KR102640587B1 - Nucleic acid-polypeptide compositions and uses thereof - Google Patents

Abstract

Disclosed herein are compositions and pharmaceutical formulations comprising polynucleic acid molecules and binding moieties conjugated to polymers. Also described herein are methods of treating cancer using compositions or pharmaceutical agents comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer.

Description

Nucleic acid-polypeptide compositions and uses thereof

cross-reference

This application claims priority from U.S. Provisional Application No. 62/316,919, filed April 1, 2016, which is incorporated herein by reference.

sequence list

This application contains a sequence listing filed electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy created on March 28, 2017 is named 45532-707_601_SL.txt and is 615,666 bytes in size.

Gene repression by RNA-guided gene silencing provides several levels of control: transcriptional inactivation, small interfering RNA (siRNA)-induced mRNA degradation, and siRNA-induced transcriptional attenuation. In some cases, RNA interference (RNAi) provides long-lasting effects over multiple cell divisions. As such, RNAi is a viable method useful for drug target validation, gene function analysis, pathway analysis, and disease therapeutics.

Abramova et al., "Novel oligonucleotide analogues based on morpholino nucleoside subunits-Antisense technologies: New chemical possibilities", Indian Journal of Chemistry, Vol. 48B, December 2009, pp. 1721-1726 Baumer et al., “Antibody-Mediated Delivery of Anti-KRAS-siRNA In Vivo Overcomes Therapy Resistance in Colon Cancer”, Clin Cancer Res. 2015 Mar 15;21(6): 1383-94 Singh et al., “Recent developments in oligonucleotide conjugation”, Chem. Soc. Rev., 2010, 39, 2054-2070

In certain embodiments, disclosed herein are compositions and pharmaceutical formulations comprising binding moieties conjugated to polynucleic acid molecules and polymers. In some embodiments, also described herein are methods of treating a disease or condition (e.g., cancer) using compositions or pharmaceutical agents comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer.

In certain embodiments, disclosed herein are molecules of formula (I):

A-X-B-Y-C

<Formula I>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker; and

Y is a bond or second linker;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties.

In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Contains dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides. do. In some embodiments, the one or more 2' modified nucleotides comprise locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some embodiments, the one or more modified internucleotide linkages comprise a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, one or more inverted base moieties are at at least one terminus.

In some embodiments, the polynucleotide comprises a single strand. In some embodiments, the polynucleotide comprises two or more strands. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises one or more modifications.

In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide and the second polynucleotide are siRNA molecules.

In some embodiments, the first polynucleotide is at least 60%, 65%, 70%, Includes sequences having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the first polynucleotide consists of a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

In some embodiments, the second polynucleotide is at least 60%, 65%, 70%, Includes sequences having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the second polynucleotide consists of a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

In some embodiments, X and Y are independently binding or non-polymeric linker groups. In some embodiments, X is a bond. In some embodiments, X is a C ₁ -C ₆ alkyl group. In some embodiments, Y is a C ₁ -C ₆ alkyl group. In some embodiments, X is a homobifuctional linker or heterobifunctional linker, optionally conjugated to a C ₁ -C ₆ alkyl group. In some embodiments, Y is a homobifunctional linker or a heterobifunctional linker.

In some embodiments, the binding moiety is an antibody or binding fragment thereof. In some embodiments, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), Includes diabodies, minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some embodiments, the antibody or binding fragment thereof is an anti-EGFR antibody or binding fragment thereof.

In some embodiments, C is polyethylene glycol. In some embodiments, C has a molecular weight of about 5000 Da.

In some embodiments, A-X is joined to the 5' end of B and Y-C is joined to the 3' end of B. In some embodiments, Y-C is joined to the 5' end of B and A-X is joined to the 3' end of B. In some embodiments, A-X, Y-C, or a combination thereof is conjugated to an internucleotide linking group.

In some embodiments, the molecule further comprises D. In some embodiments, D is conjugated to C or A.

In some embodiments, D is conjugated to a molecule of formula (I) according to formula (II) below:

(AXBYC _n )-LD

<Formula II>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

n is an integer from 0 to 1;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; D is attached to any position on A, B, or C.

In some embodiments, D is INF7 or melittin.

In some embodiments, D is an endosomally degradable polymer.

In some embodiments, L is a C ₁ -C ₆ alkyl group. In some embodiments, L is a homobifunctional linker or a heterobifunctional linker.

In some embodiments, the molecule further comprises at least a second binding moiety A. In some embodiments, at least the second binding moiety A is conjugated to A, B, or C. In some embodiments, at least the second binding moiety A is cholesterol.

In some embodiments, the molecule further comprises at least an additional polynucleotide B. In some embodiments, at least additional polynucleotide B is conjugated to A, B, or C.

In some embodiments, the molecule further comprises at least an additional polymer C. In some embodiments, at least additional polymer C is conjugated to A, B, or C.

In certain embodiments, disclosed herein are molecules of Formula (I): AXBYC (Formula I), wherein A is an antibody or binding fragment thereof; B is a polynucleotide; C is polymer; X is a bond or first non-polymeric linker; Y is a bond or second linker; The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; A and C are not attached to the same end of B. In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Contains dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA) modified nucleotides. do. In some embodiments, the one or more 2' modified nucleotides comprise a locked nucleic acid (LNA) or an ethylene nucleic acid (ENA). In some embodiments, the one or more modified internucleotide linkages comprise a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, one or more inverted base moieties are at at least one terminus. In some embodiments, the polynucleotide comprises a single strand. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises one or more modifications. In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide is at least 80%, 85%, 90%, Includes sequences having 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the second polynucleotide is at least 80%, 85%, 90%, Includes sequences having 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, Y is a non-polymeric linker group. In some embodiments, X is a bond. In some embodiments, X is a C ₁ -C ₆ alkyl group. In some embodiments, Y is a C ₁ -C ₆ alkyl group. In some embodiments, X is a homobifunctional or heterobifunctional linker, optionally conjugated to a C ₁ -C ₆ alkyl group. In some embodiments, Y is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single-chain variable fragment (scFv), Includes diabodies, minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some embodiments, C is polyethylene glycol. In some embodiments, C has a molecular weight of about 1000 Da, 2000 Da, or 5000 Da. In some embodiments, AX is joined to the 5' end of B and YC is joined to the 3' end of B. In some embodiments, YC is conjugated to the 5' end of B and AX is conjugated to the 3' end of B. In some embodiments, the molecule further comprises D. In some embodiments, D is conjugated to C or A. In some embodiments, D is conjugated to a molecule of Formula (I) according to Formula (II): (AXBYC _c )-LD(Formula II), wherein A is an antibody or binding fragment thereof; B is a polynucleotide; C is polymer; X is a bond or first non-polymeric linker; Y is a bond or second linker; L is a bond or third linker; D is an endosomal degradable moiety; c is an integer from 0 to 1; The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; A and C are not attached to the same end of B; D is conjugated to any position on A or C or to the end of B. In some embodiments, D is INF7 or melittin. In some embodiments, D is an endosomally degradable polymer. In some embodiments, L is a C ₁ -C ₆ alkyl group. In some embodiments, L is a homobifunctional linker or a heterobifunctional linker. In some embodiments, the molecule further comprises at least a second binding moiety. In some embodiments, at least the second binding moiety is conjugated to A, B, or C. In some embodiments, at least the second binding moiety is cholesterol. In some embodiments, the molecule further comprises at least an additional polynucleotide B. In some embodiments, at least additional polynucleotide B is conjugated to A, B, or C. In some embodiments, the molecule further comprises at least an additional polymer C. In some embodiments, at least additional polymer C is conjugated to A, B, or C.

In certain embodiments, disclosed herein are pharmaceutical compositions comprising the molecules described above, and pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. In some embodiments, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, or transdermal administration.

In certain embodiments, disclosed herein is a method of treating a disease or disorder in a patient in need thereof comprising administering to the patient a composition comprising a molecule described above. In some embodiments, the disease or disorder is cancer. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a hematologic malignancy. In some embodiments, the cancer comprises KRAS-related cancer, EGFR-related cancer, AR-related cancer, β-catenin-related cancer, PIK3C-related cancer, or MYC-related cancer. In some embodiments, the cancer includes bladder cancer, breast cancer, colorectal cancer, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, or thyroid cancer. In some embodiments, the cancer comprises acute myeloid leukemia, CLL, DLBCL, or multiple myeloma. In some embodiments, the method is immunotherapy.

In certain embodiments, disclosed herein is a method of inhibiting expression of a target gene in a primary cell of a patient comprising administering to the primary cell a molecule described above. In some embodiments, the method is an in vivo method. In some embodiments, the patient is a human.

In certain embodiments, disclosed herein is an immunotherapy comprising the molecules described above for the treatment of a disease or disorder in a patient in need thereof.

In certain embodiments, kits comprising the molecules described above are disclosed herein.

Various aspects of the invention are set forth in detail in the appended claims. The features and advantages of the present invention will be better understood by reference to the following detailed description, and the following accompanying drawings, which set forth exemplary implementations in which the principles of the invention are utilized:
1A-1C depict pictorial representations of the molecules described herein.
Figure 2 shows the structure of the cholesterol conjugate passenger strand.
Figure 3 shows the INF7 peptide sequence described herein (SEQ ID NO: 2055).
Figure 4 shows the melittin peptide sequence described herein (SEQ ID NO: 2060).
Figure 5 shows preparative HPLC of EGFR antibody-PEG20kDa-EGFR.
Figure 6 depicts SDS-PAGE analysis of EGFR antibody-PEG20kDa-EGFR conjugate.
Figure 7 shows the analytical chromatogram of EGFR antibody-PEG10kDa-EGFR siRNA.
Figure 8 shows the analysis chromatogram of EGFR antibody-PEG5kDa-EGFR siRNA.
Figure 9 shows SDS PAGE analysis of EGFR antibody-PEG10kDa-EGFR siRNA and EGFR antibody-PEG5kDa-EGFR siRNA conjugates.
Figure 10 depicts an overlay of EGFR antibody-PEG1kDa-EGFR siRNA conjugates with siRNA loadings of 1, 2, and 3.
Figure 11 shows the HPLC chromatogram of EGFR antibody-KRAS-PEG5kDa.
Figure 12 shows the HPLC chromatogram of panitumumab-KRAS-PEG5kDa.
Figure 13 shows the HPLC chromatogram of EGFR antibody-SS-siRNA-PEG5kDa (DAR = 1).
Figure 14 shows the HPLC chromatogram of EGFR antibody-PEG24-melittin (loading =~1).
Figure 15 shows HPLC chromatogram of EGFR antibody-melittin (n=~1).
Figure 16 shows the mass spectrum of EGFR antibody-melittin (n=1).
Figure 17 shows HIC chromatogram of EGFR antibody-PEG1kDa-INF7 (peptide loading = ~1).
Figure 18 shows HPLC chromatogram of EGFR antibody-INF7 (peptide loading = ~1).
Figure 19 shows INF7-PEG1kDa-(EGFR antibody-KRAS-PEG5kDa).
Figure 20 shows melittin-PEG1kDa-(EGFR antibody-KRAS-PEG5kDa).
Figure 21 depicts plasma concentration-time profiles up to 96 hours after administration with siRNA concentrations expressed as percent of injected dose (%ID).
Figure 22 shows plasma concentration-time profiles up to 96 hours after administration with siRNA concentrations expressed as percent of injected dose (%ID).
Figure 23 shows plasma concentration-time profiles up to 96 hours after administration with siRNA concentrations expressed as percent of injected dose (%ID).
Figure 24 depicts plasma concentration-time profiles up to 96 hours after administration with siRNA concentrations expressed as percent of injected dose (%ID).
Figure 25 depicts plasma concentration-time profiles up to 24 hours after administration with siRNA concentrations expressed as percent of injected dose (%ID).
Figures 26A and 26B depict tissue concentration-time profiles in tumor or normal liver of mice. Figure 26A shows tissue concentration-time profiles up to 168 hours post-dose measured in subcutaneous flank H358 tumors in a mouse model. Figure 26B shows tissue concentration-time profiles up to 168 hours post-dose measured in normal liver of mice.
Figure 27 shows tissue concentration-time profiles up to 168 hours post-dose measured in subcutaneous flank H358 tumor and normal liver of mice.
Figure 28 depicts tissue concentration-time profiles up to 168 hours post-dose measured in subcutaneous flank H358 tumor and normal liver of mice.
Figure 29 depicts tissue concentration-time profiles up to 168 hours post-dose measured in subcutaneous flank H358 tumor and normal liver of mice.
Figure 30 shows tissue concentration-time profiles up to 168 hours post-dose measured in subcutaneous flank H358 tumor and normal liver of mice.
Figures 31A and 31B depict siRNA-mediated mRNA knockdown of human KRAS in human subcutaneous flank H358 tumor (Figure 31A) or mouse KRAS in normal mouse liver (Figure 31B).
Figure 32 depicts siRNA-mediated mRNA knockdown of human EGFR in human subcutaneous flank H358 tumor.
Figure 33 depicts siRNA-mediated mRNA knockdown of human KRAS in human subcutaneous flank H358 tumor.
Figure 34 depicts siRNA-mediated mRNA knockdown of human EGFR in human subcutaneous flank H358 tumor.
Figure 35 shows siRNA-mediated mRNA knockdown of mouse KRAS in mouse liver.
Figure 36 depicts plasma concentration-time profiles up to 96 hours after administration with siRNA concentrations expressed as percent of injected dose (%ID).
Figure 37 depicts tissue concentration-time profiles up to 144 hours post-dose measured in the liver, kidney, and lung of wild-type CD-1 mice.
Figures 38A and 38B show tissue concentration-time up to 144 hours after administration measured in human subcutaneous flank H358 tumors for chol-KRAS mixed with chol-INF7 peptide (Figure 38A) or chol-melittin peptide (Figure 38B). Shows the profile.
Figures 39A and 39B show tissue concentration-time profiles up to 144 hours after administration measured in mouse liver for chol-KRAS mixed with chol-INF7 peptide (Figure 39A) or chol-melitin peptide (Figure 39B). do.
Figures 40A and 40B show tissue concentration-time profiles up to 144 hours after administration measured in mouse kidney for chol-KRAS mixed with chol-INF7 peptide (Figure 40A) or chol-melittin peptide (Figure 40B). do.
Figures 41A and 41B show tissue concentration-time profiles up to 144 hours after administration measured in mouse lungs for chol-KRAS mixed with chol-INF7 peptide (Figure 41A) or chol-melittin peptide (Figure 41B). do.
Figure 42 depicts siRNA-mediated mRNA knockdown of mouse KRAS in mouse liver.
Figures 43A and 43B depict tissue concentration-time profiles up to 96 hours post-dose measured in human subcutaneous flank H358 tumor (Figure 43A) or mouse liver (Figure 43B).
Figures 44A and 44B show tissue concentration-time profiles up to 96 hours post-dose measured in mouse kidney (Figure 44A) or mouse lung (Figure 44B).
Figure 45 shows siRNA-mediated mRNA knockdown of mouse KRAS in human subcutaneous flank H358 tumor.
Figure 46 shows tissue concentrations of siRNA at 96 hours post-dose measured in human subcutaneous flank H358 tumor and mouse liver, kidney, and lung.
Figures 47A and 47B show siRNA-mediated mRNA knockdown of EGFR (Figure 47A) or KRAS (Figure 47B) in human subcutaneous flank H358 tumors.
Figure 48 shows siRNA-mediated mRNA knockdown of human CTNNB1 in Hep3B orthotopic liver tumor.
Figure 49 shows human alpha-fetoprotein in the serum of mice bearing Hep3B orthotopic liver tumors.
Figure 50A shows siRNA-mediated mRNA knockdown of human EGFR in LNCaP tumors.
Figure 50B shows siRNA concentration in tumor or liver tissue at 96 hours after administration.
Figure 51A depicts siRNA-mediated mRNA knockdown of human EGFR in LNCaP tumors at 96 hours.
Figure 51B shows siRNA concentration in tumor or liver tissue at 96 hours after administration.
Figure 52 shows plasma siRNA concentrations of exemplary molecules described herein.
Figure 53A depicts siRNA concentrations of exemplary molecules described herein in HCC827 tumor or liver tissue.
Figure 53B shows EGFR EGFR mRNA expression levels of exemplary molecules described herein.
Figure 54 shows exemplary A and B producing molecules encompassed by formula (I).
Figure 55 depicts EGFR mRNA expression levels of exemplary molecules described herein.
Figure 56A depicts siRNA concentrations of exemplary molecules described herein in HCC827 tumor or liver tissue.
Figure 56B shows EGFR mRNA expression levels of exemplary molecules described herein.
Figures 57A-57B depict siRNA concentrations of exemplary molecules described herein in liver (Figure 57A) and tumor (Figure 57B).
Figure 57C shows KRAS mRNA expression levels of exemplary molecules described herein.
Figure 58A depicts plasma siRNA concentrations of exemplary molecules described herein.
Figure 58B shows plasma antibody concentrations of exemplary molecules described herein.
Figure 59A depicts siRNA concentrations of exemplary molecules described herein in tumor or liver tissue.
Figure 59B shows mRNA expression levels of exemplary molecules described herein in Hep3B tumors.
Figure 60 shows CTNNB1 mRNA expression levels of exemplary molecules described herein in the liver.
Figure 61 shows KRAS mRNA expression levels of exemplary molecules described herein in the liver.
Figure 62 depicts plasma siRNA or monoclonal antibody (mAb) concentrations of exemplary molecules described herein.
Figure 63A depicts siRNA concentrations of exemplary molecules described herein in tumor or liver tissue.
Figure 63B shows EGFR mRNA expression levels of exemplary molecules described herein in LNCaP tumors.
Figures 64A-64E show HPRT mRNA expression levels in the heart (Figure 64A), HPRT mRNA expression levels in gastrointestinal tissues (Figure 64B), and HPRT mRNA expression levels in the liver (Figure 64C) of exemplary molecules described herein. HPRT mRNA expression levels in lungs (Figure 64D), and siRNA concentrations in tissues (Figure 64E) are shown.
Figures 65A-65E show mRNA expression levels in the heart (Figure 65A), mRNA expression levels in gastrointestinal tissues (Figure 65B), liver (Figure 65C), and lungs of exemplary molecules described herein. mRNA expression levels (Figure 65D), and siRNA concentrations in tissues (Figure 65E) are shown.
Figures 66A-66D show siRNA concentration in heart (Figure 66A), mRNA expression level in heart (Figure 66B), mRNA expression level in gastrointestinal tissue (Figure 66C), and siRNA concentration in muscle (Figure 66D). It shows.
Figure 67A depicts mRNA expression levels of exemplary molecules described herein.
Figure 67B shows siRNA concentrations of exemplary molecules described herein in tumor or liver tissue.
Figures 68A-68B depict anti-B cell antibody-siRNA conjugates that activate primary mouse B cells. Figure 68A depicts anti-B cell Fab-siRNA conjugate. Figure 68B shows anti-B cell monoclonal antibody-siRNA conjugate.
Figure 69A depicts plasma siRNA concentrations of exemplary molecules described herein.
Figure 69B shows the concentration of antibody zalutumumab of exemplary molecules described herein in plasma at a dose of 5 mg/kg.
Figure 70A shows mRNA expression levels of exemplary molecules described herein.
Figure 70B shows siRNA concentrations of exemplary molecules described herein in tumor or liver tissue.
Figure 70C shows plasma siRNA concentrations of exemplary molecules described herein.
Figure 71A depicts siRNA concentrations of exemplary molecules described herein in LNCaP tumors.
Figures 71B-Figure 71C depict mRNA expression levels of exemplary molecules described herein in LNCaP tumors.
Figure 72A depicts siRNA concentrations of exemplary molecules described herein in tissue.
Figure 72B shows mRNA expression levels of exemplary molecules described herein in HCC827 tumors at 96 hours post treatment.
Figure 73A depicts siRNA concentrations of exemplary molecules described herein in plasma at a dose of 0.5 mg/kg.
Figure 73B shows antibody zalutumumab concentrations of exemplary molecules described herein in plasma at a dose of 5 mg/kg.
Figure 74 depicts the plasma clearance of exemplary molecules encompassed by formula (I) containing different linkers.
Figure 75A depicts mRNA expression levels of exemplary molecules described herein in HCC827 tumors at a dose of 0.5 mg/kg.
Figures 75B-Figure 75D depict siRNA concentrations in tumor (Figure 75B), liver (Figure 75C), and plasma (Figure 75D).
Figures 76A-76D depict mRNA expression levels of exemplary molecules described herein that target HPRT. Figure 76A shows mRNA expression levels in the heart. Figure 76B shows mRNA expression levels in muscle. Figure 76C shows mRNA expression levels in the liver. Figure 76D shows mRNA expression levels in the lung.
Figures 77A-77D depict siRNA concentrations of exemplary molecules encompassed by formula (I) in muscle (Figure 77A), heart (Figure 77B), liver (Figure 77C), and lung (Figure 77D).
Figures 78A-78D show mRNA of exemplary molecules comprised by formula (I) in heart (Figure 78A), gastrointestinal tissue (Figure 78B), liver (Figure 78C), and lung (Figure 78D) at 96 hours post treatment. Expression levels are shown.
Figure 79 depicts plasma siRNA concentrations of exemplary molecules encompassed by formula (I).
Figure 80A shows mRNA expression levels of exemplary molecules encompassed by formula (I) in LNCaP tumors at 96 hours after treatment.
Figure 80B shows siRNA concentrations of exemplary molecules encompassed by formula (I) in LNCaP tumor, liver, kidney, lung, and spleen tissue samples.
Figure 81A shows mRNA expression levels of exemplary molecules encompassed by formula (I) in HCC827 tumors at 96 hours after treatment.
Figure 81B depicts siRNA concentrations of exemplary molecules encompassed by formula (I) in tumor, liver, kidney, lung, and spleen tissue samples.
Figure 82 depicts plasma siRNA concentrations of exemplary molecules encompassed by formula (I).
Figure 83 depicts plasma siRNA concentrations of exemplary molecules encompassed by formula (I).
Figure 84 depicts mRNA expression levels of exemplary molecules encompassed by Formula (I) in HCC827 tumors at 96 hours after treatment.
Figure 85 depicts siRNA concentrations in HCC827 tumor or liver tissue at 96 hours post administration.
Figure 86 depicts relative mRNA expression levels of exemplary molecules encompassed by Formula (I) in mouse spleen B cells 48 hours after treatment. Each exemplary molecule is also indicated by a number.
Figure 87 depicts the stability of exemplary molecules comprised by formula (I) (or ASC) in mouse plasma.

Nucleic acid (e.g., RNAi) therapy is a targeted therapy with high selectivity and specificity. However, in some cases, nucleic acid therapy is also hindered by poor cellular uptake, limited blood stability, and non-specific immune stimulation. To address these issues, for example, novel linkers for better stabilization and/or lower toxicity, optimization of binding moieties for increased target specificity and/or targeted delivery, and increased stability and/or reduced toxicity. Various modifications of nucleic acid compositions are being developed, such as modifying nucleic acid polymers for targeted off-target effects.

In some embodiments, the arrangement or order of the different components that make up the nucleic acid composition affects cellular uptake, stability, toxicity, efficacy, and/or non-specific immune stimulation. For example, if the nucleic acid component includes binding moieties, polymers, and polynucleic acid molecules (or polynucleotides), the order or arrangement of the binding moieties, polymers, and/or polynucleic acid molecules (or polynucleotides) (e.g. , binding moiety-polynucleic acid molecule-polymer, binding moiety-polymer-polynucleic acid molecule, or polymer-binding moiety-polynucleic acid molecule) may also affect cellular uptake, stability, toxicity, efficacy, and/or non-specific immune stimulation. affects.

In some embodiments, the array of nucleic acid components described herein comprises molecules that affect cellular uptake, stability, toxicity, efficacy, and/or non-specific immune stimulation. In some cases, the molecules include polynucleic acid molecules and binding moieties conjugated to polymers. In some embodiments, the molecule comprises a molecule according to Formula (I): A-X-B-Y-C; where A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some cases, the polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties. In some cases, molecules of formula (I) additionally include D, which is an endosomally degradable moiety.

In some embodiments, polynucleic acid molecules arranged as described herein and molecules comprising binding moieties conjugated to polymers enhance cellular uptake, stability, and/or efficacy. In some cases, polynucleic acid molecules arranged as described herein and molecules comprising binding moieties conjugated to polymers reduce toxicity and/or non-specific immune stimulation. In some cases, the molecules include molecules according to formula (I): A-X-B-Y-C; where A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some cases, the polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties. In some cases, molecules of formula (I) additionally include D, which is an endosomally degradable moiety.

In some embodiments, the molecules described herein are further used to treat a disease or disorder. In some cases, the molecule for treatment of a disease or disorder is a molecule according to Formula (I): A-X-B-Y-C; where A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some cases, the polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties. In some cases, molecules of formula (I) additionally include D, which is an endosomally degradable moiety.

In some embodiments, the molecules described herein are also used to inhibit the expression of a target gene in primary cells of a patient in need thereof. In such cases, the molecule for such use is a molecule according to formula (I): A-X-B-Y-C; where A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some cases, the polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties. In some cases, molecules of formula (I) additionally include D, which is an endosomally degradable moiety.

In some embodiments, the molecules described herein are also used as immuno-oncology therapies for the treatment of diseases or disorders. In some cases, the molecule is according to formula (I): A-X-B-Y-C; where A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some cases, the polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties. In some cases, molecules of formula (I) additionally include D, which is an endosomally degradable moiety.

In a further embodiment, described herein includes kits comprising one or more of the molecules described herein.

Therapeutic Molecular Platform

In some embodiments, molecules described herein (e.g., therapeutic molecules) comprise a polynucleic acid molecule and a binding moiety conjugated to a polymer. In some embodiments, the molecule (e.g., therapeutic molecule) includes a molecule according to formula (I):

A-X-B-Y-C

<Formula I>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties.

In some cases, molecules of formula (I) additionally include D, which is an endosomally degradable moiety.

In some embodiments, at least one A and/or at least one C is conjugated to the 5' end of B, to the 3' end of B, to an internal site of B, or any combination thereof. In some cases, at least one A is conjugated at one end of B, while at least one C is conjugated at the opposite end of B. In some cases, at least one of A is conjugated at one end of B, while at least one of C is conjugated at an internal site of B.

In some cases, A and C are unconjugated or conjugated to the same end of B. In some cases, A is attached or conjugated to B at the first end of B. In some cases, C is attached or conjugated to B at a second end of B, and the second end of B is different from the first end. In some cases, A is attached to or conjugated to B at the 5' end of B, and C is attached to or conjugated to B at the 3' end of B. In other cases, A is attached to or conjugated to B at the 3' end of B, and C is attached to or conjugated to B at the 5' end of B.

In some embodiments, A is an antibody or binding fragment thereof. In some cases, C is a polymer. In some cases, A and C are not conjugated or attached to the same end of B. In some cases, A is attached or conjugated to B at the first end of B. In some cases, C is attached or conjugated to B at a second end of B, and the second end of B is different from the first end. In some cases, A is attached to or conjugated to B at the 5' end of B, and C is attached to or conjugated to B at the 3' end of B. In other cases, A is attached to or conjugated to B at the 3' end of B, and C is attached to or conjugated to B at the 5' end of B. In some cases, the X linking A to B is a binding or non-polymeric linker. In some cases, X is a non-peptide linker (or a linker that does not contain an amino acid residue). In some cases, the Y linking B to C is a bond or second linker. In some cases, X joins A to the 5' end of B, and Y joins C to the 3' end of B. In other cases, X joins A to the 3' end of B, and Y joins C to the 5' end of B.

In some embodiments, X-B is conjugated to or attached to the N-terminus, C-terminus, constant region, hinge region, or Fc region of A. In some cases, X-B is conjugated or attached to the N-terminus of A. In some cases, X-B is conjugated or attached to the C-terminus of A. In some cases, X-B is bonded or attached to the hinge region of A. In some cases, X-B is conjugated or attached to the constant region of A. In some cases, X-B is conjugated or attached to the Fc region of A.

In some cases, at least one B and/or at least one C, and optionally at least one D, are conjugated to the first A. In some cases, at least one B is joined to the first A at the end (e.g., 5' end or 3' end) or to the first A through an internal site. In some cases, at least one C is joined to the first A directly or indirectly through two or more Bs. When conjugated indirectly through two or more Bs, the two or more Cs are conjugated at the same end as the first A on B, at the opposite end from the first A, or independently at an internal site. In some cases, at least one additional A is additionally conjugated to the first A, B, or C. In further cases, at least one D is optionally conjugated directly or indirectly to a first A, at least one B, or at least one C. When conjugated directly to a first A, at least one D is also optionally conjugated to at least one B to form an A-D-B conjugate, or optionally to at least one B and at least one C to form an A-D-B-C conjugate. In some cases, the at least one additional A is different from the first A.

In some cases, two or more Bs and/or two or more Cs are conjugated to the first A. In some cases, two or more Bs are joined to the first A at the ends (e.g., 5' end or 3' end) or to the first A through an internal site. In some cases, two or more Cs are joined to a first A directly or indirectly through two or more Bs. When conjugated indirectly through two or more Bs, the two or more Cs are conjugated at the same end as the first A on B, at the opposite end from the first A, or independently at an internal site. In some cases, at least one additional A is additionally conjugated to the first A, two or more Bs, or two or more Cs. In additional cases, at least one D is optionally conjugated directly or indirectly to a first A, two or more Bs, or two or more Cs. When indirectly bonded to a first A, at least one D is through two or more Bs, through two or more Cs, through a B-C orientation forming an A-B-C-D type conjugate, or through a C-B orientation forming an A-C-B-D type conjugate. Through, it is connected to the first A. In some cases, the at least one additional A is different from the first A. In some cases, the two or more Bs are different. In other cases, two or more Bs are identical. In some cases, two or more Cs are different. In other cases, two or more Cs are identical. In additional cases, two or more Ds are different. In additional cases, two or more Ds are identical.

In other cases, two or more Bs and/or two or more Ds, and optionally two or more Cs, are joined to the first A. In some cases, two or more Bs are joined to the first A at the ends (e.g., 5' end or 3' end) or to the first A through an internal site. In some cases, two or more Ds are joined to a first A directly or indirectly through two or more Bs. When conjugated indirectly through two or more Bs, the two or more Ds are conjugated at the same end as the first A on B, at the opposite end from the first A, or independently at an internal site. In some cases, at least one additional A is additionally bonded to the first A, to two or more Bs, or to two or more Ds. In additional cases, two or more Cs are optionally bonded directly or indirectly to first A, to two or more Bs, or to two or more Ds. In some cases, the at least one additional A is different from the first A. In some cases, the two or more Bs are different. In other cases, two or more Bs are identical. In some cases, two or more Cs are different. In other cases, two or more Cs are identical. In additional cases, two or more Ds are different. In additional cases, two or more Ds are identical.

In some embodiments, molecules described herein (e.g., therapeutic molecules) include molecules according to formula (II):

(AXBYC _c )-LD

<Formula II>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

C is an integer from 0 to 1;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; D is attached to any position on A, B, or C.

In some embodiments, molecules described herein (e.g., therapeutic molecules) include molecules according to formula (III):

A _a -XB _b -YC _c -LD _n

<Equation III>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

D is an endosomal degradable moiety;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

a and b are independently integers from 1 to 3;

c is an integer from 0 to 3;

n is an integer from 0 to 10;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; A is attached to any position on B, C, or D; B is conjugated to any position on A, C, or D; C is attached to any position on A, B, or D; D is attached to any position on A, B, or C.

In some embodiments, molecules described herein (e.g., therapeutic molecules) include molecules according to Formula (IIIa): A-X-B-L-D-Y-C.

In some embodiments, molecules described herein (e.g., therapeutic molecules) include molecules according to Formula (IIIb): A _a -XB _b -LD _n .

In some embodiments, molecules described herein (e.g., therapeutic molecules) include molecules according to Formula (IV):

AX-(B _b -YC _c -LD _n ) _m

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

D is an endosomal degradable moiety;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

a and b are independently integers from 1 to 3;

c is an integer from 0 to 3;

n is an integer from 0 to 10;

m is an integer from 1 to 3;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; C is conjugated to any position on B or D; D is attached to any position on B or C.

In some embodiments, molecules described herein (e.g., therapeutic molecules) include molecules according to formula (IVa): AX-(B _b -LD _n -YC _c ) _m .

In some embodiments, a molecule described herein (e.g., a therapeutic molecule) is a molecule as depicted in Figure 1. In some cases, the molecules described herein (e.g., therapeutic molecules) are molecules as depicted in Figure 1A. In some cases, the molecules described herein (e.g., therapeutic molecules) are molecules as depicted in Figure 1B. In additional cases, the molecules described herein (e.g., therapeutic molecules) are molecules as depicted in Figure 1C.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

In some embodiments, the molecule (e.g., a therapeutic molecule) is a molecule as exemplified:

.

shown above is for expression purposes only, humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', bivalent Fab2, single-chain variable fragment (scFv), diabody, mini It includes a body, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.

polynucleic acid molecular target

In some embodiments, polynucleic acid molecule B is a polynucleic acid molecule (or polynucleotide) that hybridizes to a target region on an oncogene. In some cases, oncogenes are further divided into several categories: growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, and transcription factors. Exemplary growth factors include c-Sis. Exemplary receptor tyrosine kinases include epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR), and HER2/neu. Exemplary cytoplasmic tyrosine kinases include the Src-family tyrosine kinases, the Syk-ZAP-70 family of tyrosine kinases, the BTK family of tyrosine kinases, and the Abl gene in CML. Exemplary cytoplasmic serine/threonine kinases include Raf kinases and cyclin-dependent kinases. Exemplary regulatory GTPases include the Ras family of proteins such as KRAS. Exemplary transcription factors include the MYC gene. In some cases, oncogenes described herein include oncogenes selected from growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, or transcription factors. In some embodiments, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of an oncogene selected from a growth factor or mitogen, receptor tyrosine kinase, cytoplasmic tyrosine kinase, cytoplasmic serine/threonine kinase, regulatory GTPase, or transcription factor. .

In some embodiments, the oncogene described herein is Abl , AKT -2, ALK , AML1 (or RUNX1), AR, AXL , BCL -2, 3, 6, BRAF , c- MYC , EGFR , ErbB -2 ( Her2 , Neu ), Fms , FOS , GLI1 , HPRT1 , IL-3, INTS2 , JUN , KIT, KS3, K-sam, LBC ( AKAP13 ), LCK , LMO1 , LMO2, LYL1 , MAS1 , MDM2 , MET, MLL ( KMT2A ) ), MOS, MYB , MYH11 / CBFB , NOTCH1 ( TAN1 ), NTRK1 (TRK), OST ( SLC51B ), PAX5 , PIM1 , PRAD -1, RAF , RAR / PML , HRAS , KRAS , NRAS , REL/NRG, RET , ROS , SKI, SRC, TIAM1 , or TSC2 . In some embodiments, the polynucleic acid molecule is Abl , AKT -2, ALK , AML1 (or RUNX1 ), AR, AXL , BCL -2, 3, 6, BRAF , c-MYC, EGFR , ErbB -2 ( Her2 , Neu ), Fms , FOS , GLI1 , HPRT1 , IL-3, INTS2 , JUN , KIT, KS3, K-sam, LBC ( AKAP13 ) , LCK , LMO1 , LMO2 , LYL1 , MAS1 , MDM2 , MET, MLL ( KMT2A ), MOS, MYB , MYH11 / CBFB , NOTCH1 ( TAN1 ), NTRK1 ( TRK ), OST( SLC51B ) , PAX5 , PIM1 , PRAD-1, RAF , RAR / PML , HRAS , KRAS , NRAS , REL / NRG , RET, ROS , SKI, SRC, TIAM1 , or TSC2 is a polynucleic acid molecule that hybridizes to the target region.

In some embodiments, oncogenes described herein include KRAS , EGFR , AR, HPRT1 , CNNTB1 (β -catenin), or β -catenin related genes . In some embodiments, polynucleic acid molecule B is KRAS , EGFR , AR, HPRT1 , CNNTB1 ( β -catenin) , or β-catenin It is a polynucleic acid molecule that hybridizes to the target region of the relevant gene. In some embodiments, polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to the target region of KRAS . In some embodiments, polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to the target region of EGFR . In some embodiments, polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to the target region of AR . In some embodiments, polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to the target region of CNNTB1 (β-catenin). In some embodiments, polynucleic acid molecule B is CNNTB1 (β-catenin) It is a polynucleic acid molecule that hybridizes to the target region of the relevant gene. In some cases, β-catenin Related genes include PIK3CA , PIK3CB , and Myc . In some cases, polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to the target region of HPRT1 .

Kirsten rat sarcoma virus oncogene Homolog ( KRAS )cast targeting polynucleic acid molecule

The Kirsten rat sarcoma virus oncogene homolog (GTPase KRas, also known as V-Ki-ras2 Kirsten rat sarcoma virus oncogene homolog, or KRAS) is involved in regulating cell division. K-Ras protein is a GTPase belonging to the Ras superfamily. In some cases, K-Ras not only regulates cell cycle progression but also induces growth arrest, apoptosis, and replicative senescence under different environmental triggers (e.g., cellular stress, ultraviolet light, heat shock, or ionizing irradiation). induce. In some cases, wild-type KRAS genes have been shown to be frequently lost during tumor progression in different types of cancer, whereas mutations in the KRAS gene have been associated with cancer development. In some cases, KRAS amplification has also been implicated in cancer development (e.g., Valtorta et al . “KRAS gene amplification in colorectal cancer and impact on response to EGFR-targeted therapy,” Int . J. Cancer 133 : 1259-1266 ( 2013). In such cases, the cancer is associated with a refractory cancer in which the patient has acquired resistance to a particular inhibitor or class of inhibitors.

In some embodiments, the KRAS gene is wild type or comprises a mutation. In some cases, the KRAS mRNA is wild-type or contains a mutation. In some cases, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of wild-type KRAS DNA or RNA . In some cases, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of KRAS DNA or RNA containing a mutation (e.g., substitution, deletion, or addition).

In some embodiments, the KRAS DNA or RNA comprises one or more mutations. In some embodiments, the KRAS DNA or RNA comprises one or more mutations at codons 12 or 13 within exon 1. In some cases, the KRAS DNA or RNA contains one or more mutations at codons 61, 63, 117, 119, or 146. In some cases, KRAS DNA or RNA contains amino acid residues 12, 13, 18, 19, 20, 22, 24, 26, 36, 59, 61, 63, 64, 68, 110, 116, 117, 119, It contains one or more mutations at positions corresponding to 146, 147, 158, 164, 176, or combinations thereof. In some embodiments, KRAS DNA or RNA comprises G12V, G12D, G12C, G12A, G12S, G12F, G13C, G13D, G13V, A18D, L19F, T20R, Q22K, I24N, N26K, I36L, I36M, A59G, At a position corresponding to an amino acid residue selected from A59E, Q61K, Q61H, Q61L, Q61R, E63K, Y64D, Y64N, R68S, P110S, K117N, C118S, A146T, A146P, A146V, K147N, T158A, R164Q, K176Q, or combinations thereof. Contains one or more mutations.

In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at codons 12 or 13 within exon 1. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at codons 61, 63, 117, 119, or 146. In some embodiments, the polynucleic acid molecule comprises amino acid residues 12, 13, 18, 19, 20, 22, 24, 26, 36, 59, 61, 63, 64, 68, 110, 116, 117, 119 of a KRAS polypeptide. , 146, 147, 158, 164, 176, or a combination thereof. In some embodiments, the polynucleic acid molecule is a KRAS polypeptide of , Q61K, Q61H, Q61L, Q61R, E63K, Y64D, Y64N, R68S, P110S, K117N, C118S, A146T, A146P, A146V, K147N, T158A, R164Q, K176Q, or combinations thereof. Hybridizes to the target region of KRAS DNA or RNA containing.

Target epidermal growth factor receptor ( EGFR )cast targeting polynucleic acid molecule

The epidermal growth factor receptor (EGFR, ErbB-1, or HER1) is a transmembrane tyrosine kinase receptor and also includes HER2/c-neu (ErbB-2), Her3 (ErbB-3), and Her4 (ErbB-4). It is a member of the ErbB family of receptors. In some cases, EGFR mutations lead to downstream activation of RAS/RAF/MAPK, PI3K/AKT, and/or JAK/STAT pathways, resulting in inhibition of mitosis, cell proliferation, and apoptosis. Additionally, amplification of the wild-type EGFR gene has been implicated in the development of cancers such as glioblastoma and non-small cell lung cancer (Talasila, et al., "EGFR Wild-type Amplification and Activation Promote Invasion and Development of Glioblastoma Independent of Angiogenesis," Acta Neuropathol . 125(5): 683-698 (2013); Bell et al., "Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non-Small-Cell Lung Cancer: Molecular Analysis of the IDEAL/INTACT Gefitinib Trials," J. Clinical Oncology 23 (31): 8081-8092 (2005)).

In some embodiments, the EGFR DNA or RNA is wild-type EGFR or EGFR containing a mutation. In some cases, the EGFR is wild-type EGFR . In some cases, EGFR DNA or RNA contains mutations. In some cases, the polynucleic acid molecule hybridizes to the target region of wild-type EGFR DNA or RNA. In some cases, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA that contains a mutation (e.g., substitution, deletion, or addition).

In some cases, EGFR DNA or RNA contains one or more mutations. In some embodiments, the EGFR DNA or RNA comprises one or more mutations within one or more exons. In some cases, one or more exons include exon 18, exon 19, exon 20, exon 21, or exon 22. In some cases, the EGFR DNA or RNA contains one or more mutations in exon 18, exon 19, exon 20, exon 21, exon 22, or combinations thereof.

In some cases, EGFR DNA or RNA consists of amino acid residues 34, 38, 45, 62, 63, 77, 78, 108, 114, 120, 140, 148, 149, 160, 177, 178, 189, 191, 198, 220, 222, 223, 229, 237, 240, 244, 252, 254, 255, 256, 263, 270, 273, 276, 282, 288, 289, 301, 303, 304, 309, 314, 326 , 331, 354, 363, 373, 337, 380, 384, 393, 427, 428, 437, 441, 447, 465, 475, 515, 526, 527, 531, 536, 541, 546, 571, 588, 589 , 596, 596, 598, 602, 614, 620, 628, 636, 641, 645, 651, 671, 689, 694, 700, 709, 712, 714, 715, 716, 719, 720, 721, 731, 733 , 739-744, 742, 746-750, 746-752, 746, 747, 747-749, 747-751, 747-753, 751, 752, 754, 752-759, 750, 761-762, 761, 763, 765, 767-768, 767-769, 768, 769, 769-770, 770-771, 772, 773-774, 773, 774, 774-775, 776, 779, 783, 784, 786, 790, 792, 794, 798, 803, 805, 807, 810, 826, 827, 831, 832, 833, 835, 837, 838, 839, 842, 843, 847, 850, 851, 853, 854, 856, 858, 861 , It contains one or more mutations at positions corresponding to 863, 894, 917, 967, 1006, 1019, 1042, 1100, 1129, 1141, 1153, 1164, 1167, or a combination thereof. In some embodiments, the EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 747, 761, 790, 854, 858, or combinations thereof of the EGFR polypeptide. In some embodiments, the EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 761, 790, 858, or combinations thereof of the EGFR polypeptide. In some embodiments, the EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 747 of the EGFR polypeptide. In some embodiments, the EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 761 of the EGFR polypeptide. In some embodiments, the EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 790 of the EGFR polypeptide. In some embodiments, the EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 854 of the EGFR polypeptide. In some embodiments, the EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 858 of the EGFR polypeptide.

