KR19980703534A - Human cryptin growth factor - Google Patents

Abstract

The present invention describes human cryptin growth factor polypeptides (CGF) and DNA (RNAs) encoding such polypeptides and methods of making such polypeptides by recombinant techniques. The present invention also describes methods of using the polypeptides to heal wounds or regenerate tissues, stimulate implant fixation and form blood vessels. In addition, the present invention describes antagonists against these polypeptides and their use as therapeutic agents for treating and / or preventing neoplasia such as tumors. The present invention also describes diagnostic assays for identifying mutations in the CGF nucleic acid sequences and the level of modification of the CGF polypeptide to detect cancer.

Description

Human cryptin growth factor

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and methods of making such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention have been presumably identified as human cryptin growth factors (often described as CGF). The present invention also relates to the inhibitory action of such polypeptides.

Growth factors, and other mitotics, including transformed oncogenes, can quickly induce complex sets of genes to be expressed by specific cells. Lau, LF and Nathans, D., Molecular Aspects of Cellular Regulation , 6: 165-202 (1991). These genes, called immediate early or early reactive genes, are transcriptionally activated within minutes after contact with growth factors or mitosis, independent of newly initiated protein synthesis. These immediate reactive gene groups encode secreted extracellular proteins that require the cooperation of complex biological processes such as differentiation and proliferation, regeneration and wound healing. Ryseck, RP et al., Cell Growth Differ. , 2: 235-233 (1991).

Expression of these immediate reactive genes acts as a third messenger in the cascade of events caused by growth factors. In addition, these genes are believed to need to integrate and cooperate with complex biological processes, such as differentiation and wound healing, in which cell proliferation occurs as a common event.

Cryptin growth factor is overexpressed and secreted by certain types of cancer cells, such as pancreatic cancer cells.

The CGF of the present invention exhibits amino acid sequence homology with the cryptographic growth factors described in US Pat. No. 5,256,643, which is incorporated herein by reference. Such crypto growth factors are one of those known as useful tumor markers. Crypto is often upregulated in colon cancer and expressed in pancreatic cancer.

According to one aspect of the invention, novel mature polypeptides and fragments, homologs and derivatives thereof are biologically active and diagnostically or therapeutically useful.

According to another aspect of the invention, a human nucleic acid comprising mRNA, DNA, cDNA and genomic DNA, and an isolated nucleic acid encoding fragments, homologs and derivatives thereof that are biologically active and diagnostically or therapeutically useful. Provide a molecule.

According to another aspect of the present invention, culturing a recombinant prokaryotic and / or eukaryotic host cell containing a nucleic acid sequence encoding a polypeptide of the invention under conditions that promote the expression of the polypeptide and subsequent recovery of the polypeptide. It provides a method for producing the polypeptide by recombinant technology comprising a.

According to another aspect of the invention, the polypeptide, or a polynucleotide encoding the polypeptide, is used for therapeutic purposes, for example, to treat osteoporosis, a myelopathic disease, to aid in implant fixation, to stimulate wound healing and tissue regeneration. To promote angiogenesis, and to stimulate the proliferation of vascular smooth muscle and endothelial cell production.

According to a further aspect of the invention, an antibody against said polypeptide is provided.

According to another aspect of the present invention, there is provided an antagonist for the polypeptide, which can be used to inhibit the action of the polypeptide, for example, during wound healing or to limit the production of excess connective tissue in pulmonary fibrosis. .

According to another aspect of the invention, there is also provided a nucleic acid probe comprising a nucleic acid molecule of sufficient length to specifically hybridize with the polynucleotide sequence of the invention.

According to another aspect of the invention, a diagnostic assay is provided for screening for diseases associated with expression of polypeptides of the invention and for assaying mutations in nucleic acid sequences encoding such polypeptides.

In accordance with a further aspect of the present invention, there is provided a method for using said polypeptides and polynucleotides encoding such polypeptides for in vitro purposes relating to scientific research investigations, DNA synthesis and the production of DNA vectors.

All aspects of the invention should be apparent to those skilled in the art from the teachings herein.

The following figures illustrate aspects of the invention but are not intended to limit the scope of the invention as encompassed by the claims.

1 illustrates the cDNA and corresponding deduced amino acid sequence of a polypeptide according to the invention. Standard single letter abbreviations are used for amino acids. Sequencing is performed using a 373 automated DNA sequencer (Applied Biosystem, Inc.).

Figure 2 illustrates amino acid homology between the polypeptide (top) and the Crypto Growth Factor (bottom) of the present invention.

According to an aspect of the present invention, a mature polypeptide having the inferred amino acid sequence of FIG. 1 (SEQ ID NO: 2) or a mature polypeptide encoded by the cDNA of a clone deposited as ATCC Accession No. 97142 on May 11, 1995 is used. An isolated nucleic acid (polynucleotide) is provided that encodes.

Polynucleotides encoding polypeptides of the invention are found in cDNA libraries derived from human pancreatic tissue. It is structurally related to human cryptographic growth factors. It contains an open reading frame that encodes a protein of 230 amino acid residues, the initial 23 amino acid residues being the presumed leader sequence such that the mature protein contains 207 amino acids. As shown in FIG. 2, the polypeptides of the invention have conserved cysteine residues in common with cryptographic growth factors.

Furthermore, since the polypeptide of the present invention has a putative soluble portion comprising amino acids 45 to 128 of SEQ ID NO: 2, amino acids 129 to 207 are portions of the putative transition membrane.

Early Northern blot analysis indicates that it is very highly expressed in pancreatic cancer cells.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA including cDNA, genomic DNA and synthetic DNA. Such DNA may be double stranded or single stranded, and in the case of the single stranded strand, may be an encoded or non-encrypted (anti-sense) strand. The coding sequence encoding the mature polypeptide is the same as the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone, or as a result of the redundancy or degeneracy of the genetic code. It can be a different coding sequence that encodes the same mature polypeptide as the cDNA.

A polynucleotide encoding a mature polypeptide of FIG. 1 (SEQ ID NO: 2) or a polynucleotide encoding a mature polypeptide encoded by a deposited cDNA is merely a coding sequence for the mature polypeptide; Additional coding sequences, such as coding sequences for mature polypeptides and leader or secretory sequences or proprotein sequences; Coding sequences for mature polypeptides (and any additional coding sequences) and non-coding sequences such as introns or non-coding sequences 5 'and / or 3' of coding sequences for mature polypeptides.

Thus, a polynucleotide encoding the term polypeptide encompasses not only a polynucleotide comprising a coding sequence for a polypeptide, but also a polynucleotide comprising additional coding and / or non-coding sequences.

The present invention also relates to variants of the above-mentioned polynucleotides encoding fragments, homologs and derivatives of the polypeptides having a deduced amino acid sequence of FIG. 1 (SEQ ID NO: 2) or polypeptides encoded by cDNA of deposited clones. Variants of such polynucleotides may be natural allelic variants of the polynucleotides or non-natural variants of the polynucleotides.

Thus, the present invention is directed to a polypeptide or deposited clone of FIG. 1 (SEQ ID NO: 2), as well as to a polynucleotide encoding the same mature polypeptide or the same mature polypeptide encoded by the cDNA of a deposited clone as shown in FIG. 1 (SEQ ID NO: 2). And variants of the polynucleotide encoding fragments, derivatives or homologs of the polypeptide encoded by cDNA of. Such nucleotide variants include deletion variants, substitutional variants and addition or insertion variants.

