KR102689998B1 - SNP marker composition for discriminating Fusarium wilt-resistant or sensitive Raphanus sativus cultivar and uses thereof - Google Patents

Abstract

The present invention relates to a SNP marker composition and its use for determining radish cultivars resistant or susceptible to wilt disease. The SNP marker of the present invention can accurately identify radish individuals showing resistance or susceptibility to radish wilt disease, so Resistant radish individuals can be selected and cultivated early on, which is very useful in reducing the time, cost, and effort required for breeding.

Description

SNP marker composition for discriminating Fusarium wilt-resistant or sensitive Raphanus sativus cultivar and uses thereof}

The present invention relates to a SNP marker composition and its use for determining wilt disease-resistant or susceptible radish varieties.

Radish ( Raphanus sativus L.), a vegetable from the Brassica family, is one of Korea's representative vegetables and is a very important crop, accounting for more than 60% of the total production along with Chinese cabbage among domestically produced fruits and vegetables. Recently, the occurrence of various diseases and physiological disorders has increased in continuous radish cultivation areas, making radish cultivation difficult. To date, diseases that occur on radish in Korea include Fusarium wilt, clubroot, black rot, downy mildew, black spot, and bacterial leaf. 19 species, including spot), were reported.

Wilt caused by Fusarium oxysporum , formerly called yellows, is a soil-borne disease that occurs in hundreds of types of crops and causes great damage worldwide. Radish wilt disease is caused by F. oxysporum f. sp. It is caused by raphani and is a major disease of radish that occurs worldwide and causes enormous damage. Radish wilt disease was first reported in 1934 in white Chinese winter radish fields in San Benito, California, USA, in 1946 in radish fields in Waukesha, Wisconsin, and is currently occurring throughout the United States. It is thought to have occurred in Korea for a long time. It was first reported in 1981 at the Minong cultivation complex in Cheongwon-gun, and the incidence of wilt disease is gradually increasing due to continued continuous cropping.

Methods to control radish wilt disease include cultivating resistant varieties, crop rotation, sowing after disinfecting healthy seeds, applying lime, prohibiting excessive use of nitrogen fertilizer, and soil disinfection. Among these methods, cultivation of resistant varieties is recognized as the most environmentally friendly method for controlling radish wilt disease. Therefore, research is needed to identify radish wilt disease resistance genes and develop molecular markers for the development of radish disease-resistant radish varieties.

Accordingly, in the present invention, QTL associated with wilt disease resistance was searched for by breeding and disease testing a RIL (recombinant inbred line) population raised through self-fertilization after crossing a radish wilt disease-resistant line and a susceptible radish line, and the searched QTL could be detected. We developed a set of KASP primers that can distinguish between wilt disease-resistant and susceptible radish cultivars based on the SNP molecular markers and SNP molecular markers. Although radish is a major vegetable crop grown worldwide, research on disease resistance traits and marker development has been focused on F ₂ , which is convenient for preparing materials for experiments. However, because F ₂ cannot be repeated, the accuracy of the pathological test results (phenotype) is reduced by testing the phenotype in one individual, and this low accuracy also has a negative impact on the accuracy of genotyping analysis related to resistance. Therefore, since radish wilt disease resistance is a QTL and the inheritance pattern is complex, by using the RIL population, the genotype is homozygous and repeatable, thereby ensuring the reliability of the results of the pathological test. To date, KASP markers that can be conveniently used for molecular markers and SNPs to determine resistance to radish wilt disease through genetic analysis using RIL populations in radish have not been developed. In addition, in the case of marker testing using SNP, a method is often used to distinguish differences in genotypes by comparing dissociation curves of amplification products through HRM (htigh resolution melting) analysis without periodic electrophoresis after PCR with a fluorescent sample. There are many cases where it is unclear to distinguish the polymorphism of the melting curve depending on the left, so the test has the disadvantage of being unclear. Therefore, the present inventor developed a molecular marker using KASP for genotype discrimination using differences in fluorescent substances using fluorescent samples capable of detecting each target SNP.

Meanwhile, Korean Patent No. 1361296 discloses a 'primer set containing markers associated with radish wilt disease resistance and a method for selecting resistant radish varieties using the same,' and Korean Patent No. 1733464 discloses 'Identifying cultivars resistant to cruciferous wilt disease.' 'Molecular markers and their uses' are disclosed, but 'SNP markers for determining radish wilt disease-resistant or susceptible radish varieties present on 12,812,422 bp and 12,812,701 bp of radish chromosome 7, which are closely related to resistance to radish wilt disease of the present invention. There is no description regarding the ‘composition and its use’.

