirus are used to infect Sf9 cells seeded in 35 mm dishes. After 4 days, the supernatants of these culture dishes are collected and then stored at 4 ° C.

Sf9 cells are grown in Grace culture supplemented with 10% heat-inactivated FBS. Cells are infected with recombinant baculovirus V-FGF-15 at an infection redundancy (MOI) of 2. After 6 hours, the medium is removed and replaced with SF900 II culture without methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 by time, it is the ³⁵ S- methionine and ³⁵ S cysteine 5μCi 5μCi (Amersham). Cells are further incubated for 16 hours prior to collection by centrifugation, and labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 3

Expression of Recombinant FGF-15 in COS Cells

Expression of the plasmid FGF-15-HA is characterized by (1) the origin of SV40 replication, (2) the ampicillin resistance gene, and (3) E. E. coli replication origin, (4) derived from the vector pcDNA3 / Amp (Invitrogen) containing the polylinker region, the SV40 intron and the CMV promoter in front of the polyadenylation site. The DNA fragment encoding the entire FGF-15 precursor and HA tag fused with its 3 'end in frame are cloned into the polylinker region of the vector, thereby inducing expression of the recombinant protein under the control of the CMV promoter. HA tags correspond to epitopes derived from influenza hemagglutinin protein as described above. I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37: 767, (1984). Injection of HA tags into target proteins facilitates detection of recombinant proteins with antibodies that recognize HA epitopes.

The construction method of the plasmid is as follows:

DNA sequence encoding FGF-15 (ATCC # 97146) was constructed by PCR using two primers: 5 'primer 5' CTAGTGGATCCGCCATC ATG GTAAAACCGGTGCCC 3 '(SEQ ID NO: 7) is 18 of the coding sequence starting from the start codon The BamHI site (in bold) precedes the dog nucleotide, and the 3 'sequence 5' GTCGACCTCGAGTGTGTGCTTACTCTTGTT 3 '(SEQ ID NO: 8) is the complementary sequence for the XhoI site, translation stop codon, HA tag, and the last 18 nucleotides of the FGF-15 coding sequence. (Does not include a stop codon). Thus, the PCR product contains the BamHI site, the coding sequence before the HA tag fused in frame, the transcription termination stop codon after the HA tag, and the XhoI site.

PCR amplified DNA fragments and vector pcDNA3 / Amp are digested with each restriction enzyme and linked. This coupling mixture. E. coli strain SURE (available from Stratagene Cloning Systems, La Jolla, CA 92037) is transformed, the transformed cultures are plated on ampicillin medium plates and resistant colonies are selected. Plasmid DNA is isolated from the transformants and the presence of the correct fragments is examined by restriction analysis. For expression of recombinant FGF-15, COS cells were cultured by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). Transfection with expression vector. Expression of the FGF-15 HA protein is detected by radiolabeling and immunoprecipitation methods (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labeled with ³⁵ S-cysteine for 8 hours 2 days after transfection. The culture medium was then collected and cells were washed (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5)) [Wilson, I. et al., Id. 37: 767 (1984). Both cell lysates and cultures are precipitated with HA specific monoclonal antibodies. Precipitated protein is analyzed on a 15% SDS-PAGE gel.

Many modifications and variations of the present invention are possible in light of the above teachings, so that the invention, other than as specifically described, may be practiced within the scope of the appended claims.

Sequence list

(1) General Information:

(i) Applicant: Green, etc.

(ii) Name of the Invention: Fibroblast Growth Factor 15

(iii) SEQ ID NO: 8

(iv) corresponding address:

(A) Address: Karella, Byrne, Bain, Gilphylan, Cinch, Stewart and Allstein

(B) Distance: Becker Farm Rhode 6

(C) City: Roseland

(D) State: New Jersey

(E) Country: United States

(F) ZIP Code: 07068

(v) computer readable form:

(A) Media type: 3.5 inch diskette

(B) Computer: IBM PS / 2

(C) operating system: MS-DOS

(D) Software: WORD PERFECT 5.1

(vi) Current application information:

(A) Application number:

(B) filing date:

(C) Classification number:

(vii) Prior application information:

(A) Application number: 08 / 207,412

(B) Application date: March 8, 1994

(viii) Agent / Manager Information:

(A) Statement: Ferraro Gregory D.

(B) registration number: 36,134

(C) Reference / Dock Number: 325800-364

(xi) telecommunication information:

(A) Phone number: 201-994-1700

(B) Telly Fax: 201-994-1744

(2) Information about SEQ ID NO: 1

(i) sequence characteristics

(A) Length: 680 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) Molecular Form: cDNA

(xi) sequence description:

SEQ ID NO: 1

(2) Information about SEQ ID NO:

(i) sequence characteristics

(A) Length: 225 amino acids

(B) Form: Amino Acid

(C) Number of chains:

(D) Phase: Linear

(ii) Molecular Form: Protein

(xi) sequence description:

SEQ ID NO: 2

(2) information about SEQ ID NO:

(i) sequence characteristics

(A) Length: 32 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) molecular form: oligonucleotide

(xi) sequence description:

