KR102679956B1 - Method of culturing muscle cells for producing cattle cultured meat - Google Patents

Abstract

The present invention relates to a medium composition and culture method for culturing muscle cells for the production of cultured beef meat, which promotes cell number proliferation through reduction of oxygen concentration in the growth stage and differentiation stage for bovine muscle stem cells. By confirming that the formation of muscle fibers is possible with a low concentration of serum in DMEM/F12 basic culture medium by increasing the amount of protein and vitamins in the cells, culture conditions and methods that can achieve the best culture while minimizing the concentration of animal-derived serum were developed. to provide.

Description

Method of culturing muscle cells for producing cattle cultured meat}

The present invention relates to a medium composition and culture method for culturing muscle cells for producing cultured beef meat.

According to a recent report by the Food and Agriculture Organization of the United Nations (FAO), the world's population is expected to increase by 0.6% annually from 7.64 billion in 2018 to 9.2 billion in 2050. Essential amino acids, one of the most important nutrients for maintaining a growing population, are nutrients that cannot be synthesized in the body or are synthesized in very small quantities and must be consumed through food. Meat consumption required to supply essential amino acids is expected to increase by 1.3% annually from 3.04 million tons in 2018, reaching 4.55 million tons in 2050. However, there are limits to meeting this increase in protein demand with traditional livestock production methods, and there is a strong opinion that there is a need to convert part of the insufficient protein demand into alternative livestock products.

Meanwhile, food shortages due to future population growth include various issues such as environmental and ethical issues, so artificial meat that can respond to all of these areas is needed. Among alternative foods, alternative livestock products that can replace livestock products to meet the demand for protein have the advantage of lower overall resource input and greenhouse gas usage compared to existing meat, less environmental pollutants such as odor, and contain elements beneficial to health. Have.

The representative alternative livestock product is artificial meat. Artificial meat can be largely divided into a method that imitates the taste and effects of artificial meat by processing vegetable raw materials, and a method that cultivates animal cells to cultivate meat in specific spaces and conditions. It is known that this artificial meat has some advantages over existing meat in terms of safety.

Traditionally, soybeans have received the most attention as an ingredient for making artificial meat. Beyond Meat, a soy-based meat company that has recently been in the spotlight, uses proteins extracted from plants to create processed foods with a shape and texture similar to meat. In addition, OmniPork is in the spotlight by making artificial pork using mushrooms and soybeans and making pork substitutes using it.

Meanwhile, cultured meat is attracting attention among artificial meats that mimic animal proteins using technologies different from vegetable raw materials. According to the life cycle assessment (LCA) of cultured meat production, cultured meat can reduce land use by 99%, gas emissions by 96%, and energy consumption by 45% compared to meat production using traditional livestock methods. It is expected to reduce the burden of environmental pollution, and there are also advantages in terms of animal welfare related to poor breeding environments and slaughter.

Cultured meat differentiates stem cells and grows them into muscle tissue, so it does not require secondary organs such as organs, brains, or skeletons, and has the characteristic of relatively low nutrient and energy consumption when looking only at the culture process. However, at the current level of cell culture technology, a high level of hygiene must be maintained for cell culture, and considering the resulting energy input, it is difficult to conclude that nutrients and energy consumption are low.

In order to realize the various advantages that cultured meat has over conventional meat, a sufficiently economical and environmentally friendly medium is essential. The culture medium for cultured meat must not only contain various nutrients, but also contain growth factors necessary for the growth and differentiation of myoblasts and be suitable for the development of root canal tissue into muscle. Growth factors are either synthesized as muscle cells grow or secreted externally by the muscle cells themselves. Additionally, it may be present in the surrounding area (paracrine effect) or provided by other types of cells further away (endocrine effect).

Therefore, in addition to adding them directly to the medium during the medium manufacturing step, the necessary growth factors can be supplied by culturing other cells in the surrounding area. In terms of nutrients, the most important thing is serum. One of the main components of the medium for producing cultured meat is calf serum (FBS). FBS is an essential ingredient commonly used in cell culture media, but its harvest and production require the slaughter of calves, which poses serious scientific and ethical concerns.

