KR100407087B1 - Human Vascular IBP-like Growth Factor - Google Patents

Abstract

The present invention describes human vascular IBP-like growth factor polypeptides (VIGF) and DNA (RNAs) encoding such polypeptides and methods of making such polypeptides by recombinant techniques. The present invention also describes methods of using the polypeptides to heal wounds or regenerate tissues, stimulate implant fixation and form blood vessels. The present invention also describes antagonists against the polypeptides and their use as therapeutic agents for treating atherosclerosis, tumors and scars. The present invention also describes diagnostic assays for identifying mutations in VIGF nucleic acid sequences and the level of modification of the VIGF polypeptide.

Description

Human Vascular IBP-Like Growth Factor

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and methods of making such polynucleotides and polypeptides. The present invention also relates to inhibition of the action of the polypeptide.

Polypeptides of the present invention are insulin-like growth factor binding proteins that modulate the activity of growth regulator families including insulin cef lO / cyr 61, connective tissue growth factor (CTGF) and nov and insulin-like growth factor (IGF). -like growth factor binding protein (IBP) family. Because mRNAs corresponding to polypeptides of the invention are highly expressed in vascular cell types, such polypeptides are described below as human vascular IBP-like growth factor or "VIGF".

Growth factors, and other fissions, including transgenic oncogenes, can quickly induce complex sets of genes to be expressed by specific cells. Lau, LF and Nathans, B., Molecular Aspects of Cellular Regulation, 6: 165-202 (1991). These genes, called immediate early reactive or early reactive genes, activate transcription within minutes of contact with growth factors or fissions, independent of newly initiated protein synthesis. These immediate reactive gene groups encode secreted extracellular proteins required for the cooperation of complex biological processes such as differentiation and proliferation, regeneration and wound healing. Ryseck, R.P. et al., Cell Growth Differ., 2: 235-233 (1991).

Considerably related proteins belonging to this group include cef 10 from chicks, which are detected after being induced by viral oncozin pp6Ov-SrC. Simmons, D.L. et al., PNAS, U.S.A., 86: 1178-1182 (1989). The closely related protein cyr 61 is rapidly activated by serum or platelet induced growth factor (PDGF). 0'Brien, T.P. et al., Mol. Cell Biol., 10: 3569-3577 (1990). Total amino acid identity between cef 10 and cyr 61 is as high as 83%. The third member is human connective tissue growth factor (CTGF). Bradham, D.M. et al., J. Cell. Biol., 114: 1285-1294 (1991). CTGF is a cysteine-rich peptide that is secreted at high concentration by human vascular endothelial cells after activation with transforming growth factor beta (TGF-β). CTGF exhibits PDGF-like biological and immunological activity and competes with PDGF for specific cell surface receptors.

The fourth member of the immediate reactive protein is fisp-12, which is induced by serum and mapped to genomic regions of rats. Ryseck, R.P. et al., Cell Growth Differ., 2: 235-233 (1991). Another member of the family is the chick gene nov, commonly found in adult kidney cells and found to be overexpressed in myeloblastosis-associated virus type 1 induced neoblastoma. In addition, the expression of the amino end-cut nov product in chick embryo fibroblasts is sufficient to induce transformation. See Joliot, V. et al., Mol. Cell. Biol., 12: 10-21 (1992).

Expression of these immediate reactive genes acts as a "third messenger" in the cascade of events caused by growth factors. In addition, these genes are believed to be necessary to integrate and coordinate complex biological processes, such as differentiation and wound healing, in which cell proliferation occurs as a common event.

This newly known family of growth regulators is CTGF; cef 10 / cyr 6l; And CCN series for nov. VIGF polypeptides of the invention are believed to be members of this family of growth regulators. Such VIGF polypeptides also contain continuous cysteines that are highly homologous to insulin-like growth factor (IGF) -binding proteins.

Two or more different binding proteins, IGF-binding protein 53 and IGF-binding protein 1, have been identified in adult serum. IGF-binding proteins have both stimulatory and inhibitory effects on IGF. See Clemmons, et al., J. Clin. Invest., 77: 1548 (1986), showed that IGF complexed with its binding protein to increase binding to fibroblasts and smooth muscle cell surface receptors. In vitro, the inhibitory effect of IGF-binding proteins on various IGF actions was observed. These inhibitory effects were observed by stimulation of glucose transport by adipocytes, stimulation of sulfate incorporation by chondrocytes and thymidine incorporation in fibroblasts. See Zapf et al., J. Clin. Invest., 63: 1077 (1979). In addition, the inhibitory effect of IGF-binding protein on growth factor mediated cleavage activity in normal cells was shown.

According to one aspect of the present invention, novel mature polypeptides, which are VIGF, and fragments, analogs and derivatives thereof are biologically active and diagnostically or therapeutically useful.

According to another aspect of the invention, human VIGF comprising mRNA, DNA, cDNA and genomic DNA and isolated nucleic acid molecules encoding fragments, analogs and derivatives thereof that are biologically active and diagnostically or therapeutically useful do.

According to another aspect of the invention, the polypeptide is by recombinant technology comprising culturing a recombinant prokaryotic and / or hint host cell containing a human VIGF nucleic acid sequence under conditions that facilitate expression and subsequent recovery of the protein. It provides a method of manufacturing.

According to another aspect of the invention, the polypeptide or polynucleotide encoding the polypeptide is treated for therapeutic purposes, eg, myelopathy disease, osteoporosis, aids implant fixation, stimulates wound healing or tissue regeneration. And methods for promoting angiogenesis and proliferating vascular smooth muscle and endothelial cell production.

According to a further aspect of the invention, an antibody against said polypeptide is provided.

According to another aspect of the invention, there is provided an antagonist to the polypeptide, which can be used to inhibit the action of the polypeptide, for example, during wound healing or to limit the production of excess connective tissue in the pulmonary artery fibers. .

According to another aspect of the present invention, a nucleic acid probe is also provided comprising a nucleic acid molecule of sufficient length to specifically hybridize with a VIGF sequence.

According to another aspect of the invention, diagnostic assays are provided for screening for diseases associated with underexpression and overexpression of VIGF polypeptides and assaying for mutations in nucleic acid sequences encoding such polypeptides.

All aspects of the invention must be apparent to those skilled in the art from the teachings herein.

The following drawings specifically illustrate the invention but are not intended to limit the scope of the invention as encompassed by the claims.

1 shows the cDNA and corresponding deduced amino acid sequence of the VIGF polypeptide. The initial 21 amino acids represent putative leader sequences and thus the mature polypeptide contains 163 amino acids. Standard single letter abbreviations are used for amino acids. Sequence analysis was performed using a 373 automated DNA sequence analyzer (Applied Biosystem, Inc.). The accuracy of sequence analysis is estimated to be greater than 97%.

2 shows amino acid sequence homology between VIGF and the remaining members of the CCN family

It is paid.

3 depicts SDS-polyacrylamide gels indicating the results of VIGF bacterial purification and electrophoresis.

FIG. 4 shows a gel showing Northern blot results performed on VIGF.

FIG. 5 depicts gels showing cell type analysis results of VIGF gene expression in the indicated various tissues. Lane 1 is umbilical venous endothelial cells, lane 2 is aortic smooth muscle cells and lane 3 is foreskin fibroblasts. 5A shows the results after 2 hours of exposure and FIG. 5B shows the results after 36 hours of exposure.

According to one aspect of the invention, an isolated polypeptide encoding the mature polypeptide having the deduced amino acid sequence of FIG. 1 or the cDNA of a clone deposited as ATCC Accession No. 75874 on August 25, 1994 Nucleic acid (polynucleotide) is provided.

Polynucleotides encoding polypeptides of the invention can be obtained from human umbilical vein and aortic endothelial cells, aortic smooth muscle cells and pulmonary aneurysms. Polynucleotides of the invention are found in cDNA libraries derived from human umbilical vein endothelial cells. It is structurally related to the IBP and CCN families. It contains an open reading frame that encodes a protein of 184 amino acid residues, the initial approximately 21 amino acids being putative leader sequences such that the mature protein contains 163 amino acids.