As noted above, the polynucleotide may have a coding sequence that is a natural allelic variant of the coding sequence shown in FIG. 1 (SEQ ID NO: 2) or the coding sequence of the deposited clone. As is known in the art, allelic variants are alternative forms of polynucleotide sequences in which one or more nucleotides may be substituted, deleted or added without substantially modifying the function of the encoded polypeptide.

The invention also relates to a polynucleotide sequence in which the coding sequence for the mature polypeptide assists the expression and secretion of the polypeptide from the host cell, eg, a leader sequence that acts as a secretory sequence that regulates the transport of the polypeptide from the host cell. Polynucleotides that can be fused in the same reading frame as. A polypeptide having a leader sequence may be a preprotein and have a leader sequence that is cleaved by the host cell to form a mature form of the polypeptide. The polynucleotide may also encode a proprotein, which is a mature protein plus an additional 5 'amino acid residue. Mature proteins with prosequences are proproteins and are inactive forms of the protein. When the prosequence is cleaved, the active mature protein remains.

Thus, for example, the polynucleotide of the present invention can encode a mature protein, a protein having a prosequence, or a protein having both a prosequence and a presequence (leader sequence).

The polynucleotide of the present invention may have a coding sequence fused within the same frame as the marker sequence to purify the polypeptide of the present invention. Such marker sequence may be a hexahistidine tag supplied by a pQE-9 vector, provided for purification of a mature polypeptide fused with the marker in the case of a bacterial host, or for example a COS-7 cell. If a mammalian host is used, it may be a hemagglutinin (HA) tag. HA tags correspond to epitopes derived from influenza hemagglutinin proteins (Wilson, I., et al., Cell, 37: 767 (1984)).

The term gene means a segment of DNA involved in producing a polypeptide chain; It includes insertion sequences (introns) between individual coding segments (exons) as well as the front and back regions (leader and taylor) of the coding region.

Fragments of the full-length CGF gene can be used as hybridization probes for the cDNA library to isolate the full-length CGF gene and to isolate other genes with sequences similar to the CGF gene or with similar biological activity. . Probes of this type preferably have about 30 or more bases and may contain, for example, 50 or more bases. Such probes can be used to identify genomic clone (s) containing cDNA clones corresponding to full length transcripts and complete CGF genes including regulatory and promoter regions, exons and introns. One example of the screen involves synthesizing oligonucleotide probes by separating the coding region of the CGF gene by using known DNA sequences. Labeled oligonucleotides having sequences complementary to the gene sequences according to the invention are used to screen libraries of human cDNA, genomic DNA or mRNA to determine the members of the library to which the probe hybridizes.

The invention also relates to polynucleotides which hybridize with the above-mentioned sequences when at least 70%, preferably at least 90%, more preferably 95% of homogeneity exists between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions with the above-mentioned polynucleotides. As used herein, the term stringent conditions means that hybridization occurs only when there is at least 95%, preferably at least 97%, identity between sequences. In a preferred embodiment the polynucleotide hybridizing with the above-mentioned polynucleotide encodes a polypeptide substantially retaining the same biological function or activity as the mature polypeptide encoded by the cDNA or deposited cDNA of FIG. 1 (SEQ ID NO: 2).

Alternatively, the polynucleotide is at least 20, preferably at least 30, more preferably 50, which may be hybridized with the polynucleotide of the present invention and have homogeneity as mentioned above and may or may not retain activity. It may contain more than one base. For example, such polynucleotides can be used, for example, as probes for polynucleotides of SEQ ID NO: 1 to recover polynucleotides, or as diagnostic probes or as PCR primers.

Accordingly, the present invention provides a polynucleotide encoding not only a polypeptide of SEQ ID NO: 2 but a fragment thereof (the fragment having at least 30, preferably at least 50 bases) and at least 70%, preferably at least 90%, more preferably And polynucleotides having at least 95% homology and polynucleotides encoded by such polynucleotides.

The deposits referred to in the present invention are claimed under the Convention of the Budapest Treaty on the International Approval of Microbial Deposits in Patent Procedures. These deposits are merely to provide convenience to those skilled in the art, and the deposits are subject to 35 U.S.C. It is not an approval requirement to meet § 112 regulations. The sequence of the polynucleotide contained in the deposited material, and the amino acid sequence of the polypeptide encoded thereby, is adjusted in the event of a conflict with the sequence cited herein by reference and described herein. A license may be required to manufacture, use or sell the deposited material, no license is granted by this application.

The invention also relates to polypeptides having an inferred amino acid sequence of FIG. 1 (SEQ ID NO: 2) or an amino acid sequence encoded by deposited cDNA, as well as fragments, homologues and derivatives of such polypeptides.

When referring to the polypeptide of FIG. 1 (SEQ ID NO: 2) or to a polypeptide encoded by a deposited cDNA, the terms fragments, derivatives and homologs refer to polypeptides that substantially retain the same biological function or activity as the polypeptide. Thus, homologues include proproteins that are activated by cleavage of the proprotein moiety to produce a mature polypeptide having activity.

The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

A fragment, derivative or homologue of the polypeptide of FIG. 1 (SEQ ID NO: 2) or polypeptide encoded by a deposited cDNA is (i) substituted with an amino acid residue (preferably a conserved amino acid residue) in which one or more amino acid residues are conserved or not. And the amino acid residue thus substituted may or may not be encoded by the genetic code, (ii) at least one amino acid residue comprises a substituent group, (i) the mature polypeptide is another compound, for example a polypeptide Fused with a compound that increases the half-life of (eg, polyethylene glycol), (iii) a leader or secretory sequence; Sequences used for purification of mature polypeptides; Or an additional amino acid, such as a proprotein sequence, is fused with a mature polypeptide, or (i) a splice variant of a mature polypeptide that still retains its biological activity although certain amino acid residues are deleted. One of ordinary skill in the art, from the teachings herein, may consider that such fragments, derivatives and homologues are within the scope of the present invention.

Polypeptides and polynucleotides of the invention are preferably provided in isolated form and are preferably purified homogeneously.

The term isolated means to remove a substance from its original environment (eg, the natural environment if it is a natural substance). For example, native polynucleotides or polypeptides present in living animals are not isolated, but identical polynucleotides or polypeptides isolated from some or all of the materials that coexist in the natural system are isolated. Such polynucleotides may be part of a vector and / or the polynucleotide or polypeptide may be part of a composition and may be separated when the vector or composition is not part of its natural environment.

Polypeptides of the invention have at least 70% homology (70% homology) with the polypeptide of SEQ ID NO: 2 as well as the polypeptide of SEQ ID NO: 2, preferably at least 90% homology (90%) with the polypeptide of SEQ ID NO: 2 Homologous), more preferably a polypeptide having at least 95% homology (at least 95% homologous) with the polypeptide of SEQ ID NO: 2, and generally at least 30 amino acids, more preferably at least 50 amino acids A portion of the polypeptide having the portion of the polypeptide containing it.

As is known in the art, homology between two polypeptides is determined by comparing the amino acid sequence of one polypeptide to its second polypeptide and its conserved amino acid substituents.

Fragments or portions of the polypeptides of the invention can be used to prepare corresponding full length polypeptides by peptide synthesis, and thus such fragments can be used as intermediates for making full length polypeptides. Fragments or portions of the polypeptides of the invention can be used to synthesize the full length polynucleotides of the invention.