The cell culture medium for cultured meat production requires horse or cow fetal serum, and this serum is obtained by slaughtering pregnant cows. As cultured meat production increases, livestock slaughter also increases, which is not in line with the original purpose of developing cultured meat. not. Therefore, there is a need to establish a culture environment that can achieve the best culture while minimizing the concentration of serum.

Research on cultured meat includes Korean Patent Publication No. 10-2020-0071061, “Cultured Meat Composition,” which includes a three-dimensional scaffold, myoblasts or their progenitor cells, extracellular matrix (ECM)-secreting cells, and endothelial cells or their progenitor cells. A method for producing an edible composition is disclosed, comprising incubating ascites cell types and inducing differentiation of myoblasts into myotubes.

In addition, research on culture conditions and methods for animal cell culture includes Korean Patent Publication No. 10-2014-0103759, “Serum-free medium for animal cell culture and composition for improving skin condition using the same,” which describes serum-free medium for animal cell culture. The composition of the medium is made up of ingredients permitted as raw materials for pharmaceuticals or cosmetics, and the stability of the formulation is increased by changing the composition and content of mineral salts, amino acids, and vitamins. By adding a combination of cytokines to the medium composition, skin cells are stimulated. A method of culturing cells under serum-free medium conditions at a rate similar to that of a serum-containing medium was disclosed, and Korean Patent Publication No. 10-2013-0008293 describes mass production of growth factors using fetal-derived mesenchymal stem cells in amniotic fluid cultured under hypoxic conditions. Pertaining to a method and composition for skin regeneration, a method for mass proliferation of mesenchymal stem cells comprising culturing fetal-derived mesenchymal stem cells in amniotic fluid under hypoxic conditions, a conditioned medium composition prepared using the same, and human growth factors A mass production method and a composition for skin regeneration using the composition were disclosed.

The present invention relates to a culture medium and culture method for muscle cells for the development of cultured bovine meat. While researching culture conditions and methods that can achieve the best culture while minimizing the concentration of animal-derived serum, the present inventors discovered that oxygen The present invention was completed by establishing a culture method to differentiate muscle stem cells into myotubes under conditions that promote the proliferation of muscle stem cells by reducing the concentration and reduce the use of serum by increasing the amount of nutrients such as proteins and vitamins. .

The purpose of the present invention is to provide a medium composition and culture method for culturing muscle cells for producing cultured beef meat.

This invention

1) Isolating muscle stem cells from bovine skeletal muscle tissue;

2) culturing the cells of step 1) in oxygen 5 to 20% and serum concentration 5 to 20% by weight to proliferate undifferentiated muscle stem cells; and

3) culturing the undifferentiated muscle stem cells of step 2) in medium conditions of 5 to 20% oxygen and 0 to 5 wt% serum concentration to differentiate them into muscle fibers (myofibers); cultured beef meat comprising; Provides a muscle cell culture method for production.

The present invention provides a culture medium composition capable of proliferating and differentiating muscle cells with minimal use of animal-derived serum.

Additionally, using the muscle cell culture method of the present invention, a cultured meat culture method using minimal use of animal-derived serum can be developed.

Figure 1 is a diagram showing the process of isolating muscle stem cells from bovine skeletal muscle.
Figure 2 is a diagram comparing the in vitro differentiation capacity of cells (a) from which only fibroblast-like cells were removed three times and cells differentiated using CD56+/CD29+ antibodies (b).
Figure 3 is a diagram showing the proliferation ability of cells according to the culture medium during cell growth.
Figure 4 is a graph showing the results of measuring the number of cells according to serum and oxygen concentration.
Figure 5 is a graph showing the expression of muscle stem cell transcription factors according to serum and oxygen concentration.
Figure 6 is a graph showing the expression of proliferation-related factors according to serum and oxygen concentration in muscle cells cultured for 1 week.
Figure 7 is a graph showing the expression of proliferation-related factors according to serum and oxygen concentration in muscle cells cultured for 2 weeks.
Figure 8 is a graph showing the expression of differentiation-related factors according to serum and oxygen concentration in F10 culture medium.
Figure 9 is a graph showing the expression of differentiation-related factors according to serum and oxygen concentration in DMEM/F12 culture medium.
Figure 10 is a graph showing the expression of differentiation-related factors according to oxygen concentration in PROMOCELL serum-free culture medium.
Figure 11 shows differentiated cells (A), total number of nuclei (B), total number of myotube cells (C), and myotube cell nuclear fusion rate (D) according to oxygen concentration in PROMOCELL serum-free culture medium.
Figure 12a shows differentiated cells according to serum concentration in DMEM/F12 culture medium under 20% oxygen conditions, and Figure 12b shows the total number of nuclei (B), total number of myotube cells (C), and myotube cell nuclear fusion rate (D). It represents.
Figure 13 is a schematic diagram of proliferation and differentiation of bovine skeletal muscle cells for cultured meat.