The name of VIGF as a hybrid member of both the CCN growth factor and the IBP family is based mainly on the conservation of amino acid sequences. VIGF is 94% identical to the IBP feature (GCGCCXXCAXXXXXXC) that is 40-45% similar across all polypeptides (12 of 18 total VIGF cysteines are conserved) and is perfectly conserved in all members of the CCN family. It can be seen that it is similar to the CCN series.

The VIGF polypeptide also has considerable similarity with the IBP family. Two adjacent regions, amino acids 51-65 (IBP characteristic) and amino acids 76-90, show at least 80% identity to the IBP family. These regions are contained within the putative IGF binding domain of IBP. Human tissue and cell type specific expression was determined by Northern blot analysis. 2.3-2.4 kb VIGF mRNA is localized in the lungs and kidneys of adults as shown using the procedure of Example 4. VIGF gene expression was not detected in the heart, brain, placenta, liver, skeletal muscle and pancreas. Cultured human umbilical vein endothelial cells and aortic smooth muscle cells are cell types that express high levels of VIGF mRNA, while foreskin fibroblasts are cell types that express extremely low levels. Taken together, these results suggest that VIGF is primarily of vascular origin.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA including cDNA, genomic DNA and synthetic DNA. Such DNA may be double stranded or single stranded, and in the case of the single stranded strand, may be an encoded or non-encrypted (anti-sense) strand. The coding sequence encoding the mature polypeptide is the same as the coding sequence shown in FIG. 1 or the coding sequence of the deposited clone, or as a result of the redundancy or degeneracy of the genetic code, the coding sequence is identical to the DNA or deposited cDNA of FIG. It can be a different coding sequence that encodes a polypeptide.

Polynucleotides encoding the mature polypeptide of FIG. 1 or the mature polypeptide encoded by the deposited cDNA may only be encoded by the coding sequence for the mature polypeptide; Additional coding sequences, such as coding sequences for mature polypeptides and leader or secretory sequences or proprotein sequences; Coding sequences for mature polypeptides (and any additional coding sequences) and non-coding sequences such as introns or non-coding sequences 5 'and / or 3' of coding sequences for mature polypeptides.

Thus, the term "polynucleotide encoding a polypeptide" encompasses not only polynucleotides comprising coding sequences for polypeptides, but also polynucleotides comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the above-mentioned polynucleotides encoding fragments, analogs and derivatives of the polypeptides having the inferred amino acid sequence of FIG. 1 or the polypeptides encoded by the cDNAs of deposited clones. Variants of such polynucleotides may be natural allelic variants of the polynucleotides or non-natural variants of the polynucleotides.

Thus, the present invention is directed to a polynucleotide encoding the same mature polypeptide as that shown in FIG. 1 or a cDNA of a deposited clone, as well as a polypeptide encoded by the cDNA of the polypeptide of FIG. 1 or a deposited clone. Variants of such polynucleotides encoding fragments, derivatives or analogs. Such nucleotide variants include deletion variants, substitutional variants and addition or insertion variants.

As noted above, the polynucleotide may have a coding sequence that is a natural allelic variant of the coding sequence shown in FIG. 1 or the coding sequence of the deposited clone. As is known in the art, allelic variants are alternative forms of polynucleotide sequences in which one or more nucleotides may be substituted, deleted or added without substantially modifying the function of the encoded polypeptide.

The invention also relates to a polynucleotide sequence in which the coding sequence for a mature polypeptide assists in the expression and secretion of a polypeptide from a host cell, eg, a leader sequence that acts as a secretory sequence that regulates the transport of the polypeptide from the host cell. Polynucleotides that can be fused in the same reading frame. A polypeptide having a leader sequence may be a preprotein and have a leader sequence that is cleaved by the host cell to form a mature form of the polypeptide. The polynucleotide may also encode a proprotein, which is a mature protein plus an additional 5 'amino acid residue. Mature proteins with prosequences are proproteins and are inactive forms of the protein. When the prosequence is cleaved, the active mature protein remains.

Thus, for example, the polynucleotide of the present invention can encode a mature protein, a protein having a pro sequence, or a protein having both a prosequence and a presequence (leader sequence).

The polynucleotide of the present invention may have a coding sequence fused within the same frame as the marker sequence to purify the polypeptide of the present invention. Such marker sequence may be a hexahistidine tag supplied by a pQE-9 vector, provided for purification of a mature polypeptide fused with the marker in the case of a bacterial host, or for example a COS-7 cell. If a mammalian host is used, it may be a hemagglutinin (HA) tag. HA tags correspond to epitopes derived from influenza hemagglutinin proteins (Wilson, I., et al., Cell, 37: 767 (1984)).

The present invention also relates to polynucleotides which hybridize with the above-mentioned sequences when at least 50%, preferably at least 70%, identity is present between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions with the above-mentioned polynucleotides. As used herein, the term "stringent conditions" means that hybridization occurs only when at least 95%, preferably at least 97%, identity between sequences exists. In a preferred embodiment the polynucleotide hybridizing with the above-mentioned polynucleotide encodes a polypeptide substantially retaining the same biological function or activity as the mature polypeptide encoded by the cDNA or deposited cDNA of FIG. 1.

The deposits referred to in the present invention are claimed under the Convention of the Budapest Treaty on the International Approval of Microbial Deposits in Patent Procedures. These deposits are merely to provide convenience to those skilled in the art, and the deposits are subject to 35 U.S.C. It is not an approval requirement to meet § 112 regulations. The sequence of the polynucleotide contained in the deposited material, and the amino acid sequence of the polypeptide encoded thereby, is adjusted in the event of a conflict with the sequence cited herein by reference and described herein. A license may be required to manufacture, use or sell the deposited material, no license is granted by this application.

The invention also relates to VIGF polypeptides having an inferred amino acid sequence of FIG. 1 or an amino acid sequence encoded by deposited cDNA, as well as fragments, analogs and derivatives of such polypeptides.

When referring to the polypeptide of FIG. 1 or a polypeptide encoded by a deposited cDNA, the terms “fragment”, “derivative” and “analog” substantially retain the same biological function or activity as the polypeptide. Means a polypeptide. Thus, analogs include proproteins that are activated by cleavage of the proprotein moiety to produce mature polypeptide with activity.

The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

Fragments, derivatives or analogs of the polypeptides of FIG. 1 or polypeptides encoded by deposited cDNA are (i) one or more amino acid residues substituted or unsubstituted with amino acid residues (preferably conserved amino acid residues) and so substituted. The amino acid residue may or may not be encoded by the genetic code, (ii) one or more amino acid residues comprise a substituent group, (iii) the mature polypeptide increases the half-life of another compound, eg, a polypeptide To be fused with a compound (eg, polyethylene glycol), or (iv) a leader or secretory sequence; Sequences used for purification of mature polypeptides; Or an additional amino acid, such as a proprotein sequence, may be fused with a mature polypeptide. One of ordinary skill in the art, from the teachings herein, may consider such fragments, derivatives and analogs to be within the scope of the present invention.

Polypeptides and polynucleotides of the invention are preferably provided in isolated form and are preferably purified homogeneously.

The term "isolated" means that the substance is removed from its original environment (eg, the natural environment if it is a natural substance). For example, natural polynucleotides or polypeptides present in living animals are not isolated, but identical polynucleotides or polypeptides are separated from some or all of the materials that coexist in the natural system. Such polynucleotides may be part of a vector and / or the polynucleotide or polypeptide may be part of a composition and may be separated when the vector or composition is not part of its natural environment.

The invention also relates to vectors comprising the polynucleotides of the invention, host cells genetically engineered using the vectors of the invention, and methods of making polypeptides of the invention by recombinant techniques.

Host cells are genetically engineered (transformation introduced, transformed or transfected) using vectors of the invention, which can be, for example, cloning vectors or expression vectors. Such vectors may be in the form of, for example, plasmids, viral particles, phages, and the like. The host cells engineered as described above can be cultured in a conventional nutrient medium modified to be suitable for activation of promoters, selection of transformants or amplification of VIGF genes. Culture conditions such as temperature, pH and the like have been used previously with the host cell selected for expression and will be apparent to those skilled in the art.

Polynucleotides of the invention can be used to prepare polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of various expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV4O; Bacterial plasmids; Phage DNA; Baculovirus; Yeast plasmids; Viral DNA such as vectors derived from the combination of plasmid and phage DNA, vaccinia, adenovirus, poultry pox virus and pseudorabies. However, any other vector can be used if it is replicable and viable in the host.