The present invention was derived from the above needs, and the present inventors used the Y31 line showing resistance and the Y106 line showing sensitivity to pathotype 147A of the radish wilt disease pathogen ( Fusarium oxysporum f. sp raphani ), using radish 7 After confirming the QTL (Quantitative trait locus) related to radish wilt disease resistance present on chromosome 1, In the QTL region, SNP (single nucleotide polymorphism) markers located on 12,812,422 bp and 12,812,701 bp of radish chromosome 7, which are closely related to radish wilt disease resistance, were discovered. In addition, a KASP (Kompetitive allele specific PCR) primer set based on the SNP marker was developed, and the present invention was completed by confirming that the developed KASP primer set can accurately distinguish resistant or susceptible radish individuals to radish wilt disease. did.

In order to solve the above problem, the present invention is a polynucleotide consisting of the base sequence of SEQ ID NO: 10 or 11, with 8 or more consecutive nucleotides including a SNP (single nucleotide polymorphism) base located at the 301st position of each base sequence. Provided is a SNP marker composition for determining Fusarium wilt resistant or susceptible radish varieties, comprising a polynucleotide or a complementary polynucleotide thereof.

In addition, the present invention provides a microarray for determining wilt disease-resistant or susceptible radish varieties, including a polynucleotide containing the above SNP base or cDNA thereof.

In addition, the present invention provides a probe for determining wilt disease-resistant or susceptible radish varieties, including a polynucleotide containing the above SNP base or cDNA thereof.

In addition, the present invention provides oligonucleotide primer set 1 of SEQ ID NOs: 1, 2, and 3; Oligonucleotide primer set 2 of SEQ ID NOs: 4, 5, and 6; and oligonucleotide primer set 3 of SEQ ID NOs: 7, 8, and 9. It provides a primer set composition for determining wilt disease-resistant or susceptible radish varieties, comprising at least one oligonucleotide primer set selected from the group consisting of.

In addition, the present invention provides the primer set composition; and a reagent for performing an amplification reaction. It provides a kit for determining wilt disease-resistant or susceptible radish varieties, including a kit.

Additionally, the present invention includes the steps of isolating genomic DNA from a radish sample; Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition according to the present invention to amplify the target sequence; and detecting the product of the amplification step. It provides a method for determining wilt disease-resistant or susceptible radish varieties, including a step.

The SNP marker of the present invention can accurately identify radish individuals that are resistant or susceptible to radish wilt disease, so radish individuals that are resistant to wilt disease can be selected and cultivated at an early stage, reducing the time, cost, and effort required for breeding. It can be very useful in reducing costs.

Figure 1 is a result showing the location of loci related to wilt disease resistance in a genetic map created using a RIL (recombinant inbred line) population created by crossing the parental lines Y31 (resistant) and Y106 (susceptible).
Figure 2 shows two different, independent pathological tests for wilt disease among the parental lines, Y31 (resistant) and Y106 (susceptible), and their RIL population, using the SNP-based KASP primer set of the present invention (Table 5) for 2 years. This is the result of performing KASP analysis on 63 resistant lines and 66 susceptible lines that showed the same phenotype in the experiment (both the first and second year results were resistant or susceptible).
Figure 3 shows a cross between the parental lines Y31 (resistant) and Y106 (susceptible) using marker 2 of the present invention (KASP primer set (SEQ ID NO: 1, 2 and 3) based on SNP marker 'R7_12812422' in Table 4). This is the result of performing KASP analysis on the created RIL group (Table 8).

In order to achieve the object of the present invention, the present invention provides a polynucleotide consisting of the base sequence of SEQ ID NO: 10 or 11, containing 8 or more consecutive SNP (single nucleotide polymorphism) bases located at the 301st position of each base sequence. Provided is a SNP marker composition for determining Fusarium wilt-resistant or susceptible radish varieties, which includes a polynucleotide composed of nucleotides or a complementary polynucleotide thereof.

In one embodiment of the present invention, the contiguous nucleotides may be 8 to 100 contiguous nucleotides, but are not limited thereto.

In this specification, the term 'nucleotide' refers to a deoxyribonucleotide or ribonucleotide that exists in single-stranded or double-stranded form, and includes analogs of natural nucleotides unless specifically stated otherwise.