Hereinafter, the present invention will be described in detail.

This invention

1) Isolating muscle stem cells from bovine skeletal muscle tissue;

2) culturing the cells of step 1) under conditions of 0 to 5% oxygen and 5 to 20 wt% serum concentration to proliferate undifferentiated muscle stem cells; and

3) culturing the undifferentiated muscle stem cells of step 2) in medium conditions of 5 to 20% oxygen and 0 to 5 wt% serum concentration to differentiate them into muscle fibers (myofibers); cultured beef meat comprising; Provides a muscle cell culture method for production.

The method of producing cultured meat includes the process of isolating cells within the muscle from the muscle, proliferating them, and differentiating them into the form of muscle.

The cells used at this time are muscle stem cells (Myosatellite cells), which are located around muscle fibers in the body and divide when the muscles are stimulated or injured and play the role of creating muscles.

Muscle stem cells are largely divided into muscle satellite cells (myosatellite cells (inactive state)) and myoblasts (activated state). During fetal development, some of the muscle progenitor cells develop into muscle satellite cells in a growth quiescent state before and after birth. This engrafts into the basal plate of the muscle fiber.

These cells are activated by external stimuli such as wounds and differentiate into myoblasts capable of division, ultimately forming muscle cells/tissues. The two muscle stem cells are appropriately balanced for muscle growth and are capable of mutual transformation.

Muscle production-inducing factors activate the PI3K (phosphatidylinositol-3 kinase)/Akt pathway within muscle cells and thereby induce muscle protein synthesis by phosphorylating lower-level proteins.

Myoblast differentiation and muscle formation are regulated by various factors. Among them, MyoD initiates the expression of specific genes related to myoblast muscle differentiation and induces myoblast differentiation. Myogenin and MHC (myosin heavy chain) regulated by MyoD induce fusion of myoblasts, leading to the formation of myotubes and muscle fibers. Myotube cells and muscle fibers formed through this process form bundles and ultimately form muscles.

Currently, most research on cultured meat production is conducted by isolating muscle stem cells from muscle tissue collected from live livestock or slaughtered carcasses. After sectioning the collected muscle tissue and dissociating it into single cells using proteolytic enzymes, density gradient centrifugation, separation by cell attachment time, cytochalasin B treatment, or surface marker factors of muscle stem cells (integrin α7, SM/C A common method is to isolate only muscle stem cells using (-26, CD34, CD56, CD29, etc.).

Isolated muscle stem cells are proliferated in a culture medium containing growth factors (EGF, IGF, FGF, HGF, etc.) and differentiation inhibitors (inhibition of Rock signaling, inhibition of BMP signaling, inhibition of p38 signaling, etc.) in a culture dish.

The culture medium of the present invention refers to a medium capable of supporting the growth and survival of muscle stem cells in vitro, and includes all common media used in the art suitable for culturing the obtained muscle stem cells, and Depending on the type, medium and culture conditions can be selected.

The medium used for culture is preferably cell culture minimum medium (CCMM), which generally contains a carbon source, a nitrogen source, and trace element components.

Cell culture minimal media include, for example, Dulbecco's Modified Eagle's Medium (DMEM), A-DMEM, Minimal essential Medium (MEM), Basal Medium Eagle (BME), RPMI1640, F-10, F-12, and α Minimal essential Medium (αMEM). ), GMEM (Glasgow's Minimal essential Medium), and IMEM (Iscove's Modified Dulbecco's Medium), etc., but are not limited thereto.