Appropriate DNA sequences can be inserted into the vector by a variety of methods. Generally, such DNA sequences are inserted into suitable restriction endonuclease sites by methods well known in the art. Such and other methods are considered to be within the scope of those skilled in the art.

DNA sequences in expression vectors are operably linked to appropriate expression control sequences (promoters) to direct mRNA synthesis. Representative examples of such promoters include the LTR or SV4O promoter, E. E. coli lac or trp, phage lambda PL promoters, and other promoters known to modulate gene expression in prokaryotic or eukaryotic cells or their viruses may be mentioned. The expression vector also contains a ribosomal binding site and transcription terminator for initiation of translation. The vector may comprise a sequence suitable for amplifying expression.

In addition, the expression vector is preferably dihydrofolate reductase or neomycin resistance, or E. coli for eukaryotic cell culture. It contains one or more selectable marker genes that provide phenotypic characteristics for the selection of transformed host cells, such as tetracycline or ampicillin resistance in E. coli.

A vector containing the appropriate DNA sequence as well as the appropriate promoter or regulatory sequence as mentioned above is used to transform the appropriate host so that the host can express the protein.

Representative examples of suitable hosts include: Coli. Bacterial cells such as Streptomyces, Salmonella typhimurium; Fungal cells such as yeast; Insectoid cells such as Drosophila S2 and Sf9; Animal cells such as CHO, COS or Bowes melanoma; Adenovirus; Plant cells and the like can be mentioned. Selection of suitable hosts is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also encompasses recombinant constructs comprising one or more of the sequences as broadly described above. Such constructs include vectors such as plasmids or viral vectors in which the sequences of the invention have been inserted in a forward or backward direction. In a preferred embodiment of this embodiment, the construct further comprises a regulatory sequence, for example comprising a promoter operably linked to the sequence. Many suitable vectors and promoters are known to those skilled in the art and are commercially available. The following vectors are provided by way of example. Bacterial: pQE7O, pQE6O, pQE-9 (source: Qiagen), pBS, pD1O, phagescript, psiXl74, pbluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Source: Stratagene): pTRC99a, pkk-3 , pDR54O, pRIT5 from Pharmacia. Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Source: Stratagene), pSVK3, pBPV, pMSG, pSVL (Source: Pharmacia). However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

The promoter region can be selected from any desired gene using a Chloramphenicol transferase (CAT) vector or other vector with a selectable marker.Two suitable vectors are PKK232-8 and SM7. Examples include lac I, lacZ, T3, T7, gpt, lambda P _R , P _L and trp Eukaryotic promoters include CMV immediate promoter, HSV thymidine kinase, early and late SV4O, LTRs from retroviruses, and mice Metallothionein-I. Selection of suitable vectors and promoters is well within the scope of techniques common in the art.

In a further aspect, the present invention relates to a host cell containing the above-mentioned construct. The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell. The introduction of the construct into host cells can be performed by calcium phosphate transfection, DEAE-dextran mediated transfection, or electroporation. Davis, L., Dibner, M., Battey, I., Basic Method in Molecular Biology, (1986)].

Constructs in host cells can be used in conventional manner to produce gene products encoded by recombinant sequences. Alternatively, the polypeptides of the invention can be made synthetically by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of a suitable promoter. Cell-free translation systems can also be used to make such proteins using RNA derived from the DNA constructs of the invention. Cloning and expression vectors suitable for use with prokaryotic and eukaryotic hosts are described in Sambrook. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y, (1989), incorporated herein by reference.

Transcription of the DNA encoding a polypeptide of the invention by higher eukaryotic cells is increased by inserting an enhancer sequence into the vector. Enhancers are typically cis-functional elements of DNA that are about 10 to 300 bp and act on the promoter to increase transcription. SV4O enhancers on the terminal side of the origin of replication bp 100 to 270, cytomegalovirus early promoter enhancers, polyoma enhancers on the terminal side of origin of replication, and adenovirus enhancers are included as examples.

In general, recombinant expression vectors include: origin of replication; Selective markers that allow transformation of host cells, for example E. Ampicillin resistance gene and S. coli S. cerevisiae TRP1 gene; And a promoter derived from a highly expressed gene that directs transcription of the underlying sequence. The promoter may be derived from an operon encoding a corresponding promoter such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock protein and the like. The heterologous structural sequence is assembled in an appropriate phase with translation initiation and termination sequences, and preferably with leader sequences that can direct the translated protein to be secreted into the cytoplasmic space or extracellular medium. Optionally, this heterologous structural sequence can encode a fusion protein comprising an N-terminal identification peptide that provides the desired properties, eg, stabilization or simplified purification of the expressed recombinant product.

Expression vectors useful for use in bacteria are constructed by inserting a structural DNA sequence encoding a protein of interest into an operative reading with a functional promoter, along with a suitable translational initiation and termination signal. The vector may comprise one or more phenotypic selectable markers and origins of replication and provide amplification in the host if necessary. Suitable prokaryotic host cells for transformation are E. coli. There are various species in E. coli, Bacillus subtilis, Salmonella typhimurium, and Pseudomanas, Streptomyces, and Staphylococcus, but other ones may be selected and used.

As a representative but non-limiting example, expression vectors useful for use in bacteria can include bacterial markers of origin and selectable markers derived from commercial plasmids comprising the genetic elements of the well-known cloning vector pBR322 (ATCC 37017). have. Such commercially available vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA). The pBR322 "backbone" fragment is combined with the appropriate promoter and the structural sequence to be expressed.

After transforming a suitable host strain and growing the host strain at a suitable cell density, the selected promoter is induced by a suitable method (eg temperature change or chemical induction) and the cells are cultured for an additional period of time.

Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extracts are retained for further purification.

Microbial cells used for the expression of proteins can be disrupted by conventional methods, including methods that are well known to those skilled in the art, such as freeze-thaw circulation, sonication, mechanical disruption, or the use of cell lysates. have.

In addition, various mammalian cell culture systems can be used to express recombinant proteins. Examples of mammalian expression systems include the COS-7 strain of monkey kidney fibroblasts described in Gluzman, Cell, 23: 175 (1981), and other cell lines capable of expressing a conformity vector, such as C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors include origins of replication, suitable promoters and enhancers, and essential ribosomal binding sites, polyadenylation sites, splice donor and receptor sites, transcription termination sequences, and 5 'flanking non-transcription sequences. DNA sequences derived from SV4O splices and polyadenylation sites can be used to obtain the required non-transcriptional genetic elements.

VIGF polypeptides in methods comprising ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography Can be recovered and purified from recombinant cell culture. Protein refolding steps can be used to complete the arrangement of mature proteins, if necessary. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

Polypeptides of the invention are naturally purified products or by recombinant techniques from chemical synthesis processes or from prokaryotic or eukaryotic cell hosts (eg, by bacterial, yeast, higher plant, insect and mammalian cells in culture). It may be a manufactured product. Depending on the host used in the recombinant preparation process, the polypeptides of the invention may or may not be glycosylated. Polypeptides of the invention may also comprise initial methionine amino acid residues.

The VIGF polypeptides of the invention can be used for wound healing and re-growth related treatment of tissues associated therewith (eg connective tissue, skin, bone, cartilage, muscle, lung or kidney).

VIGF polypeptides can also be used to stimulate the formation of blood vessels by promoting the growth of smooth muscle and endothelial cells. This increase in VIGF-mediated angiogenesis will be beneficial for ischemic tissue, and collateral vessel development of the heart following coronary stenosis.

VIGF polypeptides may be used during implant fixation to stimulate cell growth around the implant, thereby promoting attachment of the implant to the intended site. VIGF polypeptides can also be used to increase IGF stability in tissues or serum. It may also increase binding to the IGF receptor. Since IGF increases human bone marrow erythrocytes and granulocyte progenitor growth in vitro, VIGF polypeptides can also be used to stimulate erythropoiesis or granulocyte formation.

According to another aspect of the present invention, a test related to scientific research on DNA synthesis and construction of a DNA vector for the purpose of developing a therapeutic agent or diagnostic agent for treating a human disease or a polypeptide thereof encoding the polypeptide. Provided are methods of use as test reagents for in vitro purposes.