In some embodiments, the EGFR DNA or RNA comprises T34M, L38V, E45Q, L62R, G63R, G63K, S77F, F78L, R108K, R108G, E114K, A120P, L140V, V148M, R149W, E160K, S177P, M178I, K189T, D191N, S198R, S220P, R222L, R222C, S223Y, S229C, A237Y, C240Y, R244G, R252C, R252P, F254I, R255 (nonsense mutation), D256Y, T263P, Y270C, T273A, Q276 (nonsense mutation) sense), E282K, G288 (frame shift), A289D, A289V, A289T, A289N, A289D, V301 (deletion), D303H, H304Y, R309Q, D314N, C326R, G331R, T354M, T363I, P373Q, R337S, S380 (frame shift), T384S, D 393Y, R427L, G428S, S437Y, V441I, S447Y, G465R, I475V, C515S, C526S, R527L, R531 (nonsense), V536M, L541I, P546Q, C571S, G588S, P589L, P596L, P596S, P596R, P 596L, G598V, G598A, E602G , G614D, C620Y, C620W, C628Y, C628F, C636Y, T638M, P641H, S645C, V651M, R671C, V689M, P694S, N700D, E709A, E709K, E709Q, E709K, F712L, K714N, I7 15S, K716R, G719A, G719C, G719D , G719S, S720C, S720F, G721V, W731Stop, P733L, K739-I744 (insertion), V742I, V742A, E746-A750 (deletion), E746K, L747S, L747-E749 (deletion), L747-T751 (deletion), L747 -P753 (deletion), G746-S752 (deletion), T751I, S752Y, K754 (deletion), S752-I759 (deletion), A750P, D761-E762 (e.g., insertion of residue EAFQ (SEQ ID NO: 2110)), D761N, D761Y , A763V, V765A, A767-S768 (e.g., residue TLA insertion), A767-V769 (e.g., residue ASV insertion), S768I, S768T, V769L, V769M, V769-D770 (e.g., residue Y insertion), 770-771 ( e.g. insertion of residue GL), 770-771 (e.g. insertion of residue G), 770-771 (insertion of e.g. residue CV), 770-771 (insertion of residue SVD), P772R, 773-774 (e.g. insertion of residue NPH) insertion), H773R, H773L, V774M, 774-775 (e.g., residue HV insertion), R776H, R776C, G779F, T783A, T784F, T854A, V786L, T790M, L792P, P794H, L798F, R803W, H805R, D807H , G810S, N826S, Y827 (nonsense), R831H, R832C, R832H, L833F, L833V, H835L, D837V, L838M, L838P, A839V, N842H, V843L, T847K, T847I, H850N, V851A, I853T, F856L, L 858R, L858M, L861Q, L861R , G863D, Q894L, G917A, E967A, D1006Y, P1019L, S1042N, R1100S, H1129Y, T1141S, S1153I, Q1164R, L1167M, or combinations thereof.

In some cases, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA that contains one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations within exon 18, exon 19, exon 20, exon 21, exon 22, or combinations thereof.

In some embodiments, the polynucleic acid molecule comprises amino acid residues 34, 38, 45, 62, 63, 77, 78, 108, 114, 120, 140, 148, 149, 160, 177, 178, 189, 191 of the EGFR polypeptide. , 198, 220, 222, 223, 229, 237, 240, 244, 252, 254, 255, 256, 263, 270, 273, 276, 282, 288, 289, 301, 303, 304, 309, 314, 3 26 , 331, 354, 363, 373, 337, 380, 384, 393, 427, 428, 437, 441, 447, 465, 475, 515, 526, 527, 531, 536, 541, 546, 571, 588, 5 89 , 596, 596, 598, 602, 614, 620, 628, 636, 641, 645, 651, 671, 689, 694, 700, 709, 712, 714, 715, 716, 719, 720, 721, 731, 7 33 , 739-744, 742, 746-750, 746-752, 746, 747, 747-749, 747-751, 747-753, 751, 752, 754, 752-759, 750, 761-762, 761, 763 , 765, 767-768, 767-769, 768, 769, 769-770, 770-771, 772, 773-774, 773, 774, 774-775, 776, 779, 783, 784, 786, 790, 792 , 794, 798, 803, 805, 807, 810, 826, 827, 831, 832, 833, 835, 837, 838, 839, 842, 843, 847, 850, 851, 853, 854, 856, 858, 8 61 Hybridizing to a target region of EGFR DNA or RNA containing one or more mutations at positions corresponding to , 863, 894, 917, 967, 1006, 1019, 1042, 1100, 1129, 1141, 1153, 1164, 1167, or a combination thereof do. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at a position corresponding to amino acid residues 747, 761, 790, 854, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 761, 790, 858, or combinations thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 747 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 761 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 790 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA that contains a mutation at a position corresponding to amino acid residue 854 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 858 of the EGFR polypeptide.

In some embodiments, the polynucleic acid molecule is T34M, L38V, E45Q, L62R, G63R, G63K, S77F, F78L, R108K, R108G, E114K, A120P, L140V, V148M, R149W, E160K, S177P, M178I, K189T of EGFR polypeptide. , D191N, S198R, S220P, R222L, R222C, S223Y, S229C, A237Y, C240Y, R244G, R252C, R252P, F254I, R255 (nonsense mutation), D256Y, T263P, Y270C, T273A, Q276 (nonsense), E 282K, G288( frame shift), A289D, A289V, A289T, A289N, A289D, V301 (deletion), D303H, H304Y, R309Q, D314N, C326R, G331R, T354M, T363I, P373Q, R337S, S380 (frame shift), T384S, D39 3Y, R427L , G428S, S437Y, V441I, S447Y, G465R, I475V, C515S, C526S, R527L, R531 (nonsense), V536M, L541I, P546Q, C571S, G588S, P589L, P596L, P596S, P596R, P596L , G598V, G598A, E602G, G614D, C620Y, C620W, C628Y, C628F, C636Y, T638M, P641H, S645C, V651M, R671C, V689M, P694S, N700D, E709A, E709K, E709Q, E709K, F712L, K714N, I715 S, K716R, G719A, G719C, G719D, G719S, S720C, S720F, G721V, W731Stop, P733L, K739-I744 (insertion), V742I, V742A, E746-A750 (deletion), E746K, L747S, L747-E749 (deletion), L747-T751 (deletion), L747- P753 (deletion), G746-S752 (deletion), T751I, S752Y, K754 (deletion), S752-I759 (deletion), A750P, D761-E762 (e.g., residue EAFQ insertion (SEQ ID NO: 2110)), D761N, D761Y, A763V, V765A, A767-S768 (e.g., residue TLA insertion), A767-V769 (e.g., residue ASV insertion), S768I, S768T, V769L, V769M, V769-D770 (e.g., residue Y insertion), 770-771 (e.g., residue Y insertion) , residue GL insertion), 770-771 (e.g., residue G insertion), 770-771 (e.g., residue CV insertion), 770-771 (e.g., residue SVD insertion), P772R, 773-774 (e.g., residue NPH insertion) ), H773R, H773L, V774M, 774-775 (e.g., residue HV insertion), R776H, R776C, G779F, T783A, T784F, T854A, V786L, T790M, L792P, P794H, L798F, R803W, H805R, D807H, G810S, N826S , Y827 (nonsense), R831H, R832C, R832H, L833F, L833V, H835L, D837V, L838M, L838P, A839V, N842H, V843L, T847K, T847I, H850N, V851A, I853T, F856L, L858R , L858M, L861Q, L861R, Hybridizes to the target region of EGFR DNA or RNA containing one or more mutations selected from G863D, Q894L, G917A, E967A, D1006Y, P1019L, S1042N, R1100S, H1129Y, T1141S, S1153I, Q1164R, L1167M, or combinations thereof. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from L747S, D761Y, T790M, T854A, L858R, or combinations thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from D761Y, T790M, L858R, or combinations thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation L747S of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation D761Y of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising the mutation T790M of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation T854A of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation L858R of the EGFR polypeptide.

Androgen receptor (AR) targeting polynucleic acid molecule

Androgen receptor (AR) (also known as NR3C4, nuclear receptor subfamily 3, group C, gene 4) is a member of the estrogen receptor (ER), glucocorticoid receptor (GR), progesterone receptor (PR), and mineralocorticoid receptor (MR). It belongs to the steroid hormone group of the nuclear receptor superfamily along with related members. Androgens, or steroid hormones, regulate protein synthesis and tissue remodeling through androgen receptors. AR proteins are ligand-inducible zinc finger transcription factors that regulate target gene expression. The presence of mutations in the AR gene has been observed in several types of cancer (e.g., prostate, breast, bladder, or esophageal cancer) and, in some cases, has been associated with metastatic progression.

In some embodiments, the AR DNA or RNA is wild type or comprises one or more mutations and/or splice variants. In some cases, AR DNA or RNA contains one or more mutations. In some cases, AR DNA or RNA includes, but is not limited to, AR1/2/2b, ARV2, ARV3, ARV4, AR1/2/3/2b, ARV5, ARV6, ARV7, ARV9, ARV10, ARV11, ARV12, ARV13, ARV14, ARV15. , ARV16, and AR splice variants including ARV(v567es). In some cases, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA that contains mutations (e.g., substitutions, deletions, or additions) or splice variants.

In some embodiments, the AR DNA or RNA includes one or more mutations. In some embodiments, the AR DNA or RNA includes one or more mutations within one or more exons. In some cases, one or more exons include exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, or exon 8. In some embodiments, the AR DNA or RNA comprises one or more mutations within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, or combinations thereof. In some cases, AR DNA or RNA consists of amino acid residues 2, 14, 16, 29, 45, 54, 57, 64, 106, 112, 176, 180, 184, 194, 198, 204, 214, 221, 222, 233, 243, 252, 255, 266, 269, 287, 288, 334, 335, 340, 363, 368, 369, 390, 403, 443, 491, 505, 513, 524, 524, 528, 533 , 547, 548, 564, 567, 568, 574, 547, 559, 568, 571, 573, 575, 576, 577, 578, 579, 580, 581, 582, 585, 586, 587, 596, 597, 599 , 601, 604, 607, 608, 609, 610, 611, 615, 616, 617, 619, 622, 629, 630, 638, 645, 647, 653, 662, 664, 670, 671, 672, 674, 677 , 681, 682, 683, 684, 687, 688, 689, 690, 695, 700, 701, 702, 703, 705, 706, 707, 708, 710, 711, 712, 715, 717, 720, 721, 722 , 723, 724, 725, 726, 727, 728, 730, 732, 733, 737, 739, 741, 742, 743, 744, 745, 746, 748, 749, 750, 751, 752, 754, 755, 756 , 757, 758, 759, 762, 763, 764, 765, 766, 767, 768, 771, 772, 774, 777, 779, 786, 795, 780, 782, 784, 787, 788, 790, 791, 793 , 794, 798, 802, 803, 804, 806, 807, 812, 813, 814, 819, 820, 821, 824, 827, 828, 830, 831, 834, 840, 841, 842, 846, 854, 855 , 856, 863, 864, 866, 869, 870, 871, 874, 875, 877, 879, 880, 881, 886, 888, 889, 891, 892, 895, 896, 897, 898, 902, 903, 904 , It contains one or more mutations at positions corresponding to 907, 909, 910, 911, 913, 916, 919, or combinations thereof. In some embodiments, AR DNA or RNA comprises AR polypeptides E2K, P14Q, K16N, V29M, S45T, L54S, L57Q, Q64R, Y106C, Q112H, S176S, K180R, L184P, Q194R, E198G, G204S, G214R, K221N, N222D, D233K, S243L, A252V, L255P, M266T, P269S, A287D, E288K, S334P, S335T, P340L, Y363N, L368V, A369P, P390R, P390S, P390L, A403V, Q443R, G491 S, G505D, P513S, G524D, G524S, D528G, P533S, L547F, P548S, D564Y, S567F, G568W, L574P, L547F, C559Y, G568W, G568V, Y571C, Y571H, A573D, T575A, C576R, C576F, G577R, S578T, C579 Y, C579F, K580R, V581F, F582Y, F582S, R585K, A586V, A587S, A596T, A596S, S597G, S597I, N599Y, C601F, D604Y, R607Q, R608K, K609N, D610T, C611Y, R615H, R615P, R615G, R616C, L616 R, L616P, R617P, C619Y, A622V, R629W, R629Q, K630T, L638M, A645D, S647N, E653K, S662 (nonsense), I664N, Q670L, Q670R, P671H, I672T, L674P, L677P, E681L, P682T, G683A, V684I, V684A, A 687V, G688Q, H689P, D690V , D695N, D695V, D695H, L700M, L701P, L701I, H701H, S702A, S703G, N705S, N705Y, E706 (nonsense), L707R, G708A, R710T, Q711E, L712F, V715M, K717Q, K720E , A721T, L722F, P723S, G724S, G724D, G724N, F725L, R726L, N727K, L728S, L728I, V730M, D732N, D732Y, D732E, Q733H, I737T, Y739D, W741R, M742V, M742I, G743R, G743V, L744 F, M745T, V746M, A748D, A748V, A748T, M749V, M749I, G750S, G750D, W751R, R752Q, F754V, F754L, T755A, N756S, N756D, V757A, N758T, S759F, S759P, L762F, Y763H, Y763C, F764L, A765 T, A765V, P766A, P766S, D767E, L768P, L768M, N771H, E772G, E772A, R774H, R774C, K777T, R779W, R786Q, G795V, M780I, S782N, C784Y, M787V, R788S, L790F, S791P, E793D, F794S, Q798 E, Q802R, G803L, F804L, C806Y, M807V, M807R, M807I, L812P, F813V, S814N, N819Q, G820A, L821V, Q824L, Q824R, F827L, F827V, D828H, L830V, L830P, R831Q, R831L, Y834C, R840C, R840 H, I841S, I842T, R846G, R854K, R855C, R855H, F856L, L863R, D864N, D864E, D864G, V866L, V866M, V866E, I869M, A870G, A870V, R871G, H874Y, H874R, Q875K, T877S, T877A, D879T, D879 G, L880Q, L881V, M886V, S888L, Of amino acid residues selected from V889M, F891L, P892L, M895T, A896T, E897D, I898T, Q902R, V903M, P904S, P904H, L907F, G909R, G909E, K910R, V911L, P913S, F916L, Q919R, or combinations thereof. in the corresponding position Contains one or more mutations.

In some embodiments, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid hybridizes to one or more AR splice variants. In some embodiments, the polynucleic acid includes, but is not limited to, AR1/2/2b, ARV2, ARV3, ARV4, AR1/2/3/2b, ARV5, ARV6, ARV7, ARV9, ARV10, ARV11, ARV12, ARV13, ARV14, ARV15. hybridizes to AR DNA or RNA containing one or more AR splice variants, including , ARV16, and ARV(v567es). In some embodiments, the polynucleic acid molecule is directed to a target region of AR DNA or RNA comprising one or more mutations within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, or combinations thereof. Hybridize. In some embodiments, the polynucleic acid molecule comprises amino acid residues 2, 14, 16, 29, 45, 54, 57, 64, 106, 112, 176, 180, 184, 194, 198, 204, 214, 221 of the AR polypeptide. , 222, 233, 243, 252, 255, 266, 269, 287, 288, 334, 335, 340, 363, 368, 369, 390, 403, 443, 491, 505, 513, 524, 524, 528, 5 33 , 547, 548, 564, 567, 568, 574, 547, 559, 568, 571, 573, 575, 576, 577, 578, 579, 580, 581, 582, 585, 586, 587, 596, 597, 5 99 , 601, 604, 607, 608, 609, 610, 611, 615, 616, 617, 619, 622, 629, 630, 638, 645, 647, 653, 662, 664, 670, 671, 672, 674, 6 77 , 681, 682, 683, 684, 687, 688, 689, 690, 695, 700, 701, 702, 703, 705, 706, 707, 708, 710, 711, 712, 715, 717, 720, 721, 7 22 , 723, 724, 725, 726, 727, 728, 730, 732, 733, 737, 739, 741, 742, 743, 744, 745, 746, 748, 749, 750, 751, 752, 754, 755, 7 56 , 757, 758, 759, 762, 763, 764, 765, 766, 767, 768, 771, 772, 774, 777, 779, 786, 795, 780, 782, 784, 787, 788, 790, 791, 7 93 , 794, 798, 802, 803, 804, 806, 807, 812, 813, 814, 819, 820, 821, 824, 827, 828, 830, 831, 834, 840, 841, 842, 846, 854, 8 55 , 856, 863, 864, 866, 869, 870, 871, 874, 875, 877, 879, 880, 881, 886, 888, 889, 891, 892, 895, 896, 897, 898, 902, 903, 9 04 , 907 , 909, 910, 911, 913, 916, 919, or a combination thereof. In some embodiments, the polynucleic acid molecule is an AR polypeptide of: , D233K, S243L, A252V, L255P, M266T, P269S, A287D, E288K, S334P, S335T, P340L, Y363N, L368V, A369P, P390R, P390S, P390L, A403V, Q443R, G491S, G5 05D, P513S, G524D, G524S, D528G , P533S, L547F, P548S, D564Y, S567F, G568W, L574P, L547F, C559Y, G568W, G568V, Y571C, Y571H, A573D, T575A, C576R, C576F, G577R, S578T, C579Y, C5 79F, K580R, V581F, F582Y, F582S , R585K, A586V, A587S, A596T, A596S, S597G, S597I, N599Y, C601F, D604Y, R607Q, R608K, K609N, D610T, C611Y, R615H, R615P, R615G, R616C, L616R, L6 16P, R617P, C619Y, A622V, R629W , R629Q, K630T, L638M, A645D, S647N, E653K, S662 (nonsense), I664N, Q670L, Q670R, P671H, I672T, L674P, L677P, E681L, P682T, G683A, V684I, V684A, A687V , G688Q, H689P, D690V, D695N, D695V, D695H, L700M, L701P, L701I, H701H, S702A, S703G, N705S, N705Y, E706 (nonsense), L707R, G708A, R710T, Q711E, L712F, V715M, K717Q, K720E, A 721T, L722F, P723S, G724S , G724D, G724N, F725L, R726L, N727K, L728S, L728I, V730M, D732N, D732Y, D732E, Q733H, I737T, Y739D, W741R, M742V, M742I, G743R, G743V, L744F, M7 45T, V746M, A748D, A748V, A748T , M749V, M749I, G750S, G750D, W751R, R752Q, F754V, F754L, T755A, N756S, N756D, V757A, N758T, S759F, S759P, L762F, Y763H, Y763C, F764L, A765T, A7 65V, P766A, P766S, D767E, L768P , L768M, N771H, E772G, E772A, R774H, R774C, K777T, R779W, R786Q, G795V, M780I, S782N, C784Y, M787V, R788S, L790F, S791P, E793D, F794S, Q798E, Q8 02R, G803L, F804L, C806Y, M807V , M807R, M807I, L812P, F813V, S814N, N819Q, G820A, L821V, Q824L, Q824R, F827L, F827V, D828H, L830V, L830P, R831Q, R831L, Y834C, R840C, R840H, I8 41S, I842T, R846G, R854K, R855C , R855H, F856L, L863R, D864N, D864E, D864G, V866L, V866M, V866E, I869M, A870G, A870V, R871G, H874Y, H874R, Q875K, T877S, T877A, D879T, D879G, L8 80Q, L881V, M886V, S888L, V889M F891L, P892L, M895T, A896T, E897D, i898T, Q902R, V903M, P904S, P904H, L907F, G909R, G909E AR DNA containing mutations Alternatively, it hybridizes to the target region of RNA.

Targeting β - catenin and β- catenin - related genes polynucleic acid molecule

Catenin beta-1 (also known as CTNNB1, β-catenin, or beta-catenin) is a member of the catenin protein family. In humans, it is encoded by the CTNNB1 gene and is known for its dual functions of cell-cell adhesion and gene transcription. Beta-catenin is an essential structural component of cadherin-based adherens junctions, regulates cell growth and intercellular adhesion, and is anchored to the actin cytoskeleton. In some cases, beta-catenin is responsible for transmitting contact inhibitory signals that stop cells from dividing once the epithelial sheet is complete. Beta-catenin is also a major nuclear effector of the Wnt signaling pathway. In some cases, imbalances in the structural and signaling properties of beta-catenin result in disease and deregulated growth associated with malignancies such as cancer. For example, overexpression of beta-catenin has been linked to cancers such as gastric cancer (Suriano, et al., "Beta-catenin (CTNNB1) gene amplification: a new mechanism of protein overexpression in cancer," Genes Chromosomes Cancer 42(3 ): 238-246 (2005)). In some cases, mutations in the CTNNB1 gene have been associated with the development of cancer (e.g., colon cancer, melanoma, hepatocellular carcinoma, ovarian cancer, endometrial cancer, medulloblastoma, pilomatricoma, or prostate cancer). , was associated with metastatic progression. In a further case, mutations in the CTNNB1 gene translocate beta-catenin to the nucleus and consistently induce transcription of its target genes without any external stimulation. In some cases, the potential of beta-catenin to change the previously epithelial phenotype of affected cells to an invasive mesenchymal-like type contributes to metastasis formation.

In some embodiments, the CTNNB1 gene is wild type CTNNB1 or CTNNB1 comprising one or more mutations. In some cases, CTNNB1 is wild type CTNNB1 . In some cases, CTNNB1 is a CTNNB1 that contains one or more mutations. In some cases, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to the target region of wild-type CTNNB1 . In some cases, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of CTNNB1 containing a mutation (e.g., substitution, deletion, or addition).

In some embodiments, CTNNB1 DNA or RNA contains one or more mutations. In some embodiments, the CTNNB1 DNA or RNA includes one or more mutations within one or more exons. In some cases, one or more exons include exon 3. In some cases, the CTNNB1 DNA or RNA contains one or more mutations at codons 32, 33, 34, 37, 41, 45, 183, 245, 287, or combinations thereof. In some cases, CTNNB1 DNA or RNA consists of amino acid residues 25, 31, 32, 33, 34, 35, 36, 37, 41, 45, 140, 162, 170, 199, 213, 215, 257, 303, of the CTNNB1 polypeptide. 322, 334, 354, 367, 373, 383, 387, 402, 426, 453, 474, 486, 515, 517, 535, 553, 555, 582, 587, 619, 623, 641, 646, 688, 703 , It contains one or more mutations at positions corresponding to 710, 712, 714, 724, 738, 777, or a combination thereof. In some embodiments, CTNNB1 DNA or RNA comprises W25 (nonsense mutation), L31M, D32A, D32N, D32Y, D32G, D32H, S33C, S33Y, S33F, S33P, G34R, G34E, G34V, I35S, H36Y, S37F, S37P, S37C, S37A, T41N, T41A, T41I, S45Y, S45F, S45C, I140T, D162E, K170M, V199I, C213F, A215T, T257I, I303M, Q322K, E334K, K354T, G367V, P3 73S, W383G, N387K, L402F, N426D, R453L, R453Q, R474 (nonsense mutation), R486C, R515Q, L517F, R535 (nonsense mutation), R535Q, M553V, G555A, R582Q, R587Q, C619Y, Q623E, T641 (frameshift), S646F, M68 8T, Comprising one or more mutations at a position corresponding to an amino acid residue selected from Q703H, R710H, D712N, P714R, Y724H, E738K, F777S, or combinations thereof.

In some embodiments, the polynucleic acid molecule is CTNNB1 comprising one or more mutations. Hybridizes to the target region of DNA or RNA. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations within exon 3. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNB1 DNA or RNA comprising one or more mutations at codons 32, 33, 34, 37, 41, 45, 183, 245, 287, or combinations thereof. In some embodiments, the polynucleic acid molecule comprises amino acid residues 25, 31, 32, 33, 34, 35, 36, 37, 41, 45, 140, 162, 170, 199, 213, 215, 257, 303 of the CTNNB1 polypeptide. , 322, 334, 354, 367, 373, 383, 387, 402, 426, 453, 474, 486, 515, 517, 535, 553, 555, 582, 587, 619, 623, 641, 646, 688, 7 03 , 710, 712, 714, 724, 738, 777, or a combination thereof. In some embodiments, the polynucleic acid molecule is W25 (nonsense mutation), L31M, D32A, D32N, D32Y, D32G, D32H, S33C, S33Y, S33F, S33P, G34R, G34E, G34V, I35S, H36Y, S37F of the CTNNB1 polypeptide. , S37P, S37C, S37A, T41N, T41A, T41I, S45Y, S45F, S45C, I140T, D162E, K170M, V199I, C213F, A215T, T257I, I303M, Q322K, E334K, K354T, G367V, P373S , W383G, N387K, L402F , N426D, R453L, R453Q, R474 (nonsense mutation), R486C, R515Q, L517F, R535 (nonsense mutation), R535Q, M553V, G555A, R582Q, R587Q, C619Y, Q623E, T641 (frameshift), S646F, M688T, Q 703H Hybridizes to the target region of CTNNB1 DNA or RNA containing one or more mutations selected from , R710H, D712N, P714R, Y724H, E738K, F777S, or combinations thereof.

In some embodiments, the beta-catenin related genes further include PIK3CA , PIK3CB , and MYC . In some embodiments, the beta-catenin related gene further comprises PIK3CA DNA or RNA. PIK3CA (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha or p110α protein) is a class i PI 3-kinase catalytic subunit that uses ATP to phosphorylate phosphatidylinositol. In some embodiments, the PIK3CA gene is wild type PIK3CA or PIK3CA comprising one or more mutations. In some cases, the PIK3CA DNA or RNA is wild-type PIK3CA . In some cases, PIK3CA DNA or RNA contains one or more mutations. In some cases, the polynucleic acid molecule hybridizes to a target region of wild-type PIK3CA DNA or RNA. In some cases, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA containing the mutation (e.g., substitution, deletion, or addition).

In some embodiments, PIK3CA DNA or RNA contains one or more mutations. In some embodiments, the PIK3CA DNA or RNA comprises one or more mutations within one or more exons. In some cases, the PIK3CA DNA or RNA contains one or more mutations within exons 9 and/or 20. In some cases, PIK3CA DNA or RNA consists of amino acid residues 1, 4, 10-16, 11-18, 11, 12, 38, 39, 65, 72, 75, 79, 81, 83, 88, 90, 93, 102, 103, 103-104, 103-106, 104, 105-108, 106, 106-107, 106-108, 107, 108, 109-112, 110, 111, 113, 115, 137, 170, 258, 272, 279, 320, 328, 335, 342, 344, 345, 350, 357, 359, 363, 364, 365, 366, 378, 398, 401, 417, 420, 447-455, 449, 449- 457, 451, 453, 454, 455, 455-460, 463-465, 471, 495, 522, 538, 539, 542, 545, 546, 547, 576, 604, 614, 617, 629, 643, 663, 682, 725, 726, 777, 791, 818, 866, 901, 909, 939, 951, 958, 970, 971, 975, 992, 1004, 1007, 1016, 1017, 1021, 1025, 1029, 1 037, 1040, It contains one or more mutations at positions corresponding to 1043, 1044, 1045, 1047, 1048, 1049, 1052, 1065, 1069, or combinations thereof. In some embodiments, the PIK3CA DNA or RNA comprises M1V, R4 (nonsense mutation), L10-M16 (deletion), W11-P18 (deletion), W11L, G12D, R38L, R38H, R38C, R38S, E39K, E39G, E65K, S72G, Q75E, R79M, E81K, E81 (deletion), F83Y, R88Q, C90Y, C90G, R93Q, R93W, I102 (deletion), E103G, E103-P104 (deletion), E103-G106 (deletion), P104L, V105-R108 (deletion), G106V, G106-N107 (deletion), G106-R108 (deletion), G106R, N107S, R108L, R108H, E109-I112 (deletion), E110 (deletion), K111E , K111R, K111N, K111 (deletion), L113 (deletion), R115L, Q137L, N170S, D258N, Y272 (nonsense mutation), L279I, G320V, W328S, R335G, T342S, V344G, V344M, V344A, N345K, N345 I, N345T , D350N, D350G, R357Q, G359R, G363A, G364R, E365K, E365V, P366R, C378R, C378Y, R398H, R401Q, E417K, C420R, C420G, P447-L455 (deletion), P449L, P449-N 457 (deletion), G451R , G451V, E453K, E453Q, E453D, D454Y, L455 (frameshift insertion), L455-G460 (deletion), G463-N465 (deletion), P471L, P471A, H495L, H495Y, E522A, D538N, P539R, E542K, E542 V, E542G, E542Q, E542A, E545K, E545A, E545G, E545Q, E545D, Q546K, Q546R, Q546P, E547D, S576Y, C604R, F614I, A617W, S629C, Q643H, I663S, Q682 (deletion), D 725N, W726K, R777M, E791Q , R818C, L866W, C901F, F909L, D939G, R951C, Q958R, E970K, C971R, R975S, R992P, M1004I, G1007R, F1016C, D1017H, Y1021H, Y1021C, T1025A, T1025S, D1029H, E1037K, M1040V, M1043V, M1043I, N1044K , N1044Y, D1045V, H1047R, H1047L, H1047Y, H1047Q, H1048R, G1049R, T1052K, H1065L, 1069W (non-stop mutation), or combinations thereof.

In some embodiments, the polynucleic acid molecule comprises one or more mutations. Hybridizes to the target region of PIK3CA DNA or RNA. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA containing one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations within exon 9 or exon 20. In some embodiments, the polynucleic acid molecule comprises amino acid residues 1, 4, 10-16, 11-18, 11, 12, 38, 39, 65, 72, 75, 79, 81, 83, 88, 90 of the PIK3CA polypeptide. , 93, 102, 103, 103-104, 103-106, 104, 105-108, 106, 106-107, 106-108, 107, 108, 109-112, 110, 111, 113, 115, 137, 170 , 258, 272, 279, 320, 328, 335, 342, 344, 345, 350, 357, 359, 363, 364, 365, 366, 378, 398, 401, 417, 420, 447-455, 449, 44 9 -457, 451, 453, 454, 455, 455-460, 463-465, 471, 495, 522, 538, 539, 542, 545, 546, 547, 576, 604, 614, 617, 629, 643, 663 , 682, 725, 726, 777, 791, 818, 866, 901, 909, 939, 951, 958, 970, 971, 975, 992, 1004, 1007, 1016, 1017, 1021, 1025, 1029, 1037, 1040 , 1043, 1044, 1045, 1047, 1048, 1049, 1052, 1065 , 1069, or combinations thereof. In some embodiments, the polynucleic acid molecule is M1V, R4 (nonsense mutation), L10-M16 (deletion), W11-P18 (deletion), W11L, G12D, R38L, R38H, R38C, R38S, E39K, E39G of the PIK3CB polypeptide. , E65K, S72G, Q75E, R79M, E81K, E81 (deletion), F83Y, R88Q, C90Y, C90G, R93Q, R93W, I102 (deletion), E103G, E103-P104 (deletion), E103-G106 (deletion), P104L , V105-R108 (deletion), G106V, G106-N107 (deletion), G106-R108 (deletion), G106R, N107S, R108L, R108H, E109-I112 (deletion), E110 (deletion), K111E, K111R, K111N, K111 (deletion), L113 (deletion), R115L, Q137L, N170S, D258N, Y272 (nonsense mutation), L279I, G320V, W328S, R335G, T342S, V344G, V344M, V344A, N345K, N345I, N345T, D350N, D350G, R357Q, G359R, G363A, G364R, E365K, E365V, P366R, C378R, C378Y, R398H, R401Q, E417K, C420R, C420G, P447-L455 (deletion), P449L, P449-N457 (deletion), G451R, G451V, E453K, E453Q, E453D, D454Y, L455 (frameshift insertion), L455-G460 (deletion), G463-N465 (deletion), P471L, P471A, H495L, H495Y, E522A, D538N, P539R, E542K, E542V, E542G, E542Q, E542A , E545K, E545A, E545G, E545Q, E545D, Q546K, Q546R, Q546P, E547D, S576Y, C604R, F614I, A617W, S629C, Q643H, I663S, Q682 (deletion), D725N, W726K, R777M , E791Q, R818C, L866W, C901F, F909L, D939G, R951C, Q958R, E970K, C971R, R975S, R992P, M1004I, G1007R, F1016C, D1017H, Y1021H, Y1021C, T1025A, T1025S, D1029H, E1037K, M1040V, M1043V, M1043I, N1044K, N1044Y, D1045V, Hybridization to a target region of PIK3CA DNA or RNA containing one or more mutations at positions corresponding to amino acid residues selected from H1047R, H1047L, H1047Y, H1047Q, H1048R, G1049R, T1052K, H1065L, 1069W (non-stop mutations), or combinations thereof. It is a polynucleic acid molecule that

In some embodiments, the beta-catenin related gene further comprises PIK3CB . In some embodiments, the PIK3CB gene is wild type or comprises one or more mutations. In some cases, the PIK3CB DNA or RNA is wild-type PIK3CB DNA or RNA. In some cases, PIK3CB DNA or RNA contains one or more mutations. In some cases, the polynucleic acid molecule is wild-type PIK3CB Hybridizes to the target region of DNA or RNA. In some cases, the polynucleic acid molecule hybridizes to a target region of the PIK3CB DNA or RNA containing the mutation (e.g., substitution, deletion, or addition).

In some embodiments, PIK3CB DNA or RNA contains one or more mutations. In some embodiments, the PIK3CB DNA or RNA comprises one or more mutations within one or more exons. In some cases, PIK3CB DNA or RNA consists of amino acid residues 18, 19, 21, 28, 50, 61, 68, 103, 135, 140, 167, 252, 270, 290, 301, 304, 321, 369, 417, 442, 470, 497, 507, 512, 540, 551, 552, 554, 562, 567, 593, 595, 619, 628, 668, 768, 805, 824, 830, 887, 967, 992, 100 5, It contains one or more mutations at positions corresponding to 1020, 1036, 1046, 1047, 1048, 1049, 1051, 1055, 1067, or combinations thereof. In some embodiments, PIK3CB DNA or RNA is W18 (nonsense mutation), A19V, D21H, G28S, A50P, K61T, M68I, R103K, H135N, L140S, S167C, G252W, R270W, K290N, E301V, I304R, R321Q, V369I, T417M, N442K, E470K, E497D, P507S, I512M, E540 (nonsense mutation), C551R, E552K, E554K, R562 (nonsense mutation), E567D, A593V, L595P, V619A, R628 (nonsense mutation), R668 W, L768F, K805E, D824E, A830T, E887 (nonsense mutation), V967A, I992T, A1005V, D1020H, E1036K, D1046N, E1047K, A1048V, L1049R, E1051K, T1055A, D1067V, D1067A, or Corresponding to amino acid residues selected from combinations thereof Contains one or more mutations at a position.

In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA containing one or more mutations within an exon. In some embodiments, the polynucleic acid molecule comprises amino acid residues 18, 19, 21, 28, 50, 61, 68, 103, 135, 140, 167, 252, 270, 290, 301, 304, 321, 369 of the PIK3CB polypeptide. , 417, 442, 470, 497, 507, 512, 540, 551, 552, 554, 562, 567, 593, 595, 619, 628, 668, 768, 805, 824, 830, 887, 967, 992, 1 005 , 1020 , 1036, 1046, 1047, 1048, 1049, 1051, 1055, 1067, or combinations thereof. In some embodiments, the polynucleic acid molecule is W18 (nonsense mutation), A19V, D21H, G28S, A50P, K61T, M68I, R103K, H135N, L140S, S167C, G252W, R270W, K290N, E301V, I304R, R321Q of the PIK3CB polypeptide. , V369I, T417M, N442K, E470K, E497D, P507S, I512M, E540 (nonsense mutation), C551R, E552K, E554K, R562 (nonsense mutation), E567D, A593V, L595P, V619A, R628 (nonsense mutation), R668W, L7 68F , K805E, D824E, A830T, E887 (nonsense mutation), V967A, I992T, A1005V, D1020H, E1036K, D1046N, E1047K, A1048V, L1049R, E1051K, T1055A, D1067V, D1067A, or a combination thereof. Position corresponding to selected amino acid residue Hybridizes to a target region of PIK3CB DNA or RNA containing one or more mutations.

In some embodiments, the beta-catenin related gene further comprises MYC . In some embodiments, the MYC gene is wild-type MYC or MYC comprising one or more mutations. In some cases, MYC is wild-type MYC DNA or RNA. In some cases, MYC DNA or RNA contains one or more mutations. In some cases, the polynucleic acid molecule hybridizes to a target region of wild-type MYC DNA or RNA. In some cases, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of MYC DNA or RNA containing a mutation (e.g., substitution, deletion, or addition).

In some embodiments, MYC DNA or RNA comprises one or more mutations. In some embodiments, the MYC DNA or RNA includes one or more mutations within one or more exons. In some cases, MYC DNA or RNA contains one or more mutations within exon 2 or exon 3. In some cases, MYC DNA or RNA contains amino acid residues 2, 7, 17, 20, 32, 44, 58, 59, 76, 115, 138, 141, 145, 146, 169, 175, 188, 200, 202, 203, It contains one or more mutations at positions corresponding to positions 248, 251, 298, 321, 340, 369, 373, 374, 389, 395, 404, 419, 431, 439, or combinations thereof. In some embodiments, MYC DNA or RNA comprises MYC polypeptides P2L, F7L, D17N, Q20E, Y32N, A44V, A44T, T58I, P59L, A76V, F115L, F138S, A141S, V145I, S146L, S169C, S175N, C188F, One or more mutations at positions corresponding to amino acid residues selected from N200S, S202N, S203T, T248S, D251E, S298Y, Q321E, V340D, V369D, T373K, H374R, F389L, Q395H, K404N, L419M, E431K, R439Q, or combinations thereof. Includes.

In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA containing one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations within exon 2 or exon 3. In some embodiments, the polynucleic acid molecule comprises amino acid residues 2, 7, 17, 20, 32, 44, 58, 59, 76, 115, 138, 141, 145, 146, 169, 175, 188, 200 of the MYC polypeptide. MYC DNA or Hybridizes to the target region of RNA. In some embodiments, the polynucleic acid molecule is P2L, F7L, D17N, Q20E, Y32N, A44V, A44T, T58I, P59L, A76V, F115L, F138S, A141S, V145I, S146L, S169C, S175N, C188F, N200S of MYC polypeptide. , S202N, S203T, T248S, D251E, S298Y, Q321E, V340D, V369D, T373K, H374R, F389L, Q395H, K404N, L419M, E431K, R439Q, or combinations thereof. hybridizes to the target region of MYC DNA or RNA.

hypoxanthine Phosphoribosyltransferase One( HPRT1 )second targeting polynucleic acid molecule

Hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is a transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate. HGPRT is encoded by the hypoxanthine phosphoribosyltransferase 1 ( HPRT1 ) gene.

In some embodiments, the HPRT1 DNA or RNA is wild type or comprises one or more mutations. In some cases, HPRT1 DNA or RNA contains one or more mutations within one or more exons. In some cases, one or more exons include exon 2, exon 3, exon 4, exon 6, exon 8, or exon 9. In some cases, the HPRT1 DNA or RNA contains one or more mutations at positions corresponding to amino acid residues 35, 48, 56, 74, 87, 129, 154, 162, 195, 200, 210, or combinations thereof of the HPRT1 polypeptide. . In some embodiments, the polynucleic acid molecule comprises V35M, R48H, E56D, F74L, R87I, N129 (splice-site mutation), N154H, S162 (splice-site mutation), Y195C, Y195N, R200M, E210K of the HPRT1 polypeptide. , or a combination thereof, comprising one or more mutations selected from Hybridizes to the target region of HPRT1 DNA or RNA.

In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRT1 DNA or RNA comprising one or more mutations within exon 2, exon 3, exon 4, exon 6, exon 8, or exon 9. In some embodiments, the polynucleic acid molecule comprises one or more mutations at positions corresponding to amino acid residues 35, 48, 56, 74, 87, 129, 154, 162, 195, 200, 210, or combinations thereof of the HPRT1 polypeptide. Hybridizes to the target region of HPRT1 DNA or RNA. In some embodiments, the polynucleic acid molecule comprises V35M, R48H, E56D, F74L, R87I, N129 (splice-site mutation), N154H, S162 (splice-site mutation), Y195C, Y195N, R200M, E210K of the HPRT1 polypeptide. Hybridizes to the target region of HPRT1 DNA or RNA containing one or more mutations selected from , or combinations thereof.

polynucleic acid molecular sequence

In some embodiments, the polynucleic acid molecule comprises a sequence that hybridizes to a target sequence exemplified in Tables 1, 4, 7, 8, or 10. In some cases, the polynucleic acid molecule is B. In some cases, polynucleic acid molecule B includes a sequence that hybridizes to the target sequence illustrated in Table 1 (KRAS target sequence). In some cases, polynucleic acid molecule B comprises a sequence that hybridizes to the target sequence illustrated in Table 4 (EGFR target sequence). In some cases, polynucleic acid molecule B comprises a sequence that hybridizes to the target sequence illustrated in Table 7 (AR target sequence). In some cases, polynucleic acid molecule B comprises a sequence that hybridizes to the target sequence illustrated in Table 8 (β-catenin target sequence). In additional cases, polynucleic acid molecule B comprises a sequence that hybridizes to the target sequences illustrated in Table 10 (PIK3CA and PIK3CB target sequences).

In some embodiments, polynucleic acid molecule B has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of the sequence listed in Table 2 or Table 3. %, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 50% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 60% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 70% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 75% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 80% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 85% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 90% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 96% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 97% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 98% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 99% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 16-75.

In some embodiments, polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NOs: 16-75. %, 98%, 99%, or 100% sequence identity. In some cases, the second polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NOs: 16-75 %, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NOs: 16-75. , a first polynucleotide having 98%, 99%, or 100% sequence identity and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% to SEQ ID NOs: 16-75. , a second polynucleotide having 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.

In some embodiments, polynucleic acid molecule B has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of the sequence listed in Table 5 or Table 6. %, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 50% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 60% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 70% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 75% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 80% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 85% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 90% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 96% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 97% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 98% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 99% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 452-1955.