The medium may contain antibiotics such as penicillin, streptomycin, or gentamicin.

When cultivating animal cells, contamination by microorganisms occurs frequently, and such contamination must be prevented because it affects the growth and survival rate of cells.

In particular, more caution is required when extracting cells from livestock carcasses and performing basic culture, such as in the production of cultured meat, and various antibiotics and antifungal agents have been used in muscle stem cell culture to prevent contamination from various bacteria.

However, because there are issues with antibiotic residues in food and side effects that occur when consumed excessively, great care must be taken when using antibiotics to cultivate muscle stem cells for the production of cultured meat.

In addition to the known antibiotics described above, substances that prevent contamination by mycoplasma are also used in culture.

In the case of mycoplasma, unlike general bacteria, it does not have a cell wall and is resistant to antibiotics, causing great damage to cells when infected. To prevent this, mycoplasma-specific antibiotics (e.g. PlasmocinTM prophylactic) are commercially available. .

Cellular signaling molecules are essential factors for cell growth and maintenance.

The above substances are secreted from endocrine organs and surrounding stromal cells, and bind to receptors present in the cell membrane or cytoplasm to activate the signal transduction system involved in cell growth and differentiation. Therefore, through various combinations of these, characteristics such as cell growth and differentiation can be controlled and maintained.

The signaling substances are as follows, but are not limited to these.

PDGF, such as PDGF AA, PDGF BB; IGFs, such as IGF-I, IGF-II;

Fibroblast growth factors (FGF), such as acidic FGF, basic FGF, β-endothelial growth factor, FGF 4, FGF 5, FGF 6, FGF 7, FGF 8 and FGF 9;

Transforming growth factors (TGFs) such as TGF-P1, TGF β12, TGF-β2, TGF-β3, TGF-β5;

Bone morphogenetic proteins (BMPs) such as BMP 1, BMP 2, BMP 3, BMP 4;

Vascular endothelial growth factor (VEGF), such as VEGF, placental growth factor;

Epidermal growth factors (EGF), such as EGF, amphiregulin, betacellulin, heparin-binding EGF;

Interleukins, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14;

Colony stimulating factors (CSF) such as CSF-G, CSF-GM, CSF-M;

nerve growth factor (NGF); stem cell factor; Including, but not limited to, hepatocyte growth factor, and ciliary neurotrophic factor.

Amino acids are the basic units that form proteins and are essential elements added to culture media. They are added to cell culture medium and used for protein synthesis. They not only help cells grow, but are also used for energy production.

There are 20 types of amino acids used in the living body, including nonessential amino acids that can be synthesized in the living body and essential amino acids that cannot be synthesized and must be consumed through food.

Among the amino acids used in general serum-free media for animal cell culture, glutamine (L-glutamine) is excluded.

Glutamine (L-glutamine) is a type of non-essential amino acid that is not only used in protein synthesis but also can be used as an energy source along with carbohydrates, so it is one of the essential elements added to the culture medium. However, as glutamine is oxidized, ammonia is added to the culture medium. It may accumulate and become cytotoxic, and its half-life in aqueous solution is very short, so it can be used by adding it to the culture medium immediately before use, or a glutamine substitute (GlutaMAX™) can be used that minimizes accumulation of toxic ammonia and is stable over a wide temperature range. , a commercially available culture medium with glutamine substitute added can also be used.

Preferred amino acid components include arginine (L-Arginine), cysteine (L-Cystine), glycine (Glycine), histidine (L-Histidine), isoleucine (L-Isoleucine), leucine (L-Leucine), lysine (L -Lysine, L-Methionine, L-Phenylalanine, L-Serine, L-Threonine, LTryptophan, L-Tyrosine, L-Proline , alanine (L-Alanine), asparagine (L-Asparagine), valine (L-Valine), and at least one selected from the group consisting of salts thereof is preferred.

As the salt, hydrochloride (HCl), acetate (CH3COOH), etc. may be used.

