KR102649855B1 - A novel yeast strain producing mucic acid by fermenting galacturonic acid - Google Patents

Abstract

The present invention provides a novel yeast strain, Saccharomyces cerevisiae , which produces mucic acid by fermenting galacturonic acid, and an optimal method for increasing the production of mucic acid using the same. Regarding the culture method, the strain of the present invention has an improved consumption rate of galacturonic acid and an improved production capacity of mucic acid compared to existing strains, and has a significantly improved production capacity of mucic acid as biomass. have

Description

A novel yeast strain producing mucic acid by fermenting galacturonic acid}

The present invention relates to a new yeast strain, Saccharomyces cerevisiae , which produces meso-galactarate (mucic acid) by fermenting galacturonic acid, and to producing mucic acid using the same. ) is about the optimal culture method to increase the production of.

Mucic acid is known as a chemical substance widely used in the chemical, pharmaceutical, cosmetics, and food industries. In the chemical and cosmetic industries, mucic acid is used as a precursor for the production of nylon and PEF, and in the food industry it is used in self-rising flour, flavoring agents, etc. Despite these commercial uses, mucic acid is produced by nitric acid oxidation of galactose or electrooxidation of D-galacturonic acid, and the demand for biologically based production methods is increasing along with concerns about health and the environment. there is.

In particular, galacturonic acid, the substrate of mucic acid, is the main component of pectin and is mainly contained in pectin-rich biomass such as citrus peel waste (CPW) and sugar beet pulp. In particular, it is estimated that at least 10 million tons of citrus peel waste is generated every year worldwide, and the financial burden of disposing of it is significant, so there is a need to build a circular economy model such as biological conversion through fermentation.

Korea also produces about 500,000 tons of citrus fruits annually, and about 60,000 tons of citrus peel waste is generated through the processing process, and about 50,000 tons are discarded as non-commodity fruits, causing environmental and economic problems. However, effective measures to utilize next-generation biomass are not yet in place.

Meanwhile, Saccharomyces cerevisiae is known as a GRAS microorganism, has high organic acid tolerance, and is easy to supply cofactors such as NADH. In a previous study, mucic acid was produced by engineered Saccharomyces cerevisiae , but it was limited by a very low production rate.

Accordingly, while researching a new strain that produces biofuel by fermenting galacturonic acid, the present inventors introduced udh genes from three different bacteria into Saccharomyces cerevisiae to produce mucic acid. A strain capable of producing acid was developed, and as a result, it was discovered that the production of mucic acid, which can be used as biofuel, was greatly increased, leading to the completion of the present invention.

KR-10-2017-009521

The purpose of the present invention is to provide a strain of Saccharomyces cerevisiae that has the ability to produce mucic acid by fermenting galacturonic acid, and the Saccharomyces cerevisiae of the present invention Because the Seth cerevisiae strain has excellent mucic acid production ability, it can be used in citrus peel waste treatment and biofuel industries.

In order to achieve the above object, the present invention provides a Saccharomyces cerevisiae strain consisting of accession number KCTC 14701BP.

In one embodiment of the present invention, the “strain” is characterized by introducing a codon optimized Ps-udh gene consisting of SEQ ID NO: 2.

In one embodiment of the present invention, the “strain” is characterized by improved mucic acid production ability, but is not limited thereto.

In one embodiment of the present invention, the “strain” is characterized by improved galacturonic acid consumption, but is not limited thereto.

In one embodiment of the present invention, the “strain” is characterized by supplying NAD+ upon introduction of a codon optimized Ps-udh gene, but is not limited thereto.

In addition, the present invention includes a first step of fermenting the Saccharomyces cerevisiae strain of any one of claims 1 to 5 in a medium; In step 1, 1 to 20 g/L yeast extract, 2 to 40 g/L peptone, 10 to 100 g/L xylose, and 5 to 100 g/L pectin are added. step; and a method for producing mucic acid, including three steps of recovering mucic acid from the medium or the strain.