In some embodiments, polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NO: 452-1955 %, 98%, 99%, or 100% sequence identity. In some cases, the second polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NO: 452-1955 %, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 452-1955. , a first polynucleotide having 98%, 99%, or 100% sequence identity and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% to SEQ ID NO: 452-1955. , a second polynucleotide having 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.

In some embodiments, polynucleic acid molecule B has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% of the sequence listed in Table 7. %, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 50% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 60% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 70% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 75% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 80% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 85% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 90% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 96% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 97% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 98% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 99% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 1956-1962.

In some embodiments, polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NOs: 1956-1962 %, 98%, 99%, or 100% sequence identity. In some cases, the second polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NOs: 1956-1962 %, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 1956-1962 , a first polynucleotide having 98%, 99%, or 100% sequence identity, and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85 to SEQ ID NOs: 1956-1962 and a second polynucleotide complementary to the sequence having %, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.

In some embodiments, polynucleic acid molecule B has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% of the sequence listed in Table 9. %, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 50% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 60% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 70% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 75% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 80% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 85% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 90% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 96% sequence identity to SEQ ID NO: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 97% sequence identity to SEQ ID NO: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 98% sequence identity to SEQ ID NO: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 99% sequence identity to SEQ ID NO: 1967-2002. In some embodiments, the polynucleic acid molecule consists of SEQ ID NO: 1967-2002.

In some embodiments, polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NO: 1967-2002 %, 98%, 99%, or 100% sequence identity. In some cases, the second polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NO: 1967-2002 %, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 1967-2002 , a first polynucleotide having 98%, 99%, or 100% sequence identity and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% to SEQ ID NO: 1967-2002. , a second polynucleotide having 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.

In some embodiments, polynucleic acid molecule B has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% of the sequence listed in Table 11. %, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 50% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 60% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 70% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 75% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 80% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 85% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 90% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 95% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 96% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 97% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 98% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 99% sequence identity to SEQ ID NO: 2013-2032. In some embodiments, the polynucleic acid molecule consists of SEQ ID NO: 2013-2032.

In some embodiments, polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NO: 2013-2032 %, 98%, 99%, or 100% sequence identity. In some cases, the second polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97 for SEQ ID NO: 2013-2032 %, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2013-2032 , a first polynucleotide having 98%, 99%, or 100% sequence identity and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% to SEQ ID NO: 2013-2032. , a second polynucleotide having 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.

In some embodiments, polynucleic acid molecule B has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% of the sequence listed in Table 12. %, 97%, 98%, 99%, or 100% sequence identity.

In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% of SEQ ID NO: 2082-2109 or 2117. %, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 50% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 60% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 70% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 75% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 80% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 85% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 90% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 95% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 96% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 97% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 98% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence with at least 99% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 2082-2109 or 2117.

In some embodiments, polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% for SEQ ID NOs: 2082-2109 or 2117. , includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some cases, the second polynucleotide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% for SEQ ID NOs: 2082-2109 or 2117. , includes sequences having 97%, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, A first polynucleotide having 97%, 98%, 99%, or 100% sequence identity and at least 50%, 55%, 60%, 65%, 70%, 75%, 80 to SEQ ID NO: 2082-2109 or 2117 %, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity.

polynucleic acid molecule

In some embodiments, polynucleic acid molecules described herein include RNA or DNA. In some cases, polynucleic acid molecules include RNA. In some cases, RNA is short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), or heterologous nuclear RNA (hnRNA). ) includes. In some cases, RNA includes shRNA. In some cases, RNA includes miRNA. In some cases, RNA includes dsRNA. In some cases, RNA includes tRNA. In some cases, RNA includes rRNA. In some cases, RNA includes hnRNA. In some cases, RNA includes siRNA. In some cases, polynucleic acid molecules include siRNA. In some cases, B includes siRNA.

In some embodiments, the polynucleic acid molecule is about 10 to about 50 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides in length.

In some embodiments, the polynucleic acid molecule is about 50 nucleotides in length. In some cases, polynucleic acid molecules are about 45 nucleotides long. In some cases, polynucleic acid molecules are about 40 nucleotides long. In some cases, polynucleic acid molecules are about 35 nucleotides long. In some cases, polynucleic acid molecules are about 30 nucleotides long. In some cases, polynucleic acid molecules are about 25 nucleotides long. In some cases, polynucleic acid molecules are about 20 nucleotides long. In some cases, polynucleic acid molecules are about 19 nucleotides long. In some cases, polynucleic acid molecules are about 18 nucleotides long. In some cases, polynucleic acid molecules are about 17 nucleotides long. In some cases, polynucleic acid molecules are about 16 nucleotides long. In some cases, polynucleic acid molecules are about 15 nucleotides long. In some cases, polynucleic acid molecules are about 14 nucleotides long. In some cases, polynucleic acid molecules are about 13 nucleotides long. In some cases, polynucleic acid molecules are about 12 nucleotides long. In some cases, polynucleic acid molecules are about 11 nucleotides long. In some cases, polynucleic acid molecules are about 10 nucleotides long. In some cases, the polynucleic acid molecule is about 10 to about 50 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 45 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 40 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 35 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 30 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 25 nucleotides in length. In some cases, the polynucleic acid molecule is about 10 to about 20 nucleotides in length. In some cases, the polynucleic acid molecule is about 15 to about 25 nucleotides in length. In some cases, the polynucleic acid molecule is about 15 to about 30 nucleotides in length. In some cases, the polynucleic acid molecule is about 12 to about 30 nucleotides in length.

In some embodiments, the polynucleic acid molecule comprises a first polynucleotide. In some cases, the polynucleic acid molecule includes a second polynucleotide. In some cases, a polynucleic acid molecule includes a first polynucleotide and a second polynucleotide. In some cases, the first polynucleotide is the sense strand or the passenger strand. In some cases, the second polynucleotide is an antisense strand or a guide strand.

In some embodiments, the polynucleic acid molecule is a first polynucleotide. In some embodiments, the first polynucleotide is about 10 to about 50 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides in length.

In some cases, the first polynucleotide is about 50 nucleotides long. In some cases, the first polynucleotide is about 45 nucleotides long. In some cases, the first polynucleotide is about 40 nucleotides long. In some cases, the first polynucleotide is about 35 nucleotides long. In some cases, the first polynucleotide is about 30 nucleotides long. In some cases, the first polynucleotide is about 25 nucleotides long. In some cases, the first polynucleotide is about 20 nucleotides long. In some cases, the first polynucleotide is about 19 nucleotides long. In some cases, the first polynucleotide is about 18 nucleotides long. In some cases, the first polynucleotide is about 17 nucleotides long. In some cases, the first polynucleotide is about 16 nucleotides long. In some cases, the first polynucleotide is about 15 nucleotides long. In some cases, the first polynucleotide is about 14 nucleotides long. In some cases, the first polynucleotide is about 13 nucleotides long. In some cases, the first polynucleotide is about 12 nucleotides long. In some cases, the first polynucleotide is about 11 nucleotides long. In some cases, the first polynucleotide is about 10 nucleotides long. In some cases, the first polynucleotide is about 10 to about 50 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 45 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 40 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 35 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 30 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 25 nucleotides in length. In some cases, the first polynucleotide is about 10 to about 20 nucleotides in length. In some cases, the first polynucleotide is about 15 to about 25 nucleotides in length. In some cases, the first polynucleotide is about 15 to about 30 nucleotides in length. In some cases, the first polynucleotide is about 12 to about 30 nucleotides in length.

In some embodiments, the polynucleic acid molecule is a second polynucleotide. In some embodiments, the second polynucleotide is about 10 to about 50 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 30, about 15 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 nucleotides in length.

In some cases, the second polynucleotide is about 50 nucleotides long. In some cases, the second polynucleotide is about 45 nucleotides in length. In some cases, the second polynucleotide is about 40 nucleotides in length. In some cases, the second polynucleotide is about 35 nucleotides long. In some cases, the second polynucleotide is about 30 nucleotides in length. In some cases, the second polynucleotide is about 25 nucleotides long. In some cases, the second polynucleotide is about 20 nucleotides long. In some cases, the second polynucleotide is about 19 nucleotides long. In some cases, the second polynucleotide is about 18 nucleotides long. In some cases, the second polynucleotide is about 17 nucleotides long. In some cases, the second polynucleotide is about 16 nucleotides long. In some cases, the second polynucleotide is about 15 nucleotides long. In some cases, the second polynucleotide is about 14 nucleotides long. In some cases, the second polynucleotide is about 13 nucleotides long. In some cases, the second polynucleotide is about 12 nucleotides long. In some cases, the second polynucleotide is about 11 nucleotides long. In some cases, the second polynucleotide is about 10 nucleotides long. In some cases, the second polynucleotide is about 10 to about 50 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 45 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 40 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 35 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 30 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 25 nucleotides in length. In some cases, the second polynucleotide is about 10 to about 20 nucleotides in length. In some cases, the second polynucleotide is about 15 to about 25 nucleotides in length. In some cases, the second polynucleotide is about 15 to about 30 nucleotides in length. In some cases, the second polynucleotide is about 12 to about 30 nucleotides in length.

In some embodiments, the polynucleic acid molecule includes a first polynucleotide and a second polynucleotide. In some cases, the polynucleic acid molecule further comprises blunt ends, overhangs, or combinations thereof. In some cases, the blunt ends are 5' blunt ends, 3' blunt ends, or both. In some cases, the overhang is a 5' overhang, a 3' overhang, or both. In some cases, the overhang includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base pairing nucleotides. In some cases, the overhang includes 1, 2, 3, 4, 5, or 6 non-base pairing nucleotides. In some cases, the overhang includes 1, 2, 3, or 4 non-base pairing nucleotides. In some cases, the overhang includes one non-base pairing nucleotide. In some cases, the overhang includes two non-base pairing nucleotides. In some cases, the overhang includes three non-base pairing nucleotides. In some cases, the overhang includes four non-base pairing nucleotides.

In some embodiments, the sequence of the polynucleic acid molecule is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% relative to the target sequence described herein. %, 98%, 99%, or 99.5% complementary. In some embodiments, the sequence of the polynucleic acid molecule is at least 50% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 60% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 70% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 80% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 90% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 95% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 99% complementary to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule is 100% complementary to the target sequence described herein.

In some embodiments, the sequence of the polynucleic acid molecule has no more than 5 mismatches to the target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule has no more than 4 mismatches to the target sequence described herein. In some cases, the sequence of a polynucleic acid molecule may have three or fewer mismatches to the target sequence described herein. In some cases, the sequence of a polynucleic acid molecule may have two or fewer mismatches to the target sequence described herein. In some cases, the sequence of a polynucleic acid molecule may have one or fewer mismatches to the target sequence described herein.

In some embodiments, the specificity of a polynucleic acid molecule that hybridizes to a target sequence described herein is 95%, 98%, 99%, 99.5%, or 100% sequence complementarity of the polynucleic acid molecule to the target sequence. In some cases, hybridization is subject to high stringency hybridization conditions.

In some embodiments, the polynucleic acid molecule hybridizes to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least eight contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 9 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 10 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 11 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 12 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 13 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 14 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 15 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 16 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 17 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 18 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 19 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 20 contiguous bases of a target sequence described herein.

In some embodiments, polynucleic acid molecules have reduced off-target effects. In some cases, “off-target” or “off-target effects” are the unintended effects of a polynucleic acid polymer against a given target interacting directly or indirectly with another mRNA sequence, DNA sequence, or cellular protein or other moiety. It refers to any case that causes an effect. In some cases, “off-target effects” occur when there is simultaneous degradation of other transcripts due to partial homology or complementarity between the other transcripts and the sense and/or antisense strands of the polynucleic acid molecule.

In some embodiments, polynucleic acid molecules include natural, synthetic, or artificial nucleotide analogs or bases. In some cases, polynucleic acid molecules include a combination of DNA, RNA, and/or nucleotide analogs. In some cases, synthetic or artificial nucleotide analogs or bases contain modifications in one or more of a ribose moiety, a phosphate moiety, a nucleoside moiety, or a combination thereof.

In some embodiments, the nucleotide analogs or artificial nucleotide bases described above include nucleic acids with modifications in the 2' hydroxyl group of the ribose moiety. In some cases, the modification includes H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, and R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogens, sulfur, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols, and oxygen. In some cases, the alkyl moiety further includes modifications. In some cases, the modification is an azo group, keto group, aldehyde group, carboxyl group, nitro group, nitroso group, nitrile group, heterocycle (e.g., imidazole, hydrazino or hydroxylamino) group, isocyanate or cyanate. groups, or sulfur-containing groups (such as sulfoxides, sulfones, sulfides, or disulfides). In some cases, the alkyl moiety further includes hetero substitution. In some cases, the carbon of the heterocyclic group is substituted by nitrogen, oxygen, or sulfur. In some cases, heterocyclic substitution includes, but is not limited to, morpholino, imidazole, and pyrrolidino.

In some cases, the modification at the 2' hydroxyl group is a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the 2'-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, while the 2'O-methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. . Exemplary chemical structures of the 2'-O-methyl modification of an adenosine molecule and the 2'O-methoxyethyl modification of uridine are shown below.

In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification in which an extended amine group comprising a propyl linker attaches the amine group to the 2' oxygen. In some cases, this modification introduces one positive charge from the amine group per sugar, neutralizing the overall negative charge from the phosphate of the oligonucleotide molecule and improving cellular uptake properties due to its zwitterionic nature. An exemplary chemical structure of 2'-O-aminopropyl nucleoside phosphoramidite is shown below.

In some cases, modifications at the 2' hydroxyl group cause the oxygen molecule bonded to the 2' carbon to be bonded to the 4' carbon by a methylene group, forming a 2'- C ,4'- C -oxy-methylene-linked bicyclic ribosome. Locked or cross-linked ribose modifications (e.g., locked nucleic acids or LNAs) that form nucleotide monomers. An exemplary representation of the chemical structure of LNA is shown below. The representation shown on the left highlights the chemical linkage of the LNA monomer. The representation shown on the right highlights the locked 3'-endo ( ³ E) conformation of the furanose ring of the LNA monomer.

In some cases, modifications at the 2' hydroxyl group involve ethylene nucleic acids (ENAs), such as 2'-4'-ethylene-bridged nucleic acids, which lock the sugar form into a C _3' -endo sugar puckering form. . ENAs are part of the bridging nucleic acid class of modified nucleic acids that also include LNAs. Exemplary chemical structures of ENA and cross-linked nucleic acids are shown below.

In some embodiments, additional modifications at the 2' hydroxyl group include 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2 '-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or Includes 2'-O-N-methylacetamido (2'-O-NMA).

In some embodiments, the nucleotide analog is a modified base, such as, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N, N,-dimethyladenine, 2 -propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides with modifications at the 5 position, 5-(2 -Amino) propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguano Sine, 7-methylguanosine, 2, 2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides (e.g., 7-deaza-adenosine, 6-azouridine, 6-azocitidine, or 6-azothymidine), 5-methyl-2-thiouridine, other thio bases (e.g., 2-thiouridine, 4-thiouridine, and 2-thiocitidine), Dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, optional O- and N-alkylated purines and pyrimidines (e.g. N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridin-4-one, or pyridin-2-one), phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxy Benzene, modified cytosine acting as a G-clamp nucleotide, 8-substituted adenine and guanine, 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyalkyl nucleotide, carboxyalkylaminoalkyl nucleotide, and alkylcarbonylalkylation. Contains nucleotides. Modified nucleotides also include nucleotides that are modified for the sugar moiety, as well as nucleotides with a non-ribosyl sugar or analog. For example, the sugar moiety in some cases is or is based on mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocycles, or carbocycles. The term nucleotide also includes what are known in the art as universal bases. By way of example, and not limitation, universal bases include 3-nitropyrrole, 5-nitroindole, or nebularine.

In some embodiments, the nucleotide analog is morpholino, peptide nucleic acid (PNA), methylphosphonate nucleotide, thiolphosphonate nucleotide, 2'-fluoro N3-P5'-phosphoramidite, or 1',5 '-anhydrohexitol nucleic acid (HNA) is further included. Morpholinos or phosphorodiamidate morpholino oligos (PMOs) include synthetic molecules whose structures mimic natural nucleic acid structures but deviate from the normal sugar and phosphate structures. In some cases, the 5-membered ribose ring is replaced with a 6-membered morpholino ring containing 4 carbons, 1 nitrogen, and 1 oxygen. In some cases, ribose monomers are linked by phosphorodiamidate groups instead of phosphate groups. In such cases, the backbone modification removes all positive and negative charges, making the morpholino a neutral molecule that can cross cell membranes without the aid of cell transport agents such as those used by charged oligonucleotides.

In some embodiments, the morpholino or PMO described above is a PMO comprising a positive or cationic charge. In some cases, the PMO is PMO plus (Sarepta). PMO plus can contain any number of (1-piperazino)phosphinylideneoxy, (1-(4-(omega-guanidino-alkanoyl))-piperazino)phosphinylideneoxy linkages (e.g. , as described in PCT Publication No. WO2008/036127). In some cases, the PMO is the PMO described in US Patent No. 7943762.

In some embodiments, the morpholino or PMO described above is PMO-X (Sarepta). In some cases, PMO-X is a phosphorodiamidate morpholino oligomer comprising at least one linkage or at least one of the disclosed terminal modifications, such as those disclosed in PCT Publication No. WO2011/150408 and US Publication No. 2012/0065169. refers to

In some embodiments, the morpholino or PMO described above is a PMO as described in Table 5 of US Publication No. 2014/0296321.

In some embodiments, the peptide nucleic acid (PNA) does not contain sugar rings or phosphate linkages and the bases are attached and appropriately spaced by oligoglycine-like molecules, eliminating backbone charge.

In some embodiments, one or more modifications optionally occur at internucleotide linkages. In some cases, modified internucleotide linkages include, but are not limited to, phosphorothioate; phosphorodithioate; methylphosphonate; 5'-alkylenephosphonate; 5'-methylphosphonate; 3'-alkylene phosphonate; boron trifluoridate; 3'-5' linkage or 2'-5' linkage; boranophosphate esters and selenophosphates of phosphotriesters; thionoalkylphosphotriester; hydrogen phosphonate bond; alkyl phosphonate; Alkylphosphonothioate; Arylphosphonothioate; phosphoroselenoate; Phosphorodicelenoate; phosphinate; phosphoramidate; 3'-alkylphosphoramidate; aminoalkylphosphoramidate; thionophosphoramidate; phosphoropiperazidate; phosphoroanilothioate; phosphoroanilidate; ketones; sulfone; sulfonamide; carbonate; carbamate; methylene hydrazo; methylene dimethyl hydrazo; Formacetal; thioform acetal; oxime; methylene imino; methylenemethylimino; thioamidate; A bond with a riboacetyl group; aminoethyl glycine; Silyl or siloxane linkage; For example, an alkyl or cycloalkyl bond with or without heteroatoms of 1 to 10 carbons, which may be saturated or unsaturated and/or substituted and/or contain heteroatoms; a bond in which the base has a morpholino structure, amide, or polyamide attached directly or indirectly to the aza nitrogen of the backbone; and combinations thereof.

In some cases, the modification is a methyl or thiol modification, such as a methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotides (left) and methylphosphonate nucleotides (right) are shown below.

In some cases, modified nucleotides include, but are not limited to, 2'-fluoro N3-P5'-phosphoramidites, shown as:

In some cases, modified nucleotides include, but are not limited to, hexitol nucleic acids (or 1', 5'-anhydrohexitol nucleic acids (HNA)), shown as follows:

In some embodiments, the one or more modifications include a modified phosphate backbone where the modification produces a neutral or uncharged backbone. In some cases, the phosphate backbone is modified by alkylation to produce an uncharged or neutral phosphate backbone. As used herein, alkylation includes methylation, ethylation, and propylation. In some cases, an alkyl group as used herein in the context of alkylation refers to a linear or branched saturated hydrocarbon group containing 1 to 6 carbon atoms. In some cases, exemplary alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, hexyl, It includes isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3.3-dimethylbutyl, and 2-ethylbutyl groups. In some cases, the modified phosphate is a phosphate group as described in US Pat. No. 9,481,905.

In some embodiments, the additional modified phosphate backbone includes methylphosphonate, ethylphosphonate, methylthiophosphonate, or methoxyphosphonate. In some cases, the modified phosphate is methylphosphonate. In some cases, the modified phosphate is ethylphosphonate. In some cases, the modified phosphate is methylthiophosphonate. In some cases, the modified phosphate is methoxyphosphonate.

In some embodiments, the one or more modifications optionally further include modifications of the ribose moiety, phosphate backbone, and nucleoside, or modifications of nucleotide analogs at the 3' or 5' end. For example, the 3' end optionally includes a 3' cationic group, or the nucleoside at the 3'-end is inverted using a 3'-3' linkage to include a 3' cationic group. In another alternative, the 3'-terminus is optionally conjugated with an aminoalkyl group, such as 3' C5-aminoalkyl dT. In a further alternative, the 3'-terminus is optionally conjugated to an abasic moiety, such as an apurinic or apyrimidine moiety. In some cases, the 5'-terminus is conjugated with an aminoalkyl group, such as a 5'-O-alkylamino substituent. In some cases, the 5'-terminus is conjugated to a base-free moiety, such as a purine-free or apyrimidine-free moiety.

In some embodiments, the polynucleic acid molecule comprises one or more of the artificial nucleotide analogs described herein. In some cases, the polynucleic acid molecule is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more as described herein. Includes the artificial nucleotide analogs described. In some embodiments, the artificial nucleotide analog is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more. 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2 '-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-O -dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modification, LNA, ENA, PNA, HNA, morpholino, methylphospho nate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidite, or combinations thereof. In some cases, the polynucleic acid molecule is 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy- 2'-Fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2' -O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modification, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotide, thiolphosphonate nucleotide, 2'-fluoro N3-P5'-phosphoramidite, or combinations thereof. In some cases, a polynucleic acid molecule has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more 2' -O-methyl modified nucleotides. In some cases, a polynucleic acid molecule has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more 2' -O-methoxyethyl (2'-O-MOE) modified nucleotides. In some cases, polynucleic acid molecules contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more thiolphosphatase Contains phonate nucleotides.

In some embodiments, the polynucleic acid molecule has at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 or more variants. In some cases, the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

In some cases, the polynucleic acid molecule has at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, and about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22 or more modified nucleotides. In some cases, the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

In some cases, the polynucleic acid molecule is about 5% to about 100% modified, about 10% to about 100% modified, about 20% to about 100% modified, about 30% to about 100% modified, about 40% to about 100% modified. at least one of a modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification Includes. In some cases, the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

In some cases, about 5 to about 100% of the polynucleic acid molecules comprise artificial nucleotide analogs described herein. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, of polynucleic acid molecules. 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some cases, about 5%, 10%, 15%, 20%, 25 of the polynucleic acid molecules of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117. %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the Includes the artificial nucleotide analogs described. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% of the polynucleic acid molecules of SEQ ID NOs: 16-45, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% of the polynucleic acid molecules of SEQ ID NO: 452-1203, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% of the polynucleic acid molecules of SEQ ID NO: 1956-1962, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% of the polynucleic acid molecules of SEQ ID NO: 1967-2002. 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% of the polynucleic acid molecules of SEQ ID NO: 2013-2032. 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some cases, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60 of the polynucleic acid molecules of SEQ ID NOs: 2082-2109 or 2117. %, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% comprises an artificial nucleotide analog described herein. In some embodiments, the artificial nucleotide analog is 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy. Oxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl ( 2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modification, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotide, thiolphosphonate nucleotide, 2'-fluoro N3-P5'-phosphoramidite, or combinations thereof.

In some cases, polynucleic acid molecules comprising artificial nucleotide analogs include SEQ ID NOs: 46-75. In some cases, polynucleic acid molecules comprising artificial nucleotide analogs include SEQ ID NOs: 1204-1955. In some cases, polynucleic acid molecules comprising artificial nucleotide analogs include SEQ ID NOs: 1967-2002. In some cases, polynucleic acid molecules comprising artificial nucleotide analogs include SEQ ID NOs: 2013-2032. In some cases, polynucleic acid molecules comprising artificial nucleotide analogs include SEQ ID NOs: 2082-2109 or 2117.

In some cases, one or more of the artificial nucleotide analogs described herein, compared to a natural polynucleic acid molecule, may be a nuclease, e.g., a ribonuclease such as RNase H, a deoxyribonuclease such as DNase, or 5 Resistant to exonucleases such as '-3' exonuclease and 3'-5' exonuclease. In some cases, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluo. , 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP) ), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modification, LNA, ENA, PNA, HNA, morpholino, Artificial nucleotide analogs, including methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidite, or combinations thereof, are ribonucleic acid nucleotides, such as nucleases, such as RNase H. Resistant to clease, deoxyribonuclease such as DNase, or exonuclease such as 5'-3' exonuclease and 3'-5' exonuclease. In some cases, the 2'-O-methyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some cases, 2'O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5 ' exonuclease resistance). In some cases, the 2'-O-aminopropyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). . In some cases, the 2'-deoxy modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some cases, the T-deoxy-2'-fluoro modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease). resistance). In some cases, 2'-O-aminopropyl (2'-O-AP) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5 ' exonuclease resistance). In some cases, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'- 5' exonuclease resistance). In some cases, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'- 5' exonuclease resistance). In some cases, T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5 ' exonuclease resistance). In some cases, the 2'-O-N-methylacetamido (2'-O-NMA) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3' -5' exonuclease resistance). In some cases, the LNA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the ENA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the HNA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistance). The morpholino may be nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some cases, the PNA-modified polynucleic acid molecule is resistant to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the methylphosphonate nucleotide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some cases, the thiolphosphonate nucleotide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistance). In some cases, the polynucleic acid molecule comprising 2'-fluoro N3-P5'-phosphoramidite is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5 ' exonuclease resistance). In some cases, the 5' conjugates described herein inhibit 5'-3' exonucleolytic cleavage. In some cases, the 3' conjugates described herein inhibit 3'-5' exonucleolytic cleavage.

In some embodiments, one or more of the artificial nucleotide analogs described herein have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2 '-O-aminopropyl (2'-0-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), T-O -dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modification, LNA, ENA, PNA, HNA, morpholino, methylphospho One or more of the artificial nucleotide analogs, including nucleotides, thiolphosphonate nucleotides, or 2'-fluoro N3-P5'-phosphoramidites, have increased activity against their mRNA targets compared to equivalent natural polynucleic acid molecules. It has binding affinity. In some cases, 2'-O-methyl modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, 2'-O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, 2'-O-aminopropyl modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. In some cases, 2'-deoxy modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, T-deoxy-2'-fluoro modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, 2'-O-aminopropyl (2'-O-AP) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, 2'-O-N-methylacetamido (2'-O-NMA) modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, LNA-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, ENA-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. In some cases, PNA-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. In some cases, HNA-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, morpholino-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. In some cases, methylphosphonate nucleotide-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent native polynucleic acid molecules. In some cases, thiolphosphonate nucleotide-modified polynucleic acid molecules have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. In some cases, polynucleic acid molecules comprising 2'-fluoro N3-P5'-phosphoramidite have increased binding affinity for their mRNA targets compared to equivalent natural polynucleic acid molecules. In some cases, increased affinity is exemplified by lower Kd, higher melting temperature (Tm), or combinations thereof.

In some embodiments, the polynucleic acid molecules described herein are chirally pure (or stereopure) polynucleic acid molecules, or polynucleic acid molecules that contain a single enantiomer. In some cases, polynucleic acid molecules include L-nucleotides. In some cases, polynucleic acid molecules include D-nucleotides. In some cases, the polynucleic acid molecular composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of its enantiomers. In some cases, the polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of a racemic mixture. In some cases, polynucleic acid molecules include those described in US Publication Nos. 2014/194610 and 2015/211006; and polynucleic acid molecules described in PCT Publication No. WO2015107425.

In some embodiments, the polynucleic acid molecules described herein are further modified to include an aptamer-conjugation moiety. In some cases, the aptamer conjugation moiety is a DNA aptamer-conjugation moiety. In some cases, the aptamer-conjugation moiety is an alphamer (Centauri Therapeutics) comprising an aptamer portion that recognizes a specific cell-surface target and a portion that presents a specific epitope for attachment to circulating antibodies. In some cases, the polynucleic acid molecules described herein are further modified to include an aptamer-conjugation moiety, as described in U.S. Pat. Nos. 8,604,184, 8,591,910, and 7,850,975.

In a further embodiment, the polynucleic acid molecules described herein are modified to increase their stability. In some embodiments, the polynucleic acid molecule is RNA (e.g., siRNA), and the polynucleic acid molecule is modified to increase its stability. In some cases, the polynucleic acid molecule is modified by one or more of the modifications described above to increase its stability. In some cases, the polynucleic acid molecule is a polynucleic acid molecule, such as 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy. Oxy-2'-fluoro, 2'-O-aminopropyl (2'-0-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl ( 2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modification or by locking or cross-linking ribose. Modified at the 2' hydroxyl position by conformation (e.g., LNA or ENA). In some cases, the polynucleic acid molecule is modified with 2'-O-methyl and/or 2'-O-methoxyethyl ribose. In some cases, polynucleic acid molecules can also be modified with morpholino, PNA, HNA, methylphosphonate nucleotides, thiolphosphonate nucleotides, and/or 2'-fluoro N3-P5'-phosphoramidase to increase their stability. includes t. In some cases, the polynucleic acid molecule is a chirally pure (or stereopure) polynucleic acid molecule. In some cases, chirally pure (or stereopure) polynucleic acid molecules are modified to increase their stability. Suitable modifications to RNA to increase stability for delivery will be apparent to those skilled in the art.

In some embodiments, the polynucleic acid molecules described herein have RNAi activity that modulates the expression of RNA encoded by the genes described above. In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate the expression of a gene, wherein one strand of the double-stranded siRNA molecule is complementary to the nucleotide sequence of the gene or RNA encoded by the gene or portion thereof. wherein the second strand of the double-stranded siRNA molecule comprises a nucleotide sequence that is substantially similar to the nucleotide sequence of the gene or RNA encoded by the gene, or portion thereof. In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate the expression of a gene, each strand of the siRNA molecule comprising about 15 to 25, 18 to 24, or 19 to about 23 nucleotides, each A strand contains at least about 14, 17, or 19 nucleotides that are complementary to nucleotides of the other strand. In some cases, the polynucleic acid molecules described herein are double-stranded siRNA molecules that downregulate the expression of a gene, each strand of the siRNA molecule comprising about 19 to about 23 nucleotides, each strand complementary to a nucleotide on the other strand. Contains at least about 19 nucleotides. In some cases, the gene is KRAS , EGFR , AR, HPRT1 , CNNTB1 ( β -catenin), or β -catenin It is a related gene.

In some embodiments, polynucleic acid molecules described herein are constructed using chemical synthesis and/or enzymatic ligation reactions using methods known in the art. For example, polynucleic acid molecules can be chemically modified using naturally occurring nucleotides or using various modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the dimer formed between the polynucleic acid molecule and the target nucleic acid. It is synthesized with Exemplary methods include US Patent Nos. 5,142,047; No. 5,185,444; No. 5,889,136; No. 6,008,400; and Nos. 6,111,086; PCT Publication No. WO2009099942; or those described in European Publication No. 1579015. Additional exemplary methods are described in Griffey et al., "2'-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides," J. Med . Chem . 39 (26):5100-5109 (1997)); Obika, et al. "Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering". Tetrahedron Letters 38 (50): 8735 (1997); Koizumi, M. “ENA oligonucleotides as therapeutics”. Current opinion in molecular therapeutics 8 (2): 144-149 (2006); and Abramova et al., "Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical possibilities," Indian Journal of Chemistry 48B:1721-1726 (2009). Alternatively, the polynucleic acid molecule can be produced using an expression vector in which the polynucleic acid molecule has been subcloned in an antisense orientation (i.e., the RNA transcribed from the inserted polynucleic acid molecule will be in an antisense orientation relative to the target polynucleic acid molecule of interest). It is produced with

bonding chemistry

In some embodiments, the polynucleic acid molecule is conjugated to a binding moiety. In some cases, the binding moiety may be an amino acid, peptide, polypeptide, protein, antibody, antigen, toxin, hormone, lipid, nucleotide, nucleoside, sugar, carbohydrate, polymer, such as polyethylene glycol and polypropylene glycol, as well as any of these classes. Includes analogs or derivatives of both substances. Additional examples of binding moieties also include steroids, such as cholesterol, phospholipids, di- and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or containing substitutions), enzyme substrates, biotin, digoxigenin, and polysaccharides. In some cases, the binding moiety is an antibody or binding fragment thereof. In some cases, the polynucleic acid molecule is further conjugated to a polymer, and optionally to an endosomally degradable moiety.

In some embodiments, a polynucleic acid molecule is conjugated to a binding moiety by a chemical ligation process. In some cases, a polynucleic acid molecule is conjugated to a binding moiety by native ligation. In some cases, splicing can be performed as described in Dawson, et al. “Synthesis of proteins by native chemical ligation,” Science 1994, 266 , 776-779; Dawson, et al. “Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives,” J. Am. Chem . Soc . 1997, 119, 4325-4329; Hackeng, et al. “Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology.,” Proc . Natl . Acad . Sci . USA 1999, 96, 10068-10073; or Wu, et al. “Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol,” Angew . Chem . Int . Ed. 2006, 45 , 4116-4125]. In some cases, conjugation is as described in U.S. Pat. No. 8,936,910. In some embodiments, a polynucleic acid molecule is conjugated to a binding moiety either site-specifically or non-specifically through ligation chemistry.

In some cases, polynucleic acid molecules are conjugated to binding moieties by site-directed methods using “traceless” coupling technology (Philochem). In some cases, “traceless” coupling techniques use an N-terminal 1,2-aminothiol group on the binding moiety that is subsequently conjugated to a polylactic acid molecule containing an aldehyde group (Casi et al., “Site-specific traceless “coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery,” JACS 134 (13): 5887-5892 (2012).

In some cases, polynucleic acid molecules are conjugated to a binding moiety by site-directed methods using non-natural amino acids incorporated into the binding moiety. In some cases, the unnatural amino acid includes p -acetylphenylalanine (pAcPhe). In some cases, the keto group of pAcPhe selectively couples to an alkoxy-amine derivatized conjugation moiety to form an oxime bond (Axup et al., "Synthesis of site-specific antibody-drug conjugates using unnatural amino acids," PNAS 109 (40): 16101-16106 (2012)).

In some cases, polynucleic acid molecules are conjugated to binding moieties by site-directed methods using enzyme-catalyzed processes. In some cases, site-directed methods utilize SMARTag™ technology (Redwood). In some cases, SMARTag™ technology involves the generation of formylglycine (FGly) residues from cysteine by formylglycine synthase (FGE) and hydrazino-pictet-Spengler (HIPS) via an oxidation process in the presence of an aldehyde tag. It involves subsequent conjugation of FGly to an alkylhydrazine-functionalized polynucleic acid molecule via ligation (Wu et al ., "Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag," PNAS 106 (9): 3000-3005 (2009); Agarwal, et al ., "A Pictet-Spengler ligation for protein chemical modification," PNAS 110 (1): 46-51 (2013))

In some cases, the enzyme-catalyzed process involves microbial transglutaminase (mTG). In some cases, polynucleic acid molecules are conjugated to binding moieties using a microbial transglutaminase catalyzed process. In some cases, mTG catalyzes the formation of a covalent bond between the amide side chain of glutamine within the recognition sequence and the primary amine of the functionalized polynucleic acid molecule. In some cases, mTG is Streptomyces mobarensis ( Streptomyces mobarensis (see Strop et al., "Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates," Chemistry and Biology 20 (2) 161-167 (2013))

In some cases, polynucleic acid molecules are conjugated to binding moieties by methods described in PCT Publication No. WO2014/140317 using sequence-specific transpeptidases.

In some cases, polynucleic acid molecules are conjugated to binding moieties by methods described in US Patent Publication Nos. 2015/0105539 and 2015/0105540.

Combination moiety

In some embodiments, binding moiety A is a polypeptide. In some cases, the polypeptide is an antibody or fragment thereof. In some cases, the fragment is a combined fragment. In some cases, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a murine antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab ₂ , F( ab)' ₃ fragment, single chain variable fragment (scFv), bis-scFv, (scFv) ₂ , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein (dsFv), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or binding fragment thereof, or chemically modified derivative thereof.

In some cases, A is an antibody or binding fragment thereof. In some cases, A is a humanized antibody or binding fragment thereof, a murine antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, monovalent Fab', bivalent Fab ₂ , F(ab)' ₃ Fragments, single chain variable fragment (scFv), bis-scFv, (scFv) ₂ , diabodies, minibodies, nanobodies, triabodies, tetrabodies, disulfide stabilized Fv proteins (“dsFv”), single-domain antibodies (sdAb) ), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or binding fragment thereof, or chemically modified derivative thereof. In some cases, A is a humanized antibody or binding fragment thereof. In some cases, A is a murine antibody or binding fragment thereof. In some cases, A is a chimeric antibody or binding fragment thereof. In some cases, A is a monoclonal antibody or binding fragment thereof. In some cases, A is monovalent Fab'. In some cases, A is divalent Fab ₂ . In some cases, A is a single chain variable fragment (scFv).

In some embodiments, binding moiety A is a bispecific antibody or binding fragment thereof. In some cases, bispecific antibodies are tri-functional antibodies or bispecific mini-antibodies. In some cases, bispecific antibodies are tri-functional antibodies. In some cases, tri-functional antibodies are full-length monoclonal antibodies that contain binding sites for two different antigens. Exemplary tri-functional antibodies include catumaxomab (targeting EpCAM and CD3; Fresenius Biotech/Trion Pharma), ertumaxomab (targeting HER2/neu/CD3; Fresenius Biotech/Trion Pharma), lymphomun FBTA05 (targets CD20/CD3; Fresenius Biotech/Trion Pharma), RG7221 (RO5520985; targets angiopoietin 2/VEGF; Roche), RG7597 (targets Her1/Her3; Genentech/Roche), MM141 (IGF1R) /targets Her3; Merrimack), ABT122 (targets TNFα/IL17; Abbvie), ABT981 (targets IL1α/IL1β; Abbott), LY3164530 (targets Her1/cMET; Eli Lilly), and TRBS07 (Ektomab) ; targeting GD2/CD3; Trion Research Gmbh). Additional exemplary tri-functional antibodies include mAb ² from F-star Biotechnology. In some cases, A is a bispecific trifunctional antibody. In some embodiments, A is catumaxomab (targeting EpCAM and CD3; Fresenius Biotech/Trion Pharma), ertumaxomab (targeting HER2/neu/CD3; Fresenius Biotech/Trion Pharma), lymphomun. FBTA05 (targets CD20/CD3; Fresenius Biotech/Trion Pharma), RG7221 (RO5520985; targets angiopoietin 2/VEGF; Roche), RG7597 (targets Her1/Her3; Genentech/Roche), MM141 ( Targets IGF1R/Her3; Merrimack), ABT122 (targets TNFα/IL17; Abbvie), ABT981 (targets IL1α/IL1β; Abbott), LY3164530 (targets Her1/cMET; Eli Lilly), TRBS07 (Ektomab) ; targeting GD2/CD3; Trion Research Gmbh), and mAb ² from F-star Biotechnology.

In some cases, bispecific antibodies are bispecific mini-antibodies. In some cases, the bispecific mini-antibody is a bivalent Fab ₂ , F(ab)' ₃ fragment, bis-scFv, (scFv) ₂ , diabody, minibody, triabody, tetrabody, or bispecific T-cell Contains engaging antibodies (BiTE). In some embodiments, the bispecific T-cell engaging antibody is a fusion protein containing two single chain variable fragments (scFvs) where the two scFvs target epitopes of two different antigens. Exemplary bispecific mini-antibodies include, but are not limited to, DART (dual-affinity retargeting platform; MacroGenics), blinatumomab (MT103 or AMG103; targeting CD19/CD3; Micromet), MT111 (CEA/ Targets CD3; Micromet/Amegen), MT112 (BAY2010112; targets PSMA/CD3; Micromet/Bayer), MT110 (AMG 110; targets EPCAM/CD3; Amgen/Micromet), MGD006 (targets CD123/CD3) MacroGenics), MGD007 (targets GPA33/CD3; MacroGenics), BI1034020 (targets two different epitopes on β-amyloid; Ablynx), ALX0761 (targets IL17A/IL17F; Ablynx), TF2 (CEA/ targeting hepten; Immunomedics), IL-17/IL-34 biAb (BMS), AFM13 (targeting CD30/CD16; Affimed), AFM11 (targeting CD19/CD3; Affimed), and domain antibodies (Domantis/ dAb) from GSK.

In some embodiments, binding moiety A is a bispecific mini-antibody. In some cases, A is bispecific Fab ₂ . In some cases, A is a bispecific F(ab)' ₃ fragment. In some cases, A is a bispecific bis-scFv. In some cases, A is bispecific (scFv) ₂ . In some embodiments, A is a bispecific diabody. In some embodiments, A is a bispecific minibody. In some embodiments, A is a bispecific triabody. In another embodiment, A is a bispecific tetrabody. In another embodiment, A is a bispecific T-cell engaging antibody (BiTE). In a further embodiment, A is DART (dual-affinity retargeting platform; MacroGenics), blinatumomab (MT103 or AMG103; targeting CD19/CD3; Micromet), MT111 (targeting CEA/CD3; Micromet) /Amegen), MT112 (BAY2010112; targets PSMA/CD3; Micromet/Bayer), MT110 (AMG 110; targets EPCAM/CD3; Amgen/Micromet), MGD006 (targets CD123/CD3; MacroGenics), MGD007 (targets GPA33/CD3; MacroGenics), BI1034020 (targets two different epitopes on β-amyloid; Ablynx), ALX0761 (targets IL17A/IL17F; Ablynx), TF2 (targets CEA/hepten; Immunomedics ), IL-17/IL-34 biAb (BMS), AFM13 (targeting CD30/CD16; Affimed), AFM11 (targeting CD19/CD3; Affimed), and domain antibody (dAb from Domantis/GSK) Selected bispecific mini-antibodies.

In some embodiments, binding moiety A is a trispecific antibody. In some cases, trispecific antibodies include F(ab)' ₃ fragments or triabodies. In some cases, A is a trispecific F(ab)' ₃ fragment. In some cases, A is a triabody. In some embodiments, A is an antibody described in Dimas, et al ., “Development of a trispecific antibody designed to simultaneously and efficiently target three different antigens on tumor cells,” Mol . It is a trispecific antibody as described in Pharmaceutics , 12 (9): 3490-3501 (2015).