Vitamins are necessary to maintain cell activity, and preferred ingredients include Folic Acid, Myo-Inositol, Niacinamide, Pyridoxine, Biotin, Riboflavin, and Thiamine. ) and at least one selected from the group consisting of salts thereof are preferred.

The salt may include hydrochloride (HCl), acetate (CH3COOH), etc.

Inorganic salts play a role in regulating the expression of cellular functions, and preferred ingredients include calcium chloride (CaCl2, anhydrous), potassium chloride (KCl), sodium chloride (NaCl), copper sulfate (CuSO4·5H2O), and ferric sulfate. (FeSO4·7H2O) At least one selected from the group consisting of magnesium chloride (MgCl2), disodium phosphate (Na2HPO4), zinc sulfate (ZnSO4·7H2O), and sodium phosphate (NaH2PO4·H2O) is preferred.

The step of isolating undifferentiated muscle stem cells in step 1) is performed using cell growth rate and a sorter.

The separation method using the cell growth rate was designed by Richler et al. (1970, Israel) to separate muscle stem cells, fibroblasts, and epithelial cells from cell populations obtained from muscle tissue by using the time difference in attachment to the culture dish according to the characteristics of the cells. It is a technique (pre-plating technique).

Since fibroblasts and epithelial cells attach to a culture dish and grow relatively faster than muscle stem cells, cells dissociated into single cells using trypsin, etc. are transferred to a new culture dish and subcultured, and cultured after 1 to 2 hours. Muscle stem cells can be recovered by collecting cells and culture medium that do not adhere to the dish.

The muscle stem cells of the present invention can be obtained from the skeletal muscle between the buttocks and hind legs of living cows and the sirloin, but are not limited thereto.

Additionally, the obtained muscle stem cells can be cultured in vitro.

Step 2) refers to a hypoxia state in which less oxygen exists than that of normal cell culture conditions.

The hypoxic state in step 2) may be a state where the oxygen concentration is 5 to 20%, but is not limited thereto.

The hypoxic state in step 2) can be maintained for 7 to 15 days.

The cells in step 2) may show high expression of muscle stem cell factors MYF5, MYOD, MYOG, and MYH1.

Cells in step 2) may have low expression of P53 and P21, factors related to muscle cell death.

Cells in step 2) may show high expression of the proliferation gene C-MYC.

Differentiation refers to a phenomenon in which the structure or function of a cell becomes specialized while the cell divides, proliferates, and grows.

The low serum medium of step 3) may contain 0 to 5% by weight of FBS, 0 to 3% by weight, and preferably 0 to 2% by weight of the medium, but is not limited thereto. .

Cells in step 3) may show high expression of differentiation-related factors MYF5, MYOG, and MYH1.

The cells in step 3) may be differentiated into multinucleated myotube cells through cell fusion.

The myotube cells may have an increased nuclear fusion rate.

Hereinafter, the present invention will be described in detail through examples.

However, the following examples illustrate the present invention, and the scope of the present invention is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present invention defined in the claims are also included in the scope of the present invention. belongs to

<Example 1> Isolation of bovine muscle stem cells

To recover bovine skeletal muscle-derived stem cells, 200 g of skeletal muscle, sirloin, and skeletal muscle between the hip and hind leg of the cow were recovered and moved to the laboratory to recover only the necessary tissues under sterile conditions.

Collagenase was added to the shredded tissue and cultured in an incubator for 30 minutes. Cells were attempted to be separated from the enzyme-treated tissue through pipetting and repeated suction and release using a 10ml syringe. After the cells were sufficiently separated, 30% FBS was added to inactivate the enzyme, and the enzyme was washed twice using D-PBS through a centrifuge.

Finally, the cell pellets were diluted with cell culture medium and seeded into a collagen-coated 25 T flask. After 2 hours, all supernatants were collected and transferred to a new collagen coated 25 T flask.

Rapid adhering cells (RAC), which are mostly made up of fibroblasts, cells that attach quickly, and slowly adhering cells (SAC), which are made up of myoblasts and satellite cells (named muscle derived stem like cells (MDSCs)) that attach relatively slowly compared to fibroblasts. Cells were separated by testing the characteristics of cells by attachment period (Wu et al., 2010, Cell Tissue Res).