The invention also relates to vectors comprising the polynucleotides of the invention, host cells genetically engineered using the vectors of the invention, and methods of making polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transduced, transformed or transfected) using vectors of the invention, which can be, for example, cloning vectors or expression vectors. Such vectors may be in the form of, for example, plasmids, viral particles, phages, and the like. The host cells engineered as described above can be cultured in a conventional nutrient medium modified to be suitable for activation of promoters, selection of transformants or amplification of CGF genes. Culture conditions such as temperature, pH and the like have been used previously with the host cell selected for expression and will be apparent to those skilled in the art.

Polynucleotides of the invention can be used to prepare polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of various expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV40; Bacterial plasmids; Phage DNA; Baculovirus; Yeast plasmids; Vectors derived from the combination of plasmid and phage DNA, vice versa, such as vaccinia, adenovirus, poultry pox virus, and pseudorabies. However, any other vector can be used if it is replicable and viable in the host.

Appropriate DNA sequences can be inserted into the vector by a variety of methods. Generally, such DNA sequences are inserted into suitable restriction endonuclease sites by methods well known in the art. Such and other methods are considered to be within the scope of those skilled in the art.

DNA sequences in expression vectors are operably linked to appropriate expression control sequences (promoters) to direct DNA synthesis. Representative examples of such promoters include the LTR or SV40 promoter, E. E. coli lac or trp , phage lambda P _L promoters, and other promoters known to modulate gene expression in prokaryotic or eukaryotic cells or their viruses may be mentioned. The expression vector also contains a ribosomal binding site and transcription terminator for initiation of translation. The vector may comprise a sequence suitable for amplifying expression.

In addition, the expression vector is preferably dihydrofolate reductase or neomycin resistance, or E. coli for eukaryotic cell culture. It contains one or more selectable marker genes that provide phenotypic properties for the selection of transformed host cells, such as tetracycline or ampicillin resistance in E. coli.

A vector containing the appropriate promoter or regulatory sequence as well as the appropriate DNA sequence as mentioned above is used to transform the appropriate host so that the host can express the protein.

Representative examples of suitable hosts include: E. coli, Streptomyces (Streptomyces), Salmonella typhimurium bacterial cells, such as (Salmonella typhimurium); Fungal cells such as yeast; Insectoid cells such as Drosophila S2 and Spodoptera Sf9 ; Animal cells such as CHO, COS or Bowes melanoma; Adenovirus; Plant cells and the like can be mentioned. Selection of suitable hosts is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also encompasses recombinant constructs comprising one or more of the sequences as broadly described above. Such constructs include vectors such as plasmids or viral vectors in which the sequences of the invention have been inserted in a forward or backward direction. In a preferred aspect of this embodiment, the construct further comprises a regulatory sequence, for example comprising a promoter operably linked to the sequence. Many suitable vectors and promoters are known to those skilled in the art and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (source: Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Source: Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Source: Stratagene), pSVK3, pBPV, pMSG, pSVL (Source: Pharmacia). However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

Promoter regions can be selected from any desired gene using a CAT (Chloramphenicol transferase) vector or other vector with selectable markers. Two suitable vectors are PKK232-8 and PCM7. Particularly named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P _R , P _L and trp. Eukaryotic promoters include the CMS immediate promoter, HSV thymidine kinase, early and late SV40, LTR from retrovirus, and mouse metallothionein-I. Selection of suitable vectors and promoters is well within the scope of conventional techniques in the art.

In a further aspect, the present invention relates to a host cell containing the above-mentioned construct. The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into host cells can be performed by calcium phosphate transfection, DEAE-dextran mediated transfection, or electroporation. Davis, L., Dibner, M., Battey, I., Basic Method in Molecular Biology, (1986)].

Constructs in host cells can be used in conventional manner to produce gene products encoded by recombinant sequences. Alternatively, the polypeptides of the invention can be made synthetically by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of a suitable promoter. Cell-free translation systems can also be used to make such proteins using RNA derived from the DNA constructs of the invention. Cloning and expression vectors suitable for use with prokaryotic and eukaryotic hosts are described in Sambrook. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), incorporated herein by reference.

Transcription of the DNA encoding a polypeptide of the invention by higher eukaryotic cells is increased by inserting an enhancer sequence into the vector. Enhancers are typically cis-acting elements of DNA that are about 10-300b and act on the promoter to increase transcription. SV40 enhancers on the terminal side of replication origin bp 100 to 270, cytomegalovirus early promoter enhancers, polyoma enhancers on the terminal side of replication origin, and adenovirus enhancers are included as examples.

In general, recombinant expression vectors include, but are not limited to, the origin of replication; Selective markers that allow transformation of host cells, for example E. Coli and s. Ampicillin resistance gene of the S. cerevisiae TRP1 gene; And a promoter derived from a highly expressed gene directing transcription of the underlying sequence. The promoter may be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock protein. The heterologous structural sequence is assembled in an appropriate phase with translation initiation and termination sequences, and preferably with leader sequences that can direct the translated protein to be secreted into the cytoplasmic space or extracellular medium. Optionally, this heterologous structural sequence can encode a fusion protein comprising an N-terminal identification peptide that provides the desired properties, eg, stabilization or simplified purification of the expressed recombinant product.

Expression vectors useful for use in bacteria are constructed by inserting a structural DNA sequence encoding a protein of interest into an operative reading with a functional promoter, along with a suitable translational initiation and termination signal. The vector can maintain the vector, including one or more phenotypic selectable markers and origins of replication, and provides amplification in the host if necessary. Suitable prokaryotic host cells for transformation are E. coli. There are various species in E. coli, Bacillus subtilis , Spropanella typhimurium, and Pseudomanas genus, Streptomyces genus and Staphylococcus genus, but others may be selected and used.

As a representative but non-limiting example, expression vectors useful for use in bacteria can include bacterial markers of origin and selectable markers derived from commercial plasmids comprising the genetic elements of the well-known cloning vector pBR322 (ATCC 37017). have. Such commercially available vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA). The pBR322 backbone fragment is combined with a suitable promoter and structural sequence to be expressed.

After transforming a suitable host strain and growing the host strain at a suitable cell density, the selected promoter is induced by a suitable method (eg temperature change or chemical induction) and the cells are cultured for an additional period of time.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

Microbial cells used for the expression of proteins can be disrupted by conventional methods, including methods that are well known to those skilled in the art, such as freeze-thaw circulation, sonication, mechanical disruption, or the use of cell lysates. have.

In addition, various mammalian cell culture systems can be used to express recombinant proteins. Examples of mammalian expression systems include the COS-7 strain of monkey kidney fibroblasts described in Gluzman, Cell, 23: 175 (1981), and other cell lines capable of expressing a conformity vector, such as C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors include origin of replication, suitable promoters and enhancers, and essential ribosomal binding sites, polyadenylation sites, split donor and receptor sites, transcription termination sequences, and 5 'flanking non-transcription sequences. DNA sequences derived from SV40 splits and polyadenylation sites can be used to provide the necessary non-transcriptal genetic elements.

Polypeptides of the invention include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography The method can be recovered and purified from recombinant cell culture. Protein refolding steps can be used to complete the arrangement of mature proteins, if necessary. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

Polypeptides of the invention are naturally purified products or by recombinant techniques from chemical synthesis processes or from prokaryotic or eukaryotic cell hosts (eg, by bacterial, yeast, higher plant, insect and mammalian cells in culture). It may be a manufactured product. Depending on the host used in the recombinant preparation process, the polypeptides of the invention may or may not be glycosylated. Polypeptides of the invention may also comprise initial methionine amino acid residues.

Amplification, rearrangement, deletion or restriction fragments of the kryptin gene in normal tissues as compared to tumor tissues using the CGF gene of the invention as a probe for Southern blot analysis containing an endonuclease cleaved DNA preparation Check for polymorphisms of length.