SEQ ID NO: 3

(2) information about SEQ ID NO:

(i) sequence characteristics

(A) Length: 33 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) molecular form: oligonucleotide

(xi) sequence description:

SEQ ID NO: 4

(2) information about SEQ ID NO:

(i) sequence characteristics

(A) Length: 33 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) molecular form: oligonucleotide

(xi) sequence description:

SEQ ID NO: 5

(2) Information about SEQ ID NO:

(i) sequence characteristics

(A) Length: 30 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) molecular form: oligonucleotide

(xi) sequence description:

SEQ ID NO: 6

(2) information for SEQ ID NO: 7

(i) sequence characteristics

(A) Length: 33 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) molecular form: oligonucleotide

(xi) sequence description:

SEQ ID NO: 7

(2) information for SEQ ID NO: 8:

(i) sequence characteristics

(A) Length: 33 base pairs

(B) Form: Nucleic Acid

(C) Number of chains: Japanese chains

(D) Phase: Linear

(ii) molecular form: oligonucleotide

(xi) sequence description:

SEQ ID NO: 8

Claims (27)

(a) a polynucleotide encoding the polypeptide described in FIG. 1; (b) polynucleotides capable of hybridizing with polynucleotides (a) and having at least 70% sequence homology; (c) Polynucleotide An isolated polynucleotide comprising a member selected from the group consisting of polynucleotide fragments of (a) or (b). The polynucleotide of claim 1, wherein the polynucleotide encodes a polypeptide comprising amino acids 1 to amino acids 252 as set forth in SEQ ID NO: 2. The polynucleotide of claim 1, wherein the polynucleotide is DNA. The polynucleotide of claim 1, wherein the polynucleotide is RNA. The polynucleotide of claim 1, wherein the polynucleotide is genomic DNA. The polynucleotide of claim 1 comprising nucleotides 1 to 759 described in SEQ ID NO: 1. (a) a polynucleotide encoding a mature polypeptide encoded by DNA included in ATCC Accession No. 97146; (b) a polynucleotide encoding a polypeptide expressed by the DNA contained in ATCC Accession No. 97146; (c) polynucleotides capable of hybridizing with polynucleotides (a) or (b) and having at least 70% sequence homology and (d) Polynucleotide An isolated polynucleotide comprising a member selected from the group consisting of polynucleotide fragments of (a), (b) or (c). 8. The polynucleotide of claim 7, wherein the polynucleotide encodes a polypeptide expressed by the DNA contained in ATCC Accession No. 97146. 8. The polynucleotide of claim 7, wherein the polynucleotide encodes a polypeptide expressed by the DNA contained in ATCC Accession No. 97146. 8. The polynucleotide of claim 7, wherein the polynucleotide encodes a polypeptide expressed by the DNA contained in ATCC Accession No. 97146. A vector comprising the DNA of claim 2. A host cell genetically engineered with the vector of claim 11. A method of making a polypeptide comprising expressing a polypeptide encoded by the DNA from a host cell of claim 12. A method of producing a cell capable of expressing a polypeptide, including genetically engineering a cell with the vector of claim 11. (i) a polypeptide having the putative amino acid sequence of FIG. 1 and fragments, homologs and derivatives thereof; (ii) a polypeptide selected from the group consisting of a polypeptide encoded by cDNA of ATCC Accession No. 97146 and fragments, homologs and derivatives thereof. The polypeptide of claim 15, wherein the polypeptide comprises the putative amino acid sequence of FIG. 1. An antibody against the polypeptide of claim 15. A compound that inhibits the polypeptide of claim 15. A compound that activates a receptor for a polypeptide of claim 15. A method of treating a patient in need of an FGF-15 polypeptide, comprising administering a therapeutically effective amount of the polypeptide of claim 15 to a patient in need thereof. A method of treating a patient in need of inhibiting FGF-15 polypeptide, comprising administering to a patient in need thereof an amount of the compound of claim 18. The method of claim 20, wherein the therapeutically effective amount of the polypeptide is administered by providing the patient with DNA encoding the polypeptide to express the polypeptide in vivo. The method of claim 21, wherein the compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing the patient with DNA encoding the antagonist to express the antagonist in vivo. (a) combining the cell-containing reaction mixture containing the compound to be screened and the label introduced into the cell as the cell proliferates under conditions where the cell is normally stimulated by the polypeptide, and (b) determining a compound that is active as an agonist for the polypeptide of claim 15, comprising determining the extent of proliferation of the cell to determine whether the compound is an effective agonist. (a) combining the cell-containing reaction mixture containing the compound to be screened, the polypeptide and the label introduced into the cell as the cell proliferates under conditions where the cell is normally stimulated by the polypeptide, and (b) determining the compound that is active as an antagonist to the polypeptide of claim 15, comprising determining the proliferation of cells to determine whether the compound is an effective antagonist. A method of diagnosing susceptibility to a disease or disorder associated with overexpression of the polypeptide of claim 15, comprising measuring a mutation in a nucleic acid sequence encoding the polypeptide. A diagnostic method comprising analyzing the presence of the polypeptide of claim 15 in a sample derived from a host.