In the SNP marker composition according to one embodiment of the present invention, the SNP position base is the 301st base in the base sequence of SEQ ID NO: 10 or 11, and the polymorphic base information is indicated as [/] in the SNP sequence information in Table 4. , the base sequence of SEQ ID NO: 10 or 11 of the present invention means a sequence containing the base located before the slash (/) in Table 4.

The SNP marker of the present invention can be used to determine wilt disease-resistant or susceptible radish varieties because the 301st SNP mutation position in the nucleotide sequence shown in SEQ ID NO: 10 is G or A, and in the nucleotide sequence shown in SEQ ID NO: 11, the 301st SNP mutation position is G or A. This is based on the fact that the 301st SNP mutation position appears differently as T or G. In the base at the SNP position, if the 301st base in the base sequence of SEQ ID NO. 10 is G or the 301st base in the base sequence of SEQ ID NO. 11 is T, it can be identified as a wilt disease-resistant radish variety (see Table 3).

The present invention relates to nucleotide variants at SNP positions in the nucleotide sequence of SEQ ID NO: 10 or 11, but when such SNP nucleotide mutations are found in double-stranded gDNA (genomic DNA), a polynucleotide sequence complementary to the nucleotide sequence It is interpreted to include also. Therefore, the base at the SNP position in the complementary polynucleotide sequence also becomes a complementary base. In this respect, all sequences presented herein are based on sequences in the sense strand of genomic DNA, unless otherwise specified.

The present invention also provides a microarray for determining wilt disease-resistant or susceptible radish cultivars, comprising a polynucleotide containing the above SNP base or cDNA thereof.

Preferably, the polynucleotide may be immobilized on a substrate coated with an active group of amino-silane, poly L-lysine, or aldehyde, but is not limited thereto. Additionally, preferably, the substrate may be a silicon wafer, glass, quartz, metal, or plastic, but is not limited thereto. Methods for immobilizing the polynucleotide on a substrate include micropipetting using a piezoelectric method, a method using a pin-type spotter, etc.

As used herein, the term 'substrate' refers to any substrate that possesses hybridization properties and to which a marker can be attached under conditions that the background level of hybridization is kept low. Typically, the substrate may be a microtiter plate, membrane (eg, nylon or nitrocellulose), microspheres (beads), or a chip. Before application to or immobilization on a membrane, nucleic acid probes can be modified to facilitate immobilization or improve hybridization efficiency. The modifications may include homopolymer tailing, coupling with different reactive functional groups such as aliphatic groups, NH ₂ groups, SH groups and carboxyl groups, or coupling with biotin, haptens or proteins. .

The microarray according to the present invention can be prepared by conventional methods known to those skilled in the art using the polynucleotide according to the present invention or its complementary polynucleotide, the polypeptide encoded by it, or its cDNA.

The present invention also provides a probe for determining wilt disease-resistant or susceptible radish varieties, comprising a polynucleotide containing the above SNP base or cDNA thereof.

As used herein, the term 'probe' refers to a hybridization probe, which refers to a linear oligomer having a natural or modified monomer or linkage containing deoxyribonucleotides and ribonucleotides capable of sequence-specific binding to the complementary strand of a nucleic acid. . The probe of the present invention is an allele-specific probe, in which a polymorphic site is present among nucleic acid fragments derived from two members of the same species, and hybridizes to the DNA fragment derived from one member, but does not hybridize to the fragment derived from the other member. . Preferably, the probe may be single stranded for maximum efficiency in hybridization, more preferably a deoxyribonucleotide, but is not limited thereto.

As used herein, the term 'hybridization' refers to complementary single-stranded nucleic acids forming double-stranded nucleic acids. Hybridization can occur between two nucleic acid strands that are completely matched or substantially matched with some mismatches. Complementarity for hybridization may vary depending on hybridization conditions, especially temperature.

As a probe used in the present invention, a sequence that is perfectly complementary to the polynucleotide containing the SNP may be used, but a substantially complementary sequence may be used to the extent that it does not interfere with specific hybridization. It could be. Preferably, the probe used in the present invention contains a sequence capable of hybridizing to a sequence comprising 8 to 100 consecutive nucleotides including the nucleotide at position 301 of SEQ ID NO: 14 or 15, which is a SNP nucleotide. More preferably, the 3'-end or 5'-end of the probe has a base complementary to the SNP base. In general, since the stability of the duplex formed by hybridization tends to be determined by the match of the terminal sequences, the terminal portion of the probe having a base complementary to the SNP base at the 3'-end or 5'-end Without hybridization, these duplexes can disassemble under stringent conditions. Suitable conditions for hybridization can be determined by referring to information commonly known in the art. The stringent conditions used for hybridization must be sufficiently stringent to ensure hybridization to only one of the alleles, and can be determined by controlling temperature, ionic strength (buffer concentration), and the presence of compounds such as organic solvents. These stringent conditions may vary depending on the sequence being hybridized.