In some embodiments, binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein. In some cases, cell surface proteins are antigens expressed by cancerous cells. Exemplary cancer antigens include, but are not limited to, alpha fetoprotein, ASLG659, B7-H3, BAFF-R, Brevican, CA125 (MUC16), CA15-3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (phosphatase anchor protein) SH2 domain containing 1a), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRH1), GEDA, HLA-DOB (beta subunit of MHC class II molecule (Ia antigen)), human Chorionic gonadotropin, ICOS, IL-2 receptor, IL20Rα, immunoglobulin superfamily receptor translocation-related 2 (IRTA2), L6, Lewis Y, Lewis X, MAGE-1, MAGE-2 , MAGE-3, MAGE 4, MART1, mesothelin, MDP, MPF (SMR, MSLN), MCP1 (CCL2), macrophage inhibitory factor (MIF), MPG, MSG783, mucin, MUC1-KLH , Napi3b (SLC34A2), nectin-4, Neu oncogene product, NCA, placental alkaline phosphatase, prostate-specific membrane antigen (PMSA), prostatic acid phosphatase, PSCA hlg, p97, purinergic receptor P2X ligand-gated. Ion channel 5 (P2X5), LY64 (lymphocyte antigen 64 (RP105)), gp100, P21, 6 transmembrane epithelial antigen of the prostate (STEAP1), STEAP2, Sema 5b, tumor-associated glycoprotein 72 (TAG-72), TrpM4 ( BR22450, FLJ20041, TRPM4, TRPM4B, transient receptor potential cation channel, subfamily M, member 4).

In some cases, cell surface proteins include cluster of differentiation (CD) cell surface markers. Exemplary CD cell surface markers include, but are not limited to, CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g. CD79a, CD79b), CD90, CD95 (Fas) , CD103, CD104, CD125 (IL5RA), CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), CD326 (EpCAM), Includes etc.

In some cases, binding moiety A is an antibody or binding fragment thereof that recognizes a cancer antigen. In some cases, binding moiety A is alpha fetoprotein, ASLG659, B7-H3, BAFF-R, Brevican, CA125 (MUC16), CA15-3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (phosphatase anchor protein 1a) (containing SH2 domain), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRH1), GEDA, HLA-DOB (beta subunit of MHC class II molecule (Ia antigen)), human villous Gonadotropin, ICOS, IL-2 receptor, IL20Rα, immunoglobulin superfamily receptor translocation-related 2 (IRTA2), L6, Lewis Y, Lewis X, MAGE-1, MAGE-2, MAGE -3, MAGE 4, MART1, mesothelin, MCP1 (CCL2), MDP, macrophage inhibitory factor (MIF), MPF (SMR, MSLN), MPG, MSG783, mucin, MUC1-KLH, Napi3b (SLC34A2), nectin-4, Neu oncogene product, NCA, placental alkaline phosphatase, prostate-specific membrane antigen (PMSA), prostatic acid phosphatase, PSCA hlg, p97, purinergic receptor P2X ligand-gated ion channel. 5 (P2X5), LY64 (lymphocyte antigen 64 (RP105), gp100, P21, 6 transmembrane epithelial antigen of the prostate (STEAP1), STEAP2, Sema 5b, tumor associated glycoprotein 72 (TAG-72), TrpM4 (BR22450, FLJ20041) , TRPM4, TRPM4B, transient receptor potential cation channel, subfamily M, member 4) or a combination thereof is an antibody or binding fragment thereof.

In some cases, binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some cases, binding moiety A can bind to CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15s, CD16, CDw17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g. CD79a, CD79b), CD90, CD95 (Fas), CD103, CD104 , CD125 (IL5RA), CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), CD326 (EpCAM), or a combination thereof. It is an antibody that recognizes or a binding fragment thereof.

In some embodiments, the antibody or binding fragment thereof is zalutumumab (HuMax-EFGr, Genmab), abagovomab (Menarini), abituzumab (Merck), adecatumumab (MT201), alacizumab pegol, alemtuzumab (Campath®, MabCampath, or Campath-1H; Leukosite), AlloMune (BioTransplant), amatuximab (Morphotek, Inc.), anti-VEGF (Genetech), anatumomab mapenatox, Apoli Zumab (hu1D10), asscreen bacumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech/Roche), B43.13 (OvaRex, AltaRex Corpo ration), basiliximab (Simulect®, Novartis), Belly Mumab (Benlysta®, GlaxoSmithKline), bevacizumab (Avastin®, Genentech), blinatumomab (Blincyto, AMG103; Amgen), BEC2 (ImGlone Systems Inc.), carrumab (Janssen Biotech), catumaxomab (Removab) , Trion Pharma), CEAcide (Immunomedics), cetuximab (Erbitux®, ImClone), sitatuzumab Bogatox (VB6-845), saxutumumab (IMC-A12, ImGlone Systems Inc.), conatumumab (AMG) 655, Amgen), dacetuzumab (SGN-40, huS2C6; Seattle Genetics, Inc.), daratumumab (Darzalex®, Janssen Biotech), detumomab, drogitumab (Genentech), durvalumab (MedImmune) , dusigitumab (MedImmune), edrecolomab (MAb17-1A, Panorex, Glaxo Wellcome), elotuzumab (Empliciti™, Bristol-Myers Squibb), emibetuzumab (Eli Lilly), enabatuzumab (Facet Biotech Corp) .), enfortumab vedotin (Seattle Genetics, Inc.), enoblituzumab (MGA271, MacroGenics, Inc.), encituxumab (Neogenix Oncology, Inc.), epratuzumab (Lymphocide, Immunomedics, Inc. .), ertumaxomab (Rexomun®, Trion Pharma), etaracizumab (Abegrin, MedImmune), parretuzumab (MORAb-003, Morphotek, Inc), FBTA05 (Lymphomun, Trion Pharma), piclatuzumab (AVEO Pharmaceuticals) ), pigitumumab (CP-751871, Pfizer), flavotumab (ImGlone Systems), fresolimumab (GC1008, Aanofi-Aventis), putuximab, glaximab, ganitumab (Amgen), zirentuximab (Rencarex®, Wilex AG), IMAB362 (Claudiximab, Ganymed Pharmaceuticals AG), imalumab (Baxalta), IMC-1C11 (ImGlone Systems), IMC-C225 (ImGlone Systems Inc.), imgatuzumab (Genentech/Roche) , intetumumab (Centocor, Inc.), ipilimumab (Yervoy®, Bristol-Myers Squibb), iratumumab (Medarex, Inc.), isatuximab (SAR650984, Sanofi-Aventis), labetuzumab ( CEA-CIDE, Immunomedics), lexatumumab (ETR2-ST01, Cambridge Antibody Technology), lintuzumab (SGN-33, Seattle Genetics), rucatumumab (Novartis), lumiliximab, mapatumumab (HGS-ETR1) , Human Genome Sciences), matuzumab (EMD 72000, Merck), milatuzumab (hLL1, Immunomedics, Inc.), mitumomab (BEC-2, ImGlone Systems), narnatumab (ImGlone Systems), necitumumab ( Portrazza™, Eli Lilly), nesbacumab (Regeneron Pharmaceuticals), nimotuzumab (h-R3, BIOMAb EGFR, TheraCIM, Theraloc, or CIMAher; Biotech Pharmaceutical Co.), nivolumab (Opdivo®, Bristol-Myers Squibb), obinutuzumab (Gazyva or Gazyvaro; Hoffmann-La Roche), ocaratuzumab (AME-133v, LY2469298; Mentrik Biotech, LLC), Ofatumumab (Arzerra®, Genmab), onartuzumab (Genentech), ontuxizumab (Morphotek, Inc.), oregobomab (OvaRex®, AltaRex Corp.), otrertuzumab (Emergent BioSolutions) , panitumumab (ABX-EGF, Amgen), pancomab (Glycotope GMBH), parsatuzumab (Genentech), partritumab, pembrolizumab (Keytruda®, Merck), pemtumomab (Theragyn, Antisoma), per Tuzumab (Perjeta, Genentech), pidilizumab (CT-011, Medivation), polatuzumab vedotin (Genentech/Roche), pritumumab, lacotumomab (Vaxira®, Recombio), ramucirumab (Cyramza) ®, ImGlone Systems Inc.), rituximab (Rituxan®, Genentech), lovatumumab (Schering-Plough), seribantumab (Sanofi/Merrimack Pharmaceuticals, Inc.), cibrotuzumab, siltuximab (Sylvant) ™, Janssen Biotech), Smart MI95 (Protein Design Labs, Inc.), Smart ID10 (Protein Design Labs, Inc.), Tavalumab (LY2127399, Eli Lilly), Taplicumomab Poptox, Fenatumomab, Teff Rotumumab (Roche), tetulomab, TGN1412 (CD28-SuperMAB or TAB08), tigatuzumab (CD-1008, Daiichi Sankyo), tositumumab, turastuzumab (Herceptin®), tremelimumab ( CP-672,206; Pfizer), tucotuzumab selmorukin (EMD Pharmaceuticals), ublituximab, urelumab (BMS-663513, Bristol-Myers Squibb), voloxiximab (M200, Biogen Idec), Zatuxi Includes Mop, etc.

In some embodiments, binding moiety A is zalutumumab (HuMax-EFGr, Genmab), abagovomab (Menarini), abituzumab (Merck), adecatumumab (MT201), alacizumab pegol, alemtuzumab ( Campath®, MabCampath, or Campath-1H; Leukosite), AlloMune (BioTransplant), amatuximab (Morphotek, Inc.), anti-VEGF (genetech), anatumomab mapenatox, Apoli Zumab (hu1D10), asscreen bacumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech/Roche), B43.13 (OvaRex, AltaRex Corpo ration), basiliximab (Simulect®, Novartis), Belly Mumab (Benlysta®, GlaxoSmithKline), bevacizumab (Avastin®, Genentech), blinatumomab (Blincyto, AMG103; Amgen), BEC2 (ImGlone Systems Inc.), carrumab (Janssen Biotech), catumaxomab (Removab) , Trion Pharma), CEAcide (Immunomedics), cetuximab (Erbitux®, ImClone), sitatuzumab Bogatox (VB6-845), saxutumumab (IMC-A12, ImGlone Systems Inc.), conatumumab (AMG) 655, Amgen), dacetuzumab (SGN-40, huS2C6; Seattle Genetics, Inc.), daratumumab (Darzalex®, Janssen Biotech), detumomab, drogitumab (Genentech), durvalumab (MedImmune) , dusigitumab (MedImmune), edrecolomab (MAb17-1A, Panorex, Glaxo Wellcome), elotuzumab (Empliciti™, Bristol-Myers Squibb), emibetuzumab (Eli Lilly), enabatuzumab (Facet Biotech Corp) .), enfortumab vedotin (Seattle Genetics, Inc.), enoblituzumab (MGA271, MacroGenics, Inc.), encituxumab (Neogenix Oncology, Inc.), epratuzumab (Lymphocide, Immunomedics, Inc. .), ertumaxomab (Rexomun®, Trion Pharma), etaracizumab (Abegrin, MedImmune), parretuzumab (MORAb-003, Morphotek, Inc), FBTA05 (Lymphomun, Trion Pharma), piclatuzumab (AVEO Pharmaceuticals) ), pigitumumab (CP-751871, Pfizer), flavotumab (ImGlone Systems), fresolimumab (GC1008, Aanofi-Aventis), putuximab, glaximab, ganitumab (Amgen), zirentuximab (Rencarex®, Wilex AG), IMAB362 (Claudiximab, Ganymed Pharmaceuticals AG), imalumab (Baxalta), IMC-1C11 (ImGlone Systems), IMC-C225 (ImGlone Systems Inc.), imgatuzumab (Genentech/Roche) , intetumumab (Centocor, Inc.), ipilimumab (Yervoy®, Bristol-Myers Squibb), iratumumab (Medarex, Inc.), isatuximab (SAR650984, Sanofi-Aventis), labetuzumab ( CEA-CIDE, Immunomedics), lexatumumab (ETR2-ST01, Cambridge Antibody Technology), lintuzumab (SGN-33, Seattle Genetics), rucatumumab (Novartis), lumiliximab, mapatumumab (HGS-ETR1) , Human Genome Sciences), matuzumab (EMD 72000, Merck), milatuzumab (hLL1, Immunomedics, Inc.), mitumomab (BEC-2, ImGlone Systems), narnatumab (ImGlone Systems), necitumumab ( Portrazza™, Eli Lilly), nesbacumab (Regeneron Pharmaceuticals), nimotuzumab (h-R3, BIOMAb EGFR, TheraCIM, Theraloc, or CIMAher; Biotech Pharmaceutical Co.), nivolumab (Opdivo®, Bristol-Myers Squibb), obinutuzumab (Gazyva or Gazyvaro; Hoffmann-La Roche), ocaratuzumab (AME-133v, LY2469298; Mentrik Biotech, LLC), Ofatumumab (Arzerra®, Genmab), onartuzumab (Genentech), ontuxizumab (Morphotek, Inc.), oregobomab (OvaRex®, AltaRex Corp.), otrertuzumab (Emergent BioSolutions) , panitumumab (ABX-EGF, Amgen), pancomab (Glycotope GMBH), parsatuzumab (Genentech), partritumab, pembrolizumab (Keytruda®, Merck), pemtumomab (Theragyn, Antisoma), per Tuzumab (Perjeta, Genentech), pidilizumab (CT-011, Medivation), polatuzumab vedotin (Genentech/Roche), pritumumab, lacotumomab (Vaxira®, Recombio), ramucirumab (Cyramza) ®, ImGlone Systems Inc.), rituximab (Rituxan®, Genentech), lovatumumab (Schering-Plough), seribantumab (Sanofi/Merrimack Pharmaceuticals, Inc.), cibrotuzumab, siltuximab (Sylvant) ™, Janssen Biotech), Smart MI95 (Protein Design Labs, Inc.), Smart ID10 (Protein Design Labs, Inc.), Tavalumab (LY2127399, Eli Lilly), Taplicumomab Poptox, Fenatumomab, Teff Rotumumab (Roche), tetulomab, TGN1412 (CD28-SuperMAB or TAB08), tigatuzumab (CD-1008, Daiichi Sankyo), tositumumab, turastuzumab (Herceptin®), tremelimumab ( CP-672,206; Pfizer), tucotuzumab selmorukin (EMD Pharmaceuticals), ublituximab, urelumab (BMS-663513, Bristol-Myers Squibb), bolociximab (M200, Biogen Idec), or Zatuk Includes simab. In some embodiments, binding moiety A is zalutumumab (HuMax-EFGr, by Genmab).

In some embodiments, the binding moiety A is conjugated to a polynucleic acid molecule (B) according to formula (I), and a polymer (C), and optionally to an endosomal degradable moiety (D) according to formula (II) described herein. do. In some cases, the polynucleic acid molecule is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, Includes sequences having 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some embodiments, the polynucleic acid molecule has at least 50%, 55%, 60%, 65 %, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some cases, the polynucleic acid molecule comprises a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117. In some cases, polymer C includes polyalkylene oxide (eg, polyethylene glycol). In some embodiments, endosomal degradable moiety D comprises INF7 or melittin, or their respective derivatives.

In some embodiments, binding moiety A is conjugated to a polynucleic acid molecule (B), and a polymer (C), and optionally an endosomal degradable moiety (D), as shown in Figure 1. In some cases, binding moiety A is an antibody or binding fragment thereof.

In some embodiments, binding moiety A is non-specifically conjugated to a polynucleic acid molecule (B). In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) via a lysine residue or cysteine residue in a non-site specific manner. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) via a lysine residue in a non-site specific manner. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) via a cysteine residue in a non-site specific manner. In some cases, binding moiety A is an antibody or binding fragment thereof.

In some embodiments, binding moiety A is conjugated to a polynucleic acid molecule (B) in a site-specific manner. In some cases, binding moiety A may be linked in a site-specific manner, via a lysine residue, via a cysteine residue, at the 5'-end, at the 3'-end, via a non-natural amino acid, or via an enzyme-modified or enzymatically modified binding agent. -Conjugated to a polynucleic acid molecule (B) via a catalyzing moiety. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) via a lysine residue in a site-specific manner. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) via a cysteine residue in a site-specific manner. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) at the 5'-end in a site-specific manner. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) at the 3'-end in a site-specific manner. In some cases, binding moiety A is conjugated to a polynucleic acid molecule (B) via a non-natural amino acid in a site-specific manner. In some cases, binding moiety A is conjugated to the polynucleic acid molecule (B) via an enzyme-modified or enzyme-catalyzed moiety via a site-specific manner. In some cases, binding moiety A is an antibody or binding fragment thereof.

In some embodiments, one or more regions of binding moiety A (e.g., an antibody or binding fragment thereof) is conjugated to a polynucleic acid molecule (B). In some cases, one or more regions of binding moiety A include the N-terminus, C-terminus, constant region, hinge region, or Fc region of binding moiety A. In some cases, the polynucleic acid molecule (B) is conjugated to the N-terminus of binding moiety A (e.g., the N-terminus of an antibody or binding fragment thereof). In some cases, the polynucleic acid molecule (B) is conjugated to the C-terminus of binding moiety A (e.g., the N-terminus of an antibody or binding fragment thereof). In some cases, the polynucleic acid molecule (B) is conjugated to the constant region of binding moiety A (e.g., the constant region of an antibody or binding fragment thereof). In some cases, the polynucleic acid molecule (B) is conjugated to the hinge region of binding moiety A (e.g., the constant region of an antibody or binding fragment thereof). In some cases, the polynucleic acid molecule (B) is conjugated to the Fc region of binding moiety A (e.g., the constant region of an antibody or binding fragment thereof).

In some embodiments, one or more polynucleic acid molecules (B) are conjugated to binding moiety A. In some cases, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more polynucleic acid molecules are conjugated to one binding moiety A. . In some cases, about one polynucleic acid molecule is conjugated to one binding moiety A. In some cases, about two polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about three polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about four polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about five polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about six polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 7 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about eight polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 9 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 10 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 11 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 12 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 13 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 14 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 15 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, about 16 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, more than one polynucleic acid molecule is the same. In other cases, one or more polynucleic acid molecules are different. In some cases, binding moiety A is an antibody or binding fragment thereof.

In some embodiments, the number of polynucleic acid molecules (B) conjugated to a binding moiety A (e.g., an antibody or binding fragment thereof) forms a ratio. In some cases, the ratio is referred to as the DAR (drug-to-antibody) ratio, where the drug referred to herein is a polynucleic acid molecule (B). In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16. That's it. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11 or greater. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12 or greater.

In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A (e.g., an antibody or binding fragment thereof) is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, It is 12, 13, 14, 15, or 16. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 13. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 14. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 15. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 16.

In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. am. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 2. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 4. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 6. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 8. In some cases, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 12.

In some embodiments, the antibody or binding fragment thereof is prepared using conventional techniques known in the art, for example, using amino acid deletions, insertions, substitutions, additions, alone or in combination, and/or recombinantly and/or It is further modified by any other modification known in the art (such as post-translational and chemical modifications such as glycosylation and phosphorylation). In some cases, the modifications further include modifications to modulate interaction with the Fc receptor. In some cases, one or more modifications include, for example, those described in International Publication No. WO97/34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Methods for introducing such modifications into the nucleic acid sequence underlying the amino acid sequence of an antibody or binding fragment thereof are well known to those skilled in the art.

In some cases, the antibody binding fragment further comprises a derivative thereof and comprises a polypeptide sequence containing at least one CDR.

In some cases, the term "single chain" as used herein means that the first and second domains of a bispecific single chain construct are preferably co-linear amino acid sequences encoded by a single nucleic acid molecule. In the form of, it means that it is covalently bonded.

In some cases, bispecific single chain antibody constructs relate to structures comprising binding domains from two antibodies. In this embodiment, the bispecific single chain antibody construct is a tandem bi-scFv or diabody. In some cases, the scFv contains VH and VL domains linked to a linker peptide. In some cases, the linker is of sufficient length and sequence to ensure that each of the first and second domains can maintain their different binding specificities independently of one another.

In some embodiments, binding or interaction, as used herein, defines the binding/interaction of at least two antigen-interaction-sites with each other. In some cases, an antigen-interaction-site defines a motif in a polypeptide that exhibits a specific interaction with a specific antigen or specific antigenic group. In some cases, binding/interaction is also understood to define specific recognition. In this case, specific recognition refers to the antibody or binding fragment thereof being able to specifically interact and/or bind to at least two amino acids of each target molecule. For example, specific recognition relates to the specificity of an antibody molecule, or its ability to distinguish between specific regions of a target molecule. In further cases, specific interaction of the antigen-interaction-site with its specific antigen results in the initiation of a signal, for example due to induction of a conformational change in the antigen, oligomerization of the antigen, etc. In a further embodiment, the binding is illustrated by the specificity of the “key-lock-principle”. Thus, in some cases, specific motifs in the amino acid sequence of the antigen-interaction site and the amino acid sequence of the antigen bind to each other as a result of their primary, secondary or tertiary structures, as well as secondary modifications of said structures. do. In this case, the specific interaction of the antigen-interaction-site with its specific antigen also results in simple binding of the site to the antigen.

In some cases, specific interaction further refers to reduced cross-reactivity or reduced off-target effects of the antibody or binding fragment thereof. For example, an antibody or binding fragment thereof that binds to the polypeptide/protein of interest but does not bind or essentially does not bind any other polypeptide is considered specific for the polypeptide/protein of interest. Examples of specific interactions of antigen-interaction-sites with specific antigens include the specificity of a ligand for its receptor, e.g., the interaction of an antigenic determinant (epitope) with the antigen binding site of an antibody.

additional combination moiety

In some embodiments, the binding moiety is a plasma protein. In some cases, plasma proteins include albumin. In some cases, binding moiety A is albumin. In some cases, albumin is conjugated to a polynucleic acid molecule by one or more of the conjugation chemistries described herein. In some cases, albumin is conjugated to polynucleic acid molecules by natural ligation chemistry. In some cases, albumin is conjugated to a polynucleic acid molecule by lysine conjugation.

In some cases, the binding moiety is a steroid. Exemplary steroids include cholesterol, phospholipids, di- and triacylglycerols, fatty acids, saturated, unsaturated, or hydrocarbons containing substitutions, or combinations thereof. In some cases, the steroid is cholesterol. In some cases, the binding moiety is cholesterol. In some cases, cholesterol is conjugated to a polynucleic acid molecule by one or more of the conjugation chemistries described herein. In some cases, cholesterol is conjugated to polynucleic acid molecules by natural ligation chemistry. In some cases, cholesterol is conjugated to a polynucleic acid molecule by lysine conjugation.

In some cases, the binding moiety is, but is not limited to, a polymer comprising a polynucleic acid molecule aptamer that binds to a specific surface marker on a cell. In this case, the binding moiety is a polynucleic acid that does not hybridize to the target gene or mRNA, but is instead capable of selectively binding to a cell surface marker, similar to an antibody that binds its specific epitope of the cell surface marker.

In some cases, the binding moiety is a peptide. In some cases, the peptide comprises about 1 to about 3 kDa. In some cases, the peptide comprises about 1.2 to about 2.8 kDa, about 1.5 to about 2.5 kDa, or about 1.5 to about 2 kDa. In some cases, the peptide is a bicyclic peptide. In some cases, the bicyclic peptide is a limited bicyclic peptide. In some cases, the binding moiety is a bicyclic peptide (e.g., Bicycle from Bicycle Therapeutics).

In additional cases, the binding moiety is a small molecule. In some cases, the small molecule is an antibody-mobilizing small molecule. In some cases, the antibody-mobilizing small molecule comprises a target-binding end and an antibody-binding end, the target-binding end being capable of recognizing and interacting with a cell surface receptor. For example, in some cases, a target-binding end comprising a glutamate urea compound can interact with PSMA, thereby enhancing antibody interaction with cells expressing PSMA (e.g., cancerous cells). In some cases, the binding moiety is described in Zhang et al., “A remote arene-binding site on prostate specific membrane antigen revealed by antibody-recruiting small molecules,” J Am Chem Soc. 132(36): 12711-12716 (2010); or McEnaney, et al., “Antibody-recruiting molecules: an emerging paradigm for engaging immune function in treating human disease,” ACS Chem Biol. 7(7): 1139-1151 (2012)].

Production of antibodies or binding fragments thereof

In some embodiments, polypeptides (e.g., antibodies and binding fragments thereof) described herein can be synthesized using any method known in the art to be useful for the synthesis of polypeptides (e.g., antibodies), particularly by chemical synthesis or Produced by recombinant expression, preferably produced by recombinant expression techniques.

In some cases, the antibody or binding fragment thereof is recombinantly expressed, and the nucleic acid encoding the antibody or binding fragment thereof is a chemically synthesized oligonucleotide (e.g., Kutmeier et al., 1994 , BioTechniques 17:242), which involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligation of the oligonucleotides, and amplification of the ligated oligonucleotides by PCR. .

Alternatively, the nucleic acid molecule encoding the antibody may be obtained from a suitable source (e.g., by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using oligonucleotide probes specific for a particular genetic sequence). Optionally generated from an antibody cDNA library, or a cDNA library) generated from any tissue or cell that expresses an immunoglobulin.

In some cases, antibodies or combinations thereof are produced by immunizing animals, such as rabbits, to generate polyclonal antibodies or, more preferably, as described, e.g., in Kohler and Milstein (1975 , Nature 256:495-497) or by Kozbor. By producing monoclonal antibodies, as described in et al. (1983 , Immunology Today 4:72) or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, Inc., pp. 77-96) Generated randomly. Alternatively, clones encoding at least the Fab portion of the antibody can optionally be obtained by screening Fab expression libraries for clones of Fab fragments that bind to specific antigens (e.g., Huse et al., 1989 , Science 246:1275-1281). as described) or by screening antibody libraries (see, e.g., Clackson et al., 1991 , Nature 352:624; Hane et al., 1997 Proc . Natl. Acad . Sci . USA 94:4937).

In some embodiments, a technique developed for the production of “chimeric antibodies” by splicing genes from mouse antibody molecules of appropriate antigen specificity together with genes from human antibody molecules of appropriate biological activity (Morrison et al., 1984 , Proc . Natl . Acad. Sci . 81:851-855; Neuberger et al., 1984 , Nature 312:604-608; Takeda et al., 1985 , Nature 314:452-454) are used. Chimeric antibodies are molecules in which different portions are derived from different animal species, such as those having variable regions derived from murine monoclonal antibodies and human immunoglobulin constant regions, such as humanized antibodies.

In some embodiments, the techniques described for the production of single chain antibodies (U.S. Pat. No. 4,694,778; Bird, 1988 , Science 242:423-42; Huston et al., 1988 , Proc . Natl . Acad. Sci . USA 85: 5879-5883; and Ward et al., 1989 , Nature 334:544-54) are adapted to produce single chain antibodies. Single chain antibodies are formed by joining heavy and light chain fragments of the Fv region through amino acid cross-linking, creating a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli are also optionally used (Skerra et al., 1988 , Science 242:1038-1041).

In some embodiments, the expression vector comprising the nucleotide sequence of the antibody or the nucleotide sequence of the antibody is transferred to a host cell by conventional techniques (e.g., electroporation, liposome transfection, and calcium phosphate precipitation) and then transferred to the transfected cell. is cultured using conventional techniques to produce antibodies. In certain embodiments, expression of the antibody is controlled by a constitutive, inducible, or tissue-specific promoter.

In some embodiments, various host expression vector systems are used to express the antibodies or binding fragments thereof described herein. These host expression systems not only represent the vehicle in which the coding sequence of the antibody is produced and then purified, but also represent cells that express the antibody or binding fragment thereof in situ when transformed or transfected with the appropriate nucleotide coding sequence. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the coding sequence for an antibody or binding fragment thereof; Yeast (eg, Saccharomyces pichia) transformed with a recombinant yeast expression vector containing the coding sequence for an antibody or binding fragment thereof; insect cell systems (e.g., baculovirus) infected with recombinant viral expression vectors containing the coding sequence for an antibody or binding fragment thereof; Plants infected with a recombinant viral expression vector (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)) or transformed with a recombinant plasmid expression vector (e.g., Ti plasmid) containing the coding sequence for an antibody or binding fragment thereof. cellular system; or a mammalian cell system with a recombinant expression construct containing a promoter derived from the genome of a mammalian cell (e.g., metallothionein promoter) or a mammalian virus (e.g., adenovirus late promoter; vaccinia virus 7.5K promoter) (e.g. COS, CHO, BH, 293, 293T, 3T3 cells).

For long-term, high-yield production of recombinant proteins, stable expression is desirable. In some cases, cell lines that stably express antibodies are randomly engineered. Rather than using expression vectors containing the viral origin of replication, host cells are transfected with DNA controlled by appropriate expression control elements (e.g., promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.), and selectable markers. converted. After introduction of foreign DNA, the engineered cells are grown in concentrated medium for 1-2 days and then transferred to selection medium. A selection marker within the recombinant plasmid confers resistance to selection and allows cells to stably incorporate the plasmid into their chromosomes, grow to form foci, and eventually be cloned and expanded into cell lines. This method can be advantageously used to engineer cell lines expressing antibodies or binding fragments thereof.

In some cases, but not limited to, herpes simplex virus thymidine kinase (Wigler et al., 1977 , Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192 , Proc . Natl . Acad . Sci USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980 , Cell 22:817) genes, which are tk-, hgprt-, or aprt-, respectively. Used in cells. Additionally, antimetabolite resistance is used as a basis for screening for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980 , Proc . Natl . Acad. Sci . USA 77:357; O'Hare et al., 1981 , Proc . Natl . Acad . Sci . USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981 , Proc. Natl . Acad . Sci . USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 ( Clinical Pharmacy 12:488-505; Wu and Wu, 1991 , Biotherapy 3:87-95; Tolstoshev, 1993 , Ann. Rev. Pharmacol . Toxicol . 32:573-596; Mulligan, 1993 , Science 260:926-932; and Morgan and Anderson, 1993 , Ann. Rev. Biochem . 62:191-217; May, 1993 , TIB TECH 11(5):155-215) and hygro, which confers resistance to hygromycin (Santerre et al., 1984 , Gene 30:147). Methods generally known in the field of recombinant DNA technology that can be used are described in Ausubel et al. (eds., 1993 , Current Protocols in Molecular Biology , John Wiley & Sons, NY; Kriegler, 1990 , Gene Transfer and Expression, A Laboratory Manual , Stockton Press, NY; and in Chapters 12 and 13, Dracopoli et al. (eds ), 1994 , Current Protocols in Human Genetics , John Wiley & Sons, NY.; Colberre-Garapin et al., 1981 , J. Mol . Biol. 150:1).

In some cases, the expression level of the antibody is increased by vector amplification (for review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning , Vol. 3. (Academic Press, New York, 1987). If the marker in the vector system expressing the antibody is amplifiable, increasing the level of inhibitor present in the culture of the host cells will increase the copy number of the marker gene. Since the amplified region is related to the nucleotide sequence of the antibody, production of the antibody will also be increased (Crouse et al., 1983 , Mol . Cell Biol. 3:257).

In some cases, for example, by chromatography (e.g., ion exchange, affinity, especially for specific antigens after protein A, and size column chromatography), centrifugation, differential solubility, or purification of the protein. Any method known in the art for purification of antibodies by any other standard technique is used.

polymer bonding moiety

In some embodiments, polymer moiety C is further conjugated with a polynucleic acid molecule described herein, a binding moiety described herein, or a combination thereof. In some cases, polymer moiety C is conjugated to a polynucleic acid molecule. In some cases, polymer moiety C is conjugated to a binding moiety. In other cases, polymer moiety C is conjugated to a polynucleic acid molecule-binding moiety molecule. In additional cases, polymer moiety C is conjugated, as shown in Figure 1 and as discussed under the Therapeutic Molecular Platforms section.

In some cases, polymer moiety C is a natural or synthetic polymer consisting of long chains of monomers, branched or unbranched in two or three dimensions, and/or crosslinked networks of monomers. In some cases, polymer moiety C includes polysaccharides, lignin, rubber, or polyalkylene oxides (e.g., polyethylene glycol). In some cases, at least one polymer moiety C may include, but is not limited to, alpha-, omega-dihydroxypolyethylene glycol, biodegradable lactone-based polymers such as polyacrylic acid, polylactic acid (PLA), poly(glycolic acid). (PGA), polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate, polyimide, polyethylene terephthalate (PET, PETG), polyethylene terephthalate (PETE), polytetramethylene glycol (PTG), or polyurethane. as well as mixtures thereof. As used herein, mixture refers to the use of different polymers within the same compound as well as in conjunction with block copolymers. In some cases, a block copolymer is a polymer in which at least one portion of the polymer is formed from monomers of another polymer. In some cases, polymer moiety C includes polyalkylene oxide. In some cases, polymer moiety C includes PEG. In some cases, polymer moiety C includes polyethylene imide (PEI) or hydroxy ethyl starch (HES).

In some cases, C is a PEG moiety. In some cases, the PEG moiety is conjugated at the 5' end of the polynucleic acid molecule, while the binding moiety is conjugated at the 3' end of the polynucleic acid molecule. In some cases, the PEG moiety is conjugated at the 3' end of the polynucleic acid molecule, while the binding moiety is conjugated at the 5' end of the polynucleic acid molecule. In some cases, the PEG moiety is conjugated to an internal site of the polynucleic acid molecule. In some cases, PEG moieties, binding moieties, or combinations thereof are conjugated to internal sites of the polynucleic acid molecule. In some cases, the bonding is a direct bonding. In some cases, conjugation is through native ligation.

In some embodiments, polyalkylene oxides (e.g., PEG) are polydisperse or monodisperse compounds. In some cases, polydisperse materials comprise a dispersion distribution of materials of different molecular weights, characterized by weight average size and dispersibility. In some cases, monodisperse PEG contains molecules of one size. In some embodiments, C is a poly- or monodisperse polyalkylene oxide (e.g., PEG), and the indicated molecular weight represents the average molecular weight of polyalkylene oxide, e.g., PEG, molecules.

In some embodiments, the molecular weight of the polyalkylene oxide (e.g., PEG) is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 450 0, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da.

In some embodiments, C is a polyalkylene oxide (e.g., PEG) and is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600. , 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4 500, 4600, 4750, 5000, 5500 , 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some embodiments, C is PEG and is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 550 0, 6000, 6500, 7000, 7500, It has a molecular weight of 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some cases, the molecular weight of C is about 200 Da. In some cases, the molecular weight of C is about 300 Da. In some cases, the molecular weight of C is about 400 Da. In some cases, the molecular weight of C is about 500 Da. In some cases, the molecular weight of C is about 600 Da. In some cases, the molecular weight of C is about 700 Da. In some cases, the molecular weight of C is about 800 Da. In some cases, the molecular weight of C is about 900 Da. In some cases, the molecular weight of C is about 1000 Da. In some cases, the molecular weight of C is about 1100 Da. In some cases, the molecular weight of C is about 1200 Da. In some cases, the molecular weight of C is about 1300 Da. In some cases, the molecular weight of C is about 1400 Da. In some cases, the molecular weight of C is about 1450 Da. In some cases, the molecular weight of C is about 1500 Da. In some cases, the molecular weight of C is about 1600 Da. In some cases, the molecular weight of C is about 1700 Da. In some cases, the molecular weight of C is about 1800 Da. In some cases, the molecular weight of C is about 1900 Da. In some cases, the molecular weight of C is about 2000 Da. In some cases, the molecular weight of C is about 2100 Da. In some cases, the molecular weight of C is about 2200 Da. In some cases, the molecular weight of C is about 2300 Da. In some cases, the molecular weight of C is about 2400 Da. In some cases, the molecular weight of C is about 2500 Da. In some cases, the molecular weight of C is about 2600 Da. In some cases, the molecular weight of C is about 2700 Da. In some cases, the molecular weight of C is about 2800 Da. In some cases, the molecular weight of C is about 2900 Da. In some cases, the molecular weight of C is about 3000 Da. In some cases, the molecular weight of C is about 3250 Da. In some cases, the molecular weight of C is about 3350 Da. In some cases, the molecular weight of C is about 3500 Da. In some cases, the molecular weight of C is about 3750 Da. In some cases, the molecular weight of C is about 4000 Da. In some cases, the molecular weight of C is about 4250 Da. In some cases, the molecular weight of C is about 4500 Da. In some cases, the molecular weight of C is about 4600 Da. In some cases, the molecular weight of C is about 4750 Da. In some cases, the molecular weight of C is about 5000 Da. In some cases, the molecular weight of C is about 5500 Da. In some cases, the molecular weight of C is about 6000 Da. In some cases, the molecular weight of C is about 6500 Da. In some cases, the molecular weight of C is about 7000 Da. In some cases, the molecular weight of C is about 7500 Da. In some cases, the molecular weight of C is about 8000 Da. In some cases, the molecular weight of C is about 10,000 Da. In some cases, the molecular weight of C is about 12,000 Da. In some cases, the molecular weight of C is about 20,000 Da. In some cases, the molecular weight of C is about 35,000 Da. In some cases, the molecular weight of C is about 40,000 Da. In some cases, the molecular weight of C is about 50,000 Da. In some cases, the molecular weight of C is about 60,000 Da. In some cases, the molecular weight of C is about 100,000 Da.

In some embodiments, the polyalkylene oxide (e.g., PEG) is an individual PEG, and the individual PEG is a polymeric PEG comprising more than one repeating ethylene oxide unit. In some cases, individual PEGs (dPEG) contain 2 to 60, 2 to 50, or 2 to 48 repeating ethylene oxide units. In some cases, dPEG has approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, Contains 28, 30, 35, 40, 42, 48, 50 or more repeating ethylene oxide units. In some cases, dPEG contains about two or more repeating ethylene oxide units. In some cases, dPEG contains about 3 or more repeating ethylene oxide units. In some cases, dPEG contains about 4 or more repeating ethylene oxide units. In some cases, dPEG contains about 5 or more repeating ethylene oxide units. In some cases, dPEG contains about 6 or more repeating ethylene oxide units. In some cases, dPEG contains about 7 or more repeating ethylene oxide units. In some cases, dPEG contains about 8 or more repeating ethylene oxide units. In some cases, dPEG contains about 9 or more repeating ethylene oxide units. In some cases, dPEG contains about 10 or more repeating ethylene oxide units. In some cases, dPEG contains about 11 or more repeating ethylene oxide units. In some cases, dPEG contains about 12 or more repeating ethylene oxide units. In some cases, dPEG contains about 13 or more repeating ethylene oxide units. In some cases, dPEG contains about 14 or more repeating ethylene oxide units. In some cases, dPEG contains about 15 or more repeating ethylene oxide units. In some cases, dPEG contains about 16 or more repeating ethylene oxide units. In some cases, dPEG contains about 17 or more repeating ethylene oxide units. In some cases, dPEG contains about 18 or more repeating ethylene oxide units. In some cases, dPEG contains about 19 or more repeating ethylene oxide units. In some cases, dPEG contains about 20 or more repeating ethylene oxide units. In some cases, dPEG contains about 22 or more repeating ethylene oxide units. In some cases, dPEG contains about 24 or more repeating ethylene oxide units. In some cases, dPEG contains about 26 or more repeating ethylene oxide units. In some cases, dPEG contains about 28 or more repeating ethylene oxide units. In some cases, dPEG contains about 30 or more repeating ethylene oxide units. In some cases, dPEG contains about 35 or more repeating ethylene oxide units. In some cases, dPEG contains about 40 or more repeating ethylene oxide units. In some cases, dPEG contains about 42 or more repeating ethylene oxide units. In some cases, dPEG contains about 48 or more repeating ethylene oxide units. In some cases, dPEG contains about 50 or more repeating ethylene oxide units. In some cases, dPEG is synthesized as a single molecular weight compound from pure (e.g., about 95%, 98%, 99%, or 99.5%) starting materials in a stepwise manner. In some cases, dPEG has a specific molecular weight rather than an average molecular weight. In some cases, the dPEG described herein is dPEG from Quanta Biodesign, LMD.

In some embodiments, polymer moiety C comprises a cationic mucinic acid based polymer (cMAP). In some cases, the cMPA comprises one or more subunits of at least one repeat subunit, with the subunit structure represented by formula (III):

where m is independently at each occurrence 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, preferably 4-6 or 5; n is independently 1, 2, 3, 4, or 5 in each case. In some embodiments, m and n are about 10, for example.

In some cases, cMAP is further conjugated to a PEG moiety to create a cMAP-PEG copolymer, mPEG-cMAP-PEGm triblock polymer, or cMAP-PEG-cMAP triblock polymer. In some cases, the PEG moiety ranges from about 500 Da to about 50,000 Da. In some cases, the PEG moiety has a weight of about 500 Da to about 1000 Da, greater than 1000 Da to about 5000 Da, greater than 5000 Da to about 10,000 Da, greater than 10,000 Da to about 25,000 Da, greater than 25,000 Da to about 50,000 Da, or any of these ranges. Any combination of two or more.

In some cases, polymer moiety C is a cMAP-PEG copolymer, mPEG-cMAP-PEGm triblock polymer, or cMAP-PEG-cMAP triblock polymer. In some cases, polymer moiety C is a cMAP-PEG copolymer. In other cases, polymer moiety C is a mPEG-cMAP-PEGm triblock polymer. In a further case, polymer moiety C is a cMAP-PEG-cMAP triblock polymer.

In some embodiments, polymer moiety C is conjugated to a polynucleic acid molecule, a binding moiety, and optionally an endosomal degradable moiety as shown in Figure 1.

Endosomal degradability moiety

In some embodiments, the molecule A-X-B-Y-C of formula (I) further comprises an additional conjugation moiety. In some cases, the additional conjugation moiety is an endosomally degradable moiety. In some cases, the endosomal degradable moiety is a cellular compartment release component, such as any of the cellular compartments known in the art, such as endosomes, lysosomes, endoplasmic reticulum (ER), Golgi apparatus, microtubules, peroxisomes, or other cells having It is a compound that can be released from vesicular bodies. In some cases, the endosomally degradable moiety includes an endosomally degradable polypeptide, an endosomally degradable polymer, an endosomally degradable lipid, or an endosomally degradable small molecule. In some cases, the endosomally degradable moiety includes an endosomally degradable polypeptide. In other cases, the endosomally degradable moiety includes an endosomally degradable polymer.

Endosomal degradability polypeptide

In some embodiments, the molecule A-X-B-Y-C of formula (I) is further conjugated with an endosomally degradable polypeptide. In some cases, endosomally degradable polypeptides are pH-dependent membrane active peptides. In some cases, endosomally degradable polypeptides are amphipathic polypeptides. In additional cases, the endosomally degradable polypeptide is a peptidomimetic. In some cases, the endosomally degradable polypeptide includes INF, melittin, meucin, or their respective derivatives. In some cases, the endosomally degradable polypeptide includes INF or a derivative thereof. In other cases, the endosomally degradable polypeptide includes melittin or a derivative thereof. In additional cases, endosomally degradable polypeptides include meucin or derivatives thereof.