Fragments of the full-length VIGF gene can be used as hybridization probes for cDNA libraries to isolate full-length VIGF genes and to isolate other genes with sequences that have high similarity to the VIGF gene or that have similar biological activities. Probes of this type can be, for example, 20 to 2000 base pairs. However, it is preferred that the probe is 30 to 50 base pairs. The probes can be used to identify genomic clone (s) containing cDNA clones corresponding to full length transcripts and complete VIGF genes including regulatory and promoter regions, exons and introns. One example of the screen involves synthesizing oligonucleotide probes by separating the coding region of the VIGF gene by using known DNA sequences. Labeled oligonucleotides having sequences complementary to the gene sequences according to the invention are used to screen libraries of human cDNA, genomic DNA or mRNA to determine the members of the library to which the probe hybridizes.

The present invention provides a method for identifying a receptor for VIGF. Genes encoding such receptors can be identified by a number of methods known to those skilled in the art, for example ligand panning and FACS classification. Coligan, et al., Current Protocols in Immun ., 1 (2), Chapter 5, (1991)]. Preferably, the polyadenylation RNA is prepared from cells reactive for VIGF and the cDNA library generated from this RNA is split into pools and transfected COS cells or other cells that are not reactive to VIGF. Use cloning. Transfected cells grown on glass slides are exposed to labeled VIGF. VIGF can be labeled in a variety of ways, including iodide or incorporation of recognition sites for site specific protein kinases. After fixation and incubation, the slides are analyzed using autoradiographing. Positive pools are identified, sub-pools are prepared, and retransfected using repeated sub-pooling and rescreening methods to yield a single clone that finally encodes the putative receptor.

As another approach to receptor identification, labeled VIGF can be photoaffinityly linked to an extract preparation that expresses a cell membrane or receptor molecule. The crosslinked material is split by PAGE and exposed to X-ray film. Labeled complexes containing VIGF-receptors are cleaved, split into peptide fragments, and protein microsequences. Amino acid sequences obtained from microsequencing can be used to design a set of degenerate oligonucleotide probes for screening cDNA libraries to identify genes encoding putative receptors.

The present invention also relates to methods of screening compounds for mimicking VIGF (agonists) or identifying those which prevent the action of VIGF. Examples of the method take advantage of the ability of VIGF to stimulate proliferation of endothelial cells in the presence of coitogen Con A. Human umbilical vein endothelial cells are obtained and supplemented with a reaction mixture suitable for culturing in 96-well flat culture plates (Costar, Cambridge, MA) and promoting cell proliferation, wherein the mixture is Con-A (manufacturer: Calbiochem, La Jolla, CA). After adding Con-A and the compound to be screened and incubated at 37 ° C., the cultures are pulsed with [ ³ H] thymidine and harvested on a glass fiber filter (PhD; Cambridge Technology, Watertown, Mass.). Average [ ³ H] thymidine incorporation (cpm) of triplicate cultures is measured using a liquid scintillation counter (Beckman Instruments, Irvine, Calif.). Significant [ ³ H] thymidine incorporation indicates stimulation of endothelial cell proliferation.

To analyze for antagonists, the above-mentioned assay is performed, but in this assay, the compound's ability to add VIGF with the compound to be screened and to inhibit [ ³ H] thymidine incorporation in the presence of VIGF, It indicates that this is an antagonist of VIGF. Alternatively, VIGF antagonists can be detected by combining VIGF and potential antagonists with membrane-bound VIGF receptors or recombinant receptors under conditions suitable for competitive inhibition assays. VIGF can be radiolabeled, for example, so that the number of VIGF molecules bound to the receptor can determine the effectiveness of the potential antagonist.

In addition, mammalian cell or membrane preparations expressing the VIGF receptor are incubated with labeled VIGF in the presence of the compound. The ability of the compound to enhance or inhibit this interaction is then measured. Alternatively, VIGF, labeled IGF and potential compounds can be cultured under conditions in which VIGF naturally binds to IGF. The degree of this interaction can be measured to determine whether the compound is an effective antagonist or agonist.

Examples of potential VIGF antagonists include antibodies that bind the polypeptide, or in some cases oligonucleotides. Alternatively, the potential antagonist may be a mutant form of a closely related protein, such as VIGF, that competitively inhibits the action of VIGF by recognizing but not affecting the VIGF receptor.

Another potential VIGF antagonist is an antisense construct prepared using antisense technology. Antisense technology is used to regulate gene expression through triple-helix formation or to control gene expression via antisense DNA or RNA, all of which are based on binding polynucleotides to DNA or RNA. For example, antisense RNA oligonucleotides of about 10 to 40 base pairs in length are designed using the 5 'coding portion of a polynucleotide sequence that encodes a mature polypeptide of the invention. By designing DNA oligonucleotides to be complementary to gene regions involved in transcription [triple helix—see Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988): and Dervan et al., Science, 251: 1360 (1991), inhibit transcription and production of VIGF. Antisense RNA oligonucleotides hybridize with mRNA in vivo and block the mRNA molecule from being translated into VIGF polypeptides [Antisense- Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). In addition, the above-mentioned oligonucleotides are delivered to cells so that antisense RNA or DNA can be expressed in vivo to inhibit the production of VIGF.

Potential VIGF antagonists include small molecules that bind to the active site, receptor binding site, IGF or other growth factor binding site of the polypeptide and interfere with the normal bioactivity of VIGF. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.

The antagonist can be used to inhibit neoplastic angiogenesis and neovascular endothelial proliferation of smooth muscle cells that diffuse atherosclerosis and restenosis and consequent balloon angioplasty.

The antagonist can be used to inhibit the overproduction of scar tissue seen in keloids formed after surgery, fibrosis after myocardial infarction, or fibrotic lesions associated with pulmonary fibrosis. The antagonist may be used in the composition with a pharmaceutically acceptable carrier as mentioned below.

The VIGF polypeptides and antagonists or agonists of the invention can be used in combination with suitable pharmaceutical carriers. Such compositions comprise a therapeutically effective amount of the polypeptide of interest and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should be suitable for the dosage form.

The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. The matter relating to the container may be a notice in the form prescribed by a government agency regulating the manufacture, use or sale of a medicament or biological product, the notice being produced by the government agency for a product for human administration, Reflect approval of use or sale. In addition, the pharmaceutical compositions of the present invention can be used in combination with other therapeutic compounds.

The pharmaceutical compositions can be administered by conventional methods, such as oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical composition is administered in an amount effective to treat and / or prevent specific symptoms. In general, it should be administered in an amount of at least about 10 μg / kg body weight and in most cases at an amount not exceeding about 8 mg / kg body weight per day. In most cases, the dosage is about 10 μg / kg body weight to about 1 mg / kg body weight per day, taking into account the route of administration, symptoms, and the like.

VIGF can be used in combination with other growth factors, including but not limited to PDGF, IGF, FGF, EGF or TGF-β, to accelerate the physiological response as shown in wound treatment.

VIGF polypeptides, and agonists and antagonists that are polypeptides, may also be used in accordance with the present invention by expressing the polypeptide in vivo, which is often referred to as "gene therapy."

Thus, for example, a patient's cells may be genetically engineered with a polynucleotide (DNA or RNA) that encodes the polypeptide in vitro, and then such genetically engineered cells may be provided to the patient to be treated with the polypeptide. Such methods are well known in the art. For example, cells can be manipulated by methods known in the art by using retroviral particles containing RNA encoding a polypeptide of the invention.

Similarly, it may be manipulated in vivo to express the polypeptide in vivo, for example by methods known in the art. As is known in the art, producer cells for preparing retroviral particles containing RNA encoding a polypeptide of the invention may be administered to a patient to manipulate the cells in vivo and to express the polypeptide in vivo. Can be. Methods and other methods for administering a polypeptide of the present invention by this procedure should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for manipulating the cell may be other than a retrovirus, for example, which may be used to manipulate the cell in vivo after combining the adenovirus with a suitable delivery vehicle.

The present invention also relates to the use of the VIGF gene as a diagnostic agent. Detection of mutated VIGF forms enables the diagnosis of certain diseases, such as tumor diseases or whether they are susceptible to such tumors, since mutations in VIGF can cause tumors.