The present invention also provides oligonucleotide primer set 1 of SEQ ID NOs: 1, 2, and 3; Oligonucleotide primer set 2 of SEQ ID NOs: 4, 5, and 6; and oligonucleotide primer set 3 of SEQ ID NOs: 7, 8, and 9. It provides a primer set composition for determining wilt disease-resistant or susceptible radish varieties, comprising at least one oligonucleotide primer set selected from the group consisting of.

In one embodiment of the present invention, the primer set may be a KASP (Kompetitive allele specific PCR) primer set capable of confirming the 301st SNP mutation position in the nucleotide sequence represented by SEQ ID NO: 10 or 11, but is not limited thereto. .

In this specification, the term 'KASP' is one of the PCR (polymerase chain reaction)-based analysis methods, which is a homogenous and fluorescence-based genotyping analysis technology. KASP is a technology based on fluorescence resonance energy transfer for allele-specific oligo extension and signal generation.

In the primer set composition according to one embodiment of the present invention, the oligonucleotide primer set 1 of SEQ ID NO: 1, 2, and 3 amplifies a polynucleotide containing the SNP base located at the 301st base of the nucleotide sequence of SEQ ID NO: 10. It can be done, and oligonucleotide primer set 2 of SEQ ID NOs: 4, 5, and 6 and oligonucleotide primer set 3 of SEQ ID NOs: 7, 8, and 9 are polynucleotides containing the SNP base located at the 301st base of the base sequence of SEQ ID NO: 11. Nucleotides can be amplified.

The KASP primer set of the present invention consists of three oligonucleotides with SEQ ID NO: 3 oligonucleotides forming one primer set, and consists of two forward primers and one reverse primer. Specifically, a FAM or HEX fluorescent substance is attached to the 5' end of the forward primer, a SNP base is attached to the 3' end, and it consists of one common reverse primer. In the primer set of the present invention, the oligonucleotides of SEQ ID NOs: 1, 4, and 7 are FAM-bound forward primers, and the oligonucleotides of SEQ ID NOs: 2, 5, and 8 are HEX-bound forward primers, SEQ ID NOs: 3, 6, and 9. The oligonucleotide is a reverse primer.

The primer set may include an oligonucleotide consisting of a segment of 14 or more, 15 or more, 16 or more, 17 or more, 18 or more consecutive nucleotides in the sequence of SEQ ID NOs. 1 to 9, depending on the sequence length of each primer set. You can. For example, the primer (19 oligonucleotides) of SEQ ID NO: 1 may include an oligonucleotide consisting of a segment of 16 or more, 17 or more, 18 or more, or 19 or more consecutive nucleotides within the sequence of SEQ ID NO: 1. . In addition, the primer may also include sequences in which the base sequences of SEQ ID NOs: 1 to 9 are added, deleted, or substituted.

As used herein, the term 'primer' refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should be used to initiate synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target desired as well as the conditions under which the primer is used, such as temperature and ionic strength.

In the present specification, oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or May contain an intercalating agent. Additionally, primers may incorporate additional features that do not change the basic nature of the primer serving as the starting point for DNA synthesis. The primer nucleic acid sequence of the present invention may, if necessary, contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., HRP (horse radish peroxidase), alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules, chemical groups (e.g., biotin), etc. there is.

The appropriate length of the primer is determined by the characteristics of the primer to be used. Primers do not have to be exactly complementary to the sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

The present invention also provides the primer set composition; and a reagent for performing an amplification reaction. It provides a kit for determining wilt disease-resistant or susceptible radish varieties, including a kit.

In the kit of the present invention, the primer set composition is as described above.

In the kit of the present invention, reagents for performing the amplification reaction may include, but are not limited to, DNA polymerase, dNTPs, and buffer.

The kit for determining wilt disease-resistant or susceptible radish varieties of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare PCR buffer, and the suggested reaction conditions. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

Isolating genomic DNA from a radish sample;

Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition of the present invention to amplify the target sequence; and

It provides a method for determining wilt disease-resistant or susceptible radish varieties, including the step of detecting the product of the amplification step.

In the method according to one embodiment of the present invention, the primer set composition is the same as described above.