In some cases, INF7 is a 24 residue polypeptide whose sequence includes CGIFGEIEELIEEGLENLIDWGNA (SEQ ID NO: 2055), or GLFEAIEGFIENGWEGMIDGWYGC (SEQ ID NO: 2056). In some cases, INF7 or a derivative thereof comprises the sequence of GLFEAIEGFIENGWEGMIWDYGSGSCG (SEQ ID NO: 2057), GLFEAIEGFIENGWEGMIDG WYG-(PEG)6-NH2 (SEQ ID NO: 2058), or GLFEAIEGFIENGWEGMIWDYG-SGSC-K(GalNAc)2 (SEQ ID NO: 2059) .

In some cases, melittin is a 26 residue polypeptide whose sequence includes CLIGAILKVLATGLPTLISWIKNKRKQ (SEQ ID NO: 2060), or GIGAVLKVLTTGLPALISWIKRKRQQ (SEQ ID NO: 2061). In some cases, melittin comprises a polypeptide sequence as described in U.S. Pat. No. 8,501,930.

In some cases, meucin is an antimicrobial peptide (AMP) derived from the venom gland of the scorpion Mesobuthus eupheus. In some cases, meucin includes meucin-13, whose sequence includes IFGAIAGLLKNIF-NH ₂ (SEQ ID NO: 2062), and meucin-18, whose sequence includes FFGHLFKLATKIIPSLFQ (SEQ ID NO: 2063).

In some cases, the endosomally degradable polypeptide has its sequence at least 50%, 60%, 70%, 80%, 90%, 95%, relative to INF7 or a derivative thereof, melittin or a derivative thereof, or meucin or a derivative thereof. or a polypeptide with 99% sequence identity. In some cases, the endosomal degradable moiety includes INF7 or a derivative thereof, melittin or a derivative thereof, or meucin or a derivative thereof.

In some cases, the endosomal degradable moiety is INF7 or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes polypeptides having 97%, 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2055 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes polypeptides having 97%, 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2055. In some cases, the endosomal degradable moiety includes SEQ ID NOs: 2056-2059. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2055. In some cases, the endosomal degradable moiety consists of SEQ ID NOs: 2056-2059.

In some cases, the endosomal degradable moiety is melittin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes polypeptides having 97%, 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2060 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2061 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2060. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2061. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2060. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2061.

In some cases, the endosomal degradable moiety is meucin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, Includes polypeptides having 97%, 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2062 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2063 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2062. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2063. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2062. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2063.

In some cases, the endosomal degradable moiety comprises a sequence as exemplified in Table 62.

Table 62.

In some cases, the endosomal degradable moiety includes the Bak BH3 polypeptide, which induces apoptosis through antagonism of inhibitor targets such as Bcl-2 and/or Bcl-x _L. In some cases, the endosomal degradable moiety is described in Albarran, et al., "Efficient intracellular delivery of a pro-apoptotic peptide with a pH-responsive carrier," Reactive & Functional Polymers 71 :261-265 (2011). Contains Bak BH3 polypeptide.

In some cases, the endosomal degradable moiety comprises a polypeptide (e.g., a cell penetrating polypeptide) as described in PCT Publication No. WO2013/166155 or WO2015/069587.

Endosomally degradable polymer

In some embodiments, the molecule A-X-B-Y-C of formula (I) is further conjugated with an endosomally degradable polymer. As used herein, endosomally degradable polymers include linear, branched network, star, comb, or ladder type polymers. In some cases, the endosomally degradable polymer is a homopolymer or copolymer comprising two or more different types of monomers. In some cases, the endosomally degradable polymer is a polycationic polymer. In other cases, the endosomally degradable polymer is a polyanionic polymer.

In some cases, polycationic polymers include monomer units that are charge positive, charge neutral, or charge negative, and have a positive net charge. In other cases, polycationic polymers include non-polymeric molecules containing two or more positive charges. Exemplary cationic polymers include, but are not limited to, poly(L-lysine) (PLL), poly(L-arginine) (PLA), polyethyleneimine (PEI), poly[α-(4-aminobutyl)-L- glycolic acid] (PAGA), 2-(dimethylamino)ethyl methacrylate (DMAEMA), or N,N-Diethylaminoethyl methacrylate (DEAEMA).

In some cases, polyanionic polymers include monomer units that are charge positive, charge neutral, or charge negative, and have a negative net charge. In other cases, polyanionic polymers include non-polymeric molecules that contain two or more negative charges. Exemplary anionic polymers include p(alkylacrylates) (e.g., poly(propyl acrylic acid) (PPAA)) or poly(N-isopropylacrylamide) (NIPAM). Additional examples include L - phenylalanine - poly( L-lysine isophthalamide) polymer, PP75.

In some embodiments, the endosomally degradable polymer described herein is a pH-responsive endosomally degradable polymer. pH-responsive polymers include polymers that increase in size (swell) or collapse depending on the pH of the environment. Polyacrylic acid and chitosan are examples of pH-responsive polymers.

In some cases, the endosomally degradable moieties described herein are membrane disrupting polymers. In some cases, the membrane-disrupting polymer includes a cationic polymer, a neutral or hydrophobic polymer, or an anionic polymer. In some cases, the membrane-disrupting polymer is a hydrophilic polymer.

In some cases, the endosomally degradable moieties described herein are pH-responsive membrane-disrupting polymers. Exemplary pH-responsive membrane-disrupting polymers include p(alkylacrylic acid), poly(N-isopropylacrylamide) (NIPAM) copolymer, succinylated p(glycidol), and p(β-malic acid) polymers. do.

In some cases, p(alkylacrylic acid) includes poly(propylacrylic acid) (polyPAA), poly(methacrylic acid) (PMAA), poly(ethylacrylic acid) (PEAA), and poly(propyl acrylic acid) (PPAA). . In some cases, p(alkylacrylic acid) includes p(alkylacrylic acid) described in Jones, et al., Biochemistry Journal 372 :65-75 (2003).

In some embodiments, the pH-responsive membrane-disruptive polymer includes p(butyl acrylate-co-methacrylic acid) (Bulmus, et al ., Journal of Controlled Release 93 :105-120 (2003); and Yessine, et al ., Biochimica et Biophysica See Acta 1613 :28-38 (2003)

In some embodiments, the pH-responsive membrane-disrupting polymer comprises p(styrene-alt-maleic anhydride) (see Henry, et al ., Biomacromolecules 7 :2407-2414 (2006)).

In some embodiments, the pH-responsive membrane disrupting polymer is a pyridyldisulfide acrylate (PDSA) polymer, such as poly(MAA- co -PDSA), poly(EAA- co -PDSA), poly(PAA- co -PDSA), poly(MAA- co -BA- co -PDSA), poly(EAA- co -BA- co -PDSA), or poly(PAA- co -BA- co -PDSA) polymers (El-Sayed, et al. ., "Rational design of composition and activity correlations for pH-responsive and glutathione-reactive polymer therapeutics," Journal of Controlled Release 104 : 417-427 (2005); or Flanary et al ., "Antigen delivery with poly(propylacrylic acid) “Conjugation enhanced MHC-1 presentation and T-cell activation,” Bioconjugate Chem . 20 :241-248 (2009)).

In some embodiments, the pH-responsive membrane-disintegrating polymer includes a soluble polymer comprising the following base structure:

.

In some cases, the endosomally degradable moieties described herein are further conjugated to additional conjugates, such as polymers (e.g., PEG), or modified polymers (e.g., cholesterol modified polymers).

In some cases, additional conjugates include detergents (eg, Triton X-100). In some cases, the endosomal degradable moieties described herein include a polymer (e.g., poly(amidoamine)) conjugated with a detergent (e.g., Triton X-100). In some cases, the endosomal degradable moieties described herein include poly(amidoamine)-Triton X-100 conjugates (Duncan, et al ., “A polymer-Triton X-100 conjugate capable of pH-dependent red blood cell lysis: a model system illustrating the possibility of drug delivery within acidic intracellular compartments," Journal of Drug Targeting 2 : 341-347 (1994)).

Endosomally degradable lipids

In some embodiments, the endosomal degradable moiety is a lipid (e.g., a fusogenic lipid). In some embodiments, the molecule A-X-B-Y-C of formula (I) is further conjugated with an endosomally degradable lipid (e.g., a fusible lipid). Exemplary fusible lipids include 1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC), (6Z,9Z,28Z,31Z) -Heptatriaconta-6,9,28,31-tetraen-19-ol (Di-Lin), N-methyl(2,2-di((9Z,12Z)-octadeca-9,12-diene Nyl)-1,3-dioxolan-4-yl)methanamine (DLin-k-DMA) and N-methyl-2-(2,2-di((9Z,12Z)-octadeca-9,12- Dienyl)-1,3-dioxolan-4-yl)ethanamine (XTC).

In some cases, the endosomal degradable moiety is a lipid described in PCT Publication No. WO09/126,933 (e.g., a fusible lipid).

Endosomal degradability small molecule

In some embodiments, the endosomal degradable moiety is a small molecule. In some embodiments, the molecule A-X-B-Y-C of formula (I) is further conjugated with an endosomally degradable small molecule. Exemplary small molecules suitable as endosomal degradable moieties include, but are not limited to, quinine, chloroquinine, hydroxychloroquinine, amodiaquine (carnoquine), amorphyroquine, primaquine, mefloquine, nivaquine, halofantrine, quinone imine, or combinations thereof. In some cases, quinoline endosomally degradable moieties include, but are not limited to, 7-chloro-4-(4-diethylamino-1-methylbutyl-amino)quinoline (chloroquinine); 7-Chloro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutyl-amino)quinoline (hydroxychloroquinine); 7-fluoro-4-(4-diethylamino-1-methylbutyl-amino)quinoline; 4-(4-diethylamino-1-methylbutylamino)quinoline; 7-hydroxy-4-(4-diethyl-amino-1-methylbutylamino)quinoline; 7-chloro-4-(4-diethylamino-1-butylamino)quinoline (desmethylchloroquinine); 7-fluoro-4-(4-diethylamino-1-butylamino)quinoline); 4-(4-diethyl-amino-1-butylamino)quinoline; 7-hydroxy-4-(4-diethylamino-1-butylamino)quinoline; 7-chloro-4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 7-fluoro-4-(1-carboxy-4-diethyl-amino-1-butylamino)quinoline; 4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 7-hydroxy-4-(1-carboxy-4-diethylamino-1-butylamino)quinoline; 7-chloro-4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 7-fluoro-4-(1-carboxy-4-diethyl-amino-1-methylbutylamino)quinoline; 4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 7-hydroxy-4-(1-carboxy-4-diethylamino-1-methylbutylamino)quinoline; 7-fluoro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 4-(4-ethyl-(2-hydroxy-ethyl)-amino-1-methylbutylamino-)quinoline; 7-hydroxy-4-(4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; Hydroxychloroquinine phosphate; 7-chloro-4-(4-ethyl-(2-hydroxyethyl-1)-amino-1-butylamino)quinoline (desmethylhydroxychloroquinine); 7-fluoro-4-(4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 4-(4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-hydroxy-4-(4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-chloro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-fluoro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 4-(1-Carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-hydroxy-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline; 7-chloro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 7-fluoro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 7-hydroxy-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; 8-[(4-aminopentyl)amino-6-methoxydihydrochloride quinoline; 1-acetyl-1,2,3,4-tetrahydroquinoline; 8-[(4-aminopentyl)amino]-6-methoxyquinoline dihydrochloride; 1-butyryl-1,2,3,4-tetrahydroquinoline; 3-Chloro-4-(4-hydroxy-alpha,alpha'-bis(2-methyl-1-pyrrolidinyl)-2,5-xylidinoquinoline, 4-[(4-diethyl-amino)- 1-methylbutyl-amino]-6-methoxyquinoline; 3-fluoro-4-(4-hydroxy-alpha,alpha'-bis(2-methyl-1-pyrrolidinyl)-2,5-xyly Dinoquinoline, 4-[(4-diethylamino)-1-methylbutyl-amino]-6-methoxyquinoline; 4-(4-hydroxy-alpha,alpha'-bis(2-methyl-1-p) Lolidinyl)-2,5-xylidinoquinoline; 4-[(4-diethylamino)-1-methylbutyl-amino]-6-methoxyquinoline; 3,4-dihydro-1-(2H)- Quinoline carboxyaldehyde; 1,1'-pentamethylene diquinolanium diiodide; 8-quinolinol sulfate and amino, aldehyde, carboxylic, hydroxyl, halogen, keto, sulfhydryl and vinyl derivatives or analogs thereof In some cases, the endosomal degradable moiety is a small molecule described in Naisbitt et al (1997, J Pharmacol Exp Therapy 280:884-893) and U.S. Pat. No. 5,736,557.

Formula (I) Molecule - Endosome Degradable moiety zygote

In some embodiments, one or more endosomal degradable moieties are conjugated to a molecule comprising at least one binding moiety, at least one polynucleotide, at least one polymer, or any combination thereof. In some cases, the endosomal degradable moiety is conjugated according to formula (II):

(AXBYC _c )-LD

<Formula II>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

c is an integer from 0 to 1;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties; D is attached to any position on A, B, or C.

In some embodiments, A and C are not attached to the same end of B.

In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides. Includes. In some cases, the one or more 2' modified nucleotides include locked nucleic acids (LNA) or ethylene nucleic acids (ENA). In some cases, the one or more modified internucleotide linkages include a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some cases, the second polynucleotide includes one or more modifications. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently binding or non-polymeric linker groups. In some cases, A is an antibody or binding fragment thereof. In some cases, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, Includes minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some cases, C is polyethylene glycol.

In some cases, the endosomal degradable moiety includes a polypeptide, polymer, lipid, or small molecule. In some cases, the endosomally degradable moiety is an endosomally degradable polypeptide. In some cases, the endosomally degradable moiety is an endosomally degradable polymer. In other cases, the endosomally degradable moiety is an endosomally degradable lipid. In additional cases, the endosomally degradable moiety is an endosomally degradable small molecule.

In some cases, the endosomal degradable moiety is INF7 or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2055 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2055. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2055.

In some cases, the endosomal degradable moiety is melittin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2060 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2060. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2060.

In some cases, the endosomal degradable moiety is a sequence as illustrated in Table 62.

In additional cases, the endosomally degradable moiety is an endosomally degradable polymer, such as a pH-responsive endosomally degradable polymer, a membrane-disruptive polymer, a polycationic polymer, a polyanionic polymer, a pH-responsive membrane-disruptible polymer, or a combination thereof. In additional cases, the endosomal degradable moiety may be p(alkylacrylic acid) polymer, p(butyl acrylate-co-methacrylic acid) polymer, p(styrene-alt-maleic anhydride) polymer, pyridyldisulfide acrylate (PDSA) ) polymers, polymer-PEG conjugates, polymer-detergent conjugates, or combinations thereof.

In some embodiments, the endosomal degradable moiety conjugate conforms to Formula (IIa):

DLAXBYC _c

<Formula IIa>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

c is an integer of 1;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties.

In some embodiments, A and C are not attached to the same end of B.

In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides. Includes. In some cases, the one or more 2' modified nucleotides include locked nucleic acids (LNA) or ethylene nucleic acids (ENA). In some cases, the one or more modified internucleotide linkages include a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some cases, the second polynucleotide includes one or more modifications. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently binding or non-polymeric linker groups. In some cases, A is an antibody or binding fragment thereof. In some cases, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, Includes minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some cases, C is polyethylene glycol.

In some cases, the endosomal degradable moiety includes a polypeptide, polymer, lipid, or small molecule. In some cases, the endosomally degradable moiety is an endosomally degradable polypeptide. In some cases, the endosomally degradable moiety is an endosomally degradable polymer. In other cases, the endosomally degradable moiety is an endosomally degradable lipid. In additional cases, the endosomally degradable moiety is an endosomally degradable small molecule.

In some cases, the endosomal degradable moiety is INF7 or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2055 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2055. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2055.

In some cases, the endosomal degradable moiety is melittin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2060 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2060. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2060.

In some cases, the endosomal degradable moiety is a sequence as illustrated in Table 62.

In additional cases, the endosomally degradable moiety is an endosomally degradable polymer, such as a pH-responsive endosomally degradable polymer, a membrane-disruptive polymer, a polycationic polymer, a polyanionic polymer, a pH-responsive membrane-disruptible polymer, or a combination thereof. In additional cases, the endosomal degradable moiety may be p(alkylacrylic acid) polymer, p(butyl acrylate-co-methacrylic acid) polymer, p(styrene-alt-maleic anhydride) polymer, pyridyldisulfide acrylate (PDSA) ) polymers, polymer-PEG conjugates, polymer-detergent conjugates, or combinations thereof.

In some cases, the endosomal degradable moiety conjugate follows formula (IIb):

A-X-B-L-D

<Formula IIb>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

X is a bond or first linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties.

In some embodiments, A and C are not attached to the same end of B.

In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides. Includes. In some cases, the one or more 2' modified nucleotides include locked nucleic acids (LNA) or ethylene nucleic acids (ENA). In some cases, the one or more modified internucleotide linkages include a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some cases, the second polynucleotide includes one or more modifications. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X and L are independently binding or non-polymeric linker groups. In some cases, A is an antibody or binding fragment thereof. In some cases, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, Includes minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some cases, C is polyethylene glycol.

In some cases, the endosomal degradable moiety includes a polypeptide, polymer, lipid, or small molecule. In some cases, the endosomally degradable moiety is an endosomally degradable polypeptide. In some cases, the endosomally degradable moiety is an endosomally degradable polymer. In other cases, the endosomally degradable moiety is an endosomally degradable lipid. In additional cases, the endosomally degradable moiety is an endosomally degradable small molecule.

In some cases, the endosomal degradable moiety is INF7 or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2055 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2055. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2055.

In some cases, the endosomal degradable moiety is melittin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2060 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2060. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2060.

In some cases, the endosomal degradable moiety is a sequence as illustrated in Table 62.

In additional cases, the endosomally degradable moiety is an endosomally degradable polymer, such as a pH-responsive endosomally degradable polymer, a membrane-disruptive polymer, a polycationic polymer, a polyanionic polymer, a pH-responsive membrane-disruptible polymer, or a combination thereof. In additional cases, the endosomal degradable moiety may be p(alkylacrylic acid) polymer, p(butyl acrylate-co-methacrylic acid) polymer, p(styrene-alt-maleic anhydride) polymer, pyridyldisulfide acrylate (PDSA) ) polymers, polymer-PEG conjugates, polymer-detergent conjugates, or combinations thereof.

In some cases, the endosomal degradable moiety conjugate follows formula (IIc):

AXBYC _c -LD

<Formula IIc>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

c is an integer of 1;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties.

In some embodiments, A and C are not attached to the same end of B.

In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides. Includes. In some cases, the one or more 2' modified nucleotides include locked nucleic acids (LNA) or ethylene nucleic acids (ENA). In some cases, the one or more modified internucleotide linkages include a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some cases, the second polynucleotide includes one or more modifications. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently binding or non-polymeric linker groups. In some cases, A is an antibody or binding fragment thereof. In some cases, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, Includes minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some cases, C is polyethylene glycol.

In some cases, the endosomal degradable moiety includes a polypeptide, polymer, lipid, or small molecule. In some cases, the endosomally degradable moiety is an endosomally degradable polypeptide. In some cases, the endosomally degradable moiety is an endosomally degradable polymer. In other cases, the endosomally degradable moiety is an endosomally degradable lipid. In additional cases, the endosomally degradable moiety is an endosomally degradable small molecule.

In some cases, the endosomal degradable moiety is INF7 or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2055 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2055. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2055.

In some cases, the endosomal degradable moiety is melittin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2060 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2060. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2060.

In some cases, the endosomal degradable moiety is a sequence as illustrated in Table 62.

In additional cases, the endosomally degradable moiety is an endosomally degradable polymer, such as a pH-responsive endosomally degradable polymer, a membrane-disruptive polymer, a polycationic polymer, a polyanionic polymer, a pH-responsive membrane-disruptible polymer, or a combination thereof. In additional cases, the endosomal degradable moiety may be p(alkylacrylic acid) polymer, p(butyl acrylate-co-methacrylic acid) polymer, p(styrene-alt-maleic anhydride) polymer, pyridyldisulfide acrylate (PDSA) ) polymers, polymer-PEG conjugates, polymer-detergent conjugates, or combinations thereof.

In some cases, the endosomal degradable moiety conjugate follows formula (IId):

ALDXBYC _c

<Formula IId>

In the above equation,

A is the binding moiety;

B is a polynucleotide;

C is polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomal degradable moiety;

c is an integer of 1;

The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties.

In some embodiments, A and C are not attached to the same end of B.

In some embodiments, one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- Dimethylaminopropyl (2'-O-DMAP), T-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O-N-methylacetamido (2'-O-NMA) modified nucleotides. Includes. In some cases, the one or more 2' modified nucleotides include locked nucleic acids (LNA) or ethylene nucleic acids (ENA). In some cases, the one or more modified internucleotide linkages include a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. In some cases, the second polynucleotide includes one or more modifications. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently binding or non-polymeric linker groups. In some cases, A is an antibody or binding fragment thereof. In some cases, the antibody or binding fragment thereof is a humanized antibody or binding fragment thereof, a chimeric antibody or binding fragment thereof, a monoclonal antibody or binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, Includes minibodies, nanobodies, single-domain antibodies (sdAb), or camelid antibodies or binding fragments thereof. In some cases, C is polyethylene glycol.

In some cases, the endosomal degradable moiety includes a polypeptide, polymer, lipid, or small molecule. In some cases, the endosomally degradable moiety is an endosomally degradable polypeptide. In some cases, the endosomally degradable moiety is an endosomally degradable polymer. In other cases, the endosomally degradable moiety is an endosomally degradable lipid. In additional cases, the endosomally degradable moiety is an endosomally degradable small molecule.

In some cases, the endosomal degradable moiety is INF7 or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2055 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2055. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2055.

In some cases, the endosomal degradable moiety is melittin or a derivative thereof. In some cases, the endosomal degradable moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% for SEQ ID NO: 2060 , includes polypeptides with 98%, 99%, or 100% sequence identity. In some cases, the endosomal degradable moiety includes SEQ ID NO: 2060. In some cases, the endosomal degradable moiety consists of SEQ ID NO: 2060.

In some cases, the endosomal degradable moiety is a sequence as illustrated in Table 62.

In additional cases, the endosomally degradable moiety is an endosomally degradable polymer, such as a pH-responsive endosomally degradable polymer, a membrane-disruptive polymer, a polycationic polymer, a polyanionic polymer, a pH-responsive membrane-disruptible polymer, or a combination thereof. In additional cases, the endosomal degradable moiety may be p(alkylacrylic acid) polymer, p(butyl acrylate-co-methacrylic acid) polymer, p(styrene-alt-maleic anhydride) polymer, pyridyldisulfide acrylate (PDSA) ) polymers, polymer-PEG conjugates, polymer-detergent conjugates, or combinations thereof.

linker

In some embodiments, the linkers described herein are cleavable linkers or non-cleavable linkers. In some cases, the linker is a cleavable linker. In some cases, the linker is an acid cleavable linker. In some cases, the linker is a non-cleavable linker. In some cases, the linker includes a C ₁ -C ₆ alkyl group (eg, a C ₅ , C ₄ , C ₃ , C ₂ , or C ₁ alkyl group). In some cases, linkers include homobifunctional cross linkers, heterobifunctional cross linkers, etc. In some cases, the linker is a traceless linker (or zero-length linker). In some cases, the linker is a non-polymeric linker. In some cases, the linker is a non-peptide linker or a linker that does not contain amino acid residues.

In some cases, the linker includes a homobifunctional linker. Exemplary homobifunctional linkers include, but are not limited to, Lomant's reagent dithiobis(succinimidylpropionate) DSP, 3'3'-dithiobis(sulfosuccinimidyl propionate (DTSSP)) , Disuccinimidyl Suberate (DSS), Bis(Sulfosuccinimidyl) Suberate (BS), Disuccinimidyl Tartrate (DST), Disulfosuccinimidyl Tartrate (Sulfo DST), Ethylene Glycobis (Succinimidylsuccinate) (EGS), Disuccinimidyl Glutarate (DSG), N,N'-Disuccinimidyl Carbonate (DSC), Dimethyl Adipimidate (DMA), Dimethyl Pimelimidate ( DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate (DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamido) Butane (DPDPB), bismaleimidohexane (BMH), aryl halide containing compounds (DFDNB) such as 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6 -Dinitrobenzene, 4,4'-difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl]disulfide (BASED), formaldehyde , glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p -diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide). .

In some embodiments, the linker comprises a heterobifunctional linker. Exemplary heterobifunctional linkers include, but are not limited to, amine-reactive and sulfhydryl cross-linkers such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N- Succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (sulfo-LC-sPDP) , Succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (sMPT), Sulfosuccinimidyl-6-[α-methyl-α-(2-pyridyldithio) Toluamido]hexanoate (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N -maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimide Mid ester (sulfo-MBs), N-succinimidyl (4-iodoacetyl) aminobenzoate (sIAB), sulfosuccinimidyl (4-iodoacetyl) aminobenzoate (sulfo-sIAB), succinimide Diyl-4-(p-maleimidophenyl)butyrate (sMPB), Sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(γ-maleimidobutyryloxy)succine Imide esters (GMBs), N-(γ-maleimidobutyryloxy)sulfosuccinimide esters (sulfo-GMBs), succinimidyl 6-((iodoacetyl)amino)hexanoate (sIAX), succinimide Imidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-car Boxylate (sIAC), succinimidyl 6-((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyl iodoacetate ( NPIA), carbonyl-reactive and sulfhydryl-reactive cross-linkers such as 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-1 -carboxyl-hydrazide-8(M ₂ C ₂ H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH), amine-reactive and photoreactive cross-linkers such as N-hyde Roxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-Hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA), Sulfosuccinimidyl-(4-azidosal) Lycylamido)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(ρ-azidosalicylamido)ethyl-1,3'-dithiopropionate (sAsD), N-Hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-Hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N-Succinimidyl-6-(4 '-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'- Dithiopropionate (sAND), N-succinimidyl-4(4-azidophenyl)1,3'-dithiopropionate (sADP), N-sulfosuccinimidyl (4-azidophenyl) )-1,3'-dithiopropionate (sulfo-sADP), sulfosuccinimidyl 4-(ρ-azidophenyl)butyrate (sulfo-sAPB), sulfosuccinimidyl 2-(7-azim do-4-methylcoumarin-3-acetamide)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methylcoumarin-3-acetate (sulfo-sAMCA ), ρ-nitrophenyl diazopyruvate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP), sulfhydryl-reactive and photoreactive. Cross-linkers, such as 1-(ρ-azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-[4-(ρ-azidosalicylamido)butyl]-3'-(2'-pyridyldithio)propionamide (APDP), benzophenone-4-iodoacetamide, benzophenone-4-maleimide carbonyl-reactive and photoreactive cross-linkers such as ρ-azidobenzoyl Hydrazide (ABH), carboxylate-reactive and photoreactive cross-linkers such as 4-(ρ-azidosalicylamido)butylamine (AsBA), and arginine-reactive and photoreactive cross-linkers such as ρ -Contains azidophenyl glyoxal (APG).

In some cases, the linker includes a reactive functional group. In some cases, the reactive functional group includes a nucleophilic group that is reactive with an electrophilic group present in the binding moiety. Exemplary electrophilic groups include carbonyl groups such as aldehydes, ketones, carboxylic acids, esters, amides, enones, acyl halides or acid anhydrides. In some embodiments, the reactive functional group is an aldehyde. Exemplary nucleophilic groups include hydrazide, oxime, amino, hydrazine, thiosemicarbazone, hydrazine carboxylate, and arylhydrazide.

In some embodiments, the linker includes a maleimide group. In some cases, maleimide groups are also referred to as maleimide spacers. In some cases, the maleimide group further includes caproic acid, forming maleimidocaproyl (mc). In some cases, the linker includes maleimidocaproyl (mc). In some cases, the linker is maleimidocaproyl (mc). In other cases, the maleimide group is a maleimidomethyl group, such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N- Contains maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC).

In some embodiments, the maleimide group is a self-stabilizing maleimide. In some cases, self-stabilizing maleimides provide intramolecular catalysis of thiosuccinimide ring hydrolysis by introducing a basic amino group adjacent to the maleimide using diaminopropionic acid (DPR), thereby forming a retro-Michael. Michael) removes the maleimide from undergoing an elimination reaction. In some cases, self-stabilizing maleimides are described in Lyon, et al., “Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates,” Nat. Biotechnol . 32 (10):1059-1062 (2014)]. In some cases, the linker includes a self-stabilizing maleimide. In some cases, the linker is a self-stabilizing maleimide.

In some embodiments, the linker includes a peptide moiety. In some cases, the peptide moiety contains at least 2, 3, 4, 5, 6, 7, 8, or more amino acid residues. In some cases, the peptide moiety is a cleavable peptide moiety (eg, enzymatically or chemically). In some cases, the peptide moiety is a non-cleavable peptide moiety. In some cases, the peptide moiety is Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 2111), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala -Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 2112), or Gly-Phe-Leu -Gly (SEQ ID NO: 2113). In some cases, the linker is a peptide moiety, such as Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 2111), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe- Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 2112), or Gly- Includes Phe-Leu-Gly (SEQ ID NO: 2113). In some cases, the linker includes Val-Cit. In some cases, the linker is Val-Cit.

In some embodiments, the linker includes a benzoic acid group, or a derivative thereof. In some cases, the benzoic acid group or its derivative includes paraaminobenzoic acid (PABA). In some cases, the benzoic acid group or its derivative includes gamma-aminobutyric acid (GABA).

In some embodiments, the linker includes one or more of a maleimide group, a peptide moiety, and/or a benzoic acid group in any combination. In some embodiments, the linker includes a combination of maleimide groups, peptide moieties, and/or benzoic acid groups. In some cases, the maleimide group is maleimidocaproyl (mc). In some cases, the peptide group is val-cit. In some cases, the benzoic acid group is PABA. In some cases, the linker includes an mc-val-cit group. In some cases, the linker includes a val-cit-PABA group. In additional cases, the linker includes the mc-val-cit-PABA group.

In some embodiments, the linker is a self-immolative or self-removing linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-elimination linker (eg, a cyclized self-elimination linker). In some cases, the linker includes a linker described in US Pat. No. 9,089,614 or PCT Publication No. WO2015038426.

In some embodiments, the linker is a dendritic type linker. In some cases, resin type linkers include branched, multifunctional linker moieties. In some cases, resin type linkers are used to increase the molar ratio of polynucleotide B to binding moiety A. In some cases, the resin type linker includes PAMAM dendrimers.

In some embodiments, the linker is a traceless linker or a linker that leaves no linker moiety (e.g., an atom or linker group) in binding moiety A, polynucleotide B, polymer C, or endosomal degradable moiety D after cleavage. Exemplary trace linkers include, but are not limited to, germanium linkers, silicon linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linkers. In some cases, the linker is as described in Hejesen, et al ., “A traceless aryl-triazene linker for DNA-directed chemistry,” Org . Biomol It is a traceless aryl-triazene linker as described in Chem 11 (15): 2493-2497 (2013). In some cases, the linker is as described in Blaney, et al ., “Traceless solid-phase organic synthesis,” Chem . Rev. 102 :2607-2024 (2002)]. In some cases, the linker is a trace linker, such as described in U.S. Pat. No. 6,821,783.

In some cases, the linker includes a functional group that exerts steric hindrance at the binding site between the linker and the conjugation moiety (e.g., A, B, C, or D described herein). In some cases, the steric hindrance is around the disulfide bond. Exemplary linkers that exhibit steric hindrance include heterobifunctional linkers, such as the heterobifunctional linkers described above. In some cases, linkers that exhibit steric hindrance include SMCC and SPDB.

In some cases, the linker is an acid cleavable linker. In some cases, acid cleavable linkers contain hydrazone linkages that are susceptible to hydrolytic cleavage. In some cases, acid cleavable linkers include thiomaleamic acid linkers. In some cases, acid cleavable linkers are described in Castaneda, et al , “Acid-cleavable thiomaleamic acid linker for homogeneous antibody-drug conjugation,” Chem . Commun . 49 : 8187-8189 (2013), a thiomaleamic acid linker.

In some cases, linkers include those described in US Pat. No. 6,884,869; No. 7,498,298; No. 8,288,352; No. 8,609,105; or No. 8,697,688; US Patent Publication No. 2014/0127239; No. 2013/028919; No. 2014/286970; No. 2013/0309256; No. 2015/037360; or No. 2014/0294851; or PCT Publication No. WO2015057699; No. WO2014080251; No. WO2014197854; No. WO2014145090; Or it is a linker described in WO2014177042.

In some embodiments, X, Y, and L are independently a bond or linker. In some cases, X, Y, and L are independently a combination. In some cases, X, Y, and L are independently linkers.

In some cases, X is a bond or linker. In some cases, X is a combination. In some cases, X is a linker. In some cases, the linker is a C ₁ -C ₆ alkyl group. In some cases, X is a C ₁ -C ₆ alkyl group, such as C ₅ , C ₄ , C ₃ , C ₂ , or C ₁ alkyl group. In some cases, a C ₁ -C ₆ alkyl group is an unsubstituted C ₁ -C ₆ alkyl group. As used in the context of linkers, and especially in the context of In some cases, X is a non-polymeric linker. In some cases, X comprises a homobifunctional or heterobifunctional linker described above. In some cases, X includes a heterobifunctional linker. In some cases, X includes sMCC. In other cases, X comprises a heterobifunctional linker optionally conjugated to a C ₁ -C ₆ alkyl group. In other cases, X includes sMCC optionally conjugated to a C ₁ -C ₆ alkyl group. In additional cases, X does not comprise a homobifunctional or heterobifunctional linker as described above.

In some cases, Y is a bond or linker. In some cases, Y is a bond. In other cases, Y is a linker. In some embodiments, Y is a C ₁ -C ₆ alkyl group. In some cases, Y is a homobifunctional or heterobifunctional linker described above. In some cases, Y is a homobifunctional linker described above. In some cases, Y is a heterobifunctional linker described above. In some cases, Y includes a maleimide group, such as maleimidocaproyl (mc) or a self-stabilizing maleimide group described above. In some cases, Y includes a peptide moiety, such as Val-Cit. In some cases, Y includes a benzoic acid group, such as PABA. In additional cases, Y comprises a combination of maleimide groups, peptide moieties, and/or benzoic acid groups. In additional cases, Y includes the mc group. In additional cases, Y includes the mc-val-cit group. In additional cases, Y includes the val-cit-PABA group. In additional cases, Y includes the mc-val-cit-PABA group.

In some cases, L is a bond or linker. In some cases, L is a bond. In other cases, L is a linker. In some embodiments, L is a C ₁ -C ₆ alkyl group. In some cases, L is a homobifunctional or heterobifunctional linker described above. In some cases, L is a homobifunctional linker described above. In some cases, L is a heterobifunctional linker described above. In some cases, L includes a maleimide group, such as maleimidocaproyl (mc) or a self-stabilizing maleimide group described above. In some cases, L includes a peptide moiety, such as Val-Cit. In some cases, L includes a benzoic acid group, such as PABA. In additional cases, L comprises a combination of maleimide groups, peptide moieties, and/or benzoic acid groups. In additional cases, L includes the mc group. In additional cases, L includes the mc-val-cit group. In additional cases, L includes the val-cit-PABA group. In additional cases, L includes the mc-val-cit-PABA group.

How to use

In some embodiments, compositions or pharmaceutical formulations described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of a disease or disorder. In some cases, the disease or disorder is cancer. In some embodiments, the compositions or pharmaceutical agents described herein are used as immunotherapy for the treatment of a disease or disorder. In some cases, immunotherapy is an immunotherapy.

cancer

In some embodiments, the compositions or pharmaceutical agents described herein are used in the treatment of cancer. In some cases, the cancer is a solid tumor. In some cases, the cancer is a blood cancer. In some cases, the cancer is relapsed or refractory, or metastatic. In some cases, the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor. In some cases, the hematological cancer is a relapsed or refractory hematological cancer, or a metastatic hematological cancer.

In some embodiments, the cancer is a solid tumor. Exemplary solid tumors include, but are not limited to, anal cancer, appendiceal cancer, cholangiocarcinoma (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of unknown primary (CUP), and esophageal cancer. , eye cancer, fallopian tube cancer, digestive cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer. , throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.

In some cases, compositions or pharmaceutical formulations described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of solid tumors. In some cases, compositions or pharmaceutical agents described herein comprising binding moieties conjugated to polynucleic acid molecules and polymers can be used to treat anal cancer, appendiceal cancer, cholangiocarcinoma (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, and colon cancer. , Cancer of unknown primary site (CUP), esophageal cancer, eye cancer, fallopian tube cancer, digestive cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, It is used in the treatment of prostate, rectal, skin, stomach, testicular, throat, thyroid, uterine, vaginal, or vulvar cancer. In some cases, the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor.

In some cases, the cancer is a blood cancer. In some cases, the blood cancer is leukemia, lymphoma, myeloma, non-Hodgkin's lymphoma, or Hodgkin's lymphoma. In some cases, blood cancers include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), and diffuse large B -cellular lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenström macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, Burkitt lymphoma, non-Burkitt lymphoma high-grade B-cell lymphoma, primary Mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B-cell prolymphoblastic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) ) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis.

In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of hematologic malignancies. In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of leukemia, lymphoma, myeloma, non-Hodgkin's lymphoma, or Hodgkin's lymphoma. In some cases, blood cancers include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), and diffuse large B -cellular lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenström macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, Burkitt's lymphoma, non-Burkitt high-grade B-cell lymphoma, primary mediastinum B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B-cell prolymphoblastic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymus) It is used in the treatment of large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some cases, the hematological cancer is a relapsed or refractory hematological cancer, or a metastatic hematological cancer.

In some cases, the cancer is KRAS-related cancer, EGFR-related cancer, AR-related cancer, HPRT1-related cancer, or β-catenin-related cancer. In some cases, the compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer may be used for the treatment of KRAS-related cancer, EGFR-related cancer, AR-related cancer, HPRT1-related cancer, or β-catenin-related cancer. It is used in In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of KRAS-related cancers. In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of EGFR-related cancers. In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of AR-related cancers. In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of HPRT1-related cancer. In some cases, compositions or pharmaceutical agents described herein comprising a polynucleic acid molecule and a binding moiety conjugated to a polymer are used in the treatment of β-catenin associated cancers. In some cases, the cancer is a solid tumor. In some cases, the cancer is a blood cancer. In some cases, the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor. In some cases, the hematological cancer is a relapsed or refractory hematological cancer, or a metastatic hematological cancer. In some cases, the cancer is bladder, breast, colorectal, endometrial, esophageal, glioblastoma multiforme, head and neck, kidney, lung, ovarian, pancreatic, prostate, thyroid, acute myeloid leukemia, CLL, DLBCL, or multiple Includes myeloma. In some cases, β-catenin-related cancers further include PIK3C-related cancers and/or MYC-related cancers.

immunotherapy

In some embodiments, the compositions or pharmaceutical agents described herein are used as immunotherapy for the treatment of a disease or disorder. In some cases, immunotherapy is an immunotherapy. In some cases, immunotherapy is categorized as active, passive, or combined (active and passive) methods. In active immunotherapy methods, for example, tumor-associated antigens (TAAs) are presented to the immune system to trigger an attack on cancer cells presenting these TAAs. In some cases, active immuno-anticancer therapy methods include tumor targeting agents and/or immune targeting agents (e.g., checkpoint inhibitors such as monoclonal antibodies), and/or vaccines, such as in situ vaccination and/or cell-based or non-cell-based (e.g., dendritic cell-based, tumor cell-based, antigen, anti-idiotype, DNA, or vector-based) vaccines. In some cases, cell-based vaccines are vaccines produced using activated immune cells obtained from the patient's own immune system and then activated by the patient's own cancer. In some cases, active immuno-anticancer therapies are further divided into non-specific active immunotherapy and specific active immunotherapy. In some cases, non-specific active immunotherapy utilizes cytokines and/or other cell signaling components to induce a general immune system response. In some cases, specific active immunotherapy uses specific TAAs to trigger an immune response.

In some embodiments, the compositions or pharmaceutical agents described herein are used as an active immune anti-cancer therapy method for the treatment of a disease or disorder (e.g., cancer). In some embodiments, the compositions or pharmaceutical agents described herein include a tumor targeting agent. In some cases, the tumor targeting agent is included in binding moiety A. In other cases, the tumor targeting agent is an additional agent used in combination with the molecule of formula (I). In some cases, the tumor targeting agent is a tumor-directed polypeptide (e.g., a tumor-directed antibody). In some cases, tumor-targeting agents exert their antitumor activity through mechanisms such as direct killing (e.g., signaling-induced apoptosis), complement-dependent cytotoxicity (CDC), and/or antibody-dependent cell-mediated cytotoxicity (ADCC). It is a tumor-directed antibody. In additional cases, tumor targeting agents trigger an adaptive immune response, with induction of anti-tumor T cells.

In some embodiments, binding moiety A is a tumor-directed polypeptide (e.g., a tumor-directed antibody). In some cases, binding moiety A exerts its antitumor activity through mechanisms such as direct killing (e.g., signaling-induced apoptosis), complement-dependent cytotoxicity (CDC), and/or antibody-dependent cell-mediated cytotoxicity (ADCC). It is a tumor-directed antibody that exerts In additional cases, binding moiety A triggers an adaptive immune response, with induction of anti-tumor T cells.

In some embodiments, the compositions or pharmaceutical formulations described herein include an immune targeting agent. In some cases, the immune targeting agent is included in binding moiety A. In other cases, the immune targeting agent is an additional agent used in combination with the molecule of formula (I). In some cases, immune targeting agents include cytokines, checkpoint inhibitors, or combinations thereof.

In some embodiments, the immune targeting agent is a checkpoint inhibitor. In some cases, immune checkpoint molecules are molecules presented on the cell surface of CD4 and/or CD8 T cells. Exemplary immune checkpoint molecules include, but are not limited to, programmed death-ligand 1 (B7-H1, PD-L1, also known as CD274), programmed death 1 (PD-1), CTLA-4, B7H1, B7H4, OX. - 40, CD137, CD40, 2B4, IDO1, IDO2, VISTA, CD27, CD28, PD-L2 (B7-DC, CD273), LAG3, CD80, CD86, PDL2, B7H3, HVEM, BTLA, KIR, GAL9, TIM3, Includes A2aR, MARCO (macrophage receptor with collagenous structures), PS (phosphatidylserine), ICOS (inducible T cell costimulator), HAVCR2, CD276, VTCN1, CD70, and CD160.