Afterwards, the same method was performed a total of 4 additional times at 16-18 hour intervals. After the supernatant was recovered, 5 ml of new culture medium was added to the remaining flasks, and additional culture was performed in an incubator.

As a result of observing and comparing the in vitro muscle fiber differentiation ability in cells isolated using CD56+/CD29+ monoclonal antibodies and cells separated using a method of removing fibroblast-like cells three times, there was a difference in differentiation ability between the two groups when differentiated in vitro for 7 days. It was confirmed that there was no (Figure 2 a and b), and an experiment was conducted by removing fibroblast-like cells three times in terms of economy and efficiency.

<Example 2> Bovine muscle stem cell proliferation

2-1. Comparison of proliferation of muscle stem cells according to culture medium

When growing bovine muscle cells (proliferation), the proliferative ability of muscle stem cells according to the culture medium was confirmed.

When cultured with low-concentration serum promocell culture medium (+ 5% serum and serum substitute combination), changes in cell morphology and rapid aging were observed, while DMEM/F12 culture medium (+ 20% serum) showed normal cell morphology and rapid growth. Therefore, DMEM/F12 culture medium was used as a culture medium for growth (Figure 3).

2-2. Confirmation of muscle stem cell proliferation ability according to serum and oxygen concentration

The proliferative ability of cells was confirmed under low serum concentration (5% serum or serum substitute combination) and hypoxia (5% oxygen).

After seeding 1000 muscle cells/well in 24 wells, the cells were cultured for 2 weeks, and cells were recovered every 2 days to measure the cell number. The culture medium was DMEM/F12 as a basic culture medium, with serum and antibiotics added.

As a result, within the same serum concentration, 5% oxygen increased cell growth by more than two-fold, and adding 10% and 20% serum at 20% oxygen showed the same effect on cell number proliferation, and 5% serum/20 % oxygen showed a 4-fold lower cell count reduction effect than the 20% serum/5% oxygen condition (Figure 4).

The above results mean that in the cell proliferation stage, muscle cells are more affected by serum concentration than oxygen, and that at the same serum concentration, a decrease in oxygen promotes cell growth.

2-3. Confirmation of expression level of muscle stem cell markers according to serum and oxygen concentration

When cultured in vitro for 7 days, the expression level of muscle stem cell (Satellite cell) markers according to serum and oxygen concentration was confirmed through quantitative PCR.

The PCR primers used in the following experiments are listed in Table 1 below.

Primer Name Sequence bGAPDH_F TGCCGCCTGGAGAAACC bGAPDH_R CGCCTGCTTCACCACCTT bPAX3_F CCCAGAGGGCAAAGCTTACA bPAX3_R ACGCGGTTGCTAAACCA bMyoD_F CACGTCTAGCCAACCCCAAACCA bMyoD_R ATGGGCTGTGCGCAGGAT bMYF5_F CAGCCTCTCTCTCCCCAGTTG bMYF5_R AGGCCCCTGGAGTTGCA bBeta-actin_F CCTGCGGCATTCACGAA bBeta-actin_R GCGGATGTCGACGTCACA bMyoG_F CCGCCACGCTGAGAGAGA bMyoG_R GGCCTCGAAGGCTTCATTC bvimentin_F TCACCTGCGCGAATACCA bvimentin_R CGATGTCGAGCGCCATCT bMYH1F GCCAGACTGTAGAGCAGGGTATATAACG bMYH1 R GCAACCATCCACAGGAACATC bTERT F GCAGGTCCTACATCCAGTGTCA bTERT R TCCATGTCCCCATAGCAGAAG p21(CDKN1A)F CTCCCAGGGCCGAAA p21(CDKN1A)R GCGTTTGGAGTGGTAGAAATCTG bTP53F TTACCGCGGAGTATTTGG bTP53 R GGCACCACCACACTGTGTCTA bMYC F CATCCTGTCGGTCCAAGCA bMYC R CTCTTCTGCAACACGTCTATTTCTG

As shown in Figure 5, under three oxygen concentration (20 vs. 10 vs. 5%) and three serum (20 vs. 10 vs. 5%) concentration conditions,

The expression levels of PAX3, PAX7, and MYOD1, which are related to maintaining the characteristics of undifferentiated muscle stem cells, were at the level of 1-1.5 and were not significantly affected by oxygen and serum concentrations.