The method of the present invention includes the step of isolating genomic DNA from a radish sample. Methods for isolating genomic DNA from the radish sample can be any method known in the art, for example, the CTAB method or the Wizard prep kit (Promega). The target sequence can be amplified by using the isolated genomic DNA as a template and performing an amplification reaction using a primer set according to an embodiment of the present invention. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There are strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using polymerase. These PCR methods are well known in the art, and commercially available kits can also be used.

In the method according to one embodiment of the present invention, the radish may be a plant seed, leaf, root, or stem, but is not limited thereto.

In the method according to one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance may be FAM, HEX, VIC, JOE, ROX, TAMRA, Cy3 or Cy5. When amplifying a target sequence and performing PCR by labeling the 5' end of the primer with the labeling material, the target sequence can be labeled with a detectable fluorescent labeling material. The oligonucleotide primer sets used to amplify the target sequence are listed in Table 5 below.

In the method according to one embodiment of the present invention, the method of determining wilt disease-resistant or susceptible radish varieties includes analyzing the product of the amplification step, and the analysis of the product of the amplification step is performed using SNP genotyping (single nucleotide A polymorphism genotyping method may be used, and preferably may be performed through HRM (high resolution melting) analysis or sequencing, but is not limited thereto.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Radish material and DNA extraction

The F ₇ generation was created by self-fertilizing the radish 'Y31' line, which is resistant to wilt disease, and the 'Y106' line, which is susceptible, and the F ₁ population that crossed them using the SSD method (single seed descent method) and progressing to the 7th generation. The recombinant inbred line (RIL) population was used.

For genomic DNA extraction, parental lines Y31 and Y106 and RIL group 170 lines of the F ₇ generation were sown in 50-hole seedling trays, and the true leaves of the seedlings were used at the 4th week of sowing. Specifically, genomic DNA was extracted from one leaf disc using the APrep ^TM Total DNA kit (APBIO, Korea). 200 ㎕ of DNA extraction buffer containing 20 ㎕ of proteinase K (100 ㎍/㎖) and 4 ㎕ of RNase (10 mg/㎖) was added to a small amount of seed sample and pulverized by bead beating. Next, the culture was incubated for 10 minutes in a constant temperature container adjusted to 65°C, the reaction solution was centrifuged at about 13,000 rpm for 1 minute to obtain a supernatant, and the supernatant was transferred to a new 1.5 ml micro tube. An equal amount of 100% ethanol was added, the reaction solution was placed in a spin column, centrifuged, and washed twice using a washing buffer. DNA was extracted by adding 30 μl of sterilized triple distilled water to the spin column, which was transferred to a new tube.

2. Wilt resistance inoculation

To induce wilt disease, the pathotype 147A strain of the radish wilt disease pathogen ( Fusarium oxysporum f. sp raphani ) was used. The RIL population was used to identify resistance-related genomic regions and genetic factors in the Y31 inbred line showing resistance to pathotype 147A. In addition, a pathological test was performed to investigate resistance to pathotype 147A, and the pathological test was performed twice in October 2021 and 2022. For pathological testing, the roots of seedlings grown for 8 days after sowing in a greenhouse were inoculated by immersing them in 147A spore suspension at a concentration of ^3.0 They were cultured under dark conditions for 14 days in a growth chamber at 25°C and exposed to light for 12 hours a day, and then the disease severity (0 to 5) was examined. If the average virulence was less than 1.0, it was judged to be resistant, if it was 1.1 to 2.5, it was judged to be moderately resistant, and if it was more than 2.5, it was judged to be susceptible. Ten individuals from each lineage were repeatedly investigated.

Symptoms according to each severity of disease (0 to 5) are as follows. 0=healthy, 1=browning in the underground part but no symptoms in the above-ground part, 2=browning in the underground part and slightly inhibited growth in the above-ground part, 3=browning in the underground part, inhibited growth in the above-ground part and slightly yellowed, 4 =The underground part is browned, growth is suppressed in both the underground and above-ground parts, and it is severely yellowed. 5=Death.

3. Library production and data production for GBS (Genotype By Sequencing) analysis

GBS is a technology that can easily analyze the genome of many samples at a low cost based on the next generation sequencing (NGS) method. It can be produced from a variety of samples and secures genome-wide SNPs of a population/individual in a short time. It is a possible technology.