In one embodiment of the present invention, “pectin” is characterized as being citrus peel waste treated by a hydrothermal pretreatment method, but is not limited thereto.

The present invention relates to a transformed Saccharomyces cerevisiae strain, which is a yeast strain with improved galacturonic acid fermentation ability, and its use. According to the strain and culture method of the present invention, Compared to existing strains, the production of mucic acid is significantly increased, and the mucic acid can be used in various industrial fields such as biofuel.

Figure 1 is a schematic diagram showing the intracellular metabolic pathway that converts galacturonic acid to mucic acid in the Saccharomyces cerevisiae strain into which udh has been introduced.
Figure 2 shows the results of comparing galacturonic acid consumption and mucic acid production by cell concentration of Saccharomyces cerevisiae strains into which three types of udh genes derived from different fungi were introduced. am.
Figure 3 shows pectin-derived galacturonic acid consumption and mucic acid according to nitrogen concentration and xylose concentration of Saccharomyces cerevisiae Ps-udh* strain into which the codon optimized Ps-udh gene was introduced. This diagram shows the results of comparing production volumes.
Figure 4 shows galacturonic acid consumption and mucic acid derived from citrus peel waste according to differences in water treatment methods of the Saccharomyces cerevisiae Ps-udh* strain into which the codon optimized Ps-udh gene was introduced. ) This diagram shows the results of comparing production volumes.

Hereinafter, the present invention will be described in detail through embodiments of the present invention with reference to the attached drawings. However, the following implementation examples are provided as examples of the present invention, and if it is judged that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , the present invention is not limited thereby. The present invention is capable of various modifications and applications within the description of the patent claims described below and the scope of equivalents interpreted therefrom.

In addition, the terminology used in this specification is a term used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator or the customs of the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when it is said that a part “includes” a certain element, this means that it may further include other elements rather than excluding other elements, unless specifically stated to the contrary.

In one aspect, the present invention relates to a Saccharomyces cerevisiae strain consisting of accession number KCTC 14701BP.

The Saccharomyces cerevisiae strain of the present invention is a GRAS-type yeast with high tolerance to various stresses such as organic acids and heat, but the natively Saccharomyces cerevisiae strain is xylose. And arabinose (L-arabinose) and galacturonic acid cannot be metabolized, so strain improvement is necessary.

Accordingly, the present inventors established a recombinant Saccharomyces cerevisiae strain into which a codon optimized Ps-udh gene was introduced.

Hereinafter, the strain establishment method and the mucic acid production method according to culture will be described in more detail through examples.

<Example 1> Materials and methods

<1-1> Strain construction by Cas9-based genome editing

All strains were constructed using the CRISPR-Cas9 system (Jeong et al., 2020b). The guide RNA (gRNA) plasmids used in this study are listed in Table 2 and were produced by high-speed cloning method (Li et al., 2011). The 23 nucleotides (unique 20 bp + NGG) of the generated guide RNA (cg#1) were designed through Sequence Manipulation Suite (http://www.bioinformatics.org/sms2), and off-targets were identified using GGGenome. . The Saccharomyces cerevisiae S288C genome was referenced and searched using the GGGenome search engine (https://gggenome.dbcls.jp/sacCer3/). Finally, the cg#1 sequence was selected as 5'-GTACACCTACCCGTCACCGG AGG. To construct the pRS42H-cg#1 gRNA plasmid, the template plasmid, pRS42H-INT#4 gRNA plasmid (Jeong et al., 2020b), was PCR amplified with primers Kim191/Kim192 (Tables 2 and 3). Then, the PCR product was treated with DpnI and used to transform E. coli TOP10. Transformants were selected on LBA agar plates. The cg#1 sequence is confirmed by Sanger sequencing using universal primers for the T3 promoter (see Table 2).