Individuals carrying mutations in the human VIGF gene can be detected at the DNA level by various techniques. Diagnostic nucleic acids can be obtained from cells of a patient, such as blood, urine, saliva, tissue biopsies and autopsy materials. Genomic DNA may be used directly for detection or may be enzymatically amplified using PCR (Saiki et al., Nature, 324: 163-166 (1986)) prior to analysis. RNA or cDNA can also be used for the same purpose. For example, PCR primers complementary to nucleic acids encoding VIGF can be used to identify and analyze VIGF mutations. For example, deletions and insertions can be detected by changes in amplified product size compared to normal genotypes. Point mutations can be identified by hybridizing amplified DNA with radiolabeled VIGF RNA or radiolabeled VIGF antisense DNA sequence. Perfectly matched sequences can be distinguished from improperly matched duplexes by RNase A digestion or melting point differences.

Genetic tests based on DNA sequence differences can be performed by detecting changes in the electrophoretic mobility of DNA fragments in the gel in the presence or absence of denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences can be discriminated on denatured formamidine gradient gels whose migration is retarded in the gel at different locations depending on their specific melting or partial melting points. See, Myers et al., Science, 230: 1242 ( 1985).

In addition, sequence changes at specific positions can be indicated by nuclease protection assays or chemical cleavage methods such as RNase and S1 protection (Cotton et al., PNAS, USA, 85: 4397-4401 (1985)). .

Thus, detection of specific DNA sequences can be accomplished by hybridization, RNase protection, chemical cleavage, direct DNA sequencing, or the use of restriction enzymes (eg, Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA. It can be achieved by such a method.

In addition to the more conventional gel-electrophoresis and DNA sequencing, mutations can be detected through in-situ analysis.

VIGF protein expression can be linked to vascular disease, or neovascular angiogenesis associated with tumor formation. VIGF has a signal peptide and mRNA is highly expressed in endothelial cells and to a lesser extent in smooth muscle cells, indicating that the protein is present in serum. Thus, anti-VIGF antibodies can be used to diagnose neovascular angiogenesis associated with vascular disease or tumor formation because the level of modification of these polypeptides can be an indication of the disease.

Competitive assay methods can be used, wherein an antibody specific for VIGF is attached to a solid support, a sample derived from labeled VIGF and a host is passed over the solid support, and the amount of label detected attached to the solid support detected in the sample. Correlated with the amount of VIGF.

The sequences of the invention are also useful for chromosome identification. The sequence can be specifically targeted to and hybridized to a specific location on an individual human chromosome. Moreover, there is a need to identify specific sites on the current chromosome. Chromosomal labeling reagents based on actual sequence data (repeat polymorphism) are currently hardly available for marking chromosomal positions. Indicating the gene location of the DNA relative to the chromosome according to the invention (mapping) is an important first step in correlating these sequences with genes associated with the disease.

Briefly, sequences can be mapped to chromosomes by making PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of 3 'non-translated regions is used to quickly select one or more exoned primers within genomic DNA, which complicates the amplification process. The primers are then used for PCR screening of somatic hybrids containing individual human chromosomes. Only hybrids containing human genes corresponding to the primers can produce amplified fragments.

PCR mapping of somatic cell hybrids is a rapid method for distributing specific DNA to specific chromosomes. Using the same oligonucleotide primers in the present invention, sub-localization can be achieved in a similar manner using panels of fragments from pools of specific chromosomes or large genomic clones. Other mapping methods that can be similarly used to map to their chromosomes include hybridization in situ, prescreening and hybridization using labeled flow-classified chromosomes to construct chromosomal specific-cDNA libraries. There is a preliminary selection method.

The cDNA clones can be fluorescently hybridized (FISH) in situ with the mid-term chromosomal spread to provide the correct chromosome location in one step. This technique can use cDNAs as short as 500 or 600 bases; However, clones of 2, OOObp and above have a high degree of ability to bind to unique chromosomal locations while exhibiting sufficient signal intensity for simple detection. FISH requires the use of clones to induce EST and the longer the better. For example, 2, OOObp is suitable, 4, OOObp is more suitable, and more than 4, OOObp is probably not necessary to obtain good results according to a suitable time ratio. For a review of these techniques, reference may be made to Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available online via the Johns Hopkins University Welch Medical Library). Next, the relationship between the gene and the disease mapped to the same chromosomal region is identified through a binding analysis (physically adjacent cogenetics).

Next, it is necessary to determine the cDNA or genomic sequence differences between the infected and non-infected. If mutations are observed in some or all infected individuals but not in normal individuals, these mutations are probably the causative agent of the disease.

With conventional physical mapping decomposition and genetic mapping techniques, a cDNA correctly localized to the chromosomal region associated with the disease can be one of 50 to 500 potential causative genes (this is a 1 megabase mapping) Resolution and one gene per 20 kb).

The polypeptides, fragments or other derivatives thereof, analogs thereof, or cells expressing them can be used as immunogens to generate antibodies to them. These antibodies can be, for example, polyclonal or monoclonal antibodies. The invention also encompasses the products of chimeric, single chain, and humanized antibodies as well as Fab fragments, or Fab expression libraries. Various methods known in the art can be used to prepare the antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by injecting the polypeptide directly into an animal or by administering the polypeptide to an animal, preferably a non-human animal. The antibody thus obtained will then be bound to the polypeptide itself. In this way, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind to a fully native polypeptide. The antibody can then be used to isolate the polypeptide from tissue expressing the polypeptide.

For the preparation of monoclonal antibodies, any technique that provides antibodies produced by continuous cell line culture can be used. Examples thereof include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B-cell hybridoma technology (Kozbor et al. , 1983, Immunology Today 4:72, and EBV-hybridoma technology for preparing human monoclonal antibodies (Cole, et al., 1985, Monoclonal Antibodies and Caner Therapy, Alan R. Liss, Inc.). , pp. 77-96].

Techniques described for the production of single chain antibodies [US Pat. No. 4,946,778] can be applied to prepare single chain antibodies against the immunogenic polypeptide products of the invention. In addition, transgenic mice can be used to express humanized antibodies to the immunogenic polypeptide products of the invention.

The invention will be further described with reference to the following examples: It should be appreciated that the invention is not limited to these examples. Unless otherwise specified, all parts or amounts are by weight.

In order to facilitate understanding of the following examples, specific methods and / or terminologies are often described.

"Plasmids" are written first in lowercase p and / or in uppercase and / or numerals. Starting plasmids in the present invention are commercially available for open purchase under unrestricted conditions or can be constructed according to methods published from commercial plasmids. In addition, plasmids equivalent to those described herein are known in the art and will be apparent to those skilled in the art.

"Digestion" of DNA refers to catalytic cleavage of DNA with restriction enzymes that act only on specific sequences of DNA. Various restriction enzymes used in the present invention are commercially available and their reaction conditions, cofactors and other requirements are used as known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer. If DNA fragments are to be isolated for plasmid construction, typically 5 to 50 micrograms of DNA are digested into larger volumes using 20 to 250 units of enzyme. The amount of buffer and substrate suitable for the particular restriction enzyme is specified by the manufacturer. Incubation times of about 1 hour at 37 ° C. are conventionally used but may be varied as directed by the supplier. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel to separate the desired fragments.

Size separation of the cleaved fragments is carried out using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057.

"Oligonucleotide" refers to single-chain polydeoxynucleotides or two complementary polydeoxynucleotide chains that can be chemically synthesized. Such synthetic oligonucleotides do not have 5 'phosphate and thus are not linked to another oligonucleotide unless phosphate is added with ATP in the presence of a kinase. Synthetic oligonucleotides will be linked to fragments that are not dephosphorylated.

"Ligation" refers to a method of forming a phosphodiester bond between two double-stranded nucleic acid fragments. See Maniatis, T., et al., Id., P. 146]. Unless otherwise provided, the ligation is carried out using well known buffers and conditions using about 10 equimolar amounts of 10 units of T4 DNA ligase (“ligase”) per 0.5 μg of DNA fragment to be linked.