In some cases, an immune checkpoint inhibitor refers to any molecule that modulates or inhibits the activity of an immune checkpoint molecule. In some cases, immune checkpoint inhibitors include antibodies, antibody-derivatives (e.g., Fab fragments, scFvs, minibodies, diabodies), antisense oligonucleotides, siRNAs, aptamers, or peptides. In some embodiments, the immune checkpoint inhibitor is selected from the group consisting of programmed death-ligand 1 (B7-H1, PD-L1, also known as CD274), programmed death 1 (PD-1), CTLA-4, PD-L2 (B7-DC) , CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137,CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collagenous structure), PS (phosphatidylserine), OX- 40, SLAM, TIGHT , VISTA, VTCN1, or any combination thereof.

In some embodiments, exemplary checkpoint inhibitors include:

PD-L1 inhibitors such as MPDL3280A (RG7446) from Genentech, anti-mouse PD-L1 antibody clone 10F.9G2 (Cat # BE0101) from BioXcell, anti-PD-L1 monoclonal antibody MDX-1105 (BMS-1105) from Bristol-Meyer's Squibb. 936559) and BMS-935559, MSB0010718C, mouse anti-PD-L1 clone 29E.2A3, and MEDI4736 from AstraZeneca;

PD-L2 inhibitors such as AMP-224 (Amplimmune) from GlaxoSmithKline, and rHIgM12B7;

PD-1 inhibitors, such as anti-mouse PD-1 antibody clone J43 (Cat # BE0033-2) from BioXcell, anti-mouse PD-1 antibody clone RMP1-14 (Cat # BE0146) from BioXcell, mouse anti-PD-1 Antibody clone EH12, Merck's MK-3475 anti-mouse PD-1 antibody (Keytruda, pembrolizumab, lambrolizumab), AnaptysBio's anti-PD-1 antibody known as ANB011, antibody MDX-1 106 (ONO-4538) , the human IgG4 monoclonal antibody nivolumab (Opdivo®, BMS-936558, MDX1106) from Bristol-Myers Squibb, AMP-514 and AMP-224 from AstraZeneca, and pidilizumab (CT-011) from CureTech;

CTLA-4 inhibitors, such as the anti-CTLA-4 antibody ipilimumab (also known as Yervoy®, MDX-010, BMS-734016, and MDX-101) from Bristol Meyers Squibb, anti-CTLA4 antibody, clone 9H10 from Millipore, and Pfizer Tremelimumab (CP-675,206, ticilimumab), and anti-CTLA4 antibody clone BNI3 from Abcam;

LAG3 inhibitors such as anti-Lag-3 antibody clone eBioC9B7W (C9B7W) from eBioscience, anti-Lag3 antibody LS-B2237 from LifeSpan Biosciences, IMP321 (ImmuFact) from Immutep, anti-Lag3 antibody BMS-986016, and LAG-3 chimeric antibody. A9H12;

B7-H3 inhibitors such as MGA271;

KIR inhibitors such as ririlumab (IPH2101);

CD137 (41BB) inhibitors such as urerumab (BMS-663513, Bristol-Myers Squibb), PF-05082566 (anti-4-1BB, PF-2566, Pfizer), or XmAb-5592 (Xencor);

PS inhibitors such as babituximab;

and inhibitors, such as antibodies or fragments thereof (e.g., monoclonal, human, humanized, or chimeric antibodies), RNAi molecules, or TIM3, CD52, CD30, CD20, CD33, CD27, OX40 (CD134), GITR, ICOS, BTLA ( CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or small molecules against SLAM.

In some embodiments, binding moiety A comprising an immune checkpoint inhibitor is used in the treatment of a disease or disorder (e.g., cancer). In some cases, binding moiety A is a bispecific antibody or binding fragment thereof comprising an immune checkpoint inhibitor. In some cases, programmed death-ligand 1 (B7-H1, PD-L1, also known as CD274), programmed death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3 , 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137,CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2 , ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collagenous structure), PS (phosphatidylserine), OX-40, SLAM, TIGHT, VISTA, VTCN1, or their Binding moiety A comprising any combination of inhibitors is used in the treatment of a disease or disorder (e.g., cancer).

In some embodiments, the molecule of formula (I) in combination with an immune checkpoint inhibitor is used in the treatment of a disease or disorder (e.g., cancer). In some cases, immune checkpoint inhibitors include PD-L1, also known as programmed death-ligand 1 (B7-H1, CD274), programmed death 1 (PD-1), CTLA-4, and PD-L2 (B7-DC, CD273). ), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137, CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO1, IDO2, ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collagenous structure), PS (phosphatidylserine), OX- 40, SLAM, TIGHT, VISTA , VTCN1, or any combination thereof. In some cases, the molecule of formula (I) is used for the treatment of a disease or disorder (e.g., cancer), ipilimumab, tremelimumab, nivolumab, pemrolizumab, pidilizumab, MPDL3280A, MEDI4736, MSB0010718C, MK- Used in combination with 3475, or BMS-936559.

In some embodiments, the immune targeting agent is a cytokine. In some cases, cytokines are further divided into chemokines, interferons, interleukins, and tumor necrosis factor. In some embodiments, chemokines serve as chemoattractants that guide the migration of cells and are classified into four subfamilies: CXC, CC, CX3C, and XC. Exemplary chemokines include the CC subfamily: CCL1, CCL2 (MCP-1), CCL3, CCL4, CCL5 (RANTES), CCL6, CCL7, CCL8, CCL9 (or CCL10), CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, and CCL28; CXC subfamily: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, and CXCL17; XC subfamily: XCL1 and XCL2; and chemokines from the CX3C subfamily CX3CL1.

Interferons (IFNs) include interferon type I (e.g., IFN-α, IFN-β, IFN-ε, IFN-κ, and IFN-ω), interferon type II (e.g., IFN-γ), and interferon type III. In some embodiments, IFN-α is further classified into about 13 subtypes, including IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21.

Interleukins are expressed by leukocytes or leukocytes and promote the development and differentiation of T and B lymphocytes and hematopoietic cells. Exemplary interleukins include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL -24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-35, and IL-36. .

Tumor necrosis factor (TNF) is a group of cytokines that regulate apoptosis. In some cases, within the TNF family include, but are not limited to, TNFα, lymphotoxin-alpha (LT-alpha), lymphotoxin-beta (LT-beta), T cell antigen gp39 (CD40L), CD27L, CD30L, FASL, 4- There are approximately 19 members, including 1BBL, OX40L, and TNF-related apoptosis-inducing ligand (TRAIL).

In some embodiments, the molecule of formula (I) in combination with a cytokine is used in the treatment of a disease or disorder (e.g., cancer). In some cases, molecules of formula (I) in combination with chemokines are used in the treatment of diseases or disorders (e.g., cancer). In some cases, molecules of formula (I) in combination with interferon are used in the treatment of diseases or disorders (e.g., cancer). In some cases, molecules of formula (I) in combination with interleukins are used in the treatment of diseases or disorders (e.g., cancer). In some cases, molecules of formula (I) in combination with tumor necrosis factor are used in the treatment of diseases or disorders (e.g., cancer). In some cases, IL-1β, IL-2, IL-7, IL-8, IL-15, MCP-1 (CCL2), MIP-1α, RANTES, MCP-3, MIP5, CCL19, CCL21, CXCL2, CXCL9, Molecules of formula (I) in combination with CXCL10, or CXCL11, are used in the treatment of diseases or disorders (e.g., cancer).

In some embodiments, a composition or pharmaceutical formulation described herein comprises a vaccine. In some cases, the vaccine is in situ vaccination. In some cases, the vaccine is a cell-based vaccine. In some cases, the vaccine is a non-cell based vaccine. In some cases, molecules of formula (I) in combination with dendritic cell-based vaccines are used for the treatment of diseases or disorders (e.g., cancer). In some cases, molecules of formula (I) in combination with tumor cell based vaccines are used in the treatment of a disease or disorder (e.g., cancer). In some cases, molecules of formula (I) in combination with antigen vaccines are used in the treatment of diseases or disorders (e.g., cancer). In some cases, molecules of formula (I) in combination with an anti-idiotype vaccine are used in the treatment of a disease or disorder (e.g., cancer). In some cases, molecules of formula (I) in combination with DNA vaccines are used in the treatment of diseases or disorders (e.g., cancer). In some cases, molecules of formula (I) in combination with vector-based vaccines are used for the treatment of diseases or disorders (e.g., cancer).

In some embodiments, the compositions or pharmaceutical agents described herein are used as a passive immunotherapy method for the treatment of a disease or disorder (e.g., cancer). Passive methods, in some cases, utilize adaptive immune system components such as exogenously generated T cells, natural killer (NK) T cells, and/or chimeric antigen receptor (CAR) T cells to attack cancer cells.

In some embodiments, molecules of formula (I) in combination with a T-cell based therapeutic are used in the treatment of a disease or disorder (e.g., cancer). In some cases, T-cell based therapeutics are activated T-cells that recognize one or more of the CD cell surface markers described above. In some cases, T-cell based therapies may target CD2, CD3, CD4, CD5, CD8, CD27, CD28, CD80, CD134, CD137, CD152, CD154, CD160, CD200R, CD223, CD226, CD244, CD258, CD267, CD272, CD272. , activated T-cell agents that recognize one or more of CD278, CD279, or CD357. In some cases, CD2, CD3, CD4, CD5, CD8, CD27, CD28, CD80, CD134, CD137, CD152, CD154, CD160, CD200R, CD223, CD226, CD244, CD258, CD267, CD272, CD274, CD278, CD279, or Molecules of formula (I) in combination with activated T-cell agents that recognize one or more of CD357 are used in the treatment of diseases or disorders (e.g., cancer).

In some embodiments, the molecules of formula (I) in combination with a natural killer (NK) T cell based therapeutic are used in the treatment of a disease or disorder (e.g., cancer). In some cases, NK-based therapeutics are activated NK agents that recognize one or more of the CD cell surface markers described above. In some cases, NK-based therapeutics target CD2, CD11a, CD11b, CD16, CD56, CD58, CD62L, CD85j, CD158a/b, CD158c, CD158e/f/k, CD158h/j, CD159a, CD162, CD226, CD314, CD335, CD337. , CD244, or CD319. In some cases, CD2, CD11a, CD11b, CD16, CD56, CD58, CD62L, CD85j, CD158a/b, CD158c, CD158e/f/k, CD158h/j, CD159a, CD162, CD226, CD314, CD335, CD337, CD244, or Molecules of formula (I) in combination with activated NK agents that recognize one or more of CD319 are used in the treatment of diseases or disorders (e.g., cancer).

In some embodiments, the molecule of formula (I) in combination with a CAR-T cell based therapeutic is used to treat a disease or disorder (e.g., cancer).

In some embodiments, the molecule of formula (I) in combination with an additional agent that destabilizes the endosomal membrane (or disrupts endosomal-lysosomal membrane trafficking) is used in the treatment of a disease or disorder (e.g., cancer). It is used. In some cases, additional agents include antimitotic agents. Exemplary anti-mitotic agents include, but are not limited to, taxanes such as paclitaxel and docetaxel; Vinca alkaloids such as vinblastine, vincristine, vindesine, and vinorelbine; cabazitaxel; colchicine; eribulin; estramustine; etoposide; ixabepilon; Podophyllotoxin; teniposide; or griseofulvin. In some cases, additional agents include paclitaxel, docetaxel, vinblastine, vincristine, vindesine, vinorelbine, cabazitaxel, colchicine, eribulin, estramustine, etoposide, ixabepilone, podophyllotoxin, and teniphor. Contains seeds, or griseofulvin. In some cases, additional agents include Taxol. In some cases, additional agents include paclitaxel. In some cases, additional agents include etoposide. In other cases, additional agents include vitamin K3.

In some embodiments, the compositions or pharmaceutical agents described herein are used as combined methods (including both active and passive methods) in the treatment of a disease or disorder (e.g., cancer).

pharmaceutical preparation

In some embodiments, the pharmaceutical formulations described herein can be administered via multiple routes of administration, including, but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal routes of administration. is administered to the subject. In some cases, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular) administration. In other cases, the pharmaceutical compositions described herein are formulated for oral administration. In other cases, the pharmaceutical compositions described herein are formulated for intranasal administration.

In some embodiments, pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, Includes capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations.

In some cases, pharmaceutical formulations include multiparticulate formulations. In some cases, pharmaceutical formulations include nanoparticle formulations. In some cases, nanoparticles include cMAP, cyclodextrins, or lipids. In some cases, nanoparticles include solid lipid nanoparticles, polymeric nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions, or micellar solutions. Additional exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (e.g., such as those with covalently bound metal chelates). , nanofibers, nanohorns, nano-onions, nanorods, nanoropes, and quantum dots. In some cases, the nanoparticles are metal nanoparticles, such as scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, Hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, Nanoparticles of phosphorus, germanium, arsenic, antimony, and combinations, alloys, or oxides thereof.

In some cases, nanoparticles include a core or a core and a shell, such as in core-shell nanoparticles.

In some cases, nanoparticles are further coated with molecules for attachment of functional elements (e.g., one or more of the polynucleic acid molecules or binding moieties described herein). In some cases, the coating may include chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carrageenan, fucoidan, agaropectin, porphyran, gum karaya, gellan gum, xanthan gum, hyaluronic acid, glucosamine, brown gum, etc. Lactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histone, protamine. , egg white albumin, dextrin, or cyclodextrin. In some cases, the nanoparticles include graphene coated nanoparticles.

In some cases, the nanoparticles have at least one dimension of less than about 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm.

In some cases, nanoparticle agents include paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (e.g., those with covalently bound metal chelates), nanofibers, nanohorns, etc. , nano-onions, nanorods, nanoropes, or quantum dots. In some cases, polynucleic acid molecules or binding moieties described herein are conjugated directly or indirectly to nanoparticles. In some cases, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more of the polynucleic acid molecules or binding moieties described herein are conjugated directly or indirectly to the nanoparticle. do.

In some embodiments, the pharmaceutical formulation comprises a carrier or carrier material selected based on compatibility with the compositions disclosed herein and release profile characteristics of the desired dosage form. Exemplary carrier materials include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol. Esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugar sodium stearoyl lactylate, carrageenan, monoglycerides, diglycerides. Includes ride, pregelatinized starch, etc. See, e.g., Remington: The Science and Practice of Pharmacy , Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences , Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms , Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Fo rms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999)].

In some cases, pharmaceutical agents contain acids such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and hydrochloric acid; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and pH adjusting agents or buffers, including buffers such as citrate/dextrose, sodium bicarbonate, and ammonium chloride. These acids, bases and buffers are included in the amounts necessary to maintain the pH of the composition in an acceptable range.

In some cases, the pharmaceutical formulation includes one or more salts in the amount necessary to adjust the osmolality of the composition to an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; Suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.

In some cases, pharmaceutical formulations additionally contain diluents used to stabilize the compound, as these can provide a more stable environment. Salts dissolved in buffers (which may also provide pH control or maintenance) are used as diluents in the art, including but not limited to phosphate buffered saline. In certain cases, diluents increase the volume of the composition to facilitate compression or create sufficient volume for homogeneous mixing for capsule filling. These compounds include, for example, lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose, such as ^Avicel® ; Dibasic calcium phosphate, dicalcium phosphate dihydrate; Tricalcium phosphate, calcium phosphate; Anhydrous lactose, spray dried lactose; pregelatinized starches, compressible sugars such as Di-Pac ^® (Amstar); Mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluent, refined sugar (confectioner's sugar); Monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; Calcium Lactate Trihydrate, Dextrate; hydrolyzed cereal solids, amylose; Powdered cellulose, calcium carbonate; glycine, kaolin; Mannitol, sodium chloride; It may contain inositol, bentonite, etc.

In some cases, pharmaceutical formulations contain disintegrants that promote destruction or disintegration of the substance. The term “disintegrate” includes both dissolution and dispersion of the dosage form upon contact with gastrointestinal fluids. Examples of disintegrants are starches, such as native starches, such as corn starch or potato starch, pregelatinized starches, such as National 1551 or Amijel ^® , or sodium starch glycolate, such as Promogel ^® or Xplo. Explotab ^® , cellulose, such as wood products, methylmicrocrystalline cellulose, such as Avicel ^® , Avicel ^® PH101, Avicel ^® PH102, Avicel ^® PH105, Elcema ^® P100, Emcocel ^® , Vivacel ^® , Ming Tia ^® , and Solka-Floc ^® , methylcellulose, croscarmellose, or cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose (Ac -Di-Sol ^® ), crosslinked carboxymethylcellulose, or crosslinked croscarmellose, crosslinked starches such as sodium starch glycolate, crosslinked polymers such as crospovidone, crosslinked polyvinylpyrrolidone , alginates, such as alginic acid or salts of alginic acid, such as sodium alginate, clays such as Veegum ^® HV (magnesium aluminum silicate), gums such as agar, guar, locust bean, karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, natural sponges, surfactants, resins such as cation-exchange resins, citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combination with starch, and the like.

In some cases, pharmaceutical preparations may contain fillers such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starch, pregelatinized starch, sucrose. , xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, etc.

Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein to prevent, reduce, or inhibit adhesion or friction of substances. Exemplary lubricants include, for example, stearic acid, calcium hydroxide, talc, sodium stearyl fumarate, hydrocarbons, such as mineral oil, or hydrogenated vegetable oils, such as hydrogenated soybean oil ( ^Sterotex® ), high grade. Fatty acids and their alkali-metal and alkaline earth metal salts such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearate, glycerol, talc, wax, Stearowet ^® , boric acid, sodium benzoate, sodium acetate, Sodium chloride, leucine, polyethylene glycol (e.g. PEG-4000) or methoxypolyethylene glycol such as Carbowax™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as Syloid™, Cab-O-Sil ^® , starch such as corn starch, silicone oil, surfactants, etc.

Plasticizers include compounds used to soften microencapsulated materials or film coatings to make them less brittle. Suitable plasticizers include, for example, polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose, and triacetin. Plasticizers can also function as dispersants or wetting agents.

Solubilizers include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium docusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hyde. Roxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrin, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol. (transcutol), propylene glycol, dimethyl isosorbide, etc.

Stabilizers include compounds such as any antioxidants, buffers, acids, preservatives, etc.

Suspending agents are compounds such as polyvinylpyrrolidone, such as polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone/vinyl acetate. Copolymer (S630), polyethylene glycol (e.g., polyethylene glycol may have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400), sodium carboxymethylcellulose, methylcellulose, hydrochloride Roxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums such as gum tragacanth and xanthan, including gum acacia, guar gum, xanthan gum, sugars, Cellulosic compounds, such as sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyether Includes toxylated sorbitan monolaurate, povidone, etc.

Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, poloxamers, bile acids. salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, such as _Pluronic® (BASF), and the like. Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils such as polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkyl ethers and alkylphenyl ethers such as Octoxynol 10, Octoxynol 40. Sometimes, surfactants are included to improve physical stability or for other purposes.

Viscosity improving agents include, for example, methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, Includes alginate, acacia, chitosan, and combinations thereof.

Wetting agents include oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium. Contains compounds such as oleate, sodium lauryl sulfate, sodium docusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts, etc.

treatment regimen

In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic applications. In some embodiments, the pharmaceutical composition is administered once daily, twice daily, three or more times daily. The pharmaceutical composition is administered daily, every other day, 5 days a week, once a week, every 2 weeks, 2 weeks a month, 3 weeks a month, once a month, twice a month, three or more times a month. The pharmaceutical composition is used for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years or more. administered during

In some embodiments, one or more pharmaceutical compositions are administered simultaneously, sequentially, or at time intervals. In some embodiments, more than one pharmaceutical composition is administered simultaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. In additional cases, one or more pharmaceutical compositions are administered at intervals of time (e.g., the first administration of the first pharmaceutical composition is on day 1 and then at least 1, 2, 3 days prior to administration of the second pharmaceutical composition). , administered at intervals of 4, 5 or more days).

In some embodiments, two or more different pharmaceutical compositions are co-administered. In some cases, two or more different pharmaceutical compositions are co-administered simultaneously. In some cases, two or more different pharmaceutical compositions are co-administered sequentially without an interval of time between administrations. In other cases, two or more different pharmaceutical compositions are sequentially co-administered with an interval of about 0.5 hours, 1 hour, 2 hours, 3 hours, 12 hours, 1 day, 2 days or more between administrations.

If the patient's condition has improved at the discretion of the doctor, administration of the composition is given continuously; Alternatively, the dose of the administered composition is temporarily reduced or temporarily suspended for a specified period of time (i.e., a “drug holiday”. In some cases, the length of the drug holiday can vary from 2 days to 1 year; Just as an example, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days. days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during the drug holiday period is 10%-100% and is used as an example only. , 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90 Includes %, 95%, or 100%.

If improvement in the patient's condition occurs, maintenance doses are administered if necessary. Thereafter, the dosage or frequency of administration, or both, as a function of symptoms, is optionally reduced to a level at which improved disease, disorder or condition is maintained.

In some embodiments, the amount of a given agent corresponding to this amount will vary depending on factors such as the particular compound, the severity of the disease, and the identity (e.g., body weight) of the subject or host in need of treatment, but will nonetheless, e.g. This is routinely determined in a manner known in the art depending on the particular circumstances surrounding the case, including the particular agent administered, the route of administration, and the subject or host being treated. In some cases, the desired dose is conveniently given as a single dose or as divided doses into two, three, four or more subdoses simultaneously (or over a short period of time) or at appropriate intervals, for example, daily.

The foregoing ranges are only indicative, as the number of variables for individual treatment regimens is large and significant excursions from these recommended values are not uncommon.

These dosages vary depending on many variables, including but not limited to the activity of the compound used, the disease or condition being treated, the mode of administration, the needs of the individual subject, the severity of the disease or condition being treated, and the judgment of the physician.

In some embodiments, the toxicity and therapeutic efficacy of such treatment regimens include, but are not limited to, determination of the LD50 (lethal dose in 50% of the population) and ED50 (therapeutically effective dose in 50% of the population). Determined by standard pharmaceutical procedures in cell culture or laboratory animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, expressed as the ratio between LD50 and ED50. Compounds that exhibit a high therapeutic index are preferred. Data obtained from cell culture assays and animal studies are used to range dosages for use in humans. Dosages of these compounds preferably fall within a range of circulating concentrations that include the ED50 with minimal toxicity. Dosages will vary within this range depending on the dosage form used and the route of administration utilized.

kit /manufactured goods

In certain embodiments, disclosed herein are kits and articles of manufacture for use with one or more compositions and methods described herein. Such kits include carriers, packages, or containers compartmentalized to receive one or more containers, such as vials, tubes, etc., each container(s) containing one of the individual elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the container is formed from various materials such as glass or plastic.

Articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, jars, and any packaging suitable for the selected formulation and intended mode of administration and treatment.

For example, the container(s) comprise a molecule A-X-B-Y-C of formula (I) optionally conjugated to an endosomally degradable moiety D as disclosed herein. Such kits optionally include identifying statements or labels or instructions relating to their use in the methods described herein.

Kits typically include a label listing the contents and/or a package insert with instructions for use and instructions for use. A set of instructions will also typically be included.

In one embodiment, the label is on or associated with the container. In one embodiment, a label is on a container when the letters, numbers, or other characters forming the label are attached, molded, or etched into the container itself; When a label is present in a can or carrier that also holds the container, such as a package insert, the label is associated with the container. In one embodiment, the label is used to indicate that the contents are to be used for a specific therapeutic purpose. The label also indicates directions for use of the contents, such as in the methods described herein.

In certain embodiments, pharmaceutical compositions are provided in packs or dispenser devices containing one or more unit dosage forms containing a compound provided herein. Packs contain metal or plastic foil, for example blister packs. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser is also accompanied by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use, or sale of drug products, the notice indicating that the drug form is intended for human or animal administration. Reflects approval by the agency. These notices are, for example, labels approved by the U.S. Food and Drug Administration for prescription drugs or approved product inserts. In one embodiment, compositions containing a compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in an appropriate container, and labeled for treatment of the indicated condition.

specific terminology

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the field to which the claimed subject matter pertains. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting on any claimed subject matter. As used herein, use of the singular includes the plural unless explicitly stated otherwise. It should be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. As used herein, the use of “or” means “and/or” unless otherwise indicated. Additionally, the use of the term “comprising” as well as other forms such as “comprise” and “included” are not limiting.

As used herein, ranges and amounts can be expressed as “about” a particular value or range. The medicine also contains precise amounts. Accordingly, “about 5 μL” means “about 5 μL” and also “5 μL.” Generally, the term “about” includes amounts expected to be within experimental error.

The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

As used herein, the terms “individual(s),” “subject(s),” and “patient(s)” refer to any mammal. In some embodiments, the mammal is a human. In some embodiments, the mammal is non-human. The above terms are not intended to require or be limited to situations characterized by supervision (e.g., continuous or intermittent) by a health care professional (e.g., physician, registered nurse, nurse practitioner, medical assistant, handyman, or hospice worker).

Example

These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims provided herein.

Example 1. Rank

Tables 1, 4, 7, 8, and 10 depict target sequences described herein. Tables 2, 3, 5, 6, 9, 11, and 12 depict the polynucleic acid molecule sequences described herein.

Table 1. KRAS target sequences

Table 2. KRAS siRNA sequences

Table 3. KRAS siRNA with chemical modifications

Table 4. EGFR target sequences

Table 5. EGFR siRNA sequences

Table 6. EGFR siRNA sequences with chemical modifications

Table 7. AR target sequences

Table 8. β-Catenin target sequence

Table 9. β-Catenin and β-catenin-related siRNA sequences.

Table 10. PIK3CA* and PIK3CB* target sequences.

Table 11. PIK3CA and PIK3CB siRNA sequences

Table 12. Additional polynucleic acid molecule sequences

Example 2. General experimental protocol

siRNA for quantitative stem -loop qPCR analyze

Plasma samples were diluted directly in TE buffer. 50 mg tissue pieces were homogenized in 1 mL of Trizol using a FastPrep-24 tissue homogenizer (MP Biomedicals) and then diluted in TE buffer. A standard curve was generated by adding siRNA to plasma or homogenized tissue from untreated animals and then serially diluting it with TE buffer. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) with 25 nM of sequence-specific stem-loop RT primers. The cDNA from the RT step was used for real-time PCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) with 1.5 μM of forward primer, 0.75 μM of reverse primer, and 0.2 μM of probe. The sequences of the KRAS and EGFR siRNA antisense strands and all primers and probes used to measure them are shown in Table 13. Quantitative PCR reactions were performed using standard cycling conditions on a ViiA 7 real-time PCR system (Life Technologies). Ct values were converted to plasma or tissue concentrations using linear equations derived from standard curves.

Table 13. Sequences of all siRNA antisense strands, primers, and probes used in stem-loop qPCR analysis.

mRNA knockdown Compare to Decide qPCR (comparative qPCR ) analyze

Tissue samples were homogenized in Trizol as described above. Total RNA was isolated using RNeasy RNA isolation 96-well plates (Qiagen), and then 500 ng RNA was reverse transcribed using the High Capacity RNA to cDNA kit (ThermoFisher). KRAS, EGFR, CTNNB1 and PPIB mRNA were quantified by TaqMan qPCR analysis performed with the ViiA 7 real-time PCR system. TaqMan primers and probes for KRAS were designed and their binding ability was verified, which are shown in Table 14. TaqMan primers and probes for EGFR and CTNNB1 were purchased from Applied Biosystems as pre-validated gene expression assays. PPIB (a housekeeping gene) was used as an internal RNA loading control, with all TaqMan primers and probes for PPIB purchased from Applied Biosystems as a pre-validated gene expression assay. Results are calculated by the comparative Ct method, which calculates the difference between the target gene (KRAS, CTNNB1, or EGFR) Ct value and the PPIB Ct value (ΔCt), and then takes the quadratic difference (ΔΔCt) relative to the PBS control. It was further standardized.

Table 14. Sequences of primers and probes for detection of KRAS mRNA using comparative qPCR analysis.

animal

All animal research is conducted by Explora BioLabs in compliance with the USDA Animal Welfare Act as well as the regulations outlined in the “Guide for the Care and Use of Laboratory Animals” (National Research Council publication, 8th Ed., revised 2011). It was performed according to protocols in accordance with the Institutional Animal Care and Use Committee (IACUC). All mice were obtained from Charles River Laboratories or Harlan Laboratories.

H358, HCC827 , and Hep- 3B2 1-7 Subcutaneous flank tumor model

For the H358 subcutaneous flank tumor model, tumor cells were inoculated and tumors were established according to the following method. Female NCr nu/nu mice were identified by ear-tag the day before cell injection. Mice were weighed before inoculation. H358 cells were cultured using 10% FBS/RPMI medium and collected using 0.05% trypsin and cell stripper (MediaTech). Five million H358 cells in 0.05 ml Hanks' Balanced Salt Solution (HBSS) with Matrigel (1:1) were injected subcutaneously into the upper right flank of each mouse. Tumor growth was monitored by tumor volume measurements using digital calipers starting 7 days after inoculation, twice weekly until the average tumor volume reached >100 and ≤300 mm ³ . Once tumors reached the desired volume (average 100-300 mm ³ ), animals were randomized and mice with very large or small tumors were killed. Mice were divided into required groups and randomized by tumor volume. Mice were then treated as described for individual experiments.

For the Hep3B orthotopic liver tumor model, tumor cells were inoculated and tumors were established according to the following method. Female NCr nu/nu mice will be identified by ear-tag the day before, and the mice will be anesthetized with isoflurane. Mice were then placed supine on a water-circulating heating pad to maintain body temperature. A small transverse incision will be made below the sternum to expose the liver. Cancer cells were slowly injected into the left upper lobe of the liver using a 28-gauge needle. Cells were injected into the liver at a 30-degree angle so that clear blebs of cells could be observed through the liver capsule. Hep 3B2.1 7 cells were prepared by suspending in cold PBS (0.1-5x10 ⁶ cells) and mixing with diluted Matrigel (30x in PBS). 30-50 ul of cells/Matrigel were inoculated. After injection, a small piece of sterile gauze was placed on the injection site and light pressure was applied for 1 minute to prevent bleeding. Afterwards, the abdomen was sutured with 6-0 silk suture. After tumor cell transplantation, the animals were kept in a warm cage, observed for 1-2 hours, and then returned to the animal cage after complete recovery from anesthesia. At 7-10 days after tumor implantation, animals were randomized, divided into required groups, and treated as described in individual experiments.

LNCap Subcutaneous flank tumor model

LNCaP cells (ATCC® CRL-1740™) were grown to approximately 80% confluency in RPMI + 10% FBS supplemented with non-essential amino acids and sodium pyruvate. Cells were mixed 1:1 with Matrigel, and 5-7*10 ⁶ cells were subcutaneously injected into male SCID mice (6-8 weeks old). Tumors typically developed to a size of 100-350 mm ³ within 3-5 weeks. Animals with tumors within this range were randomized and treated with ASC by injection into the tail vein. For PD studies, animals were sacrificed 96 hours after injection, and organ fragments were harvested, weighed, and frozen in liquid nitrogen. For RNA isolation, organ samples were homogenized in Trizol and RNA was prepared using the Qiagen RNeasy 96 Plus Kit according to the manufacturer's instructions. RNA concentration was determined spectrophotometrically. RNA was converted to cDNA by reverse transcription, and expression of specific targets was quantified by qPCR using the ΔΔCT method and a validated Taqman assay (Thermofisher). Samples were normalized for expression levels of PPIB.

cholesterol siRNA Conjugate synthesis

All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The structure of cholesterol conjugated to the passenger strand is shown in Figure 2. Table 15 shows KRAS, EGFR, and CTNNB1 siRNA sequences.

Table 15.

siRNA chemical modifications include:

· Capital (N) = 2'-OH (ribo);

· Lowercase (n) = 2'-O-Me (methyl);

· dN = 2'-H (deoxy);

· Nf = 2'-F (fluoro);

· s = phosphorothioate backbone modification;

· iB = inverted base

peptide synthesis

Peptides were synthesized on solid phase using standard Fmoc chemistry. Both peptides have cysteine at the N-terminus, and the cleaved peptides were purified by HPLC and confirmed by mass spectrometry. The INF7 peptide is depicted in Figure 3 (SEQ ID NO: 2055). The melittin peptide is shown in Figure 4 (SEQ ID NO: 2060).

port- EGFR antibody

Anti-EGFR antibodies are fully human IgG1κ monoclonal antibodies directed against the human epidermal growth factor receptor (EGFR). It is produced in the Chinese hamster ovary cell line DJT33, derived from the CHO cell line CHO-K1SV, by transfection using a GS vector carrying the antibody gene derived from a hybridoma cell line (2F8) producing human anti-EGFR antibodies. Standard mammalian cell culture and purification techniques are used for the preparation of anti-EGFR antibodies.

The theoretical molecular weight (MW) of the glycan-free anti-EGFR antibody is 146.6 kDa. The experimental MW of the major glycosylated isoform of the antibody is 149 kDa as determined by mass spectrometry. Using SDS-PAGE under reducing conditions, the MW of the light chain was found to be approximately 25 kDa and the MW of the heavy chain was approximately 50 kDa. The heavy chains are attached to each other by two interchain disulfide bonds, and one light chain is attached to each heavy chain by a single interchain disulfide bond. The light chain has two intrachain disulfide bonds and the heavy chain has four intrachain disulfide bonds. The antibody is N-linked glycosylated at Asn305 of the heavy chain with glycans composed of N-acetyl-glucosamine, mannose, fucose, and galactose. The major glycans present are fucosylated bi-antennary structures containing zero or one terminal galactose residue.

The charged subtype pattern of IgG1κ antibodies was investigated using imaging capillary IEF, agarose IEF, and analytical cation exchange HPLC. A number of charged subtypes are found, with the major subtype having an isoelectric point of approximately 8.7.

The main mechanism of action of anti-EGFR antibodies is concentration-dependent inhibition of EGF-induced EGFR phosphorylation in A431 cancer cells. Additionally, induction of antibody-dependent cell-mediated cytotoxicity (ADCC) at low antibody concentrations has been observed in preclinical cell in vitro studies.

Example 3: Antibody-PEG- EGFR and antibodies- EGFR Synthesis, purification and analysis of conjugates

Step 1: maleimide -PEG- NHS after SH - With EGFR union joint

Anti-EGFR antibody (EGFR-Ab) was exchanged with 1X phosphate buffer (pH 7.4) and made to a concentration of 5 mg/ml. To this solution, 2 equivalents of SMCC linker or maleimide-PEGxkDa-NHS (x = 1, 5, 10, 20) were added and rotated for 4 hours at room temperature. Unreacted maleimide-PEG was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and PBS pH 7.4. The antibody-PEG-Mal conjugate was collected and transferred to the reaction vessel. SH-C6-EGFR (2 equiv) was added to antibody-PEG-maleimide in PBS at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using ion exchange chromatography method-1. Fractions containing antibody-PEG-EGFR conjugates were pooled, concentrated, and buffer exchanged with PBS, pH 7.4. Antibody siRNA conjugates with SMCC linkers, PEG1kDa, PEG5kDa and PEG10kDa were isolated based on siRNA loading. Conjugates with PEG20kDa showed poor separation.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugates was assessed by preparative HPLC using Anion Exchange Chromatography Method-2 or Anion Exchange Chromatography Method-3. Examples of all conjugates prepared using these methods are listed in Table 16.

Table 16. List of AXCYB conjugates

Anion exchange chromatography method-1

1. Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID

2. Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow rate: 6.0 ml/min

3. Gradient:

a. %A %B Column Volume

b. 100 0 1.00

c. 60 40 18.00

d. 40 60 2.00

e. 40 60 5.00

f. 0 100 2.00

g. 100 0 2.00

Anion exchange chromatography method-2

1. Column: Thermo Scientific, ProPac™ SAX-10, Bio LC ^TM , 4

2. Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow rate: 1.0 ml/min

3. Gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 11.00 40 60

e. 13.00 40 60

f. 15.00 90 10

g. 20.00 90 10

Anion exchange chromatography method-3

1. Column: Thermo Scientific, ProPac™ SAX-10, Bio LCTM, 4

2. Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl

3. Flow rate: 0.75 ml/min

4. Gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 11.00 40 60

e. 23.00 40 60

f. 25.00 90 10

g. 30.00 90 10

Analysis data for EGFR antibody-PEG20kDa-EGFR are shown in Figures 5 and 6. Figure 5 shows preparative HPLC of EGFR antibody-PEG20kDa-EGFR. Figure 6 shows SDS-PAGE analysis of EGFR antibody-PEG20kDa-EGFR conjugate. The analytical chromatogram of EGFR antibody-PEG10kDa-EGFR is shown in Figure 7. Analysis data for EGFR antibody-PEG5kDa-EGFR are shown in Figures 8 and 9. Figure 8 shows the analysis chromatogram of EGFR antibody-PEG5kDa-EGFR. Figure 9 shows SDS PAGE analysis of EGFR antibody-PEG10kDa-EGFR and EGFR antibody-PEG5kDa-EGFR conjugates. Analysis data of EGFR antibody-PEG1kDa-EGFR conjugates with different siRNA loadings are shown in Figure 10.

Example 4: Antibodies- siRNA -Synthesis, purification and analysis of PEG conjugates

Step 1: SMCC After linker SH - KRAS - PEG5kDa antibody conjugation

The anti-EGFR antibody was exchanged with 1X phosphate buffer (pH 7.4) and made to a concentration of 5 mg/ml. To this solution, 2 equivalents of SMCC linker (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) was added and rotated at room temperature for 4 hours. Unreacted SMCC linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and PBS buffer pH 7.4. The retentate was collected and 2 equivalents of SH-C6-KRAS-PEG5kDa were added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing antibody-KRAS-PEG conjugate were pooled, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was analyzed by preparative HPLC using anion exchange chromatography method-3 (described in Example 1). Examples of conjugates prepared using the methods described in Examples 4 and 5 are shown in Table 17.

Table 17. List of AXBYC conjugates

The HPLC chromatogram of EGFR antibody-KRAS-PEG5kDa is shown in Figure 11. The HPLC chromatogram of panitumumab-KRAS-PEG5kDa is shown in Figure 12.

Example 5: Antibody-S-S- siRNA -Synthesis, purification and analysis of PEG conjugates

Step 1: SPDP After linker SH - siRNA - PEG5kDa antibody conjugation

The anti-EGFR antibody was exchanged with 1X phosphate buffer (pH 7.4) and made to a concentration of 5 mg/ml. To this solution, 2 equivalents of SPDP linker (succinimidyl 3-(2-pyridyldithio)propionate) was added and rotated at room temperature for 4 hours. Unreacted SPDP linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and pH 7.4 PBS buffer. The retentate was collected and 2 equivalents of SH-C6-siRNA-PEG5kDa were added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing antibody-PEG-siRNA conjugates were pooled, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2. The HPLC chromatogram of EGFR antibody-S-S-siRNA-PEG5kDa (DAR = 1) is shown in Figure 13.

Example 6: Antibodies- SMCC - endosome escape peptide Synthesis, purification and analysis of conjugates

Step 1: SMCC linker or maleimide -PEG- NHS after SH - Cys - peptide - CONH ₂ with antibody conjugation

The anti-EGFR antibody was exchanged with 1X phosphate buffer (pH 7.4) and brought to a concentration of 10 mg/ml. To this solution, 3 equivalents of SMCC linker (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) or maleimide-PEG1kDa-NHS were added and rotated at room temperature for 1.5 hours. Unreacted SMCC linker or PEG linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and PBS buffer pH 7.4 (25mM MES pH=6.1 for melittin conjugate). The retentate was collected and 3 equivalents of SH-Cys-peptide-CONH ₂ were added at room temperature and rotated overnight. The reaction mixture was then purified by HIC chromatography or cation exchange chromatography to isolate the anti-EGFR antibody-peptide or anti-EGFR antibody-PEG1k-peptide.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using hydrophobic interaction chromatography (HIC) method-1 or cation exchange chromatography method-1. Fractions containing antibody-peptide conjugates were pooled, concentrated, and buffer exchanged with PBS, pH 7.4 (10 mM acetate pH=6.0 for melittin conjugates).

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. Purity and peptide loading were assessed by preparative HPLC using HIC Method-2 or Cation Exchange Chromatography Method-2. Examples of all conjugates prepared using the method of Example 6 are listed in Tables 18 and 19.

Table 18. List of AXYD conjugates

Table 19. List of AXYD conjugates

Cation Exchange Chromatography Method-1

1. Column: GE Healthcare HiPrep SP HP 16/10

2. Solvent A: 50mM MES pH=6.0; Solvent B: 50mM MES + 0.5M NaCl pH=6.0; Flow rate: 2.0 ml/min

3. Gradient:

a. %A %B Column Volume

b. 100 0 0.1

c. 100 0 Flush Loop 12ml

d. 100 0 2.5

e. 0 100 15

f. 0 100 5

g. 100 0 0.5

h. 100 0 5

Cation exchange chromatography method-2

1. Column: Thermo Scientific, MAbPac™ SCX-10, Bio LC ^TM , 4

2. Solvent A: 20mM MES pH=5.5; Solvent B: 20 mM MES + 0.3 M NaCl pH=5.5; Flow rate: 0.5 ml/min

3. Gradient:

a. Time %A %B

b. 0.0 100 0

c. 5 100 0

d. 50 0 100

e. 80 0 100

f. 85 100 0

g. 90 100 0

Hydrophobic Interaction Chromatography Method-1 (HIC Method-1)

1. Column: GE Healthcare Butyl Sepharose High Performance (17-5432-02) 200ml

2. Solvent A: 50mM sodium phosphate + 0.8M ammonium sulfate (pH=7.0); Solvent B: 80% 50 mM sodium phosphate (pH=7.0), 20% IPA; Flow rate: 3.0 ml/min

3. Gradient:

a. %A %B Column Volume

b. 100 0 0.1

c. 0 100 3

d. 0 100 1.35

e. 100 0 0.1

f. 100 0 0.5

Hydrophobic Interaction Chromatography Method-2 (HIC Method-2)

1. Column: Tosoh Bioscience TSKgel Butyl-NPR 4.6mm ID x 10cm 2.5 μm

2. Solvent A: 100 mM sodium phosphate + 1.8 M ammonium sulfate (pH=7.0); Solvent B: 80% 100 mM sodium phosphate (pH=7.0), 20% IPA; Flow rate: 0.5 ml/min

3. Gradient:

a. Time %A %B

b. 0 100 0

c. 3 50 50

d. 21 0 100

e. 23 0 100

f. 25 100 0

Figure 14 shows HPLC chromatogram of EGFR antibody-PEG24-melittin (loading =~1). Figure 15 shows HPLC chromatogram of EGFR antibody-melittin (n=~1). Figure 16 shows the mass spectrum of EGFR antibody-melittin (n=1). Figure 17 shows HIC chromatogram of EGFR antibody-PEG1kDa-INF7 (peptide loading = ~1). Figure 18 shows HPLC chromatogram of EGFR antibody-INF7 (peptide loading = ~1).