Donor DNA fragments were produced through polymerase chain reaction (PCR) using the primers listed in Table 3. In order for each donor DNA fragment to be assembled in vivo and introduced into the chromosome, a chromosome base sequence of 20-40 bp in length was constructed on both sides of the donor DNA fragment to induce homologous recombination. Donor DNA for the L-arabinose pathway expression cassette (int#7::PFBA1-lad1-TFBA1-PPGK1-alx1-TCYC1) was obtained from Saccharomyces cerevisiae YE9 strain (Jeong et al., 2020b). PCR amplification was performed from the genome with template DNA and integrated intergenic region #7 (int#7) with Kim490/Kim491 primers. For udh gene expression, first, two donor DNAs (PCCW12 and TTDH3) for the expression cassette (PCCW12-cg#1-TTDH3) were PCR amplified with primers Kim379/Kim1199 and Kim1200/Kim396, respectively, and intergenic region #4 (int Integrated into #4). The udh genes derived from Agrobacterium tumefaciens GV3101 (Atudh), Pseudomonas putida ATCC12633 (Ppudh), and Pseudomonas syringae KACC15103 (Psudh) and the optimized synthetic codon Psudh* (Psudh-amplified*) are Kim677/Kim758, Kim675/Kim757, Kim673/Kim7 56 and Kim686/Kim759 primers were used respectively and integrated into the cg#1 region of the expression cassette (int#4::PCCW12-cg#1-TTDH3) to perform PCR amplification, resulting in At-udh, Pp-udh, Ps- udh and Ps-udh* strains were generated. Correct assembly and integration was confirmed by yeast colony PCR using kim322/Kim323 primers. Finally, yeast transformation was performed as in a previous study (Jeong et al., 2020b).

That is, the inserted udh genes are Pseudomonas syringae KACC15103 (Psudh), Pseudomonas putida ATCC12633 (Ppudh), and Agrobacterium tumefaciens GV3101 (Atudh), and Psudh* corresponds to the codon-optimized Psudh gene (see Table 1). Additionally, the base sequences of Psudh and Psudh* correspond to Table 4.

strain
(Saccharomyces cerevisiae) Description of relevant genotypes cited literature D452-2 Wild-type; Matα leu2 his3 ura3 (Hosaka et al., 1992) DY02 Xylose utilizing-engineered strain (Jeong et al., 2020a) DY23 Xylose and L-arabinose utilizing-engineered strain;
DY02 int#7::PFBA1-lad1-TFBA1-PPGK1-alx1-TCYC1 int#4::PCCW12-cg#1*-TTDH3 This study At-udh DY23 int#4::PCCW12-Atudh-TTDH3 This study Pp-udh DY23 int#4::PCCW12-Ppudh-TTDH3 This study Ps-udh DY23 int#4::PCCW12-Psudh-TTDH3 This study Ps-udh* DY23 int#4::PCCW12-Psudh*-TTDH3 This study δPs-udh* Ps-udh* leu2::LEU2-pYS-δPsudh* This study

Plasmids Description of relevant plasmids cited literature pRS41N-Cas9 pRS41N plasmid with a natNT marker and Cas9 (Kim et al., 2015) pRS42H-INT#4 pRS42H plasmid with a hph marker and gRNA block containing 23-bp near ASF1 sequence (Jeong et al., 2020b) pRS42H-INT#7 pRS42H plasmid with a hph marker and gRNA block containing 23-bp near YGR190C sequence (Jeong et al., 2020b) pRS42H-cg#1 pRS42H plasmid with a hph marker and gRNA block containing 23-bp sequence (5’-GTACACCTACCCGTCACCGG AGG) This study pYS-δPsudh* pRS305 PTDH3-Psudh*-TTDH3 This study