The labeled cryptin gene is then used for Northern blot analysis containing RNA to determine the relative expression of mRNA in a variety of normal and pathogenic tissue samples.

The CGF gene can be used to generate probes suitable for in situ RNA: RNA hybridization for mechanical localization in normal or pathogenic cells expressing CGF mRNA.

CGF oligonucleotides (sense-chains) can be used to assay the level of CGF mRNA in various tissues.

CGF polypeptide is overexpressed and secreted by certain types of cancer cells, such as pancreatic cancer cells. Thus, pancreatic cancer can be diagnosed by CGF gene transcription or detection of excess CGF protein. Thus, anti-CGF antibodies can be used to diagnose angiogenesis associated with tumor formation, since altered levels of such polypeptides may be a sign of the disease.

Competitive assay methods can be used, wherein an antibody specific for CGF is attached to the solid support, a sample derived from labeled CGF and a host is passed over the solid support, and the amount of label detected attached to the solid support is detected in the sample. Correlated with the amount of CGF.

Sandwich assays are similar to ELISA assays. In a sandwich assay, the CGF polypeptide is passed over a solid support to bind an antibody attached to this solid support. The second antibody is then bound to the CGF polypeptide. A labeled third antibody specific for the second antibody can be passed over the solid support to bind to the second antibody and then quantified.

Polypeptides of the invention can be used for wound healing and re-growth related treatment of tissues associated with it (eg connective tissue, skin, bone, cartilage, muscle, lung or kidney).

Such polypeptides may also be used to stimulate blood vessel formation by enhancing the growth of vascular smooth muscle and endothelial cells. This increase in angiogenesis will be beneficial for ischemic tissue, and lateral coronary progression of the heart following coronary stenosis.

The polypeptide of the invention may be used during implant fixation to stimulate cell growth around the implant, thereby promoting attachment of the implant to the intended site.

According to another aspect of the present invention, a test related to scientific research on DNA synthesis and construction of a DNA vector for the purpose of developing a therapeutic agent and a diagnostic agent for treating a human disease or a polypeptide thereof encoding the polypeptide. Provided are methods of use as test reagents for in vitro purposes.

The present invention provides a method for identifying a receptor for a polypeptide of the invention. Genes encoding such receptors can be identified by a number of methods known to those skilled in the art, for example ligand panning and FACS classification. Coligan, et al., Current Protocols in Immun ., 1 (2), Chapter 5, (1991)]. Preferably, the polyadenylation RNA is prepared from cells reactive to CGF polypeptide, and the cDNA library generated from such RNA is divided into pools and transfected COS cells or other cells that are not reactive to CGF. Expression cloning is used. Transfected cells grown on glass slides are exposed to labeled CGF. CGF can be labeled in a variety of ways, including iodide or incorporation of a recognition site for site specific protein kinases. After fixation and incubation, the slides are analyzed using autoradiographing. Positive pools are identified, sub-pools are prepared, and retransfected using repeated sub-pooling and rescreening methods to yield a single clone that finally encodes the putative receptor.

As another approach to receptor identification, labeled CGF can be photoaffinityly linked to an extract preparation that expresses a cell membrane or receptor molecule. The crosslinked material is split by PAGE and exposed to X-ray film. Labeled complexes containing CGF-receptors are cleaved, split into peptide fragments, and protein microsequences. Amino acid sequences obtained from microsequencing can be used to design a set of degenerate oligonucleotide probes for screening cDNA libraries to identify genes encoding putative receptors.

The present invention also relates to methods of screening compounds for identifying those that bind to and activate the CGF receptor. Examples of this method are stimulating the proliferation of endothelial cells in the presence of the auxiliary comitogen Con A. Human umbilical vein endothelial cells are obtained and cultured in 96-well flat culture plates (Costar, Cambridge, MA) and supplemented with a reaction mixture suitable for promoting cell proliferation, wherein the mixture is Con A (Calbiochem). , La Jolla, CA). After adding Con-A and the compound to be screened and incubated at 37 ° C., the cultures are pulsed with [ ³ H] thymidine and harvested on a glass fiber filter (PhD; Cambridge Technology, Watertown, Mass.). Average [ ³ H] thymidine incorporation (cpm) of triplicate cultures is measured using a liquid scintillation counter (Beckman Instruments, Irvine, Calif.). Significant [ ³ H] thymidine incorporation indicates stimulation of endothelial cell proliferation.

To analyze for antagonist compounds, the above-mentioned assays are carried out, but in this assay, the ability of the compound to add CGF with the compound to be screened and to inhibit [ ³ H] thymidine incorporation in the presence of CGF is Indicates that the compound is an antagonist of CGF.

Alternatively, CGF antagonists can be detected by combining labeled CGF and potent antagonist compounds with membrane-bound CGF receptors or recombinant receptors under conditions suitable for competitive inhibition assays. Radiolabeling of CGF, for example, allows the number of CGF molecules bound to the receptor to determine the effectiveness of an effective antagonist.

Alternatively, the reaction of a known second messenger system may be followed by interaction of the potent antagonist with the receptor. Such second messenger systems include, but are not limited to, cAMP guanylate cyclase, ion channel or phosphonoinoside hydrolysis. The compound can be labeled to detect binding. Compounds that are bound but do not cause a second messenger response are effective antagonist compounds.

Examples of potent CGF antagonists include the polypeptide itself or an antibody that binds to a receptor for such polypeptide, or in some cases oligonucleotides. In addition, an effective antagonist may be a closely related protein, eg, a mutant form of CGF, that competitively inhibits the action of CGF by recognizing but not affecting the CGF receptor.

Another potent CGF antagonist is an antisense construct prepared using antisense technology. Antisense technology is used to regulate gene expression through triple-helix formation or to control gene expression via antisense DNA or RNA, all of which are based on binding polynucleotides to DNA or RNA. For example, antisense RNA oligonucleotides of about 10 to 40 base pairs in length are designed using the 5 'coding portion of a polynucleotide sequence that encodes a mature polypeptide of the invention. By designing DNA oligonucleotides to be complementary to gene regions involved in transcription [triple helix—see Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988); And Dervan et al., Science, 251: 1360 (1991), inhibiting transcription and production of CGF. Antisense RNA oligonucleotides hybridize with mRNA in vivo and block the mRNA molecule from being translated into CGF polypeptides [Antisense- Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). In addition, the above-mentioned oligonucleotides are delivered to cells so that antisense RNA or DNA can be expressed in vivo to inhibit the production of CGF.

Efficacy CGF antagonists include small molecules that bind the active site, receptor binding site, or other growth factor binding site of the polypeptide to block normal biological activity of CGF. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.

The antagonists can be used to antagonize CGF activity and / or to antagonize neovascular angiogenesis and endothelial proliferation of smooth muscle cells that proliferate in atherosclerosis and restenosis and thus in balloon angiogenesis. By inhibiting tumor growth directly or indirectly.

The antagonist may be used in the composition with a pharmaceutically acceptable carrier as mentioned below.

CGF polypeptides and antagonist compounds of the invention can be used in combination with suitable pharmaceutical carriers. Such compositions comprise a therapeutically effective amount of the polypeptide or antagonist compound of interest and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should be suitable for the dosage form.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the invention. The matter relating to the container may be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of a medicament or biological product, the notice being produced, used by the governmental agency for a product for human administration. Or the approval of the sale. In addition, the pharmaceutical compositions of the present invention can be used with other therapeutic compounds.