However, in the case of MYF5, MYOG, and MYH1, which are genes related to differentiation and maturation into muscle fibers, it was confirmed that gene expression increased when serum concentration decreased. MYF6, which is overexpressed in myotube fibers, did not change.

The above results mean that in the growth medium, muscle cells are more affected by serum concentration than oxygen, and at the same serum concentration, reduced oxygen activates genes leading to myocytes by promoting cell growth.

2-4. Confirmation of cell life-related and proliferation-related gene expression levels of muscle stem cells (satellite cells) according to serum and oxygen concentration

When cultured in vitro for 14 days, the expression levels of genes related to cell lifespan and proliferation of muscle stem cells (Satellite cells) were confirmed according to serum and oxygen concentration.

On the 7th day of growth culture, lowering the serum concentration decreased the expression of cell death pathway-related factors, CDKN1A (P21), TP53, BAX, and BCL2 (Figure 6).

On the 14th day of growth culture, lowering the serum concentration decreased the expression of the cell cycle arrest gene P21, and 20% serum decreased the expression of the telomere length repair enzyme TERT, which is involved in cell lifespan (Figure 7).

In addition, a decrease in p21 was confirmed dependent on a decrease in serum concentration, and a decrease in P21 dependent on a decrease in oxygen concentration was confirmed within the 20% serogroup. Regardless of serum concentration, the proliferation gene MYC was maintained at 5% oxygen concentration.

The above results show that 20% serum actively induces cell proliferation and leads to cell aging, but 10% and 5% serum preserve TERT and P21 due to relatively low proliferation ability, and within the 20% serum group, the 5% oxygen group This means that P21 and MYC are conserved.

<Example 3> Bovine muscle stem cell differentiation

3-1. Confirmation of muscle stem cell differentiation ability according to components and serum concentration of differentiation medium

When differentiating muscle stem cells, it was confirmed that adding TGFB1 to F-10 basic culture medium resulted in almost no differentiation, and adding dexamethasone also did not help differentiation. In addition, it was confirmed that the addition of IGF1 (Insulin like growth factor 1) had a positive effect on muscle stem cell maturation, so experiments were conducted using culture medium with IGF1 added to the basic culture medium for subsequent muscle stem cell differentiation.

Ham's F-10 differentiation medium (DM) and DMEM/F12 differentiation medium (DM) were used to induce differentiation in vitro for 7 days and then compared.

DMEM/F12 (10565) culture medium contained more than twice as much glucose, amino acids, and vitamine as F-10 (11550) culture medium, but both cultures did not contain proteins or growth factors.

After differentiation of muscle cells in vitro for 5-7 days, distribution of multinucleated cells according to muscle fiber development and fusion of muscle fibers was confirmed. The antibody was stained at 1:200 using monoclonal antimyosin heavychain (1:100, Sigma, Cat# M4276), and the secondary antibody was stained at 1:200 using goat anti mouse IgG. As shown in the following results, it was confirmed that the cells had multiple nuclei through fusion.

When cultured with Ham's F-10 differentiation medium,

5 VS. 2 VS. As a result of comparing the 0.5% serogroup, it was confirmed that serum concentration did not significantly affect differentiation, and low oxygen concentration did not affect muscle differentiation, but myostatin (MSTN) expression decreased in 5% serum and 5% oxygen conditions. (Figure 8).

When cultured in DMEM/F12 differentiation medium,

5 VS. 2 VS. In the 2% serum among the 0.5% serogroup, the expression of myog and myh1, which are involved in the final stage of miogenesis and muscle maturation, was increased, and the expression of myostatin (MSTN), which is secreted by myocytes and inhibits muscle cell growth, was decreased (Figure 9).