Unless stated otherwise, transformation is performed as described in Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1

Bacterial Expression and Purification of VIGF

DNA sequences encoding VIGF (ATCC # 75874) are initially amplified using PCR oligonucleotide primers corresponding to the 5 'sequence of the processed VIGF protein (except the signal peptide sequence) and the 3' vector sequence for the VIGF gene. . Additional nucleotides corresponding to VIGF are added to the 5 'and 3' sequences, respectively. The 5 'oligonucleotide primer contains the sequence 5' CGCAAGCTTAAATTATGCGGTGGACTGC 3 'containing 21 nucleotides of the VIGF coding sequence starting from the Hind III restriction enzyme site (in bold) followed by the estimated terminal amino acid of the processed protein codon (underlined). Have 3 ′ Oligonucleotide Primer 5 ′ CGCTCTAGATCAGCGTGGATTTAACCA 3 ′ contains the Xba I restriction site (in bold) followed by the carboxy-terminal 5 amino acids and the reverse complement of the nucleotide corresponding to the translation stop codon (underlined). The restriction enzyme site corresponds to the restriction enzyme site on bacterial expression vector pQE-9 (Qiagen, Inc., Chatsworth, CA). pQE-9 encodes antibiotic resistance (Ampr), bacterial origin of replication (ori), IPTG-regulated promoter effector (P / O), ribosomal binding site (RBS), 6-His tag and restriction enzyme site. The VIGF PCR product and pQE-9 are then digested using Hind III and XbaI and then linked together using T4 DNA ligase. The desired recombinant may contain a VIQ coding sequence inserted below from the pQE-9 encoded histidine tag and the ribosomal binding site. Then, using the linking mixture, this method was described by Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). E. coli strain M15 [pREP4] (Source: Qiagen, Inc.) is transformed. M15 [pREP4] contains multiple copies of plasmid pREP4, which expresses the lacI inhibitor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 ug / ml) and Kan (25 ug / ml). O / N cultures are used to inoculate large cultures at a ratio of 1: 100 to 1: 250. The cells are grown to a light density of 600 (0.D ⁶⁰⁰ ) of 0.4 to 0.6. Then IPTG (“isopropyl-BD-thiogalacto pyranoside”) is added to bring the final concentration to 1 mM. IPTG is induced by inactivating the lacI inhibitors, making it clear that P / O causes increased gene expression. The cells are further grown 3 to 4 hours to allow for exponential growth culture. The cells are then harvested by centrifugation. VIGF / 6-histidine-containing M15 [pREP4] cells are lysed in 6M GnHCl, 50 mM NaPO ₄ at pH 8. The melt is loaded onto a Nickel-chelate column and the co-current is collected. The column is washed with 6M GnHCl, 50 mM NaPO ₄ at pH 8.0, 6.0 and 5.0. VIGF fusion protein (greater than 90% purity) is eluted at pH 2.0. Sample from pre-column melt (FIG. 3, lane 2), column co-current (lane 3), pH 5.0 wash (lane 4) and pH 2.0 eluate (lane 5) with sodium deoxycholate and trichloroacetic acid Precipitate. To regenerate, pH 2.0 eluate is adjusted with 3 molar guanidine HCl, 100 mM sodium phosphate, 10 molar glutathione (reduced) and 2 molar glutathione (oxidized). After incubation for 12 hours in this solution, the protein is dialyzed with 10 mmol sodium phosphate. To run the gel, the pellet is resuspended in SDS / NaOH and SDS-PAGE load buffer and thermally denatured and then electrophoresed on a 15% modified polyacrylamide gel. Gibco BRL low molecular weight standards are also electrophoresed (lane 1). This protein is visualized by Coomassie Brilliant Blue R-250 staining. 3 shows an SDS-polyacrylamide gel showing VIGF purification results.

Example 2

Cloning and Expression of VIGF Using the Baculovirus Expression System

DNA sequence encoding full length VIGF protein (ATCC # 75874) is digested with restriction enzymes PvuII and XbaI. The 639 nucleotides PvuII, XbaI fragment contain 11 and 77 nucleotides of the entire VIGF coding region and 5 'and 3' non-translated DNA, respectively. The fragment, designated F2, is separated from a 1% agarose gel using a commercial kit (trade name: "Geneclean", source: BIO 101 Inc., La Jolla, Ca.).

Vector pA2 is used for the expression of VIGF protein using the baculovirus expression system. Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555]. This expression vector contains a potent polyhedrin promoter of Autographa californica nuclear polyhidrosis virus (AcMNPV) followed by a recognition site for restriction endonucleases SmaI and XbaI. The polyadenylation site of monkey virus (SV) 40 is used for efficient polyadenylation. For easy selection of recombinant viruses, E. coli. Beta-galactosidase from E. coli is inserted following the polyhedrin promoter in the same direction as the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked by viral sequences for cell-mediated homologous recombination of cotransfected wild type viral DNA. Numerous other baculovirus vectors can be used in place of pA2, such as pRG1, pAc373, pVL941 and pAcIM1. Luckow, V.A. and Summers, M.D., Virology, 170: 31-39.

Plasmids are digested with restriction enzymes SmaI and XbaI and then dephosphorylated using methods known in the art using calf phosphatase. DNA is then isolated from 1% agarose gel using a commercial kit (trade name: "Geneclean", source: BIO 101 Inc., La Jolla, Ca.). This vector DNA is named V2.

Fragment F2 and dephosphorylated plasmid V2 are linked using T4 DNA ligase. Then, this. E. coli strain XL1 blue (Stratagene Cloning System, 11011 North Torrey Pines Road La Jolla, Ca. 92O37) was transformed and bacteria containing plasmids with VIGF cDNA (pBac VIGF) were identified using enzymes BamHI and XbaI. The sequence of such cloned fragments is confirmed by DNA sequencing.

50 μg of the plasmid pBac VIGF was subjected to lipofection method (Felgner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)], commercialized linearized baculovirus (trade name: “BaculoGold ^™ baculovirus DNA”, source: Pharmingen, San Diego, CA.) 1.0 μg Co-transfect with.

1 μg of baculogold ^™ virus DNA and 5 μg of plasmid pBac VIGF are mixed in sterile wells of microtiter plates containing 50 μl of serum free Grace medium (Life Technologies Inc., Gaithersburg, MD). After adding 10 μl of lipofectin and 9 μl of Grace's medium, mix and incubate for 15 minutes at room temperature. The transfection mixture is then added dropwise with 1 ml of serum free medium to Sf9 insect cells (ATCC CRL 1711) inoculated in a 35 mm tissue culture plate. The plate is shaken back and forth to mix the newly added solution. The plates are then incubated at 27 ° C. for 5 hours. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. The plate is placed in an incubator and incubated at 27 ° C. for 4 days.

After 4 days the supernatant is collected and plaque analysis is performed similar to that described by Summers and Smith. As a variant, agarose gels are used that include "Blue Gal" (Life Technologies Inc., Gaithersburg) to facilitate separation of blue stained plaques. (Detailed descriptions of “plaque assays” can be found on page 9-10 of the User's Guide to Insect Cell Culture and Baculovirology, distributed by the supplier, Life Technologies Inc., Gaithersburg).

Four days after a series of dilutions are performed, the virus is added to the cells and the blue stained plaques are picked out with an Eppendorf pipette tip. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace medium. The agar is removed by short centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells inoculated in 35 mm dishes. After 4 days the supernatant of the culture dish is collected and stored at 4 ° C.

Sf9 cells are grown in Grace medium supplemented with 10% heat-inactivated FBS. The cells are infected with recombinant baculovirus V-VIGF at multiplicity of infection (MOI) 2. After 6 hours the medium is removed and replaced with SF9OO II medium without the methionine and cysteine [Life Technologies Inc., Gaithersburg]. After 42 hours ³⁵ S- methionine and ³⁵ S cysteine 5μCi 5μCi: it is a (source Amersham). The cells are further incubated for 16 hours before harvesting by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 3

Expression of Recombinant VIGF in CHO Cells

Vector pN346 is used to express VIGF protein. Plasmid pN346 is a derivative of plasmid pSV2-dhfr [ATCC Accession No. 37146]. Both plasmids contain the mouse dhfr gene under the control of the SV4O early promoter. Chinese hamster ovary cells or other cells lacking dihydrofolate activity transfected with these plasmids can be selected by growing in a selective medium supplemented with chemotherapeutic methotrexate (alpha free MEM, Lift Technologies). Amplification of the DHFR gene in methotrexate (MTX) resistant cells is described by Alt, F.W., Kellems, R.M., Bertino, J.R., -and Schimke, R.T., 1978, J. Biol. Chem. 253: 1357-1370, Hamlin, J.L. and Ma. C. 1990, Biochem, et Biphys, Acta, 1097: 107-143, Page, M.J. and Sydenham, M. A. 1991, Biotechnology Vol. 9: 64-68. Cells grown at increasing concentrations of MTX show resistance to the drug by overproducing the target enzyme DHFR as a result of amplification of the DHFR gene. When the second gene is linked to the DHFR gene, it is usually co-amplified and overexpressed. As a result, when the administration of methotrexate is stopped, the cell line contains the amplified gene integrated into the chromosome.