The pharmaceutical compositions can be administered by conventional methods, such as oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical composition is administered in an amount effective to treat and / or prevent specific symptoms. In general, it should be administered in an amount of at least about 10 μg / kg body weight per day and in most cases in an amount of no greater than about 8 mg / kg body weight per day. In most cases, the dosage is about 10 μg / kg body weight to about 1 mg / kg body weight per day, taking into account the route of administration, symptoms, and the like.

CGF can be used in conjunction with other growth factors, including PDGF, IGF, FGF, EGF or TGF-β, to accelerate the physiological response as shown in wound treatment.

CGF polypeptides, and agonists and antagonists that are polypeptides, may also be used in accordance with the present invention by expressing such polypeptides in vivo, which is often referred to as gene therapy.

Thus, for example, a patient's cells may be genetically engineered with a polynucleotide (DNA or RNA) that encodes the polypeptide in vitro, and then such genetically engineered cells may be provided to the patient to be treated with the polypeptide. Such methods are well known in the art. For example, cells can be manipulated by methods known in the art by using retroviral particles containing RNA encoding a polypeptide of the invention.

Similarly, it may be manipulated in vivo to express the polypeptide in vivo, for example by methods known in the art. As is known in the art, producer cells for preparing retroviral particles containing RNA encoding a polypeptide of the invention may be administered to a patient to manipulate the cells in vivo and to express the polypeptide in vivo. Can be. Methods and other methods for administering a polypeptide of the present invention by this procedure should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for manipulating the cell may be other than a retrovirus, for example, which may be used to manipulate the cell in vivo after combining the adenovirus with a suitable delivery vehicle.

Retroviruses from which the above-mentioned retroviral plasmid vectors can be derived include monkey murine leukemia virus, spleen necrosis virus, retroviruses such as Loose sarcoma virus, hobby sarcoma virus, avian leukemia virus, primary ape leukemia virus, human Immunodeficiency viruses, adenoviruses, myeloproliferative sarcoma viruses and mammalian tumor viruses. In one embodiment, the retroviral plasmid vector is derived from monkey murine leukemia virus.

Such vectors include one or more promoters. Suitable promoters that can be used include retroviral LTRs; SV40 promoter; And Miller et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), eukaryotic intracellular promoters, including but not limited to human cytomegalovirus (CMV), or other promoters (eg, histone, pol III, and β-actin promoters). Intracellular promoters), but is not limited thereto. Other viral promoters that can be used include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. Selection of suitable promoters will be apparent to those skilled in the art from the teachings herein.

Nucleic acid sequences encoding polypeptides of the invention are under the control of suitable promoters. Suitable promoters that can be used include adenovirus promoters such as adenovirus major late promoters; Heterologous promoters such as cytomegalovirus (CMV); Respiratory syncytial virus (RSV) promoter; Inducible promoters such as MMT promoter, metallothionein promoter; Heat shock promoter; Albumin promoter; ApoAI promoter; Human globin promoter; Viral thymidine kinase promoters such as the herpes simplex thymidine kinase promoter; Retroviral LTRs (including modified retroviral LTRs as mentioned above); β-actin promoter; And human growth hormone promoters. Such promoters may also be native promoters that regulate the genes encoding the polypeptide.

Retroviral plasmid vectors can be used to transduce packaging cell lines to form producer cell lines. Examples of packaging three that can be transfected include Miller, Human Gene Therapy, Vol. 1, p. 5-14 (1990)] PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E-86, GP + envAm12, and DNA cell lines, but are not limited to these. Such vectors can transduce packaging genes by any means known in the art. Such means include, but are not limited to, electrophoresis, the use of liposomes and CaPO ₄ precipitation. In another embodiment, the retroviral plasmid vector can be embedded into liposomes or coupled to a lipid and then administered to a host.

Producer cell lines produce infectious retroviral vector particles comprising nucleic acid sequence (s) encoding the polypeptide. Such retroviral particles can be used to transduce eukaryotic cells in vitro or in vivo. Such transduced eukaryotic cells will express nucleic acid sequence (s) encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, and hematopoietic stem cells, hematocites, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

The sequences of the invention are also useful for chromosomal identification. The sequence can be specifically targeted to and hybridized to a specific location on an individual human chromosome. Moreover, there is a need to identify specific sites on the current chromosome. Very few chromosome labeling reagents are currently available based on actual sequence data (repeat polymorphism) for marking chromosomal positions. Indicating the gene location of the DNA relative to the chromosome according to the invention (mapping) is an important first step in correlating these sequences with the genes associated with the disease.

Briefly, sequences can be mapped to chromosomes by making PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of the 3 'non-translated region is used to quickly select one or more exoned primers in genomic DNA to complicate the amplification process. The primers are then used for PCR screening of celiac cell hybrids containing individual human chromosomes. Only hybrids containing human genes corresponding to the primers can produce amplified fragments.

PCR mapping of celiac cell hybrids is a rapid method for distributing specific DNA to specific chromosomes. Using the same oligonucleotide primers in the present invention, sublocalization can be achieved in a similar manner using panels of fragments from pools of specific chromosomes or large genomic clones. Other mapping methods that can be similarly used to map to their chromosomes include hybridization in situ, prescreening and hybridization using labeled flow-classified chromosomes to construct chromosomal specific-cDNA libraries. There is a preliminary selection method.

The cDNA clones can be fluorescently hybridized (FISH) in situ with mid-term chromosomal diffusion cultures to provide the correct chromosome location in one step. This technique can use cDNAs as short as 50 or 60 bases. For a review of these techniques, reference may be made to Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available online via the Johns Hopkins University Welch Medical Library). Next, the relationship between the gene and the disease mapped to the same chromosomal region is identified through a binding analysis (physically adjacent cogenetics).

Next, it is necessary to determine the cDNA or genomic sequence differences between the infected and non-infected. If mutations are observed in some or all infected individuals but not in normal individuals, these mutations are probably the causative agent of the disease.

Using conventional physical mapping degradation and genetic mapping techniques, a cDNA correctly localized to the chromosomal region associated with the disease can be one of 50 to 500 potent causative genes (1 megabase) Mapping resolution and one gene per 20 kb).

The polypeptides, fragments or other derivatives thereof, homologs thereof, or cells expressing them can be used as immunogens to generate antibodies to them. These antibodies can be, for example, polyclonal or monoclonal antibodies. The invention also encompasses chimeric, single chain, and humanized antibodies as well as products of Fab fragments, or Fab expression libraries. Various methods known in the art can be used to prepare the antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by injecting the polypeptide directly into an animal or by administering the polypeptide to an animal, preferably a non-human animal. The antibody thus obtained will then be bound to the polypeptide itself. In this way, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind to a fully native polypeptide. The antibody can then be used to isolate the polypeptide from tissue expressing the polypeptide.

For the preparation of monoclonal antibodies, any technique that provides antibodies produced by continuous cell line culture can be used. Examples thereof include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B-cell hybridoma technology (Kozbor et al. , 1983, Immunology Today 4:72, and EBV-hybridoma technology for preparing human monoclonal antibodies (Cole, et al., 1985, Monoclonal Antibodies and Caner Therapy, Alan R. Liss, Inc.). , pp. 77-96].

Techniques described for the production of single chain antibodies [US Pat. No. 4,946,778] can be applied to prepare single chain antibodies against the immunogenic polypeptide products of the invention. In addition, transgenic mice can be used to express humanized antibodies against the immunogenic polypeptide products of the invention.

The invention will be further described with reference to the following examples; It should be appreciated that the present invention is not limited to these examples. Unless otherwise specified, all parts or amounts are by weight.