Primers Sequences (5’-) Description Kim191 CACCTACCCGTCACCCG GTTTTAGAGCTAGAAATAGCAAG FC_cg#1-F Kim192 CGGTGACGGGTAGGTGTAC GATCATTTATCTTTCACTGCG FC_cg#1-R Kim490 GGCACTAGGAGCATTTGTCG Donor_INT#7_F Kim491 GTCCCTTAGGGTGCGTATAATG Donor_INT#7_R Kim379 TTCCTCGGGCAGAGAAACTCGCAGGCAACTTG CACGCAAAAGAAAACCTT Donor_CCW12p_F Kim1199 CCTCCGGTGACGGGTAGGTGTAC TATTGATATAGTGTTTAAGCGAAT Donor_CCW12p_R Kim1120 GTACACCTACCCGTCACCGGAGG GTGAATTTACTTTAAATCTTGC Donor_TDH3t_F Kim396 CCTCTGTGAGGGCCGATTATGCAGGCCTAGA ATCCTGGCGGAAAAAATTC Donor_TDH3t_R Kim677 TCATTCGCTTAAACACTATATCAATAAAAA ATGAAACGGCTTCTTGTTACC Donor_Atudh_F Kim758 ATTTAAATGCAAGATTTAAAGTAAATTCACTCA TCAGCTCTGTTTGAAGATCG Donor_Atudh_R Kim675 TCATTCGCTTAAACACTATATCAATAAAAA ATGACCACTACCCCCTTC Donor_Ppudh_F Kim757 ATTTAAATGCAAGATTTAAAGTAAATTCACTCA TCAGTTGAACGGGCCG Donor_Ppudh_R Kim673 TCATTCGCTTAAACACTATATCAATAAAAA ATGGCATCGGCTCATACC Donor_Psudh_F Kim756 ATTTAAATGCAAGATTTAAAGTAAATTCACTTA TTATTTATCGCCGAACGGTC Donor_Psudh_R Kim686 TCATTCGCTTAAACACTATATCAATAAAAA ATGGCTTTCTGCTCACAC Donor_Psudh*_F Kim759 ATTTAAATGCAAGATTTAAAGTAAATTCACTTA TTACTTGTCACCGAATGGAC Donor_Psudh*_R Kim322 GCGCATCTATTTGCCGTC Conf_INT#4_F Kim323 TCACGACACACCTCACTG Conf_INT#4_R Kim549 GCATCCTTTGCCTCTCGTTC Seq_CCW12p_F Kim1119 GTGGTGTCTCTCGTTGAAAGA qPCR_Psudh*_F Kim1120 CGGTGGTTAGAAGAAGCGAAGA qPCR_Psudh*_R gRNA guide RNA and PAM sequences (5’-) References INT#4 CTCTCGAAGGTGGTCACGTGC GGG (Jeong et al., 2020b) INT#7 GATACTTATCATTAAGAAAA TGG (Jeong et al., 2020b) cg#1 GTACACCTACCCGTCACCGG AGG This study