Plasmid pN346 is a potent promoter of the long terminal repeat (LTR) of the Raus sarcoma virus (Cullen, et al., Molecular and Cellular Biology, March 1985, 438-447) and human cytomegalovirus for expression of the gene of interest. (CMV) (Boshart et al., Cell 41: 521-530, 1985) contain fragments isolated from enhancers of immediate genes. The bottom of the promoter is the following single restriction enzyme cleavage site that allows integration of the genes: BamHI, Pvull and Nrul. In addition to these cloning sites, the plasmid contains the translation stop codon followed by the polyadenylation site of the 3 'intron and rat preproinsulin genes in all three reading frames. Other high potency promoters, such as human β-actin promoters, early or late SV4O promoters, or long terminal repeats from other retroviruses such as HIV and HTLVI, may also be used for such expression. In order to polyadenylate mRNA, other signals may also be used, such as signals from human growth hormone or globin genes.

Stable cell lines carrying the gene of interest integrated into the chromosome can be selected by cotransfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use one or more selectable markers, such as G418 and methotrexate, at the start.

Plasmid pN346 is digested with restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphatase by methods known in the art. The vector is separated from 1% agarose gel.

DNA sequences encoding full length VIGF protein (ATCC # 75874) are amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene.

The 5 'primer has the sequence 5' CGCAGATCTCCGCCACCATGAAGAGCGTCTTGCTGCTG 3 'and contains 8 nucleotides similar to the BglII restriction enzyme site (indicated in bold) followed by an efficient signal for initiation of translation in prokaryotic cells. Kozak, M., J. Mol . Biol., 196: 947-950, 1987]. The remaining nucleotides correspond to seven amino terminal amino acids including the translational initiation codon (underlined). The 3 'primer has the sequence 5' CGCAGATCTAGCCTTCTCTCACAAATCACA 3 'and contains 21 nucleotides which are the reverse complement of the 3' untranslated DNA starting from the lower 7 nucleotides from the translation stop codon following the BglII restriction enzyme site (indicated in bold). . PCR products are digested with BglII and purified on 1% agarose gel using a commercial kit (trade name: “Geneclean”, BIO 101 Inc., La Jolla, Ca.). The fragment is then linked to plasmid pN346 digested with BamHI and treated with phosphatase using T4 DNA ligase. Xl 1 Blue (Stratagene) Yi. E. coli is transformed and plated on LB, 50 μg / ml empicillin plate. Colonies carrying the desired recombinants in the proper orientation are selected by PCR using a 5 'primer corresponding to the Raus sarcoma virus promoter and a 3' primer corresponding to the reverse complement of VIGF codons 73-79. The sequence of the cloned fragments is confirmed by DNA sequencing.

Transfection of CHO-dhfr-Cells

Chinese hamster ovary cells lacking the active DHFR enzyme are used for transfection. 5 μg of the expression plasmid pN346VIGF is cotransfected with 0.5 μg of plasmid pSVneo using the lipofectin method (Felgner et al., Supral). Plasmid pSVneo contains the gene neo from Tn5, which encodes an enzyme that confers resistance to a group of antibiotics, including G418, a dominant selectivity marker. The cells are seeded in alpha free MEM supplemented with 1 mg / ml G418. After 2 days, the cells are treated with trypsin and seeded in hybridoma cloning plates (Greiner, Germany) and incubated for 10-14 days. The monoclones are then treated with trypsin and then inoculated into 6-well Petri dishes with different concentrations of methotrexate (25, 50, 100, 200, 400 nm). The clones that grow at the highest concentration of methotrexate are then transferred to new 6-well plates containing higher concentrations of methotrexate (5OOnM, 1μM, 2μM, 5μM). Repeat the same procedure until the clones grow at a concentration of 100 uM.

Expression of the desired gene product is analyzed by Western blot analysis and SDS-PAGE.

Example 4

Tissue Localization of VIGF Gene Expression by Northern Blot Analysis

Inject multiple tissue Northern blot (Clontech Laboratories, Inc., 4030 Fabian Way: Palo Alto, California 943O3) containing 2 μg of adult brain, heart, placenta, lung, liver, skeletal muscle, kidney and pancreatic poly A + mRNA per lane ( Church) buffer [Church, GM & Gilbert, W., Proc. Natl. Acad. Sci. USA 81, 1991-1995, 1984; prehybridized at 60 ° C. for 1 hour. DNA sequence encoding VIGF (ATCC # 75874) is amplified from full-length cDNA cloned in pBluescript SK (-) using Ml3 forward primer (5 'GGGTTTTCCCAGTCACGAC 3') and reverse primer (5 'ATGCTTCCGGCTCGTATG 3'). 25 ng of PCR product was random primers radiolabeled with ³² P-dCTP [Prime-It II, Stratagene Cloning Systems, 11O11 North Torrey Pines Rd .; La Jolla, California 92O37. Heat denatured VIGF probe is added directly to the prehybridization buffer and incubated at 60 ° C. for 16 hours. Wash at 60 ° C. for 20 min with 0.2 × SSC, 0.1% SDS. Autoradiography is performed at -80 ° C.

After 4 days of exposure, 2.3 kb transcript was found in lung and kidney (FIG. 4).

Example 5

Cell-type analysis of VIGF gene expression by Northern blot analysis

Human umbilical cord endothelial cells, aortic smooth muscle, and foreskin fibroblasts (Clonetics, 9620 Chesapeke Drive, Suite # 201; San Diego, Calif. 92l23) are grown to be 75-90% confluency. Total RNA is extracted with RNAzol (BiotecxLaboratories, Inc., 6023 South Loop Rast Houston, Texas 77O33). According to Sambrook et al., 1989, 1.2% agarose formaldehyde gels were prepared and total RNA 20 g and RNA ladder size markers per lane (Life Technologies, Inc., 8400 Helgerman Ct., P. 0. Box 6009 Gaithersburg, Maryland 2O884). Transfer this RNA to Hybond N + (Amersham Corp., 2636 South Clearbrook Drive; Arlington Heights, Illinois 6OOO5) overnight and use a Stratalinker UV Crosslinker (Stratagene Cloning Systems, La Jolla, California) To This blot is prehybridized at 60 ° C. for 1 hour in ingestion buffer (Church, GM & Gilbert, W., PNAS USA 81, 1991-1995, 1984). DNA sequence encoding VIGF (ATCC # 75874) is amplified from full-length cDNA cloned in pBluescript SK (-) using M13 forward primer (5 'GGGTTTTCCCAGTCACGAC 3') and reverse primer (5 'ATGCTTCCGGCTCGTATG 3'). 25 ng of PCR product is a random primer [Prime-It II, Stratagene] radiolabeled with ³² P-dCTP. Heat denatured VIGF probe is added directly to the prehybridization buffer and incubated at 60 ° C. for 16 hours. Wash at 60 ° C. for 20 min in 0.2 × SSC, 0.1% SDS. Autoradiography is performed at -80 ° C. 2.3-2.4 kb transcript was found in umbilical artery endothelial cells (lane 1) and aortic smooth muscle (lane 2) after 2 hours of exposure (FIG. 5A) and also in foreskin fibroblasts (lane 3) after 36 hours of exposure ( 5B).

Many modifications and variations of the present invention are possible in light of the above teachings, and therefore, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.