Comparing the case of culture with Ham’s F-10 differentiation medium and the case of culture with DMEM/F12 differentiation medium,

Compared to F10 culture medium, DMEM/F12 culture medium increased MYF5 by 51-fold compared to the maximum value, Myog increased by 3.7-fold, MSTN decreased by 0.6-fold compared to maximum value, and myh1 increased by 44.8-fold.

This shows that the composition of the differentiation medium is important (increasing the amount of amino acids, glucose, and vitamins in DMEM/F12) contributes to the differentiation and maturation of muscle cells, and that the serum concentration can be reduced from 5% to 2%.

3-2. Confirmation of muscle stem cell differentiation ability according to oxygen concentration

As a result of confirming the effect of oxygen concentration (5, 10, 20%) in serum-free differentiation culture medium,

It was confirmed that an increase in oxygen concentration does not contribute to differentiation and maturation into muscle fibers (Figure 10), and also affects the nuclear fusion rate [number of nuclei in myotube/total number of nuclei) It was confirmed that it could not be given (Figure 11).

In addition, as a result of confirming differentiation ability in DMEM/F12 differentiation medium at 20% oxygen and 0 to 5% serum concentration, the fusion rate increased in the case of serum-free (0%), but many undifferentiated cells disappeared and the total number of nuclei decreased, resulting in a decrease in the fusion rate. increased, and in the case of 20% oxygen, it was confirmed that 5%-2% of serum had a stable fusion rate (FIGS. 12a and b).

The above results mean that an increase in oxygen concentration does not contribute to differentiation and maturation into muscle fibers, and that the composition of the differentiation medium has more influence.

Based on the above results, the optimal growth culture medium, differentiation culture medium, and oxygen conditions are summarized in Table 2.

Medium Component company Final Concentration O2% Growth medium (GM) DMEM/F12 thermo fisher 10565 5%,
FBS 20% bFGF
Fibroblast growth factor Invitrogen 132560290-10ug 10 ng/ml HGF Gibco PHG0254-10ug 10 ng/ml IGF1
(Insulin like growth factor1) Sigma I3769-50ug 10 ng/ml, TGF -B1 Sigma h8541-5ug 2 ng/ml Dex
dexamethasone D8893-1MG
Gibco 10mM 10 nM Epidermal Growth Factor (EGF)
(recombinant human) 10ng/ml Penicillin-Streptomycin sigma-p4533 1X Difference medium (DM) DMEM/F12 thermo fisher 10565 5-20%
FBS 0-2% IGF1
(Insulin like growth factor1) Sigma I3769-50ug 10 ng/ml, Penicillin-Streptomycin sigma-p4533 1X

Claims (11)

1) Isolating muscle stem cells from bovine skeletal muscle tissue;
2) culturing the cells of step 1) in 5% oxygen and 5 to 20% by weight fetal bovine serum (FBS) for 7 to 15 days to proliferate undifferentiated muscle stem cells; and
3) The undifferentiated muscle stem cells of step 2) were cultured for 5 days under medium conditions of 5 to 20% oxygen, 0 to 2 wt% fetal bovine serum (FBS) concentration, and 5 to 20 ng/ml IGF1 (insulin like growth factor 1) concentration. A muscle cell culture method for producing cultured meat, comprising: culturing for one to seven days to differentiate into muscle fibers (myofiber).
delete According to clause 1,
Step 1) is a muscle cell culture method for producing cultured meat, characterized in that the cell growth rate and sorter are used.
delete According to clause 1,
A muscle cell culture method for producing cultured meat, wherein the cells in step 2) have increased expression of PAX3, PAX7, and MYOD1, factors related to maintaining stem cell characteristics.
According to clause 1,
A muscle cell culture method for producing cultured meat, wherein the cells in step 2) have reduced expression of P53 and P21, factors related to muscle cell death.
According to clause 1,
A muscle cell culture method for producing cultured meat, wherein the cells in step 2) have increased expression of C-MYC, a proliferation-related factor.
delete delete According to clause 1,
A muscle cell culture method for producing cultured meat, wherein the cells in step 3) have increased expression of differentiation-related factors MYF5, MYOG, and MYH1.
According to clause 1,
Step 3) A muscle cell culture method for producing cultured meat, wherein the cells have an increased nuclear fusion rate.