In order to facilitate understanding of the following examples, specific methods and / or terminologies are often described.

Plasmids are written first in lowercase p and / or in uppercase and / or numeric. Starting plasmids in the present invention are commercially available for open purchase under unrestricted conditions or can be constructed according to methods published from commercial plasmids. In addition, plasmids equivalent to those described herein are known in the art and will be apparent to those skilled in the art.

Digestion of DNA refers to catalytic cleavage of DNA with restriction enzymes that act only on specific sequences of DNA. Various restriction enzymes used in the present invention are commercially available and their reaction conditions, cofactors and other requirements are used as known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA is used with about 2 units of enzyme in about 20 μl of buffer. If DNA fragments are to be isolated for plasmid construction, typically 5-50 μg of DNA is digested into larger volumes using 20-250 units of enzyme. The amount of buffer and substrate suitable for the particular restriction enzyme is specified by the manufacturer. Incubation times of about 1 hour at 37 ° C. are conventionally used but may be varied as directed by the supplier. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to separate the desired fragments.

Size separation of the cleaved fragments is performed using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980).

Oligonucleotides refer to single-chain polydeoxynucleotides or two complementary polydeoxynucleotide chains that can be chemically synthesized. Such synthetic oligonucleotides do not have 5 'phosphate and thus are not linked to another oligonucleotide unless phosphate is added with ATP in the presence of a kinase. Synthetic oligonucleotides will be linked to fragments that are not dephosphorylated.

Ligation refers to a method of forming phosphodiester bonds between two double-stranded nucleic acid fragments. See Maniatis, T., et al., Id., P. 146]. Unless otherwise provided, ligation is carried out using well known buffers and conditions using approximately 10 equimolar amounts of 10 units of T4 DNA ligase (ligase) per 0.5 μg of DNA fragment to be linked.

Unless stated otherwise, transformation is carried out as described in Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1

Bacterial Expression and Purification of CGF

DNA sequences encoding CGF (ATCC # 97142) are initially amplified using PCR oligonucleotide primers corresponding to the 5 'sequence (-signal peptide sequence) of the processed CGF protein and the 3' vector sequence for the CGF gene. . Additional nucleotides corresponding to CGF are added to the 5 'and 3' sequences, respectively. The 5 'oligonucleotide primer has SEQ ID NO: 3 containing the CGF coding sequence starting from the BamHl restriction enzyme site (indicated in bold) followed by the estimated terminal amino acid of the processed protein codon (underlined).

5 'ACTCTTGGATCCAATTTGGGAAACAGCTATCAAAGA 3'

The 3 ′ oligonucleotide primer sequence 4 contains the XbaI restriction site (in bold) followed by the carboxy-terminal 5 amino acids and the reverse complement of the nucleotide corresponding to the translation stop codon (underlined).

5 'C TCTAGA CTATTATTTACAACATAGAAAATTAAAGGC 3'

The restriction enzyme site corresponds to the restriction enzyme site on bacterial expression vector pQE-9 (Source: Qiagen, Inc., Chatsworth, CA, 91311). pQE-9 encodes antibiotic resistance (Amp ^r ), bacterial replication origin (ori), IPTG-regulated promoter effector (P / O), ribosomal binding site (RBS), 6-His tag and restriction enzyme site. PQE-9 is then digested using Hind III and XbaI. The amplified sequence is linked to pQE-9 and inserted into the same frame using sequences encoding histidine tags and RBS. The desired recombinant may contain a CGF coding sequence inserted below from the histidine tag and the ribosomal binding site. Then, using the linking mixture, this method was described by Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). E. coli strain M15 / rep 4 (Source: Qiagen, Inc.) is transformed. M15 / rep 4 contains multiple copies of plasmid pREP4, which expresses the lacI inhibitor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 ug / ml) and Kan (25 ug / ml). O / N cultures are used to inoculate large cultures at a ratio of 1: 100 to 1: 250. The cells are grown to an optical density of 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. IPTG (isopropyl-BD-thiogalacto pyranoside) is then added to bring the final concentration to 1 mM. IPTG is induced by inactivating the lacI inhibitors, making it clear that P / O causes increased gene expression. The cells are grown for another 2.5 hours to allow for exponential growth culture. The cells are then harvested by centrifugation. CGF / 6-histidine-containing M15 [pREP4] cells are lysed in 6M GnHCl, 50 mM NaPO ₄ (pH 8) at pH 8. The melt is loaded onto a Nickel-chelate column and the co-current is collected. The column is washed with 6M GnHCl, 50 mM NaPO ₄ at pH 8.0, 6.0 and 5.0. CGF fusion protein (greater than 90% purity) is eluted at pH 2.0. To regenerate, pH 2.0 eluate is adjusted with 3 molar guanidine HCl, 100 mM sodium phosphate, 10 molar glutathione (reduced) and 2 molar glutathione (oxidized). After incubation for 12 hours in this solution, the protein is dialyzed with 10 molar sodium phosphate. To run the gel, the pellet is resuspended in SDS / NaOH and 2X SDS-PAGE load buffer and heat denatured and then electrophoresed on a 4-20% SDS-PAGE gel. This protein is visualized by Coomassie Brilliant Blue R-250 staining.

Example 2

Cloning and Expression of CGF Using the Baculovirus Expression System

DNA sequence encoding full length CGF protein (ATCC # 97142) is amplified using PCR primers containing 5 'BamHI and 3'XbaI. Such primer sequences are SEQ ID NOs: 5 and 6.

5 'ACTCTTGGATCCGCCATCATGACCTGGAGGCACCAT 3'

5 'TACAACTCTAGACTATTATTTACAACATAGAAAATTAAAGGC 3'

The BamHI-XbaI fragment contains a complete CGF coding region containing a secretion signal sequence. The fragment, designated F2, is separated from a 1% agarose gel using a commercially available kit (trade name: Geneclean, BIO 101 Inc., La Jolla, Ca.).

Vector pA2 is used for the expression of CGF proteins using the baculovirus expression system. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555]. This expression vector contains a potent polyhedrin promoter of Autographa californica nuclear polyhedrosis virus followed by a recognition site for restriction endonucleases BamHI and XbaI. The polyadenylation site of monkey virus (SV) 40 is used for efficient polyadenylation. For easy selection of recombinant viruses, E. coli. Beta-galactosidase from E. coli is inserted following the polyhedrin promoter in the same direction as the polyadenylation signal of the polyhedrin gene. Polyhedrin sequences can be flanked on both sides by viral sequences for cell-mediated homologous recombination of cotransfected wild-type viral DNA. Numerous other baculovirus vectors can be used in place of pA2, such as pRG1, pAc373, pVL941 and pAcIM1. Luckow, V.A. and Summers, M.D., Virology, 170: 31-39.

The pA2 plasmid is digested with restriction enzymes BamHI and XbaI and then dephosphorylated using methods known in the art using calf phosphatase. DNA is then isolated from 1% agarose gels using a commercial kit (Gengene, trade name: BIO 101 Inc., La Jolla, Ca.). This vector DNA is named V2.

The BamHI-XbaI cleaved fragment F2 and the dephosphorylated plasmid V2 are linked using T4 DNA ligase. Then, this. E. coli strain XL1 blue (Stratagene Cloning System, 11011 North Torrey Pines Road La Jolla, Ca. 92037) was transformed and bacteria contained in plasmids with CGF cDNA (pBac CGF) were identified using enzymes BamHI and XbaI. The sequence of such cloned fragments is confirmed by DNA sequencing.