Example 7: EEP -Antibody- siRNA -Synthesis, purification and analysis of PEG conjugates

Step 1: PEG24 After linker SH - Cys - peptide - CONH ₂ of EGFR - Ab - siRNA -Conjugation to PEG

EGFR-Ab-siRNA-PEG conjugate with siRNA loading of 1 was conjugated with 4 equivalents of PEG1k linker (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) in PBS, pH 7.4 buffer. and rotated at room temperature for 1.5 hours. Unreacted PEG1k linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and PBS buffer pH 7.4. The retentate was collected and 4 equivalents of SH-Cys-peptide-CONH ₂ were added at room temperature and rotated overnight.

Step 2: Purification

The reaction mixture was then purified by repeated spin filtration using PBS buffer pH7.4 and 50 kDa Amicon spin filters until unreacted peptides were removed as monitored by HPLC. The product contains a mixture of conjugates in which 0, 1, 2, 3 or more peptides are conjugated to the antibody backbone.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. Purity and peptide loading of the conjugates were assessed by preparative HPLC using HIC Method-2 or Cation Exchange Chromatography Method-2. Examples of conjugates prepared using the method described in Example 7 are shown in Table 20.

Table 20. (A-X-B-Y- Cn )-L-D conjugate list

Figure 19 shows INF7-PEG1kDa-(EGFR antibody-KRAS-PEG5kDa). Figure 20 shows melittin-PEG1kDa-(EGFR antibody-KRAS-PEG5kDa).

Example 8: In vivo of EGFR antibody- siRNA -PEG conjugate (PK-055) Pharmacokinetic studies

A group (n=3) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n =4) were administered one intravenous injection of PBS as a vehicle control. The treatment group administered the EGFR antibody-siRNA-PEG conjugate was administered 0.5 mg/kg (based on the weight of siRNA), and the group that received the cholesterol-siRNA conjugate was administered 15 mg/kg. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Nasal blood samples were collected via puncture of the retro-orbital plexus at 2, 15, or 60 minutes post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Table 21 describes the study design in more detail and provides cross-references to conjugate synthesis and characterization. Extremity blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantification were performed as described in Examples 2-7.

Table 21. Study design for EGFR antibody-siRNA-PEG conjugate (PK-055) with cross-reference to synthesis and characterization of tested conjugates.

EGFR siRNA was attached to an EGFR antibody (EGFR-Ab) using PEG linkers and small molecule linkers of various molecular weights, and PK was analyzed to determine the effect of linker molecular weight on the behavior of the mAb-siRNA conjugate in plasma. As shown in Figure 21, the molecular weight of the PEG linker does not have a significant effect on plasma PK except that 10 kDa PEG resulted in a faster siRNA clearance (i.e., lower plasma concentration at a later time). The orientation of siRNA and PEG relative to the EGFR-Ab was also studied. As shown in Figure 22, having siRNA between EGFR-Ab and PEG5k (EGFR antibody-KRAS-PEG5k) is more effective than the alternative conjugate with PEG5k between EGFR-Ab and siRNA (EGFR antibody-PEG5k-EGFR). Resulting in significantly higher plasma concentrations. In some cases, using two different siRNAs on these conjugates does not affect plasma kinetics.

Drug loading on EGFR-Ab was also investigated using n=1 and n=2 siRNA per EGFR-Ab. As shown in Figure 23, having only 1 siRNA per EGFR-Ab resulted in much higher plasma concentrations, whereas higher loading of n=2 siRNA per EGFR-Ab resulted in faster clearance from plasma. . The impact of adding endosomal escape peptide (melittin) was evaluated. EGFR antibody-KRAS-PEG5k and EGFR antibody-melittin were mixed together in solution and co-injected. As shown in Figure 24, the presence of EGFR antibody-melittin increases the clearance of EGFR antibody-KRAS-PEG5k from plasma at a later time.

Next, the plasma PK of the cholesterol-siRNA conjugate was compared with the mAb-siRNA conjugate after intravenous administration via tail vein injection. As shown in Figure 25, chol-siRNA conjugates are cleared from plasma much faster than mAb-siRNA conjugates. As shown in the PK profile, having EGFR or KRAS siRNA on the conjugate did not affect plasma kinetics.

In addition to plasma PK analysis, tissue PK was determined by determining siRNA concentrations in tissues at various times after administration. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the tissue density was 1 g/mL. In Figure 26, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As shown in Figure 26A, a single intravenous administration of 0.5 mg/kg of EGFR antibody-siRNA resulted in approximately 100 nM concentrations of siRNA in the tumor 24 hours after administration for virtually all conjugates. For these EGFR antibody-linker-siRNA conjugates, the molecular weight of the linker between EGFR-Ab and EGFR siRNA does not appear to alter the pK of these conjugates in subcutaneous flank H358 tumors. As shown in Figure 26B, after a single intravenous administration of 0.5 mg/kg of EGFR antibody-siRNA, the concentration of siRNA in the liver is approximately 100 nM at 24 hours post-dose, similar to that observed in tumors. At 24 hours after administration, only the small molecule linker produces siRNA concentrations in the liver that are approximately half of those observed with the longer PEG linker. siRNA concentrations decrease over time in both tumor and liver tissue using these EGFR antibody-linker-siRNA conjugates.

Orientation of siRNA and PEG relative to EGFR-Ab was also studied in relation to tissue PK profile. As shown in Figure 27, both the EGFR antibody-KRAS-PEG5k and the EGFR antibody-PEG5k-EGFR conjugate deliver approximately 100 nM siRNA into both the tumor and liver after a single intravenous administration of 0.5 mg/kg. However, EGFR antibody-KRAS-PEG5k maintains siRNA concentration in the tumor at approximately 100 nM until 168 hours after administration, whereas the other three curves show a decrease in concentration over time. Next, tissue PK was assessed as a function of drug loading. As shown in Figure 28, n=1 siRNA per EGFR-Ab delivered a greater amount of siRNA into the tumor compared to the liver. However, increasing the siRNA loading to n=2 siRNA per EGFR-Ab increased the amount of siRNA delivered to the liver and increased the amount of siRNA delivered to the tumor. Additionally, EGFR antibody-melittin was mixed with some agents to introduce an endosomal escape function. As shown in Figure 29, mixing and co-administering EGFR antibody-melittin with EGFR antibody-siRNA did not have a significant effect on tissue PK. Addition of melittin increased the uptake of siRNA in the tumor and increased the uptake of siRNA in the liver.

The tissue PK profile of cholesterol-siRNA conjugates (using both EGFR and KRAS siRNA) was also assessed in liver and subcutaneous flank H358 tumors. As shown in Figure 30, both chol-siRNA conjugates delivered siRNA at a concentration of approximately 5 μM into the liver 24 hours after a single intravenous administration of 15 mg/kg. In the liver, chol-KRAS appears to be cleared slightly more rapidly than chol-EGFR, on a 1-week time scale. Two different chol-siRNA conjugates further exhibit different PK profiles in tumors. Both cholesterol conjugates deliver less siRNA into the tumor compared to the liver, but chol-EGFR delivers more siRNA into the tumor compared to the chol-KRAS conjugate. Both chol-siRNA conjugates are cleared from the tumor over time and at similar gradients.

PD analysis followed by PK analysis. As shown in Figure 31A, the chol-KRAS conjugate caused only minor (~25%) mRNA knockdown of KRAS target genes in tumors after a single intravenous administration of 15 mg/kg. However, as shown in Figure 31B, the same 15 mg/kg dose of chol-KRAS was able to cause >50% mRNA knockdown in mouse liver. The chol-EGFR conjugate was able to cause >50% mRNA knockdown in tumors, as shown in Figure 32. In some cases, the higher knockdown of chol-EGFR in tumors compared to chol-KRAS is due to the higher siRNA concentrations observed in tumors with chol-EGFR compared to chol-KRAS (Figure 30). Finally, as shown in Figures 33 and 34, most of the EGFR antibody-siRNA conjugates were removed from the tumor after a single IV administration, but at a much lower dose (0.5 mg/kg) compared to the chol-siRNA conjugates, approximately 25% of the time. Resulted in -50% EGFR or KRAS mRNA knockdown.

Example 9: Additional antibodies- siRNA Synthesis, purification and analysis of conjugates

Step 1: SMCC After linker SH - with siRNA antibody conjugation

The antibody was exchanged with 1X phosphate buffer (pH 7.4) and made to a concentration of 10 mg/ml. To this solution, 2 equivalents of SMCC linker dissolved in DMSO was added and rotated at room temperature for 4 hours. Unreacted SMCC linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and PBS pH 7.4. The antibody-maleimide conjugate was collected into the reaction vessel and SH-C6-siRNA or SH-C6-siRNA-C6-NHCO-PEG- Added in PBS at room temperature and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography Method-2 showed antibody siRNA conjugates along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA-PEG conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugate

The isolated conjugate was characterized by SAX chromatography, SEC chromatography and SDS-PAGE analysis. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2. All DAR1 conjugates typically eluted at 9.0 ±0.4 min, whereas DAR2 and DAR3 conjugates typically eluted at 9.7 ±0.2 min. A typical DAR1 conjugate is >90% pure after purification, whereas a typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3.

Step 1: TCEP antibodies used interchain disulfide restoration

The buffer solution for the antibody was exchanged with borax buffer (pH 8) and the concentration was adjusted to 10 mg/ml. To this solution, 2 equivalents of TCEP in water were added and rotated at room temperature for 2 hours. The resulting reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and incubated with SMCC-C6-siRNA or SMCC-C6-siRNA-C6-NHCO-PEG- in pH 7.4 PBS containing 5 mM EDTA at room temperature. X kDa (2 equivalents) (X = 0.5 kDa to 10 kDa) was added to the solution and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugates along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-PEG-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugates

Isolated conjugates were characterized by SEC, SAX chromatography, and SDS-PAGE. The purity of the conjugates was assessed by preparative HPLC using Anion Exchange Chromatography Method-2 or Anion Exchange Chromatography Method-3. Isolated DAR1 conjugates typically elute in 9.0 + 0.3 minutes in analytical SAX method-2 and are >90% pure. A typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3.

Step 1: TCEP antibodies used interchain disulfide restoration

The buffer solution for the antibody was exchanged with borax buffer (pH 8) and the concentration was adjusted to 10 mg/ml. To this solution, 2 equivalents of TCEP in water were added and rotated at room temperature for 2 hours. The resulting reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and incubated with 2 equivalents of CBTF-C6-siRNA-C6-NHCO-PEG-5kDa in pH 7.4 PBS containing 5 mM EDTA at room temperature. Added to the solution and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugates along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR≥2 antibody-siRNA conjugates were separated, concentrated, and buffer exchanged with PBS, pH 7.4. A typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3 or more.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugates was assessed by preparative HPLC using Anion Exchange Chromatography Method-2 or Anion Exchange Chromatography Method-3.

Step 1: TCEP Antibody reduction using

The buffer solution for the antibody was exchanged with borax buffer (pH 8) and the concentration was adjusted to 5 mg/ml. To this solution, 2 equivalents of TCEP in water were added and rotated at room temperature for 2 hours. The resulting reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and incubated with 2 equivalents of MBS-C6-siRNA-C6-NHCO-PEG-5kDa in pH 7.4 PBS containing 5 mM EDTA at room temperature. Added to the solution and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugates along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using ion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4. A typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3 or more.

Step-3: Analysis of purified conjugates

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugates was assessed by preparative HPLC using Anion Exchange Chromatography Method-2 or Anion Exchange Chromatography Method-3.

Step 1: TCEP Antibody reduction using

The buffer solution for the antibody was exchanged with borax buffer (pH 8) and the concentration was adjusted to 5 mg/ml. To this solution, 2 equivalents of TCEP in water were added and rotated at room temperature for 2 hours. The resulting reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and incubated with 2 equivalents of MBS-C6-siRNA-C6-NHCO-PEG-5kDa in pH 7.4 PBS containing 5 mM EDTA at room temperature. Added to the solution and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugates along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4. A typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3 or more.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugates was assessed by preparative HPLC using Anion Exchange Chromatography Method-2 or Anion Exchange Chromatography Method-3.

Step 1: SPDP After linker SH - siRNA - PEG5kDa antibody conjugation

The antibody was adjusted to a concentration of 10 mg/ml by exchanging the buffer with 1X PBS at pH 7.4. To this solution, 2 equivalents of SPDP linker [succinimidyl 3-(2-pyridyldithio)propionate] or its methylated form was added and rotated at room temperature for 4 hours. Unreacted SPDP linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and pH 7.4 PBS buffer. The retentate was collected and 2 equivalents of SH-C6-siRNA-PEG5kDa in pH 7.4 PBS were added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4. A typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3 or more.

Step-3: Analysis of purified conjugate

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2.

Step 1: Antibody reduction and pyridyl dithio - siRNA - PEG5kDa join

The buffer solution for the antibody was exchanged with pH 8.0 borax buffer and the concentration was adjusted to 10 mg/ml. To this solution, 1.5 equivalents of TCEP were added and the reaction mixture was rotated for 1 hour at room temperature. Unreacted TCEP was removed by spin filtration using a 50 kDa MWCO Amicon spin filter, and the buffer was exchanged with pH 7.4 PBS. The retentate was collected and 2 equivalents of pyridyldithio-C6-siRNA-PEG5kDa in pH 7.4 PBS were added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugates

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2. A typical DAR>2 cysteine conjugate contains 90% DAR2 and 10% DAR3 or more.

Step 1: Antibody reduction and maleimide -ECL- siRNA - PEG5kDa join

The buffer solution for the antibody was exchanged with pH 8.0 borax buffer and the concentration was adjusted to 10 mg/ml. To this solution, 1.5 equivalents of TCEP (Tris(2-carboxyethyl)phosphine hydrochloride) reagent was added and rotated at room temperature for 1 hour. Unreacted TCEP was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and pH 7.4 PBS buffer with 5mM EDTA. The retentate was collected and 1.5 equivalents of maleimide-ECL-C6-siRNA-PEG5kDa in PBS pH 7.4 was added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugates

Isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2. A typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3 or more.

Step 1: NHS - PEG4 - TCO after Methyltetrazine - PEG4 - siRNA - PEG5kDa antibody conjugation

The antibody was adjusted to a concentration of 5 mg/ml by exchanging the buffer solution with pH 7.4 PBS. To this solution, 2 equivalents of NHS-PEG4-TCO linker was added and rotated at room temperature for 4 hours. Unreacted linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and pH 7.4 PBS. The retentate was collected and 2 equivalents of methyltetrazine-PEG4-siRNA-PEG5kDa in PBS, pH 7.4, was added at room temperature. The reaction mixture was analyzed by analytical SAX column chromatography, and antibody-siRNA conjugates were observed along with unreacted antibody and siRNA.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4. A typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3 or more.

Step-3: Analysis of purified conjugate

The properties and purity of the isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2.

Step 1: Antibodies glycan Strain and Gal-N ₃ addition

The antibody was exchanged with pH 6.0, 50 mM sodium phosphate buffer, and treated with EndoS2 at 37°C for 16 hours. The reaction mixture was buffer exchanged with TBS buffer (20 mM Tris, 0.9% NaCl, pH 7.4), UDP-GalNAz was added, and then incubated with 50 mM Tris, MnCl ₂ in 5 mM EDTA (pH 8), and Gal-T (Y289L). ) was added. The final solution contained concentrations of 0.4 mg/mL antibody, 10 mM MnCl ₂ , 1 mM UDP-GalNAz, and 0.2 mg/mL Gal-T(Y289L) and was incubated at 30°C overnight.

Step 2: Azide ( azide ) to modified antibodies DIBO -PEG- TCO join

The reaction mixture in Step-1 was buffer exchanged with PBS, 2 equivalents of DIBO-PEG4-TCO linker was added, and rotated at room temperature for 6 hours. Unreacted linker was removed by spin filtration using a 50 kDa MWCO Amicon spin filter and pH 7.4 PBS. The retentate was collected and used as in step-3.

Step 3: TCO to labeled antibodies methyl tetrazine - siRNA join

2 equivalents of methyltetrazine-PEG4-siRNA-PEG5kDa in pH 7.4 PBS was added to the residue of step-2 and rotated at room temperature for 1 hour. The reaction mixture was analyzed by analytical SAX column chromatography, and antibody-siRNA conjugates were observed along with unreacted antibody and siRNA.

Step 4: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4. A typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3 or more.

Step-5: Analysis of purified conjugate

The properties and purity of the isolated conjugates were characterized by mass spectrometry or SDS-PAGE. The purity of the conjugate was assessed by preparative HPLC using anion exchange chromatography method-2.

Step 1: Antibody digestion using pepsin

The antibody was adjusted to a concentration of 5 mg/ml by exchanging the buffer with pH 4.0, 20 mM sodium acetate/acetic acid buffer. Immobilized pepsin (Thermo Scientific, Prod#20343) was added and incubated at 37°C for 3 hours. The reaction mixture was filtered using a 30 kDa MWCO Amicon spin filter and pH 7.4 PBS. The retentate was collected and purified using size exclusion chromatography to isolate F(ab')2. The collected F(ab')2 was then reduced by 10 equivalents of TCEP and conjugated with SMCC-C6-siRNA-PEG5 in PBS, pH 7.4 at room temperature. Analysis of the reaction mixture on SAX chromatography showed Fab-siRNA conjugate along with unreacted Fab and siRNA-PEG.

Step 2: Purification

The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DAR1 and DAR2 Fab-siRNA conjugates were isolated, concentrated, and buffer exchanged with PBS, pH 7.4.

Step-3: Analysis of purified conjugate

The properties and purity of the isolated conjugates were assessed by SDS-PAGE and preparative HPLC using anion exchange chromatography method-2.

Purification and analysis methods

Anion exchange chromatography method-1.

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID

Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow rate: 6.0 ml/min

gradient:

a. %A %B Column Volume

b. 100 0 1.00

c. 60 40 18.00

d. 40 60 2.00

e. 40 60 5.00

f. 0 100 2.00

g. 100 0 2.00

Anion exchange chromatography method-2

Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow rate: 1.0 ml/min

gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 11.00 40 60

e. 13.00 40 60

f. 15.00 90 10

g. 20.00 90 10

Anion exchange chromatography method-3

Column: Thermo Scientific, ProPac™ SAX-10, Bio LCTM, 4

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl

Flow rate: 0.75 ml/min

gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 11.00 40 60

e. 23.00 40 60

f. 25.00 90 10

g. 30.00 90 10

Size Exclusion Chromatography Method-1

Column: TOSOH Biosciences, TSKgelG3000SW XL, 7.8

Mobile phase: 150 mM phosphate buffer

Flow rate: 1.0 ml/min for 20 minutes

siRNA synthesis

All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA.

Each siRNA passenger strand contains two conjugation handles, C6-NH ₂ and C6-SH, one at each end of the strand. The passenger strand with a C6-NH ₂ handle at its 5' end contains C6-SH at its 3' end, and the strand containing a C6-NH ₂ handle at its 3' end contains C6-SH at its 5' end. Contains. Both conjugation handles are coupled to the siRNA passenger strand via an inverted base phosphodiester or phosphorothioate.

Representative structure of siRNA with a C6-NH ₂ conjugation handle at the 5' end and C6-SH at the 3' end of the passenger strand.

Example Described in 10-41 ASC structure

ASC Structure-1 : Antibody-Lys-SMCC-S-3'-Passenger Strand. This conjugate was generated by antibody lysine-SMCC conjugation to the thiol at the 3' end of the passenger strand.

ASC Structure-2 : Antibody-Cys-SMCC-3'-Passenger Strand. This conjugate was generated by antibody interchain cysteine conjugation to SMCC at the 3' end of the passenger strand.

ASC Structure-3 : Antibody-Lys-SMCC-S-5'-Passenger Strand. This conjugate was generated by antibody lysine-SMCC conjugation to the C6-thiol at the 5' end of the passenger strand.

ASC Structure-4 : Antibody-Cys-SMCC-5'-Passenger Strand. This conjugate was generated by antibody interchain cysteine conjugation to SMCC at the 5' end of the passenger strand.

ASC Structure-5 : Antibody-Lys-PEG-5'-passenger strand. This conjugate was generated by antibody PEG-TCO conjugation to a tetrazine at the 5' end of the passenger strand.

ASC Structure-6 : Antibody-Lys-PEG-5'-Passenger Strand. This conjugate was generated by antibody PEG-TCO conjugation to a tetrazine at the 5' end of the passenger strand.

ASC structure - 7 : Antibody-Cys-PEG-5'-passenger strand without the base inverted at the 5' end. This conjugate was generated using a similar procedure to Structure-2. The antibody was conjugated directly to the amine on the passenger strand 5' terminal sugar.

Zalutumumab ( EGFR - Ab )

Zalutumumab is a fully human IgG1κ monoclonal antibody directed against the human epidermal growth factor receptor (EGFR). It is produced in the Chinese hamster ovary cell line DJT33, derived from the CHO cell line CHO-K1SV, by transfection using a GS vector carrying an antibody gene derived from a hybridoma cell line (2F8) producing human anti-EGFR antibodies. Standard mammalian cell culture and purification techniques are used for the preparation of zalutumumab.

The theoretical molecular weight (MW) of glycan-free zalutumumab is 146.6 kDa. The experimental MW of the major glycosylated isoform of the antibody is 149 kDa as determined by mass spectrometry. Using SDS-PAGE under reducing conditions, the MW of the light chain was found to be approximately 25 kDa and the MW of the heavy chain was approximately 50 kDa. The heavy chains are attached to each other by two interchain disulfide bonds, and one light chain is attached to each heavy chain by a single interchain disulfide bond. The light chain has two intrachain disulfide bonds and the heavy chain has four intrachain disulfide bonds. The antibody is N-linked glycosylated at Asn305 of the heavy chain with glycans composed of N-acetyl-glucosamine, mannose, fucose, and galactose. The major glycans present are fucosylated bi-antennary structures containing zero or one terminal galactose residue. The charged subtype pattern of IgG1κ antibodies was investigated using imaging capillary IEF, agarose IEF, and analytical cation exchange HPLC. A number of charged subtypes are found, with the major subtype having an isoelectric point of approximately 8.7.

The main mechanism of action of zalutumumab is concentration-dependent inhibition of EGF-induced EGFR phosphorylation in A431 cancer cells. Additionally, induction of antibody-dependent cell-mediated cytotoxicity (ADCC) at low antibody concentrations has been observed in preclinical cell in vitro studies.

Panitumumab ( EGFR2 - Ab )

Panitumumab is a clinically approved, fully human IgG2 subclass monoclonal antibody specific for the epidermal growth factor receptor (EGFR). Panitumumab has two gamma heavy chains and two kappa light chains. Glycosylated panitumumab has a total molecular weight of approximately 147 kDa. Panitumumab is expressed as a glycoprotein with a single common N-linked glycosylation site located in the heavy chain. Panitumumab is produced from Chinese hamster ovary (CHO) cells and purified by a series of chromatography steps, virus inactivation steps, virus filtration steps, and ultrafiltration/diafiltration steps.

Panitumumab acts as a competitive antagonist at the ligand binding site of EGFR, inhibiting binding and signaling mediated by EGF and transforming growth factor α, the natural ligand for this receptor. The affinity of panitumumab for binding to EGFR was determined to be 3.5 and 5.7 x 10 ^-12 M for recombinant EGFR using the BIAcore method. Inhibition of EGF binding was shown in A431 cells, a human epidermal carcinoma cell line expressing EGFR. Intracellular acidification, phosphorylation and internalization of EGFR were blocked by panitumumab in A431 cells in a dose-dependent manner. Panitumumab has also been shown to inhibit cell growth in vitro and in vivo in the same cell lines.

Herceptin ( EGFR3 - Ab )

Herceptin, also known as Her2, is a clinically approved humanized IgG1 subclass monoclonal antibody specific for epidermal growth factor receptor 2 (EGFR2). Herceptin has a human Fc γ1 subtype with a kappa light chain.

PSMA - Ab

PSMA-Ab is a humanized IgG1 subclass monoclonal antibody specific for prostate-specific membrane antigen (PSMA).

ASGR1 - Ab

ASGR mAb-Sino103 is a rabbit IgG monoclonal antibody that binds to mouse asialoglycoprotein receptor 1 (ASGPR1). It is supplied by Sino Biologicals Inc. (Cat # 50083-R103).

ASGR2 - Ab

ASGR mAb-R&D is a rat IgG _2A subclass monoclonal antibody that binds to mouse asialoglycoprotein receptor 1 (ASGPR1). It is purified by protein A or G from hybridoma culture supernatants and supplied by R&D Systems (Cat # MAB2755).

siRNA - TriGalNAc zygote

siRNA triGalNAc conjugate was synthesized using Lys-Lys dipeptide. Protected triGalNAc was conjugated with a dipeptide PEG linker and purified. After removing the carboxylic acid protecting group on the triGalNAc-dipeptide, it was conjugated to the 5' end of the siRNA passenger strand.

Example 10: 2016 -PK-163- LNCap

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

The AXBYC conjugate used in Groups 3-4 was prepared and purified as DAR1 (n=1) using ASC Structure-4, as described in Example 9. AXB and AXCYB conjugates were prepared as described in Example 9.

in vivo study design

A group of female SCID SHO mice (n=5) bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) ) was administered one intravenous injection of PBS as a vehicle control. Treatment groups 1-6 were administered 1.0 or 0.5 mg/kg (by weight of siRNA) according to the study design below. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 22 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. The cDNA from the RT step was then used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 22

The orientation of siRNA and PEG with respect to PSMA-Ab was studied in an in vivo mouse tumor model. As shown in Figure 50A, an alternative conjugate with siRNA between PSMA-Ab and PEG5k (PSMA-Ab(Cys)-EGFR-PEG5k or AXBYC format) has PEG5k between PSMA-Ab and siRNA (PSMA-Ab(Cys)-EGFR-PEG5k or AXBYC format). -Ab(Cys)-PEG5k-EGFR or AXCYB format) resulted in higher levels of EGFR mRNA knockdown in tumors. This approach (AXBYC) also resulted in higher levels of EGFR mRNA knockdown in tumors compared to conjugates without PEG5K (PSMA-Ab(Cys)-EGFR or AXB format).

The orientation of siRNA and PEG relative to PSMA-Ab was also studied for tissue PK profiles. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the density of the tissue to be 1 g/mL (concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue). . As shown in Figure 50B, having siRNA between PSMA-Ab and PEG5k (AXBYC) resulted in higher levels of siRNA delivery to the tumor compared to the alternative conjugate where PEG5k was between PSMA-Ab and siRNA (AXCYB). caused. This approach (AXBYC) resulted in higher levels of EGFR siRNA delivery to the tumor compared to the conjugate without PEG5K (AXB).

In the mouse LNCaP subcutaneous xenograft model, it was demonstrated that the AXBYC format for antibody siRNA conjugates resulted in higher levels of siRNA accumulation and greater magnitude of EGFR mRNA knockdown in tumor tissue compared to the AXCYB and AXB formats. LNCap tumors expressed human PSMA, resulting in tumor tissue-specific accumulation of PSMA-targeted siRNA conjugates, receptor-mediated uptake, and siRNA-promoted knockdown of target genes after intravenous administration.

Example 11: 2016 -PK-202- LNCap

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and Identification

AXBYC conjugates used in groups 3-5 and 7 were prepared and purified as DAR1 (n=1) using ASC construct-4 as described in Example 9. AXB (Group 1-2) and AXCYB (Group 6) conjugates were prepared as described in Example 9.

in vivo study design

A group of female SCID SHO mice (n=5) bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) ) was administered one intravenous injection of PBS as a vehicle control. Treatment groups 1-6 were administered 1.0 or 0.5 mg/kg (by weight of siRNA) according to the study design below. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 23 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 23

The orientation of siRNA and PEG relative to PSMA-Ab was also studied in an in vivo mouse tumor model. As shown in Figure 51A, having siRNA between PSMA-Ab and PEG5k (PSMA-Ab(Cys)-EGFR-PEG5k or AXBYC format) is an alternative conjugate where PEG5k is between PSMA-Ab and siRNA ( PSMA-Ab(Cys)-PEG5k-EGFR or AXCYB format) resulted in higher levels of EGFR mRNA knockdown in tumors. This approach (AXBYC) also resulted in higher levels of EGFR mRNA knockdown in tumors compared to conjugates without PEG5K (PSMA-Ab(Cys)-EGFR or AXB format).

The orientation of siRNA and PEG relative to PSMA-Ab was also studied for tissue PK profiles. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the density of the tissue to be 1 g/mL (concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue). As shown in Figure 51B, one with siRNA between PSMA-Ab and PEG5k (PSMA-Ab(Cys)-EGFR-PEG5k or AXBYC) is an alternative conjugate with PEG5k between PSMA-Ab and siRNA (PSMA-Ab(Cys)-EGFR-PEG5k or AXBYC). Ab(Cys)-PEG5k-EGFR or AXCYB) resulted in higher levels of siRNA delivery to the tumor. This approach (AXBYC) also resulted in higher levels of EGFR siRNA delivery to the tumor compared to conjugates without PEG5K (PSMA-Ab(Cys)-EGFR or AXB).

In the mouse LNCaP subcutaneous xenograft model, it was demonstrated that the AXBYC format for antibody siRNA conjugates resulted in higher levels of siRNA accumulation and greater magnitude of EGFR mRNA knockdown in tumor tissue compared to the AXCYB and AXB formats. LNCap tumors expressed human PSMA, resulting in tumor tissue-specific accumulation of PSMA-targeted siRNA conjugates, receptor-mediated uptake, and siRNA-promoted knockdown of target genes after intravenous administration.

Example 12: 2016 -PK-219-WT

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

The AXBYC conjugate used in Groups 4-6 was prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9. AXB (Groups 1-3) and AXCYB (Groups 7-9) and BYC (Groups 10-12) conjugates were prepared as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 24 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 5, 30, and 180 minutes post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Peripheral blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 24

In this in vivo PK experiment, the orientation of siRNA and PEG with respect to the EGFR-Ab was studied to determine the behavior of the mAb-siRNA conjugate in plasma. As shown in Figure 52, all mAb-siRNA conjugates (AXB, AXBYC, and AXCYB formats) had comparable plasma PK, with approximately 10% of the siRNAs being rapidly cleared from plasma compared to siRNA-PEG5K (BYC format). remained in systemic circulation after 168 hours (7 days).

The AXBYC format for antibody siRNA conjugates has improved PK properties compared to siRNA-PEG conjugates (BYC), which are rapidly cleared from plasma.

Example 13:2016 -PK-199- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). The same base, sugar and phosphate modifications used in the active EGFR siRNA dimer were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as vehicle control. Treatment groups 1-3 and 4-6 were administered 1.0, 0.5 or 0.25 mg/kg (by weight of siRNA) according to the study design below. As described in Example 9, groups 1-3 contained the same targeting antibody, whereas groups 4-6 had different EGFR targeting antibodies, while the remainder of the conjugate components (linker, siRNA and PEG) were identical. Group 7 was administered an antibody conjugate with a negative control siRNA sequence (scrambled) as a control for group 1. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 25 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 25

siRNA concentrations were determined in the tumor and liver 96 hours after a single intravenous injection of 1.0, 0.5, and 0.25 mg/kg. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the tissue density was 1 g/mL. In Figure 53A, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As shown in Figure 53A, both antibody conjugates were able to deliver higher levels of siRNA to the tumor compared to the liver, and a dose response was observed. Compared to the EGFR2 antibody, the EGFR antibody conjugate was able to deliver more siRNA to tumor tissue at all doses tested. See Figure 53B. Both conjugates were capable of EGFR gene-specific mRNA knockdown at 96 hours after administration. Control conjugates containing scrambled siRNA and PBS vehicle control did not cause significant EGFR gene specific mRNA knockdown.

As highlighted in Figure 54, biological activity was demonstrated with A-X-B-Y-C conjugates with a variety of different antibodies and siRNA cargos capable of in vivo biological activity in a variety of different tissue targets. In this example, tumor-specific accumulation of two conjugates targeted with two different EGFR antibodies conjugated to siRNA designed to downregulate EGFR mRNA was demonstrated. HCC827 tumors express high levels of human EGFR and both conjugates have human-specific EGFR antibodies for targeting siRNA, resulting in tumor tissue-specific accumulation of the conjugates. Receptor-mediated uptake resulted in siRNA-mediated knockdown of the target gene.

Example 14: 2016 -PK-236- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were coupled to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as vehicle control. Treatment groups 1-3 were administered 1.0, 0.5, or 0.25 mg/kg (by weight of siRNA), and groups 4 and 5 were administered 1.0 mg/kg according to the study design below. As described in Example 9, groups 1-3 contained the same targeting antibody, whereas group 4 had a different EGFR targeting antibody, while the remainder of the conjugate components (linker, siRNA and PEG) were identical. Group 6 was administered an antibody conjugate with a negative control siRNA sequence (scrambled) as a control for group 5. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 26 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control.

Table 26

In this in vivo PD experiment, dose-dependent EGFR gene-specific mRNA knockdown (Figure 55) was demonstrated 96 hours after administration of a third example of an EGFR antibody targeting agent (EGFR3). Control conjugates containing scrambled siRNA and PBS vehicle control did not result in significant EGFR gene specific mRNA knockdown.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, tumor-specific downregulation of EGFR mRNA using a third EGFR antibody targeting ligand was demonstrated. HCC827 tumors express human EGFR, and both conjugates have human-specific EGFR antibodies (EGFR and EGFR3) for targeting siRNA, resulting in tumor tissue-specific accumulation of the conjugates. Receptor-mediated uptake resulted in siRNA-mediated knockdown of the target gene.

Example 15:2016 -PK-234- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand (5' to 3') was TCUCGUGCCUUGGCAAACUUU (SEQ ID NO: 2117) and was designed to be complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR. Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as vehicle control. Treatment groups 1-3, 4-6 and 7-9 were administered 1.0, 0.5 or 0.25 mg/kg (by weight of siRNA) according to the study design below. As described in Example 9, groups 1-3 contained the same targeting antibody (EGFR3) but groups 4-9 had different EGFR targeting antibodies, while the remainder of the conjugate components (linker, siRNA and PEG) were identical. . Groups 7-9 were administered antibody conjugates with a negative control siRNA sequence (scrambled) as a control for groups 1-6. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 27 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 27

siRNA concentrations were determined in the tumor and liver 96 hours after a single intravenous injection of 1.0, 0.5, and 0.25 mg/kg. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the tissue density was 1 g/mL. In Figure 56A, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As shown in Figure 56A, both antibody conjugates were able to deliver higher levels of siRNA to the tumor compared to the liver, and a dose response was observed. Both conjugates were capable of EGFR gene-specific mRNA knockdown at 96 hours after administration compared to the scramble and vehicle controls. See Figure 56B.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, tumor-specific accumulation of two conjugates targeted with two different EGFR antibodies conjugated to siRNA designed to downregulate EGFR mRNA was demonstrated. HCC827 tumors express high levels of human EGFR and both conjugates have human-specific EGFR antibodies for targeting siRNA, resulting in tumor tissue-specific accumulation of the conjugates. Receptor-mediated uptake resulted in siRNA-mediated knockdown of the target gene.

Example 16: 2016 -PK-237- HCC827

siRNA Design and synthesis

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human KRAS. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles of C6-SH at the 3' end, which were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-SH was linked via phosphodiester, see Example 9 for chemical structure. Additionally, the 5' end of the passenger strand had the inverted base removed and the antibody was conjugated directly to the amine on the passenger strand 5' end sugar on the T base using a procedure similar to Structure 2, Example 9. Please note.

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 1-3 were prepared and purified as DAR1 (n=1) using ASC construct-7 as described in Example 9.

Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as vehicle control. Treatment groups 1-3 and 4-6 were administered 1.0, 0.5 or 0.25 mg/kg (based on weight of siRNA) according to the study design below. As described in Example 9, groups 1-6 contained the same targeting antibody (EGFR), but groups 1-3 had siRNA designed to downregulate KRAS and groups 4-6 had siRNA designed to downregulate EGFR. It had siRNA. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 28 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay described in the Methods section. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve. Plasma concentrations of the antibody component of the conjugate were determined using an ELISA assay.

Table 28

siRNA concentrations were determined in the tumor and liver 96 hours after a single intravenous injection at 1.0, 0.5, and 0.25 mg/kg. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the tissue density was 1 g/mL. In Figures 57A and 57B, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As shown in Figures 57A and 57B, both antibody conjugates were able to deliver higher levels of siRNA to the tumor compared to the liver. Conjugates containing siRNA designed to down-regulate KRAS were capable of KRAS gene-specific mRNA knockdown (Figure 57C) at 96 hours post-administration compared to conjugates containing siRNA designed to down-regulate EGFR or the PBS vehicle control. Both antibody conjugate constructs had similar PK properties (see Figures 58A and 58B), indicating that the alternative conjugation strategy used on the 5' guide strand for the antibody did not affect this biological parameter.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, tumor-specific accumulation of EGFR antibodies conjugated to siRNA designed to downregulate KRAS mRNA and siRNA-mediated mRNA knockdown were demonstrated. HCC827 tumors express high levels of human EGFR and the conjugate has human-specific EGFR antibodies for targeting siRNA, resulting in tumor tissue-specific accumulation of the conjugate. Receptor-mediated uptake resulted in siRNA-mediated knockdown of the KRAS gene.

Example 17:2016 -PK-187- Hep3B

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank Hep-3B2 1-7 tumors 100-300 mm ³ volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate. On the other hand, control group 5 (n=5) of the same mice were administered one intravenous injection of PBS as a vehicle control group. Treatment groups 1-3 were administered 1.0, 0.5, or 0.25 mg/kg (based on the weight of siRNA) according to the study design below, and 1.0 mg/kg was administered to group 4 (scramble control group). Group 4 was administered an antibody conjugate with a negative control siRNA sequence (scrambled) as a control for group 1. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. Table 29 describes the study design in more detail. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 29

siRNA concentrations were determined in the tumor and liver 96 hours after a single intravenous injection of 1.0, 0.5, and 0.25 mg/kg. The tissue concentration was measured in pmol/g and then converted to pmol/mL assuming the tissue density was 1 g/mL. In Figure 59A, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As shown in Figure 59A, the antibody conjugate was able to deliver siRNA to the tumor. The conjugate was capable of EGFR gene specific mRNA knockdown (Figure 59B) at 96 hours post administration compared to conjugates containing negative control siRNA sequences or the PBS vehicle control.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, tumor-specific accumulation of EGFR antibodies conjugated to siRNA designed to downregulate EGFR mRNA and siRNA-mediated mRNA knockdown were demonstrated. Hep-3B2 1-7 tumor cells express human EGFR and the conjugate has human-specific EGFR antibodies for targeting siRNA, resulting in tumor tissue-specific accumulation of the conjugate. Receptor-mediated uptake resulted in siRNA-mediated knockdown of the EGFR gene.

Example 18: 2016 -PK-257-WT

siRNA Design and synthesis

R1442:N5-CTNNB1-3'S

CTNNB1: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human CTNNB1. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 1248 of the human mRNA transcript for CTNNB1 (UAAUGAGGACCUAUACUUAUU; SEQ ID NO. 2095). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

Antibody conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-1 as described in Example 9. The tri-GalNAc-CTNNB1 conjugate was prepared as described in Example 9.

in vivo study design

Groups 1-3 (n=4) of wild-type female CD-1 mice were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, and GalNAc targeted controls were administered by subcutaneous injection. Treatment groups 1-3 were administered doses of 2.0, 1.0 and 0.5 mg/kg (based on the weight of siRNA), and the GalNAc targeted control conjugate was administered 2 mg/kg. All groups were administered a dose volume of 5.0 mL/kg. Table 30 shows the study design in more detail. 50 mg pieces of liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control.

Table 30

CTNNB1 gene knockdown was determined 96 hours after administration. As shown in Figure 60, GalNac-conjugated siRNA was capable of gene specific knockdown after a single subcutaneous injection as well described by others in the art. The same siRNA conjugated to ASGR antibody was also capable of CTNNB1 gene-specific downregulation in a dose-dependent manner.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, hepatic delivery of ASGR antibody conjugated to siRNA designed to downregulate CTNNB1 mRNA was demonstrated. Mouse liver cells express asialoglycoprotein receptor (ASGR) and the conjugate carries a mouse-specific ASGR antibody for targeting siRNA, resulting in siRNA-mediated knockdown of CTNNB1 in the liver.

Example 19: 2016 -PK-253-WT

siRNA Design and synthesis

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human KRAS. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO. 2088). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

Antibody conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-1 as described in Example 9. The tri-GalNAc-CTNNB1 conjugate was prepared as described in Example 9.

in vivo study design

Groups 1-3 (n=4) of wild-type female CD-1 mice were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, and GalNAc targeted controls were administered by subcutaneous injection. Treatment groups 1-3 were administered doses of 2.0, 1.0, and 0.5 mg/kg (by weight of siRNA), and the GalNAc targeted control conjugate was administered at 2 mg/kg. All groups were administered a dose volume of 5.0 mL/kg. Table 31 shows the study design in more detail. 50 mg pieces of liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control.

Table 31

KRAS gene knockdown was determined 96 hours after administration. As shown in Figure 61, GalNac-conjugated siRNA was capable of gene specific knockdown after a single subcutaneous injection as well described by others in the art. The same siRNA conjugated to ASGR antibody was also capable of KRAS gene-specific downregulation in a dose-dependent manner.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, hepatic delivery of ASGR antibody conjugated to siRNA designed to downregulate KRAS mRNA was demonstrated. Mouse liver cells express asialoglycoprotein receptor (ASGR) and the conjugate had a mouse-specific ASGR antibody for targeting siRNA, resulting in siRNA-mediated knockdown of KRAS in the liver.

Example 20:2016 -PK-129-WT-Plasma

siRNA Design and synthesis

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human KRAS. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9.

in vivo study design

Groups (n=3) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 32 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 5, 30, and 180 minutes post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve. Plasma concentrations of antibodies were determined using an ELISA assay.

Table 32

In this in vivo PK experiment, the plasma clearance of two different conjugates was studied. As shown in Figure 62, both mAb-siRNA conjugates had comparable plasma PK compared to plasma levels of siRNA (KRAS vs. EGFR) or antibody (EGFR2 vs. PSMA).

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, it was demonstrated that two different conjugates with different antibody targeting ligands and different siRNA cargos have comparable plasma PK properties.