sequence number Base sequence (5’-) Psudh
(Wild-type Psudh ) One ATGGCATCGGCTCATACCACTCAAACTCCCTTCAATCGCCTCCTGCTGACCGGTGCTGCAGGCGGCCTGGGCAAGGTATTGCGCGAGACATTGCGCCCTTACTCACACATTCTGCGACTCTCTGATATCGCCGAGATGGCGCCCGCGGTCGGCGACCATGAAGAAGTGCAGGTCTGCGATCTGGCGGACAAAGACGCCGTACACCGTCTGGTCGAAGGCGTGGACGCCATTCTGCATTTTGGCGGCGTGTCGGTCGAACGG CCTTTCGAGGAAATCCTCGGCGCTAATATCTGCGGCGTGTTCCATATCTACGAGGCCGCCCGCCGGCATGGCGTGAAACGCGTGATCTTCGCCAGCTCCAACCATGTGATCGGTTTCTACAAGCAGAACGAAACCATCGACGCGCACTCCCCGCGCCGCCCGGACAGCTACTATGGTTTGTCCAAGTCCTACGGCGAAGACATGGCCAGCTTCTACTTTGATCGTTACGGCATCGAAACCGTCAGCATCCGCATCGGCT CGTTCCCTGAACCACAGAACCGCAGAATGATGAGCACCTGGCTGAGCTTCGATGACCTGACCCGGTTGCTCGAGCGCGCCCTGTACACGCCGGACGTCGGCCACACCGTGGTGTATGGCGTGTCGGACAACAAGACCGTGTGGTGGGACAACCGCTTTGCCAGCAAACTGGACTACGCCCCTAAAGACAGCTCGGAGGTCTTCCGCGCCAAGGTCGACGCCCAGCCAATGCCGGGCGGACGACGACCCGGCAATGGTTTA CCAGGGCGGGTGCGTTTGTAGCGTCCGGACCGTTCGGCGATAAATAA Psudh*
(Codon-optimized Psudh )
2 ATGGCTTCTGCTCACACTACTCAAACTCCATTCAACAGATTGTTGTTGACTGGTGCTGCTGGTGGTTTGGGTAAGGTTTTGAGAGAAACTTTGAGACCATACTCTCACATCTTGAGATTGTCTGACATCGCTGAAATGGCTCCAGCTGTTGGTGACCACGAAGAAGTTCAAGTTTGTGACTTGGCTGACAAGGACGCTGTTCACAGATTGGTTGAAGGTGTTGACGCTATCTTGCACTTCGGTGGTGTCTCCGTTGAAAG ACCATTCGAAGAAATCTTGGGTGCTAACATCTGTGGTGTTTTCCACATCTACGAAGCTGCTAGAAGACACGGTGTTAAGAGAGTTATCTTCGCTTCTTCTAACCACGTTATCGGTTTCTACAAACAAAATGAAACTATCGACGCTCACTCTCCAAGAAGACCAGACTCTTACTACGGTTTGTCTAAGTCTTACGGTGAAGACATGGCTTCTTTCTACTTCGACAGATACGGTATCGAAACTGTTTCTATCAGAATCGGTTCT TCTTTCCCAGAACCACAAAACAGAAGAATGATGTCTACTTGGTTGTCTTTCGACGACTTGACTAGATTGTTGGAAAGAGCTTTGTACACTCCAGACGTTGGTCACACTGTTGTTTACGGTGTTTCTGACAACAAGACTGTTTGGTGGGACAACAGATTCGCTTCTAAGTTGGACTACGCTCCAAAGGACTCTTCTGAAGTTTTCAGAGCTAAGGTTGACGCTCAACCAATGCCAGCTGACGACGACCCAGCTATGGTTTACCAAGG TGGTGCTTTCGTTGCTTCTGGTCCATTCGGTGACAAGTAA

<1-2> Culture conditions and flask fermentation

Recombinant yeast strains and plasmids used in this study are listed in Tables 1 and 2. S. cerevisiae was fermented at 30°C in yeast extract-peptone (YP) medium containing 20 g/L (10 g/L yeast extract, 20 g/L peptone). The medium used for yeast transformation was YPD agar plates supplemented with antibiotics (100 μg/mL nourseothricin sulfate, 300 μg/mL hygromycin B). Plasmid DNA was amplified using Escherichia coli TOP10 (Invitrogen, Carlsbad, CA, USA). Escherichia coli was cultured in Luria-Bertani medium (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl) supplemented with 100 μg/mL ampicillin (LBA) at 37°C.

After preculturing for 24 hours in YP medium containing 20 g/L of glucose at 250 rpm, yeast cells were harvested by centrifugation at 3,134 xg for 10 minutes at 4°C and washed with distilled water. Adjust the initial cell concentration to an optical density at 600 nm (OD600) of 1.0, 20.0 or 50.0 (OD600 1.0 = 0.5 g of dry cells/L) and cell pellet in 20 g/L D-galacturonic acid and xylose 40. g/L was inoculated into 10 mL of YP medium containing the substrate. This culture was performed at two temperatures (30 or 35°C) in a 50 mL Erlenmeyer flask under oxygen conditions (Oxygen-limited, 130 rpm; Oxygen, 250 rpm). Pectin fermentation was performed in YP medium containing various pectins (0, 2.5, 5.0, 7.5, 10.0% (w/w)) and xylose as substrates, and all experiments were performed in biological triplicate.