5 μg of plasmid pBac CGF was subjected to lipofection method (Felgner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)], commercially available commercialized linearized baculovirus (BaculoGold ^™ baculovirus DNA, source: Pharmingen, San Diego, CA.) at 1.0 μg. Transfect.

1 μg of baculogold ^TM virus DNA and 5 μg of plasmid pBac CGF are mixed in sterile wells of microtiter plates containing 50 μl of serum-free Grace medium (Life Technologies Inc., Gaithersburg, MD). After adding 10 μl of lipofectin and 90 μl of Grace's medium, mix and incubate for 15 minutes at room temperature. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) inoculated in 35 mm tissue culture plates with serum free medium. The plate is shaken back and forth to mix the newly added solution. The plates are then incubated at 27 ° C. for 5 hours. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. The plate is placed in an incubator and incubated at 27 ° C. for 4 days.

After 4 days the supernatant is collected and plaque analysis is performed similar to that described by Summers and Smith. As a variant, an agarose gel with Blue Gal (Life Technologies Inc., Gaithersburg) is used to facilitate the separation of blue stained plaques. (Details of plaque analysis can be found on pages 9 to 10 of the User's Guide to Insect Cell Culture and Baculovirology, distributed by Life Technologies Inc., Gaithersburg).

Four days after a series of dilutions are performed, the virus is added to the cells and the blue stained plaques are picked out with an Eppendorf pipette tip. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace medium. The agar is removed by short centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells inoculated in 35 mm dishes. After 4 days the supernatant of the culture dish is collected and stored at 4 ° C.

Sf9 cells are grown in Grace medium supplemented with 10% heat-inactivated FBS. The cells are infected with recombinant baculovirus V-CGF at multiplicity of infection (MOI) 2. After 6 hours the medium is removed and replaced with SF900 II medium without methionine and cysteine [Life Technologies Inc., Gaithersburg]. After 42 hours ³⁵ S- methionine and ³⁵ S cysteine 5μCi 5μCi: it is a (source Amersham). The cells are further incubated for 16 hours before harvesting by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 3

Expression of Recombinant CGF in CHO Cells

Vector pN346 is used to express CGF protein. Plasmid pN346 is a derivative of plasmid pSV2-dhfr [ATCC Accession No. 37146]. Both plasmids contain the mouse dhfr gene under the control of the SV40 early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity transfected with these plasmids can be selected by growing the cells in a selective medium supplemented with chemotherapeutic methotrexate (alpha free MEM, Lift Technologies). Can be. Amplification of the DHFR gene in methotrexate (MTX) resistant cells is described by Alt, F.W., Kellems, R.M., Bertino, J.R., -and Schimke, R.T., 1978, J. Biol. Chem. 253: 1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys. Acta, 1097: 107-143, Page, M.J. and Sydenham, M. A. 1991, Biotechnology Vol. 9: 64-68. Cells grown with increasing concentrations of MTX show resistance to drugs by overproducing the target enzyme DHFR as a result of amplification of the DHFR gene. When the second gene is linked to the DHFR gene, it is usually coamplified and overexpressed. As a result, when the administration of methotrexate is stopped, the cell line contains the amplified gene integrated into the chromosome.

Plasmid pN346 is a gene of interest for the strong promoter of the long terminal repeat (LTR) of the Raus sarcoma virus (Cullen, et al., Molecular and Cellular Biology, March 1985, 438-447), and human cytomegalovirus (CMV). ) (See Boshart et al., Cell 41: 521-530, 1985) to express fragments isolated from the enhancers of immediate genes. The lower part of the promoter is the following single restriction enzyme cleavage site that allows integration of the genes: BamHI, PvuII and NruI. In addition to these cloning sites, the plasmid contains the translational stop codons in all three reading frames, followed by the polyadenylation site of the 3 'intron and the rat preproinsulin gene. Other high potency promoters, such as human β-actin promoters, early or late SV40 promoters, or long terminal repeats from other retroviruses such as HIV and HTLVI, may also be used for such expression. In order to polyadenylate mRNA, other signals may also be used, such as signals from human growth hormone or globin genes.

Stable cell lines carrying genes integrated into the chromosome can be selected during cotransfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use one or more selectable markers, such as G418 and methotrexate, at the start.

Plasmid pN346 is digested with restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphatase by methods known in the art. The vector is separated from 1% agarose gel.

DNA sequences encoding full length CGF proteins (ATCC # 97142) are amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene.

The 5 ′ primer contains SEQ ID NO: 7 and 6 nucleotides that mimic the efficient signal for initiation of translation in eukaryotic cells following the BamHI restriction enzyme site (indicated in bold). Kozak, M., J. Mol. Biol., 196: 947-950, 1987].

5 'ACTCTT GGATCCG CCATCATGACCTGGAGGCACCAT 3'

The remaining nucleotides correspond to six amino terminal amino acids including the translational initiation codon (underlined). The 3 'primer has 18 nucleotides having the sequence 8 and the reverse complement of the 3' CGF DNA starting from the PvuII restriction enzyme site and following the translation stop codon.

5 'TACAACCAGCTGCTATTATTTACAACATAG 3'

The PCR product is digested with BamHI-PuvII and purified on 1% agarose gel using a commercial kit (Gen Geneclean, BIO 101 Inc., La Jolla, Ca.). The fragment is then linked to plasmid pN346 digested with BamHI-PuvII and treated with phosphatase using T4 DNA ligase. Xl 1 Blue (Stratagene) Yi. E. coli is transformed and plated on LB, 50 μg / ml ampicillin plate. Colonies carrying the desired recombinants in the proper orientation are screened by PCR using a 5 'primer corresponding to the Raus sarcoma virus promoter and a 3' primer corresponding to the reverse complement of the CGF codon 73-79. The sequence of the cloned fragments is confirmed by DNA sequencing. Transfect CHO-dhfr-cells.

Chinese hamster ovary cells lacking the active DH FR enzyme are used for transfection. 5 μg of the expression plasmid pN346CGF is cotransfected with 0.5 μg of plasmid pSVneo using the Lipofectin method (Felgner et al., Supra). Plasmid pSVneo contains the gene neo from Tn5, which encodes an enzyme that confers resistance to a group of antibiotics, including a dominant selectivity marker, G418. The cells are seeded in alpha free MEM supplemented with 1 mg / ml G418. After 2 days, the cells are treated with trypsin and seeded in hybridoma cloning plates (Greiner, Germany) and incubated for 10-14 days. Monoclones are then treated with trypsin and then inoculated into 6-well Petri dishes with different concentrations of methotrexate (25, 50, 100, 200, 400 nm). The clones growing at the highest concentration of methotrexate are then transferred to new 6-well plates containing higher concentrations of methotrexate (500 nM, 1 μM, 2 μM, 5 μM). Repeat the same procedure until clones grow at a concentration of 100 μM.

Expression of the desired gene product is analyzed by Western blot analysis and SDS-PAGE.

Example 4

Expression through gene therapy

Skin biopsy yields fibroblasts from certain subjects. The resulting tissue is placed in tissue culture medium and separated into small pieces. This small piece is placed on the wet surface of the tissue culture flask, about 10 pieces are placed in each flask. The flask is inverted, tightly sealed and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted and the tissue pieces are fixed at the bottom of the flask and fresh medium (eg F12 medium of ham with 10% FBS, penicillin and streptomycin) is added. It is then incubated at 37 ° C. for about 1 week. At this time, fresh medium is added and replacement is continued every few days. After two more weeks of culture, a monolayer of fibroblasts appears. This monolayer is treated with trypsin and stretched into larger flasks.