Claims (44)

(a) a nucleotide sequence encoding a mature polypeptide encoded by a human cDNA contained in ATCC Accession No. 75874; (b) a nucleotide sequence encoding a full length polypeptide encoded by a human cDNA contained in ATCC Accession No. 75874; (c) a nucleotide sequence encoding amino acid residues 1 to 184 of SEQ ID NO: 2; (d) a nucleotide sequence encoding amino acid residues 22 to 184 of SEQ ID NO: 2; (e) a nucleotide sequence encoding amino acid residues 51 to 64 of SEQ ID NO: 2; (f) a nucleotide sequence encoding amino acid residues 76 to 90 of SEQ ID NO: 2; and (j) An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of nucleotide sequences complementary to any one of (a) to (f). The isolated polynucleotide of claim 1, wherein the nucleotide sequence encodes a mature polypeptide encoded by human cDNA included in ATCC Accession No. 75874. The isolated polynucleotide of claim 1, wherein the nucleotide sequence encodes a full length polypeptide encoded by human cDNA included in ATCC Accession No. 75874. The isolated polynucleotide of claim 1, wherein the nucleotide sequence encodes amino acid residues 1 to 184 of SEQ ID NO: 2. The isolated polynucleotide of claim 1, wherein the nucleotide sequence encodes amino acid residues 22 to 184 of SEQ ID NO: 2. The isolated polynucleotide of claim 1, wherein the nucleotide sequence encodes amino acid residues 51-64 of SEQ ID NO: 2. The isolated polynucleotide of claim 1, wherein the nucleotide sequence encodes amino acid residues 76 to 90 of SEQ ID NO: 2, An isolated polynucleotide comprising the nucleotide sequence set forth as SEQ ID NO: 1. An isolated polynucleotide comprising a nucleotide sequence identical to the coding nucleotide sequence of human cDNA contained in ATCC Accession No. 75874. An isolated polynucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of the isolated polynucleotide according to claim 2. An isolated polynucleotide comprising a nucleotide sequence complementary to the nucleotide sequence of the isolated polynucleotide according to claim 3. The isolated polynucleotide of any one of claims 1 to 7 and 8 to 11 comprising DNA. The isolated polynucleotide of claim 12, wherein the DNA is genomic DAN. A vector comprising an isolated polynucleotide according to any one of claims 1 to 7 and 8 to 11. With bacterial cells, fungal cells, insect cells, animal cells and plant cells transformed or transfected with the polynucleotide according to any one of claims 1 to 7 and 8 to 11 or the vector of claim 14. A host cell selected from the group consisting of: The isolated polynucleotide of any one of claims 1 to 7 and 8 to 11, wherein said isolated polynucleotide is operably linked with a heterologous regulatory sequence that regulates gene expression. Stimulating cell proliferation, including hybridizing with nucleic acid at least 30 contiguous nucleotides derived from SEQ ID NO: 1 under stringent hybridization conditions and under conditions sufficient for hybridization to occur. A method of identifying a polynucleotide encoding a polypeptide that can be. At least 30 contiguous nucleotides derived from human cDNA included in ATCC Accession No. 75874 under strict hybridization conditions and under conditions sufficient for hybridization to occur, followed by detection of said hybridization. A method of identifying a polynucleotide encoding a polypeptide that can stimulate cell proliferation. A method of producing a polypeptide comprising culturing or growing the host cell of claim 15 for a period of time and under conditions sufficient for expression of the polypeptide encoded by the polynucleotide introduced into the cell to occur. A method of producing a cell capable of expressing a polypeptide capable of stimulating proliferation of a cell, comprising transforming or transfecting the cell with the vector of claim 14. A recombinant polypeptide capable of stimulating cell proliferation when produced by the method of claim 19. (a) the amino acid sequence of the full length VIGF polypeptide encoded by human cDNA included in ATCC Accession No. # 75874; (b) the amino acid sequence of the mature VIGF polypeptide encoded by human cDNA included in ATCC Accession No. 75874; (c) an amino acid sequence comprising the amino acid residues 1 to 184 of SEQ ID NO: 2; (d) an amino acid sequence comprising the amino acid residues 22 to 184 of SEQ ID NO: 2; (e) an amino acid sequence comprising the amino acid residues 51-64 of SEQ ID NO: 2; And (f) An isolated or recombinant polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences comprising amino acid residues 76 to 90 of SEQ ID NO: 2. The isolated or recombinant polypeptide of claim 22, comprising the amino acid sequence of a full length VIGF polypeptide encoded by human cDNA included in ATCC Accession No. 75874. The isolated or recombinant polypeptide of claim 22, comprising the amino acid sequence of a mature VIGF polypeptide encoded by human cDNA included in ATCC Accession No. 75874. The isolated or recombinant polypeptide of claim 22, comprising amino acid residues 1 to 184 of SEQ ID NO: 2. The isolated or recombinant polypeptide of claim 22 comprising amino acid residues 22-184 of SEQ ID NO: 2. The isolated or recombinant polypeptide of claim 22, comprising amino acid residues 51-64 of SEQ ID NO: 2. The isolated or recombinant polypeptide of claim 22, comprising amino acid residues 76 to 90 of SEQ ID NO: 2. 29. The isolated or recombinant polypeptide of any one of claims 22 to 28 fused to a heterologous polypeptide. An antibody that specifically binds to an isolated or recombinant polypeptide according to any one of claims 22 to 28 and 30. An antibody or antisense construct that antagonizes the polypeptide according to any one of claims 22 to 28 and 30 or the activity of a naturally occurring form of said polypeptide. (a) The test compounds for endothelial cells, Con A, [3H] thymidine and regulatory activity for a period of time and under conditions sufficient to stimulate the incorporation of [3H] thymidine into endothelial cells; And binding to an isolated or recombinant polypeptide according to any one of claims 30 to 32; And (b) determining the level of [3H] thymidine incorporation in (a) compared to the [3H] thymidine incorporation obtained in the absence of said compound, wherein the difference in [3H] thymidine incorporation is A method for identifying a cell proliferation regulator, which indicates that this is a regulator of cell proliferation. 33. The method of claim 32, wherein the endothelial cells are umbilical vein endothelial cells. 34. The method of claim 32 or 33, wherein the cell proliferation modulator is an agonist of vascular IBP-like growth factor (VIGF) activity in humans. 34. The method of claim 32 or 33, wherein the cell proliferation modulator is an antagonist of vascular IBP-like growth factor (VIGF) activity in humans. 30. A binding of a polypeptide according to any one of claims 22 to 28 and 29, comprising contacting the expected binding partner with the polypeptide for a time and under conditions sufficient to cause binding. How to identify a partner. The method of claim 36, wherein the binding partner is an agonist of vascular IBP-like growth factor (VIGF) activity in humans. The method of claim 36, wherein the binding partner is an antagonist of vascular IBP-like growth factor (VIGF) activity in humans. 15. An isolated polynucleotide according to any one of claims 1 to 6 and 7 to 13, a chemically synthesized oligonucleotide comprising the same nucleotide sequence, or a vector comprising said nucleotide sequence. A diagnostic for diagnosing or probing the disease by determining whether the disease is related to a mutation in the nucleotide sequence encoding vascular IBP-like growth factor (VIGF) or whether the mutation is in the nucleotide sequence of a patient. My. The method of claim 39, wherein the nucleotide sequence of the patient encoding vascular IBP-like growth factor (VIGF) and the nucleotide sequence of the polynucleotide according to any one of claims 1 to 7 and 8 to 13. A diagnostic agent wherein the difference in nucleotide sequence, which is determined by comparison, is a sign of mutation. 41. The diagnostic agent of claim 39 or 40, used to diagnose angiogenesis associated with vascular disease or tumor formation in a patient. From a patient suffering from or prone to a disease associated with modified expression of said polypeptide, comprising an antibody capable of binding to an isolated or recombinant polypeptide according to any one of claims 22 to 28 and 30. A diagnostic agent for diagnosing or probing the disease by measuring the presence or amount of expression of the polypeptide in a sample. The method of claim 42, wherein the biological sample derived from the patient is isolated from the recombinant or recombinant polypeptide according to any one of claims 22 to 28 and 30 for a time and under conditions sufficient to form an antigen-antibody complex. A diagnostic agent that measures the presence or amount of expression of the polypeptide by contacting with a binding antibody molecule and then detecting the complex formed. The diagnostic agent according to claim 42 or 43, used for diagnosing angiogenesis associated with vascular disease or tumor formation in a patient.

Images