Quantification and quality of the extracted genomic DNA was confirmed using electrophoresis, nanodrop, and Qubit on a 1.5% agarose gel. The recommended concentration of genomic DNA for library production for GBS analysis was 30 ng/μl or more based on nanodrop measurement. A library was produced for GBS analysis, and a quality check was performed on the size of the template inserted into the library using TapeStation HS D1000Screen Tape (Agilent, USA) equipment. The average inserted size was 330 to 365 bp. Using the NovaSeq6000 equipment (Illumina Inc, USA), 180 Gb of data was produced by reading in both directions (2 × 150 bp paired-end) at 150 bp.

4. Confirmation of loci related to wilt disease resistance through genetic mapping and QTL analysis of radish

Based on the loci showing polymorphisms in the Y31 (resistant) and Y106 (susceptible) lines, which are both parents of the RIL population, polymorphisms were confirmed in the RIL population and genotypes were investigated. Genetic distances were analyzed for polymorphic SNPs using JoinMap version 4.0 software (https://www.kyazma.nl/index.php/JoinMap/). Linked loci were grouped using a logarithm of odds threshold ranging from 4.0 to 6.0, forming a total of 9 linkage groups (LG). To arrange the order of markers within the LOD grouping in each linkage group, the recombination frequency was set to 0.4 and the threshold value was set to less than 0.5, and the recombination frequency was converted to cM (centiMorgans) using Kosambi's calculation method. In addition, genetic mapping and QTL analysis were performed using SNP markers generated from re-sequencing data of Y31 (resistant) and Y106 (susceptible) and SNPs identically detected in GBS.

Resistance loci were searched by analyzing QTL based on the pathological test results investigated in the RIL population. QTL analysis of wilt disease resistance-related traits was performed using the CIM (composite interval mapping) method using Windows QTL Cartographer 2.5, and SNPs associated with wilt disease resistance traits were explored through association analysis. The QTL analysis results for the first and second pathological tests are summarized in Table 1 and Table 2 below. Through the QLT analysis results, it was confirmed that a significant QTL for wilt disease resistance was detected only on chromosome 7 (Figure 1)

Summary of QTL results Traits LOD Linkage group No. of markers No. of gene in QTL region 1st pathology test 4.0 RSAskr1.0R7 13 314 2nd pathology test 4.3 RSAskr1.0R7 14 325

QTL region summary Traits Linkage group Marker Position(cM) LOD Additive Dominant R2 No.
of gene Wilt disease
Primary R07 m_01 89.14 4.55 0.58 -0.53 0.11 33 m_02 89.60 4.55 0.57 -0.6 0.11 36 m_03 90.00 4.45 0.56 -0.7 0.11 36 m_04 91.11 4.41 0.53 0.42 0.1 41 m_05 91.85 4.73 0.57 -0.59 0.11 41 m_06 92.74 4.77 0.57 -0.27 0.11 40 m_07 93.66 6.14 0.62 0.28 0.13 45 m_08 94.38 4.9 0.55 0.44 0.11 44 m_09 94.78 5.68 0.58 0.63 0.12 47 m_10 96.67 4.64 0.54 0.45 0.1 47 m_11 98.67 4.45 0.53 0.32 0.1 51 m_12 98.80 4.45 0.53 0.39 0.1 44 m_13 99.11 4.6 0.53 0.4 0.1 37 Wilt disease
Secondary R07 m_14 83.34 4.72 0.47 -1.13 0.1 41 m_15 84.57 4.46 0.49 -0.56 0.11 36 m_16 87.14 5.28 0.54 -0.61 0.13 33 m_17 89.60 4.96 0.51 -0.32 0.12 36 m_18 90.00 4.89 0.5 -0.63 0.11 36 m_19 91.11 4.74 0.47 0.17 0.11 41 m_20 91.85 5.46 0.52 -0.5 0.13 41 m_21 92.74 5.55 0.53 -0.29 0.13 40 m_22 93.66 6.06 0.55 0 0.13 45 m_23 94.38 4.9 0.48 0.2 0.11 44 m_24 94.78 5.75 0.5 0.64 0.11 47 m_25 96.67 4.71 0.49 0.05 0.11 47 m_26 97.67 4.7 0.49 -0.26 0.11 51 m_27 99.11 4.41 0.45 0.31 0.10 37

5. SNP marker development

Based on the GBS of 170 lines of the RIL population, RSAskr1.0R7g74477 and RSAskr1.0R7g74478 genes involved in wilt disease resistance were identified through QTL and GWAS (Genome-wide association study) analysis.