<1-3> Ingredient analysis using High Performance Liqui Chromatography (HPLC)

The quantification of glucose, xylose, D-galacturonic acid, mucic acid, and ethanol was analyzed using an RI detector and high-performance liquid chromatography (HPLC 1260 series, Agilent Technologies, USA). Specifically, the column was eluted with 0.005NH ₂ SO ₄ at 0.6 mL/min and 50°C, and for analysis, the culture medium was diluted to a mucic acid concentration of 3 g/L or less, and adjusted to pH 7.0 or higher at 7.5. N NaOH was added and mixed for 5 minutes.

<Example 2> Confirmation of mucic acid production capacity

Galacturonic acid consumption and music acid ( mucic acid) production was compared. When comparing galacturonic acid consumption over 96 h, the largest amount of galacturonic acid was converted to mucic acid in the strain expressing Ps-udh.

In addition, as a result of fermentation by increasing the cell concentration from 0.5 g/L to 25 g/L, the fermentation speed was seen to be more than twice as fast, and when the codon optimized Ps-udh* gene was expressed, the largest amount of mu was produced. Produced mucic acid. At this time, all 20 g/L galacturonic acid was consumed to produce 21.8 g/L mucic acid, so the production yield was 1.1 g/g, which was consistent with the theoretical yield, and the productivity was 0.61. It was the highest among the results reported so far in g/L-h (see Table 5 and Table 6).

Strain Initial cell
(gDCW/L) Xylose
Consumed
(g/L) galUA
Consumed
(g/L) mucic acid Produced
(g/L) Yield
(g/g galUA) Volumetric productivity
(g/Lh) Specific productivity
(g/g DCW-h) Control 0.5 35.4 ± 0.1 5.8 ± 0.1 n.d. n.d. n.d. n.d. At-udh 37.0 ± 0.3 10.5 ± 0.8 11.1 ± 0.5 1.02 ± 0.08 0.15 ± 0.01 0.04 ± 0.01 Pp-udh 37.2 ± 0.3 11.8 ± 0.7 12.7 ± 0.8 1.04 ± 0.09 0.18 ± 0.01 0.04 ± 0.00 Ps-udh 37.2 ± 0.3 12.7 ± 0.2 13.6 ± 0.2 1.05 ± 0.02 0.19 ± 0.00 0.04 ± 0.00 Control 25.0 34.5 ± 0.1 9.4 ± 0.6 n.d. n.d. n.d. n.d. At-udh 34.0 ± 0.1 18.0 ± 0.6 18.8 ± 0.0 1.05 ± 0.00 0.52 ± 0.00 0.02 ± 0.00 Pp-udh 34.0 ± 0.1 17.5 ± 0.4 17.9 ± 0.0 1.04 ± 0.00 0.50 ± 0.00 0.02 ± 0.00 Ps-udh 33.8 ± 0.1 17.7 ± 0.1 17.3 ± 0.0 0.98 ± 0.00 0.48 ± 0.00 0.02 ± 0.00 Ps-udh* 34.3 ± 0.3 20.3 ± 0.3 21.8 ± 0.0 1.08 ± 0.00 0.61 ± 0.00 0.02 ± 0.00