PMV-7 (Kirschmeier, PT et al., DNA, 7: 219-25 (1988)) flanked by long terminal repeats of sarcoma virus in moroni rats was digested with EcoRI and HindIII and subsequently in calf intestine Treat with phosphatase. Linear vectors are fractionated on agarose gels and purified using glass beads.

CDNA encoding the polypeptides of the invention are amplified using PCR primers corresponding to the 5 'and 3' terminal sequences, respectively. The 5 'primer contains the EcoRI site and the 3' primer also contains the HindIII site. Molecular rat sarcoma virus linear contraction and equivalent amounts of amplified EcoRI and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for joining the two fragments. The ligation mixture is used to transform bacterial HB101 and plated onto kanamycin containing agar to determine whether the vector contains the gene of question in which it is properly inserted.

Ampotropic pA317 or GP + am12 packaging cells are grown in tissue culture to join densities in Dulbeckco modified Eagles medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. MSV vectors containing the genes are added to the medium and packaging cells are transduced with the vectors. The packaging cells then produce infectious viral particles containing the gene (packaging cells are referred to herein as producer cells).

Fresh medium is added to the transduced producer cells and the medium is harvested from 10 cm plates of serially joined producer cells. The spent medium containing the infectious viral particles is filtered through a microporous filter to remove isolated producer cells and the medium is used to infect fibroblasts. The medium is removed from the sub-fused plates of fibroblasts and quickly replaced with medium from producer cells. Remove this medium and replace with fresh medium. If the titer of the virus is high, virtually all fibroblasts will be infected and no selection is necessary. If the titer is extremely low, it is necessary to use retroviral vectors with selectable markers such as neo or his.

Gene treated fibroblasts are then grown alone or until confluence on cytodex 3 microcarrier beads and then injected into the host. Fibroblasts then produce protein products.

Many modifications and variations of the present invention are possible in light of the above teachings, and therefore, the invention may be practiced otherwise than as specifically described in the appended claims.

Sequence list

(1) General Information:

(Iii) Applicant: Meissner, etc.

(Ii) Name of the Invention: Human Cryptin Growth Factor

(Iii) number of sequences: 10

(Ⅳ) Letter address:

(A) Recipients: Karella, Byrne, Wein, Gilfilan, Stitch, Stewart Allstein (B) A: Becker Farm Road 6

(C) City: Roseland

(D) State: New Jersey

(E) Country: United States

(F) ZIP Code: 07068

(Iii) computer-readable:

(A) Media type: 3.5 inch diskette

(B) Computer: IBM PS / 2

(C) operating system: MS-DOS

(D) Software: WordPerfect 5.1

(Iii) Current application data:

(A) Application number:

(B) filing date: submitted together with the present application

(C) Classification:

(Iii) previous application data;

(A) Application number:

(B) filing date:

(Iii) Attorney / Agent Information:

(A) Statement: Ferraro Gregory D.

(B) registration number: 36,134

(C) Reference / litigation number: 325800-

(Iii) telecommunication information:

(A) Phone: 201-994-1700

(B) facsimile: 201-994-1744

(2) Information about SEQ ID NO: 1

(Iii) sequence characteristics

(A) Length: base pair

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: cDNA

(xi) SEQ ID NO: 1

(2) Information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: 205 amino acids

(B) Type: Amino Acid

(C) chain:

(D) mode: linear

(Ii) Molecular Type: Protein

(xi) SEQ ID NO: SEQ ID NO: 2

(2) information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: base pair

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(xi) SEQ ID NO: SEQ ID NO: 3

(2) information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: base pair

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(xi) SEQ ID NO: SEQ ID NO: 4

(2) information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: base pair

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(xi) SEQ ID NO: SEQ ID NO: 5

(2) Information about SEQ ID NO:

(Iii) sequence characteristics

(A) Length: base pair

(B) Type: nucleic acid

(C) chain: Japanese chain

(D) mode: linear

(Ii) Molecular Type: Oligonucleotide

(xi) SEQ ID NO: 6

Claims (20)

(a) a polynucleotide encoding a polypeptide comprising amino acids -23 to 207 as shown in FIG. 1; (b) a polynucleotide encoding a polypeptide comprising amino acids 1 to 207 shown in FIG. 1; (c) a polynucleotide encoding a polypeptide comprising amino acids 1 to 150 shown in FIG. 1; (d) a polynucleotide encoding a polypeptide comprising amino acids 45 to 150 shown in FIG. 1; (e) a polynucleotide capable of hybridizing with the polynucleotide of (a), (b), (c) or (d) and exhibiting at least 70% identity with the polypeptide; And (f) An isolated polynucleotide comprising a member selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b), (c), (d) or (e). The polynucleotide of claim 1 which is DNA. (a) a polynucleotide encoding a mature polypeptide encoded by DNA contained in ATCC Accession No. 97142; (b) a polynucleotide encoding a polypeptide expressed by the DNA contained in ATCC Accession No. 97142; (c) a polynucleotide capable of hybridizing with the polynucleotide of (a) or (b) and exhibiting at least 70% identity with said polynucleotide; And (d) An isolated polynucleotide comprising a member selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). The polynucleotide of claim 2 comprising a sequence from nucleotide 1 to nucleotide 771 as shown in FIG. 1. The polynucleotide of claim 2 comprising the sequences from nucleotide 62 to nucleotide 771 as shown in FIG. 1. The polynucleotide of claim 2 comprising a sequence from 151 nucleotides to 771 nucleotides shown in FIG. 1. The polynucleotide of claim 2 comprising a sequence from nucleotides 283 to 600 nucleotides shown in FIG. 1. A vector containing the DNA according to claim 2. A host cell genetically engineered using the vector according to claim 8. A method for producing a polypeptide comprising expressing a polypeptide encoded by DNA from a host cell according to claim 9. A method for producing a cell capable of expressing a polypeptide, comprising genetically manipulating the cell using the vector according to claim 8. (Iii) a polypeptide having the deduced amino acid sequence of FIG. 1, and fragments, homologs and derivatives thereof; And (ii) a polypeptide encoded by the cDNA of ATCC Accession No. 97142, and a member selected from the group consisting of fragments, homologs and derivatives thereof. A compound that activates a receptor for a polypeptide of claim 12. A compound that inhibits the polypeptide of claim 12. An antibody against the polypeptide of claim 12. Contacting a cell expressing a CGF receptor on a surface with a labeled CGF and a compound to be screened under conditions suitable for binding of the ligand to the receptor; And A method of identifying a compound that inhibits the activity of the polypeptide of claim 12 comprising determining the extent of binding of labeled CGF to the receptor by measuring the amount of label attached to the receptor. Contacting a cell expressing a CGF receptor on a surface with a compound to be screened under conditions suitable for binding of the ligand to the receptor; And A method of identifying a compound that inhibits the activity of the polypeptide of claim 12, including determining the degree of binding of the compound to the receptor and whether the signal generated by the binding is deficient. Contacting a cell expressing a CGF receptor on a surface with a compound to be screened under conditions suitable for binding of the ligand to the receptor; And A method for identifying a compound that activates a receptor for a polypeptide of claim 12, including determining the extent of binding of the compound to the receptor and the presence of a signal generated by the binding. A method of diagnosing a disease associated with or susceptibility to a mutation in a polynucleotide of claim 1, comprising determining a mutation in the polynucleotide of claim 1. A diagnostic method comprising analyzing the presence of a polypeptide according to claim 12 in a sample derived from a host.