At the above two gene positions, the parents of the RIL population, Y31 (resistant) and Y106 (susceptible), and the reference genome (Radish genome: Raphanus sativus L. (RSAskr_r1.0), Data source: Radish Genome Database (https://plantgarden. SNP mutations were selected by comparing jp/ja/index)) sequences, and the SNP marker information of the present invention, SNP flanking sequence information, and KASP primer set information produced based on SNP are shown in Tables 3 to 5, respectively. shown in In Table 5, marker 1 was created based on SNP 'R7_12812422', and marker 2 and marker 3 were created based on SNP 'R7_128120701'.

SNP marker information Marker Position(bp) ref. resistance sensibility R7_12812422 12,812,422 A G A R7_128120701 128,120,701 G T G

SNP flanking sequence information R7_12812422 / Resistance (G), Susceptibility (A) CGGGCACGCAAACCGGACCGCCACTTCGATTTCACCCATCTTCTTCAGACCGCTAGGTAACAGAACAAGTAGAGGATACGAATTGGTGTACACTTTGTTACTCTCTAACGTCGAGACACGAATCCTTATCTTCCCTATCCGAGTATCAGGTCTATCATCGGAGACATCCGAGAACATCCTCCAGTTGTCGAATACCCCAACAGTTAAAACAGTGCAAGGATCATAAACCTGCCACGTGTACTGCTCGTGCCATCTCG GGTCGAAACTATCAGTTATGGTTCGCGTCCGAACCCATTTCTT [G/A] CCGTACTTAGCAACACAGTAAGCATCAGTGGAGCCTTTCCCTCCGTTTTTAGCCTTCATCGGTAACAACCCACGAGCTCCGAGTATCCCCAGCTCAAGTACTCCGATCGGTGGTTTCCAGAGCTGCTTGGCCGTGGGACGGAAGTCACTACACACGTGCGCAGCCTCTTCAAGCACGTGATACCCACCTTCAAGACACAGTCTTAAGCTAATCCTCCCACAGTAAGGTCCTCCACCTTCTCCTTCCAAAGCAT GCCATTTAGACGGCACGAAACGCTCATCGATTCTCTGCTCAATGGAG (SEQ ID NO: 10) R7_128120701 / Resistance (T), Susceptibility (G) TTACTGTGTTGCTAAGTACGGTAAGAAATGGGTTCGGACGCGAACCATAACTGATAGTTTCGACCCGAGATGGCACGAGCAGTACACGTGGCAGGTTTATGATCCTTGCACTGTTTTAACTGTTGGGGTATTCGACAACTGGAGGATGTTCTCGGATGTCTCCGATGATAGACCTGATACTCGGATAGGGAAGATAAGGATTCGTGTCTCGACGTTAGAGAGTAACAAAGTGTACACCAATTCGTATCCTCTACT TGTTCTGTTACCTAGCGGTCTGAAGAAGATGGGTGAAATCGAAGT [T/G] GCGGTCCGGTTTGCGTGCCCGTCGCTGCTACCTGATGTTTGCGCGGCTTACGGACAACCACTTCTACCTAGGATGCACTATATAAGGCCTCTAGGAGTAGCACAACAGGATGCATTGAGAGGAGCGGCTACCAAAATGGTTGCCGCGTGGCTGGCTAGAGCAGAACCGCCGTTGGGACCGGAAGTGGTTCGGTATATGTTGGATGCGGATTCACATTCGTGGAGCATGAGGAAGAGCAAAGCGAATTGGTATAGGATT GTTGGGGTTTTAGCTTGGGCGGTGGGTTTAGCTAAGTGGTTA (SEQ ID NO: 11)

Underlined and bold: SNP location base

KASP primer set information Primer name Sequence(5'-3') (SEQ ID NO) marker 1 Forward(FAM) CGTCCGAACCCATTTCTT G (1) Forward(HEX) CGTCCGAACCCATTTCTT A (2) Reverse(FAM) GGCTCCACTGATGCTTACTG (3) marker 2 Forward(FAM) AGATGGTGAAATCGAAGT T (4) Forward(HEX) AAGATGGTGAAATCGAAGT G (5) Reverse AGAAGTGGTTGTCCGTAAGC (6) marker 3 Forward(FAM) AGATGGTGAAATCGAAGT T (7) Forward(HEX) AAGATGGTGAAATCGAAGT G (8) Reverse CGCAAACATCAGGTAGCAG (9)

Underlined and bold: SNP location base

6. KASP analysis

PCR reaction and analysis were performed using 5 μl of template DNA, 5 μl of KASP-TF V4.0 2X Master Mix/Standard ROX, and 0.14 μl of KASP Assay mix (KASP primer set) reaction solution. Gene amplification conditions were the same as those in the 'Guide to running KASP genotyping on the ABI 7900 instrument' provided by LGC Biosearch Technologies, and the 61-55℃ touchdown protocol was used for amplification conditions.