Production host udh gene Genotype Fermentation conditions Substrates (g/L) Time (h) mucic acid produced
(g/L) mucic acid yield (g/g) Reference Escherichia coli BL21(DE3) At ΔuxaC ΔgarD minimal
37℃, 250rpm 10 galUA,
10Glu
10Ara 48 10.3 1.05 (Zhang et al., 2016) Trichoderma reesei QM6a At* Δgar1 minimal (pH 5.0)
30℃, 200rpm 17 galUA
2 Glu 211 12.1 0.86 (Mojzita et al., 2010) Aspergillus niger ATCC1015 At* ΔgaaA minimal (pH 5.0)
30℃, 200rpm 17 galUA
2 Glu 211 0.7 0.08 (Mojzita et al., 2010) Aspergillus niger ATCC1015 At* ΔgaaA Δ39114 complex (pH 5.0)
30℃, 250rpm 20 galUA 120 4.0 1.08 (Kuivanen et al., 2016) Trichoderma reesei VTT
D-161646 At* Δgar1 complex (pH 4.0)
35℃, 400rpm, 0.5vvm 2.9% pectin
14 Lac 185 21.0 1.10 (Paasikallio et al., 2017) Trichoderma sp. LF328 T2 At* Δgar2 complex (pH 5.5)
28℃, 800 rpm microplate 8 galUA
10 Lac 168 8.0 1.20 (Vidgren et al., 2020) Coniochaeta sp. C1 At* Δgar2 complex (pH 5.5)
28℃, 800 rpm microplate 8 galUA
11 g/L Glu 168 5.1 0.82 (Vidgren et al., 2020) Trichoderma sp. LF328 T2 At* Δgar2 complex (pH 4.0)
35℃, 300-700rpm, 0.6vvm 66 galUA (Fed-batch)
22 Glu 192 25.4 1.08 (Vidgren et al., 2020) Saccharomyces cerevisiae
BY4742 At NcGAT-1 minimal (pH 6.0)
30℃, 750rpm 19 galUA One 0.016 - (Benz et al., 2014) Saccharomyces cerevisiae
BY4741 PS AngatA minimal
30℃, 18 × g 50%CPW
200 Glu (Fed-batch) 80 8.0 - (Protzko et al., 2018) Saccharomyces cerevisiae
Ps-udh* Ps* Pentose pathway** complex
30C, 250 rpm 20 galUA
40Xyl 48 21.8 1.08 This study

<Example 3> Confirmation of pectin fermentation muciic acid production capacity

For simultaneous saccharification fermentation of pectin, yeast extract and peptone, which are nitrogen sources, were treated at various concentrations. 0x (control; when the nitrogen source is not treated), 0.1x (1 g/L yeast extract, 2 g/L peptone), 0.5x (2 g/L yeast extract, 4 g/L peptone), 1.0x (10 As a result of comparing the mu acid production capacity from nitrogen sources of different concentrations (g/L yeast extract, 20 g/L peptone) and 2.0x (20 g/L yeast extract, 40 g/L peptone), It produced the largest amount of mucic acid. At this time, a maximum of 19.2 g/L mucic acid was produced over 48 hours (see Figure 3a).

In addition, for the simultaneous saccharification fermentation of pectin, the musitic acid production ability was compared by adding different concentrations of xylose at 0, 10, 20, 40, 60, 80, and 100 g/L, and the results showed that xylose above 60 g/L When added, the largest amount of mucic acid was produced (see Figure 3b).

As a result of comparing the musitic acid production ability at different concentrations of pectin for simultaneous saccharification fermentation of pectin, the production yield at a pectin concentration of 2.5% or less was close to the theoretical yield of 1.08 g/g (see Figure 3c).

<Example 4> Confirmation of citrus peel waste fermentation mu-sic acid production capacity

After pretreatment of citrus peel waste using two different methods, the production capacity of mucic acid through simultaneous saccharification fermentation was compared. As a result of comparing the dilute acid pretreatment method (1% H2SO4, 121 C, 15 minutes) and the hydrothermal pretreatment method (121 C, 15 minutes), citrus peel waste treated with the dilute acid pretreatment method did not produce muic acid at all (Figure 4a). In the citrus peel waste treated with the hydrothermal pretreatment method, a total of about 21.0 g/L of mu acid was produced over 36 hours (see Figure 4b).