As shown in Table 6 below, after hot-start activation at 94°C for 15 minutes, amplification was performed for 10 cycles at 94°C for 20 seconds and 61-55°C touchdown, followed by 26 cycles of 94°C for 20 seconds and 55°C for 60 seconds. After repeating, one cycle was performed for 60 seconds at 30°C. The negative control group was treated with distilled water, and each sample was tested 3 to 4 times. When the amount of amplification was small, recycling was performed. As shown in Table 7 below, 3 cycles of 20 seconds at 94°C and 60 seconds at 57°C were repeated, followed by one cycle of 60 seconds at 30°C.

KASP standard conditions Protocol stage temperature hour Cycle (number of times) <Stage 1>
Hot-start activation
94℃
15 minutes
One <Stage 2>
Touchdown 94℃ 20 seconds 10 61℃
(61℃ decreasing 0.6℃ per cycle to activate a final annealing/extension temperature of 55℃) 60 seconds <Stage 3>
Amplification 94℃ 20 seconds 26 55℃ 60 seconds <Optional Stage 4>
(Read stage for qPCR instruments only) 30℃ 60 seconds One

KASP recycling conditions Protocol stage temperature hour Cycle (number of times) <Stage 1>
Amplification 94℃ 20 seconds 3 57℃ 60 seconds <Optional Stage 4>
(Read stage for qPCR instruments only) 30℃
(any temperature below 40℃ is suitable for the read stage) 60 seconds One

Example 1. Validation of the SNP-based KASP primer set of the present invention

Using the KASP primer set of the present invention (Table 5), the same phenotype was observed in the parental lines Y31 (resistant) and Y106 (susceptible) and wilt disease among their RIL populations in two different, independent pathological assays over 2 years. KASP analysis was performed on 63 resistant lines and 66 susceptible lines (both the 1st and 2nd year results were resistant or susceptible).

As a result, when marker 1 (SEQ ID NO: 1, 2, and 3), marker 2 (SEQ ID NO: 4, 5, and 6), or marker 3 (SEQ ID NO: 7, 8, and 9) were used, individuals showing resistance to wilt disease showed fluorescence It appeared close to the y-axis due to the substance HEX, and individuals showing susceptibility to wilt disease appeared close to the x-axis due to the fluorescent substance FAM (Figure 2).

In addition, as a result of performing KASP analysis on the RIL population with the phenotypes shown in Table 8 below using Marker 1 of the present invention, it was confirmed that the phenotypes in Table 8 and the genotype tested with Marker 1 (Figure A) matched. .

Through this, marker 1 (SEQ ID NO: 1, 2 and 3), marker 2 (SEQ ID NO: 4, 5 and 6) or marker 3 (SEQ ID NO: 7, 8 and 9) of the present invention shows resistance or susceptibility to wilt disease. It was found that radish objects could be accurately distinguished.

Sequence list electronic file attached

Claims (8)

A polynucleotide consisting of 8 or more consecutive nucleotides containing the SNP (single nucleotide polymorphism) base located at position 301 in the base sequence of SEQ ID NO: 10, or a complementary polynucleotide thereof, is resistant or susceptible to Fusarium wilt. SNP marker composition for determining breeds. The SNP marker composition for determining wilt disease-resistant or susceptible radish varieties according to claim 1, wherein the contiguous nucleotides are 8 to 100 contiguous nucleotides. A microarray for determining wilt disease-resistant or susceptible radish varieties, comprising a polynucleotide containing the SNP base according to claim 1 or cDNA thereof. A probe for determining wilt disease-resistant or susceptible radish varieties, comprising a polynucleotide containing the SNP base according to claim 1 or cDNA thereof. A primer set composition for determining wilt disease-resistant or susceptible radish varieties, comprising oligonucleotide primer set 1 of SEQ ID NOs: 1, 2, and 3. The primer set composition of claim 5; A kit for determining wilt disease-resistant or susceptible radish varieties, including a reagent for performing an amplification reaction. Isolating genomic DNA from a radish sample;
Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition of claim 5 to amplify the target sequence; and
A method for determining wilt disease-resistant or susceptible radish varieties, including the step of detecting the product of the amplification step. The method of claim 7, wherein the detection of the amplification product is performed using a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.