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC14701BP 20210915

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> A novel yeast strain producing mucic acid by fermenting galacturonic acid <130>PN2107-330 <150> KR 10-2020-0118104 <151> 2020-09-15 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 828 <212> DNA <213> Pseudomonas syringae <400> 1 atggcatcgg ctcataccac tcaaactccc ttcaatcgcc tcctgctgac cggtgctgca 60 ggcggcctgg gcaaggtatt gcgcgagaca ttgcgccctt actcacacat tctgcgactc 120 tctgatatcg ccgagatggc gcccgcggtc ggcgaccatg aagaagtgca ggtctgcgat 180 ctggcggaca aagacgccgt acaccgtctg gtcgaaggcg tggacgccat tctgcatttt 240 ggcggcgtgt cggtcgaacg gcctttcgag gaaatcctcg gcgctaatat ctgcggcgtg 300 ttccatatct acgaggccgc ccgccggcat ggcgtgaaac gcgtgatctt cgccagctcc 360 aaccatgtga tcggtttcta caagcagaac gaaaccatcg acgcgcactc cccgcgccgc 420 ccggacagct actatggttt gtccaagtcc tacggcgaag acatggccag cttctacttt 480 gatcgttacg gcatcgaaac cgtcagcatc cgcatcggct catcgttccc tgaaccacag 540 aaccgcagaa tgatgagcac ctggctgagc ttcgatgacc tgacccggtt gctcgagcgc 600 gccctgtaca cgccggacgt cggccacacc gtggtgtatg gcgtgtcgga caacaagacc 660 gtgtggtggg acaaccgctt tgccagcaaa ctggactacg cccctaaaga cagctcggag 720 gtcttccgcg ccaaggtcga cgcccagcca atgccggcgg acgacgaccc ggcaatggtt 780 taccagggcg gtgcgtttgt agcgtccgga ccgttcggcg ataaataa 828 <210> 2 <211> 828 <212> DNA <213> Pseudomonas syringae <400> 2 atggcttctg ctcacactac tcaaactcca ttcaacagat tgttgttgac tggtgctgct 60 ggtggtttgg gtaaggtttt gagagaaact ttgagaccat actctcacat cttgagattg 120 tctgacatcg ctgaaatggc tccagctgtt ggtgaccacg aagaagttca agtttgtgac 180 ttggctgaca aggacgctgt tcacagattg gttgaaggtg ttgacgctat cttgcacttc 240 ggtggtgtct ccgttgaaag accattcgaa gaaatcttgg gtgctaacat ctgtggtgtt 300 ttccacatct acgaagctgc tagaagacac ggtgttaaga gagttatctt cgcttcttct 360 aaccacgtta tcggtttcta caaacaaaat gaaactatcg acgctcactc tccaagaaga 420 ccagactctt actacggttt gtctaagtct tacggtgaag acatggcttc tttctacttc 480 gacagatacg gtatcgaaac tgtttctatc agaatcggtt cttctttccc agaaccacaa 540 aacagaagaa tgatgtctac ttggttgtct ttcgacgact tgactagatt gttggaaaga 600 gctttgtaca ctccagacgt tggtcacact gttgtttacg gtgtttctga caacaagact 660 gtttggtggg acaacagatt cgcttctaag ttggactacg ctccaaagga ctcttctgaa 720 gttttcagag ctaaggttga cgctcaacca atgccagctg acgacgaccc agctatggtt 780 taccaaggtg gtgctttcgt tgcttctggt ccattcggtg acaagtaa 828

Claims (8)

Saccharomyces cerevisiae (Accession number: KCTC 14701BP) strain was mixed with 1 to 20 g/L yeast extract, 2 to 40 g/L peptone, 60 g/L xylose and Step 1 of fermentation in a medium containing 5 to 100 g/L of pectin; and
A method for producing mucic acid, comprising two steps of recovering mucic acid from the medium or the strain. According to paragraph 1,
The Saccharomyces cerevisiae (Accession number: KCTC 14701BP) strain is represented by the base sequence of SEQ ID NO: 2 and is a mu strain into which a udh gene encoding Uronate Dehydrogenase has been introduced. Method for producing mucic acid. According to paragraph 1,
A method of producing mucic acid, wherein the Saccharomyces cerevisiae (Accession number: KCTC 14701BP) strain has improved mucic acid production ability. According to paragraph 1,
A method for producing mucic acid, wherein the Saccharomyces cerevisiae (Accession number: KCTC 14701BP) strain has improved galacturonic acid consumption. delete delete According to paragraph 1,
The pectin is a method of producing mucic acid, which is citrus peel waste treated by a hydrothermal pretreatment method. A composition for producing mucic acid, comprising a strain of Saccharomyces cerevisiae (Accession number: KCTC 14701BP).