Example 21: 2016 -PK-123- LNCaP

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) or DAR2 (n=2) using ASC construct-1 as described in Example 9.

in vivo study design

A group of female SCID SHO mice (n=5) bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) ) was administered one intravenous injection of PBS as a vehicle control. Treatment groups were administered according to the study design in Table 33. All groups (treatment and control) were administered a dose volume of 5.71 mL/kg. Mice were sacrificed by CO ₂ asphyxiation 72 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 33

siRNA concentrations were determined in tumor and liver 72 hours after a single intravenous injection, see Figure 63A. As shown in Figure 63A, antibody conjugates with a drug-to-antibody ratio of 1 (n=1) were able to deliver siRNA to the tumor in a dose-dependent manner, at levels greater than those measured in the liver, scrambled and PBS. It caused EGFR gene-specific mRNA knockdown compared to the control group. This is in contrast to antibody conjugates with a drug-to-antibody ratio of 2 (n=2), which achieved lower concentrations of siRNA in tumors at equivalent doses, liver and tumor concentrations of the same size, and lower levels of EGFR knockdown. Unconjugated siRNA had poor tumor and liver accumulation and no measurable EGFR mRNA knockdown. Figure 63B depicts the relative proportions of EGFR mRNA in LNCaP tumors.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, it was demonstrated that DAR1 conjugates can achieve greater siRNA tumor concentrations compared to DAR 2 and unconjugated siRNA. Additionally, DAR1 conjugates can achieve higher levels of siRNA-mediated knockdown of EGFR compared to DAR 2 and unconjugated siRNA.

Example 22: 2016 -PK-258-WT

siRNA Design and synthesis

HPRT: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human HPRT. The sequence of the guide/antisense strand was AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2102) and was designed to be complementary to the gene sequence starting at base position 425 of the human mRNA transcript for HPRT. Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). The same base, sugar and phosphate modifications used in the active EGFR siRNA dimer were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates in groups 1-3 and 7-9 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9. Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9.

in vivo study design

A group of wild-type female CD-1 mice (n=4) were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=4) were treated with one intravenous injection of PBS as a vehicle control. I administered my injection. Table 34 shows the study design in more detail. A 50 mg piece of tissue was collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 34

As shown in Figures 64A-64C, dose-dependent knockdown of HPRT was measured in heart muscle, gastrointestinal skeletal muscle, and liver following a single intravenous administration of ASC. There was no measurable knockdown of HPRT in lung tissue (Figure 64D). Additionally, dose-dependent accumulation of siRNA was observed in all four tissue compartments (Figure 64E). There was no significant difference in biological activity (KD and tissue concentration) between lysine and cysteine conjugates.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, it was demonstrated that anti-B cell antibodies can be used to target siRNA to cardiac muscle, gastrointestinal skeletal muscle, and liver and achieve gene-specific downregulation of the reporter gene HPRT. There was no measurable difference in the biological activity of the ASC construct when lysine or cysteine conjugation strategies were used to attach the antibody.

Example 23: 2016 -PK-254-WT

siRNA Design and synthesis

HPRT: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human HPRT. The sequence of the guide/antisense strand was AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2102) and was designed to be complementary to the gene sequence starting at base position 425 of the human mRNA transcript for HPRT. Base, sugar and phosphate modifications, which are widely described in the field of RNAi, were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). The same base, sugar and phosphate modifications used in the active EGFR siRNA dimer were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

A group of wild-type female CD-1 mice (n=4) were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) were treated with one intravenous injection of PBS as a vehicle control. I administered my injection. Table 35 shows the study design in more detail. 50 mg pieces of tissue were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 35

As shown in Figures 65A-65C, dose-dependent knockdown of HPRT was measured in heart muscle, gastrointestinal skeletal muscle, and liver following a single intravenous administration of ASCs containing anti-B cell Fab targeting ligands. There was no measurable knockdown of HPRT in lung tissue (Figure 65D). Additionally, dose-dependent accumulation of siRNA was observed in all four tissue compartments (Figure 65E).

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, it was demonstrated that anti-B cell Fab was used to target siRNA to cardiac muscle, gastrointestinal skeletal muscle and liver and achieve gene specific downregulation of the reporter gene HPRT.

Example 24:2016 -PK-245-WT

siRNA Design and synthesis

CTNNB1: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human CTNNB1. The sequence of the guide/antisense strand was TUUCGAAUCAAUCCAACAGUU (SEQ ID NO: 2096) and was designed to target the gene sequence starting at base position 1797 of the human mRNA transcript for CTNNB1. Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 3-4 were prepared and purified as DAR1 (n=1) using ASC construct-4 as described in Example 9. Conjugates of group 1-2 were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9.

in vivo study design

A group of wild-type female CD-1 mice (n=4) were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) were treated with one intravenous injection of PBS as a vehicle control. I administered my injection. Table 36 shows the study design in more detail. 50 mg pieces of tissue were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 36

As shown in Figures 66A and 66B, a single intravenous administration of ASCs containing an anti-B cell antibody targeting ligand (anti-B cell-Ab) results in HPRT knockdown and dose-dependent tissue siRNA accumulation in cardiac muscle. It has been done. As shown in Figures 66C and 66D, a single intravenous administration of ASCs containing anti-B cell antibody targeting ligands resulted in HPRT knockdown and dose-dependent tissue siRNA accumulation in gastrointestinal skeletal muscle. There was no significant difference in biological activity (KD and tissue concentration) between lysine and cysteine conjugates.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, it was demonstrated that anti-B cell antibodies were used to target siRNA to cardiac muscle and gastrointestinal skeletal muscle and achieve gene-specific downregulation of CTNNB1 mRNA.

Example 25:2016 -PK-160- LNCaP

siRNA Design and synthesis

AR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human AR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 2822 of the human mRNA transcript for AR (guide strand sequence: GAGAGCUCCAUAGUGACACUU; SEQ ID NO. 2108). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9.

in vivo study design

A group of female SCID SHO mice (n=5) bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) ) was administered one intravenous injection of PBS as a vehicle control. The table below describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 37

As shown in Figure 67A, after a single intravenous administration of ASCs containing a PSMA antibody targeting ligand and siRNA designed to downregulate AR, AR knockdown was induced in LNCaP tumor tissue at all doses tested compared to scrambled controls. It has been done. As shown in Figure 67B, there was measurable accumulation of siRNA in tumor tissue at higher levels than measured in liver tissue.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, delivery of PSMA antibody conjugated to siRNA designed to downregulate AR mRNA to LNCaP prostate tumors was demonstrated. LNCaP cells express human PSMA on the cell surface, and the conjugate carries a human-specific PSMA antibody that binds to the antigen and allows internalization of the siRNA, resulting in siRNA-mediated knockdown of AR in tumor tissue.

Example 26: In B cells in vitro absorption and knockdown

siRNA Design and synthesis

HPRT: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human HPRT. The sequence of the guide/antisense strand was AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2102) and was designed to be complementary to the gene sequence starting at base position 425 of the human mRNA transcript for HPRT. Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vitro study design

Mouse spleens were harvested and maintained in PBS with 100 u/ml penicillin and streptomycin on ice. Spleens were crushed on clean glass slides, cut into small pieces, homogenized with an 18G needle, and filtered (70 um nylon membrane). Dead cells were removed with Milteny biotec's dead cell removal kit (Catalog#130-090101) according to the manufacturer's instructions. To isolate mouse B cells, the B cell isolation kit Milteny biotec (Catalog# 130-090-862) was used according to the manufacturer's instructions. Briefly, live spleen cells were resuspended in 200 μl of MACS buffer per mouse spleen. Non-B cells were depleted with biotin-conjugated monoclonal antibodies against CD43 (Ly48), CD4, and Ter-119, coupled with anti-biotin magnetic microbeads. From one mouse spleen, 30 million viable B cells can be obtained. To activate isolated mouse B cells ( ^2x106 /ml in 10%FBS RPMI-1640 with 100 u/ml penicillin and streptomycin), 10μg/ml LPS, 5μg/ml anti-IgM, 1μg/ml anti- A cocktail of CD40, 0.05 μg/ml IL-4, and 0.05 μg/ml INFγ was added. After 4 hours of activation, ASC (1 pM to 10 nM) was added to 10 ⁶ cells per well in 24 (0.5 ml medium) or 12 (1 ml medium) well plates. After 48 hours of ASC treatment, cells were harvested and isolated RNA was analyzed for mRNA knockdown.

Table 38

In this in vitro experiment in activated primary mouse B cells, the ability of anti-B cell antibodies and Fab ASCs to deliver siRNA designed to downregulate hypoxanthine-guanine phosphoribosyltransferase (HPRT) was measured. As shown in Figure 68A, Fab conjugates were able to downregulate HPRT compared to vehicle or scramble controls. As shown in Figure 68B, the antibody conjugate was able to downregulate HPRT compared to antibody, vehicle, and scramble controls.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, delivery of mouse anti-B cell antibody or anti-B cell Fab conjugated to siRNA designed to downregulate HPRT mRNA to activated mouse B cells was demonstrated. Activated mouse B cells recognized and internalized the antibody-siRNA conjugate through surface receptors that recognize anti-B cell antibodies, resulting in siRNA-mediated knockdown of HPRT.

Example 27:2016 -PK-249-WT

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of Group 1-2 were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9. Conjugates of groups 3-4 were prepared and purified as DAR2 (n=2) using ASC structure-4 as described in Example 9. Conjugates of groups 5-6 were prepared and purified as DAR1 (n=1) using ASC structure-5 as described in Example 9. Conjugates of groups 7-8 were prepared and purified as DAR2 (n=2) using ASC structure-5 as described in Example 9. Conjugates of groups 9-10 were prepared and purified as DAR1 (n=1) using ASC construct-6 as described in Example 9. Conjugates of groups 11-12 were prepared and purified as DAR2 (n=2) using ASC structure-6 as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate (groups 1-12) or antibody alone (groups 13-14). Table 39 depicts the study design. Nasal blood samples were collected via puncture of the retro-orbital plexus at 0.25 and 3 hours post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24 and 72 hours after administration. Peripheral blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve. Plasma concentrations of antibodies were determined using an ELISA assay.

Table 39

In this in vivo PK study, the utility of site-specific conjugation was demonstrated. As shown in Figure 69A, the DAR1 (n=1) test article (Group 9) had a comparable siRNA plasma clearance profile to the two controls (Groups 1 and 5), with approximately 10% of the siRNA being cleared after 168 hours. remained in the plasma. All DAR2 (n=2) conjugates had significantly faster clearance of siRNA from plasma compared to DAR1 conjugates. As shown in Figure 69B, the DAR1 (n=1) test article (Group 9) had a comparable EGFR-Ab plasma clearance profile to the two controls (Groups 1 and 5). All DAR2 (n=2) conjugates had a significantly faster clearance of antibody from plasma compared to DAR1 conjugates.

In the above example, the use of the lysine and cysteine conjugation strategy to attach siRNA to antibodies was demonstrated. In this example, the utility of the site-specific conjugation strategy is demonstrated and the conjugate has comparable PK properties to the non-specific conjugation strategy.

Example 28:2016 -PK-180- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100–300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as vehicle control. Table 40 describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of plasma and tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma and tissue concentrations using a linear equation derived from the standard curve.

Table 40

In this in vivo PK study, replacement of the SMCC linker between the antibody and siRNA with an enzymatically cleavable linker and introduction of a cleavable disulfide linker between siRNA and PEG, or a combination of both, were tested. As shown in Figure 70A, all linker combinations were capable of EGFR mRNA knockdown in HCC827 tumor cells compared to the scrambled control. As shown in Figure 70B, all linker combinations resulted in comparable siRNA tissue accumulation in tumor and liver. As shown in Figure 70C, all conjugates were able to maintain high levels of siRNA in plasma, with approximately 10% remaining in plasma after 168 hours.

In this AXBYC example, it was demonstrated that different linker combinations (“X” and/or “Y”) can be used to conjugate siRNA to antibodies and PEG.

Example 29: 2016 -PK-162- LNCaP

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 for the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups 1-7 (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of 8 identical mice. (n=5) were administered one intravenous injection of PBS as a vehicle control. The table below describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 41

In this in vivo PK study, disulfide (SS), enzymatically cleavable (ECL), or SMCC linkers were used between the antibody and siRNA. As shown in Graph 1 on slide 42, tumor tissue accumulation of siRNA was reduced when a cleavable disulfide linker was used instead of an ECL or SMCC linker. As shown in Graph 2 on slide 42, the ECL linker strategy resulted in EGFR mRNA knockdown in LNCaP tumor cells compared to scrambled controls. However, the SS linker failed to cause EGFR mRNA knockdown in LNCaP tumor cells compared to scrambled controls. In addition to these linker experiments, the feasibility of storing ASCs at -80°C was investigated. The preparation was rapidly frozen in liquid nitrogen at an antibody concentration of 5 mg/ml, stored at -80°C for 30 days, thawed at room temperature, and diluted to the desired dosage concentration before administration. As shown in Graph 3 on slide 42, constructs stored at -80°C and thawed prior to administration maintained the ability to cause EGFR mRNA knockdown in LNCaP tumor cells compared to scrambled controls.

In this AXBYC example, it was demonstrated that an ECL linker (“X”) can be used to conjugate antibodies to siRNA and that ASCs can be stored at -80°C for 1 month and thawed prior to administration.

Example 30: 2016 -PK-181- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications, well described in the field of RNAi, were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as a vehicle control. Table 42 describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the Methods section. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to tissue concentration using a linear equation derived from the standard curve.

Table 42

In this in vivo PK study, a disulfide or SMCC linker was used between the antibody and siRNA. As shown in Figure 72A, tumor tissue accumulation of siRNA was reduced when a cleavable disulfide linker was used instead of the more stable SMCC linker. As shown in Figure 72B, both linker strategies were able to result in EGFR mRNA knockdown in HCC827 tumor cells compared to scrambled controls.

In this AXBYC example, the use of a cleavable disulfide linker (“X”) between an antibody and siRNA is demonstrated.

Example 31: 2016 -PK-220-WT

siRNA Design and synthesis

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human KRAS. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (guide strand sequence: UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO. 2088). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 43 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 5, 30, and 180 minutes post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve. Plasma concentrations of antibodies were determined using an ELISA assay.

Table 43

In this in vivo PK study, different disulfide linkers with varying degrees of steric hindrance were studied to understand how disulfide cleavage rate affects ASC plasma PK. As shown in Figure 73A, the rate of clearance of siRNA from plasma was modulated by varying the degree of steric hindrance of the disulfide linker. Figure 73B depicts the clearance of antibody zalutumumab from plasma.

In this example, the biological activity of a variety of different AXBYC conjugates in which a variety of different disulfide linkers (“X”) can be used to conjugate siRNA to antibodies was demonstrated.

Example 32: 2016 -PK-256-WT

siRNA Design and synthesis

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human KRAS. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (guide strand sequence: UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO. 2088). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 44 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 0.25, 3, and 24 hours post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 72, 96, or 168 hours after administration. Peripheral blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve. Plasma concentrations of antibodies were determined using an ELISA assay.

Table 44

In this in vivo PK study, a variety of different linkers between antibody and siRNA were tested to determine their effect on plasma clearance. As shown in the graph on slide 45, all conjugates were able to maintain high levels of siRNA in plasma, with >10% remaining in plasma after 168 hours.

In this example, the biological activity of a variety of different AXBYC conjugates in which a variety of different linkers (“Y”) can be used to conjugate siRNA to an antibody while maintaining improved plasma kinetics over those historically observed for unconjugated siRNA. It has been proven.

Example 33:2016 -PK-237- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (guide strand sequence: ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA.

Two different passenger strands were prepared containing two conjugation handles (C6-NH ₂ and C6-SH) in two different orientations (S5'-EGFR-3'N and N5'-EGFR-3'S). In the N5'-EGFR-3'S passenger strand, both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure. In the S5'-EGFR-3'N passenger strand, both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 1-3 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9. Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC structure-2 as described in Example 9.

in vivo study design

Groups (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100–300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas one group of the same mice Control groups (n=5) were administered one intravenous injection of PBS as vehicle control. Table 45 describes the study design. Mice were sacrificed by CO ₂ asphyxiation at 72, 96, and 168 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue and plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 45

In this in vivo PK study, the biological consequences of changes in the orientation of antibodies and PEG (5' or 3') on siRNA were assessed. Additionally, the biological consequences of using lysine or cysteine to attach the linker to the antibody were evaluated. As shown in Figure 75A, both orientations of siRNA resulted in comparable EGFR tumor knockdown. As shown in Figures 75B and 75C, both orientations resulted in comparable siRNA tissue accumulation in tumor and liver. As shown in Figure 75D, the two orientations result in comparable plasma removal kinetics.

As highlighted in Figure 54, the biological activity of A-X-B-Y-C conjugates with a variety of different antibody and siRNA cargos was demonstrated, capable of in vivo biological activity in a variety of different tissue targets. In this example, it was demonstrated that antibodies can be conjugated on the 5' and 3' ends of the passenger strand of EGFR siRNA while maintaining the biological activity and tissue distribution of the siRNA.

Example 34:2016 -PK-259-WT

siRNA Design and synthesis

HPRT: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human HPRT. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 425 of the human mRNA transcript for HPRT (guide strand sequence: UUAAAAUCUACAGUCAUAGUU; SEQ ID NO. 2104). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. Two different passenger strands were prepared containing two conjugation handles (C6-NH ₂ and C6-SH) in two different orientations (S5'-HPRT-3'N and N5'-HPRT-3'S). Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 1-3 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9. Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC structure-2 as described in Example 9. Conjugates of groups 7-9 were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9. Conjugates of Group 10-12 were prepared and purified as DAR1 (n=1) using ASC Structure-3 as described in Example 9.

in vivo study design

A group of wild-type female CD-1 mice (n=4) were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) were treated with one intravenous injection of PBS as a vehicle control. I administered my injection. Table 46 shows the study design in more detail. 50 mg pieces of tissue were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 46

In in vivo PK studies, the biological consequences of changes in the orientation of the conjugation site of antibody and PEG (5' or 3') on siRNA were evaluated. Additionally, the biological consequences of using lysine or cysteine to attach the linker to the antibody were evaluated. As shown in Figure 76A-Figure 76D, all combinations of making antibody conjugates resulted in comparable HPRT knockdown in the four tissue compartments measured. As shown in Figures 77A-77D, all combinations of making antibody conjugates resulted in comparable siRNA tissue accumulation in the different compartments measured.

In this example, it was demonstrated that a variety of different conjugation strategies for siRNA and antibodies can be used in the A-X-B-Y-C format while maintaining the biological activity and tissue distribution of HPRT siRNA.

Example 35:2016 -PK-267-WT

siRNA Design and synthesis

CTNNB1: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human CTNNB1. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 1797 of the human mRNA transcript for CTNNB1 (guide strand sequence: UUUCGAAUCAAUCCAACAGUU; SEQ ID NO. 2098). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA.

Two different passenger strands were prepared containing two conjugation handles (C6-NH ₂ and C6-SH) in two different orientations (S5'-CTNNB1-3'N and N5'-CTNNB1-3'S). Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 1-3 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9. Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC structure-3 as described in Example 9. Conjugates of groups 7-9 were prepared and purified as DAR1 (n=1) using ASC structure-2 as described in Example 9. Conjugates of group 10-12 were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9.

in vivo study design

A group of wild-type female CD-1 mice (n=4) were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n=5) were treated with one intravenous injection of PBS as a vehicle control. I administered my injection. Table 47 shows the study design in more detail. 50 mg pieces of tissue were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control.

Table 47

In this in vivo PK study, the biological consequences of changes in the orientation of the conjugation site of the antibody and PEG (5' or 3') on the siRNA and of using lysine or cysteine to attach the linker to the antibody were evaluated. As shown in Figure 78A-Figure 78D, all combinations of making antibody conjugates resulted in comparable CTNNB1 knockdown in the four tissue compartments measured.

In this example, it was demonstrated that a variety of different conjugation strategies for siRNA and antibodies can be used in the A-X-B-Y-C format while maintaining the biological activity of CTNNB1 siRNA.

Example 36: 2016 -PK-188-PK

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 48 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 5, 30, and 180 minutes post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 48

As shown in Figure 79, all ASCs with different cleavable linker configurations achieved equivalent plasma PK profiles, with approximately 10% of the siRNA remaining at 168 hours post administration.

In this example, the biological activity of various A-X-B-Y-C conjugates was demonstrated where a variety of different linker strategies (components X and Y) were used to conjugate PEG and antibody to the siRNA passenger strand.

Example 37:2016 -PK-201- LNCaP

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups 1-7 (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of 8 identical mice. (n=5) were administered one intravenous injection of PBS as a vehicle control. Table 49 describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 49

As shown in Figure 80A, a variety of different linkers were used between siRNA and PEG, and following intravenous administration of a single dose of siRNA, measurable tumor tissue EGFR downregulation was achieved compared to negative control siRNA sequences or PBS controls. Additionally, as shown in Figure 80B, different linker configurations resulted in tumor siRNA accumulation at higher levels than the other tissue samples measured (liver, spleen, lung, and kidney).

In this example, the biological activity of various A-X-B-Y-C conjugates was demonstrated where a variety of different linker strategies (component Y) were used to conjugate PEG to the siRNA passenger strand.

Example 38:2016 -PK-198- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which was comparable to that used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups 1-15 (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate; A control group of 16 (n=5) of the same mice was administered one intravenous injection of PBS as a vehicle control group. Table 50 describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 50

As shown in Figure 81A, all ASCs with different arrangements of linear PEG lengths achieved dose-dependent EGFR mRNA knockdown in HCC827 tumor cells compared to negative control siRNA sequences (scrambled) and PBS controls. As shown in Figure 81B, all ASCs with different configurations in linear PEG length achieved equivalent dose-dependent siRNA tumor tissue accumulation, in addition to lower liver, lung, kidney and spleen accumulation compared to tumor.

In this example, the biological activity of various A-X-B-Y-C conjugates using a variety of different PEG (component C) lengths was demonstrated.

Example 39: 2016 -PK-194-WT

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 51 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 5, 30, and 180 minutes post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 51

As shown in slide 54, all ASCs with different linear PEG lengths achieved equivalent plasma PK profiles, with approximately 10% of the siRNA remaining at 168 hours post administration.

In this example, equivalent plasma PK properties of various A-X-B-Y-C conjugates using a variety of different PEG (component C) lengths were demonstrated.

Example 40: 2016 -PK-195-WT

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 52 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 5, 30, and 180 minutes post administration and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 96, or 168 hours after administration. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. Plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 52

As shown in Figure 83, all ASCs with different PEG configurations (length and branching) achieved equivalent plasma PK profiles, with approximately 10% of the siRNA remaining at 168 hours post administration.

In this example, equivalent plasma PK properties of various A-X-B-Y-C conjugates using a variety of different PEG (component C) lengths and branches were demonstrated.

Example 41:2016 -PK-236- HCC827

siRNA Design and synthesis

EFGR: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting at base position 333 of the human mRNA transcript for EGFR (ACUCGUGCCUUGGCAAACUUU; SEQ ID NO. 2082). Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphorothioate-inverted base-phosphorothioate linker, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity, which were equivalent to those used in active siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

All conjugates were prepared and purified as DAR1 (n=1) using ASC Structure-4 as described in Example 9.

in vivo study design

Groups 1-12 (n=5) of female NCr nu/nu mice bearing subcutaneous (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate; A control group of 13 (n=5) of the same mice was administered one intravenous injection of PBS as a vehicle control group. Table 53 describes the study design. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor and liver were collected and snap frozen in liquid nitrogen. mRNA knockdown in target tissues was determined using comparative qPCR analysis as described in Example 2. Total RNA was extracted from tissues, reverse transcribed, and mRNA levels were quantified using TaqMan qPCR using appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, and the results were calculated by the comparative Ct method, which calculates the difference (△Ct) between the target gene Ct value and the PPIB Ct value, and then calculated the quadratic difference (△△Ct ) were taken and further normalized to the PBS control. Quantification of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of siRNA was reverse transcribed using the TaqMan MicroRNA Reverse Transcription Kit using sequence-specific stem-loop RT primers. Then, cDNA from the RT step was used for real-time PCR, and Ct values were converted to plasma or tissue concentrations using a linear equation derived from the standard curve.

Table 53

As shown in Figure 84, all ASCs with different arrangements of PEG (length and branching) achieved equivalent EGFR mRNA knockdown in HCC827 tumor cells as the construct with linear PEG5K at a dose of 1 mg/kg. The construct, tested in a dose response format, showed dose-dependent knockdown of EGFR mRNA. As shown in Figure 85, all ASCs with different changes in linear PEG length and PEG branching achieved comparable siRNA tumor tissue accumulation as constructs with linear PEG5K at a dose of 1 mg/kg. In addition to low liver accumulation compared to tumor, the construct, tested in a dose response format, showed dose-dependent tumor tissue accumulation of siRNA.

In this example, the biological activity of various A-X-B-Y-C conjugates using a variety of different PEG (component C) lengths and branches was demonstrated.

Example 42: with PEG polymer ASC used in vitro knockdown

siRNA Design and synthesis

HPRT: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human HPRT. The sequence of the guide/antisense strand was AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2082) and was designed to be complementary to the gene sequence starting at base position 425 of the human mRNA transcript for HPRT. Base, sugar and phosphate modifications were used to optimize the efficacy of the dimer and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphorothioate linker. C6-NH ₂ and C6-SH were linked through phosphodiester, see Example 9 for chemical structure.

Negative control siRNA sequence (scrambled): using a published 21-mer dimer with 19 complementary bases and a 3' dinucleotide overhang (Burke et al. (2014) Pharm. Res., 31(12):3445-60) did. The sequence of the guide/antisense strand (5' to 3') was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). The same base, sugar and phosphate modifications used in the active EGFR siRNA dimer were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two splice handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 1-3 were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9. Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9.

in vitro study design

Mouse spleens were harvested and maintained in PBS with 100 u/ml penicillin and streptomycin on ice. Spleens were crushed on clean glass slides, cut into small pieces, homogenized with an 18G needle, and filtered (70 um nylon membrane). Dead cells were removed with Milteny biotec's dead cell removal kit (Catalog#130-090101) according to the manufacturer's instructions. To isolate mouse B cells, the B cell isolation kit Milteny biotec (Catalog# 130-090-862) was used according to the manufacturer's instructions. Briefly, live spleen cells were resuspended in 200 μl of MACS buffer per mouse spleen. Non-B cells were depleted with biotin-conjugated monoclonal antibodies against CD43 (Ly48), CD4, and Ter-119, coupled with anti-biotin magnetic microbeads. From one mouse spleen, 30 million viable B cells can be obtained. To activate isolated mouse B cells ( ^2x106 /ml in 10%FBS RPMI-1640 with 100 u/ml penicillin and streptomycin), 10μg/ml LPS, 5μg/ml anti-IgM, 1μg/ml anti- A cocktail of CD40, 0.05 μg/ml IL-4, and 0.05 μg/ml INFγ was added. After 4 hours of activation, ASC (1 pM to 10 nM) was added to 10 ⁶ cells per well in 24 (0.5 ml medium) or 12 (1 ml medium) well plates. After 48 hours of ASC treatment, cells were harvested and isolated RNA was analyzed for mRNA knockdown. See Table 54 for study design.

Table 54

In this in vitro experiment in activated primary mouse B cells, anti-B cell antibodies delivering siRNA designed to downregulate hypoxanthine-guanine phosphoribosyltransferase (HPRT) with various alternative PEG polymers were used in ASCs. Ability was measured. As shown in Figure 86, various ASCs with alternative PEG were able to downregulate HPRT compared to the scramble control.

In this example, the biological activity of various A-X-B-Y-C conjugates using various polymer alternatives to PEG (component C) was demonstrated.

Example 43: PK-236-WT

siRNA Design and synthesis

KRAS: A 21-mer dimer with complementary 19 bases and a 3' dinucleotide overhang was designed for human KRAS. The sequence of the guide/antisense strand was complementary to the gene starting at base position 237 of the human mRNA transcript for KRAS (guide strand sequence: UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO. 2088). Base, sugar and phosphate modifications, which are well described in the field of RNAi, were used to optimize the efficacy of the dimer and reduce its immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phosphoramidite chemistry and purified by HPLC. The base at position 11 on the passenger strand had a Cy5 fluorescent label attached as described in Example 9. The purified single strand was dimerized to obtain double-stranded siRNA. The passenger strand contained two conjugation handles: C6-NH ₂ at the 5' end and C6-SH at the 3' end. Both conjugation handles were linked to the siRNA passenger strand via a phosphodiester-inverted base-phosphodiester linker, see Example 9 for chemical structure.

ASC Synthesis and characterization

Conjugates of groups 1-3 were prepared and purified as DAR1 (n=1) using ASC structure-4 as described in Example 9. Conjugates of groups 4-6 were prepared and purified as DAR1 (n=1) using ASC structure-4, but without PEG at the 3' end of the passenger strand. Before conjugation, the 3'thiol was end-capped using N-ethylmaleimide. Conjugates of groups 7-9 were prepared and purified as DAR1 (n=1) using ASC construct-1 as described in Example 9. Conjugates of group 10-12 were prepared and purified as DAR1 (n=1) using ASC structure-1, but without PEG at the 5' end of the passenger strand.

in vivo study design

Groups (n=4) of wild-type female CD-1 mice were treated with one intravenous (iv) tail vein injection of siRNA conjugate. 0.5 mg/kg (by weight of siRNA) was administered to the treatment group, and a dose volume of 5.0 mL/kg was administered to all groups. Table 55 shows the study design in more detail. Nasal blood samples were collected via puncture of the retro-orbital plexus at 0.25, 1, and 4 hours post-dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 24, 48, or 72 hours after administration. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis.

Plasma samples (K2 EDTA) were processed within 4 hours of collection. Plasma samples were diluted with matched mouse plasma (Bioreclamation) (2-400-fold), and the concentration of CY5-siRNA in these plasma samples was determined spectroscopically using a TECAN Infinite M200 Pro (Excitation 635 nm; Emission 675 nm). Quantified. To release macromolecular interactions that can capture CY5 fluorescence, all samples were diluted two-fold with water containing 0.01% Tween 20 and 100 ug/ml heparin before quantification. To determine the amount of intact ASCs in these plasma samples, plasma samples were diluted with 2–50 nM CY5-siRNA with mouse plasma and incubated with Protein G Dynabeads (Thermofisher) loaded with 150 nM of purified EGFR-Fc protein (Sino Biological). ) was cultured with. This binding reaction was incubated for 1 hour at room temperature. The beads were washed twice with PBS containing 0.01% Tween 20 and 0.05% BSA, and then ASC bound to EGFR were eluted by incubation in 0.1 M citric acid (pH 2.7). The amount of CY5-siRNA contained in the input, unbound fraction, wash, and bead eluate was quantified by fluorescence as described above.

Table 55

In this in vivo PK study, the in vivo plasma stability of two AXBYC conjugates (cysteine and lysine conjugates to EGFR-Ab) was compared compared to two AXB conjugates. As shown in Figure 87, the concentration of siRNA was determined using two methods. The fluorescence of plasma was measured directly, and the siRNA concentration was determined using a standard curve. Alternatively, magnetic beads decorated with EGFR were used to bind the antibody conjugate, then the fluorescence of the sample was measured, and the siRNA concentration was determined using a standard curve. All data were plotted as percentage of injected dose. In two examples of AXBYC conjugates (cysteine and lysine conjugates to EGFR-Ab), improved plasma PK was observed compared to the corresponding AXB conjugates.

In this example, in vivo plasma PK for Cys and Lys AXBYC conjugates compared to the matched control AXB conjugate was demonstrated.

Example 44: Cholesterol- KRAS of conjugate (PD-058) in vivo Pharmacodynamics research

One week after inoculation, groups (n=5) of female NCr nu/nu mice bearing intrahepatic Hep 3B tumors were treated with three intravenous (iv) tail vein injections (separated 48 hours apart) of cholesterol-siRNA conjugate. , a control group of the same mice (n=5) was administered three intravenous injections of PBS as vehicle control with the same dosing schedule. The treatment group administered chol-KRAS was administered 10, 4, or 2 mg/kg. All groups (treatment and control) were administered a dose volume of 6.25 mL/kg. Table 56 describes the study design in more detail and provides cross-references to conjugate synthesis and characterization. Mice were sacrificed by CO ₂ asphyxiation 72 hours after the final dose. 50 mg pieces of tumor-bearing liver were collected and snap frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantification were performed as described in Examples 2-7.

Table 56. Study design for cholesterol-KRAS conjugate (PD-058) with cross-reference to synthesis and characterization of tested conjugates.

The chol-KRAS conjugate was evaluated for mRNA knockdown in a 3-dose study with a dose response. As shown in Figure 35, there was a clear dose-response for mouse KRAS mRNA knockdown in mouse liver tissue. The lowest dose of 2 mg/kg resulted in a 45% knockdown of mouse KRAS, while the highest dose of 10 mg/kg resulted in a 65% knockdown of mice in this 3-dose format. However, there were not enough human tumor cells present in the mouse liver at the time of collection to detect a signal from human KRAS (potentially due to model development issues, it appears that insufficient human cells were inoculated to produce rapidly growing tumors). ). As such, knockdown could not be measured in tumors.

Example 45: Cholesterol- siRNA of conjugate (PK-063) in vivo Pharmacokinetics research

Groups (n=3) of wild-type female CD-1 mice were treated with one or two intravenous (iv) tail vein injections of chol-siRNA conjugate. The treatment group was administered chol-KRAS at 10 mg/kg (based on the weight of siRNA), and the two-dose group was administered the second dose 48 hours after the first dose. All groups were administered a dose volume of 6.25 mL/kg. Table 57 depicts the study design in more detail and provides cross-references to conjugate synthesis and characterization. Nasal blood samples were collected via puncture of the retro-orbital plexus at 2, 15, 60, or 120 minutes after the final dose and centrifuged to generate plasma for PK analysis. Mice were sacrificed by CO ₂ asphyxiation at 4, 24, 96, or 144 hours after the final dose. Extremity blood samples were collected via cardiac puncture and pressurized to generate plasma for PK analysis. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantification were performed as described in Examples 2-7.

Table 57. Study design for cholesterol-siRNA conjugate (PK-063) with cross-reference to synthesis and characterization of tested conjugates.

The pharmacokinetic behavior of chol-siRNA was evaluated in a single-dose format compared to a two-dose format. As shown in Figure 36, the plasma PK profiles for the first dose and the second dose 48 hours later are nearly identical. The elimination mechanisms from plasma are not saturated from the first dose and the second dose behaves similarly. Tissue PK for three major tissues (liver, kidney, and lung) was assessed similarly. As shown in Figure 37, chol-KRAS was delivered at the highest concentration to the liver, with kidneys and lungs having approximately 10-fold lower siRNA concentrations compared to the liver. For all three tissues, the siRNA concentration after the second dose was higher than the siRNA concentration after the first dose, demonstrating that there was accumulation of siRNA in the tissue when the doses of chol-siRNA were 48 hours apart.

In vivo studies cholesterol- siRNA conjugate ( PK-067). A group of female NCr nu/nu mice (n=3) bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n= 4) was administered one intravenous injection of PBS as a vehicle control. The treatment group administered the cholesterol-siRNA conjugate was administered 5 mg/kg (based on the weight of siRNA). Some treatment groups were also administered cholesterol-peptide conjugates at a specific molar peptide:siRNA ratio, where all chol-siRNA and chol-peptide conjugates were mixed together in solution and co-injected. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Table 58 presents the study design in more detail and provides cross-references to conjugate synthesis and characterization. Mice were sacrificed by CO ₂ asphyxiation at 24, 72, or 144 hours after administration. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantification were performed as described in Examples 2-7.

Table 58. Study design for cholesterol-siRNA conjugate (PK-067) with cross-references to conjugate synthesis and characterization.

Endosomal degradable moieties (EEPs) such as INF7 and melittin were conjugated to cholesterol, mixed with chol-siRNA, and co-injected into mice to demonstrate increased siRNA efficacy due to improved endosomal escape. First, the effect of EEF addition on siRNA concentration in various tissues was evaluated. As shown in Figure 38A, addition of chol-INF7 at any molar ratio of EEP:siRNA did not affect siRNA tumor PK. However, as shown in Figure 38B, addition of chol-melittin at a 1:1 ratio did not affect tumor PK, but addition of chol-melittin at a 3:1 EEP:siRNA ratio increased the amount of siRNA in the tumor. decreased. As shown in Figure 39, chol-INF7 or chol-melittin did not have much effect on liver PK. Similarly, as shown in Figures 40 and 41, chol-INF7 and chol-melittin also did not have much effect on the PK profile in kidney and lung. Finally, the effect of the chol-EEP conjugate on mRNA KD was assessed, and as shown in Figure 42, the basal level of knockdown for chol-KRAS alone was approximately 50%. Addition of 1:1 chol-melittin or 3:1 chol-INF7 improved knockdown at each time point, due to improved endosomal escape.

In vivo studies cholesterol- siRNA conjugate (PK-076). Groups (n=5) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with three intravenous (iv) tail vein injections, separated by 48 hours, whereas those of the same mice The control group (n=5) was administered three intravenous injections of PBS as vehicle control with the same dosing schedule. The treatment group administered the cholesterol-siRNA conjugate was administered 5 mg/kg (based on the weight of siRNA). Some treatment groups were also administered cholesterol-peptide conjugates at a specific molar peptide:siRNA ratio, where all chol-siRNA and chol-peptide conjugates were mixed in solution and co-injected. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Table 59 describes the study design in more detail and provides cross-references to conjugate synthesis and characterization. Mice were sacrificed by CO ₂ asphyxiation 24 or 96 hours after administration. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantification were performed as described in Examples 2-7.

Table 59. Study design for cholesterol-siRNA conjugate (PK-076) with cross-reference to synthesis and characterization of tested conjugates.

The activity observed in the single-dose study using chol-siRNA and chol-EEP was followed up in a 3-dose study. A 3:1 ratio of EEP:siRNA was selected for INF7, and a 1:1 ratio was selected for melittin. As shown in Figures 43 and 44, addition of chol-EEP to chol-siRNA does not appear to significantly affect tissue PK after 3 doses. Regarding knockdown, Figure 45 shows that addition of chol-melittin clearly improves tumor knockdown at 24 hours after administration. It also shows that chol-melittin improves tumor knockdown at 96 hours after administration.

In vivo studies cholesterol- siRNA conjugate ( PK-079). A group (n=5) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ volume were treated with one intravenous (iv) tail vein injection of siRNA conjugate, whereas a control group of the same mice (n =5) were administered one intravenous injection of PBS as a vehicle control. The treatment group administered the EGFR antibody-siRNA-PEG conjugate was administered 0.5 mg/kg (based on the weight of siRNA), and the group administered the EGFR antibody-melittin had a difference between EGFR antibody-siRNA and EGFR antibody-melittin. They had matching doses of EGFR-Ab. All groups (treatment and control) were administered a dose volume of 5 mL/kg. Table 60 describes the study design in more detail and provides cross-references to conjugate synthesis and characterization. Mice were sacrificed by CO ₂ asphyxiation 96 hours after administration. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantification were performed as described in Examples 2-7.

Table 60. Study design for cholesterol-siRNA conjugate (PK-079) with cross-reference to synthesis and characterization of tested conjugates.

The PK/PD relationship of EGFR antibody-siRNA conjugates delivering siRNA to tumors and producing mRNA knockdown in tumors was evaluated for reproducibility. As shown in Figure 46, once again a single intravenous dose of 0.5 mg/kg of EGFR antibody-siRNA conjugate was able to deliver approximately 100 nM concentration of siRNA into the tumor using both configurations of the conjugate. Addition of EGFR antibody-melittin did not appear to affect tissue PK. Among the four tissues analyzed, tumor had the highest concentration, liver had the second highest concentration, and kidney and lung showed low uptake of siRNA. As shown in Figure 47, strong siRNA delivery to the tumor once again translated into approximately 50% knockdown of EGFR or KRAS in the tumor. Free EGFR-Ab, which served as a control, did not show mRNA knockdown like the PBS control.

In vivo studies cholesterol- siRNA conjugate (PD-077). One week after inoculation, a group (n=11) of female NCr nu/nu mice bearing intrahepatic Hep3B tumors were treated with nine intravenous (iv) or subcutaneous (sc) injections (TIW) of cholesterol-siRNA conjugates; A control group of the same mice (n=11) was administered nine intravenous tail vein injections of PBS as a vehicle control (also administered as TIW). 5 mg/kg was administered to the treatment group administered chol-CTNNB1. All groups (treatment and control) were administered a dose volume of 6.25 mL/kg. Table 61 describes the study design in more detail and provides cross-references to conjugate synthesis and characterization. Nasal blood samples were collected once weekly through puncture of the retro-orbital plexus and processed to generate serum for alpha-fetoprotein (AFP) measurement. Mice were sacrificed by CO ₂ asphyxiation 24 hours after the final dose. 50 mg pieces of tumor-bearing liver were collected and snap frozen in liquid nitrogen. The mRNA knockdown assay was performed as described above. AFP was quantified using the human alpha-fetoprotein DuoSet ELISA kit (R&D Systems) according to the manufacturer's instructions.

Table 61. Study design for cholesterol-siRNA conjugate (PK-077) with cross-reference to synthesis and characterization of tested conjugates.

Since previous studies have demonstrated that a single dose of chol-siRNA can produce knockdown in normal liver, we hypothesized that knockdown could also be achieved in orthotopic liver tumors. Mice were inoculated with intrahepatic Hep3B tumors and grown for 1 week after inoculation, and then these mice were administered chol-CTNNB1 (intravenously or subcutaneously) at a dose of 5 mg/kg three times a week for 3 weeks (9 total doses). . As shown in Figure 48, subcutaneously administered chol-CTNNB1 was able to cause >50% mRNA knockdown at the time of harvest 24 hours after the final administration. In contrast, intravenously administered chol-CTNNB1 siRNA does not appear to show any mRNA knockdown at this time point (although some mice did not have any measurable human CTNNB1 signal) to determine whether loss of signal was associated with knockdown or low tumor burden. It was difficult to do). Human Hep3B cells are also known to secrete human alpha-fetoprotein (AFP), and it is known that the amount of secreted AFP is correlated with the number of Hep3B cells. Therefore, the concentration of AFP in serum is considered a marker of tumor burden in mice, and the increase in AFP over time correlates with tumor growth. As shown in Figure 49, subcutaneously administered chol-CTNNB1 significantly reduced the level of AFP in these mice, providing evidence that CTNNB1 mRNA knockdown resulted in inhibition of tumor growth.

Example 46. Liver PK/PD studies

Female wild-type CD-1 mice will be administered 5 mg/kg (by weight of siRNA) chol-siRNA-EEP conjugate. In these studies, the siRNA used will be against mouse factor VII (FVII), so FVII knockdown can be determined by measuring FVII protein levels in plasma. Multiple EEPs (endosome degradable moieties) will be used to determine the peptide sequence that demonstrates optimal endosomal escape resulting in the best knockdown of FVII target genes compared to controls.

Example 47. Tumor PK/PD studies

Female NCr nu/nu mice bearing subcutaneous flank H358 tumors will be administered 0.5 mg/kg (siRNA basis) of the EGFR antibody-siRNA-EEP conjugate. Multiple EEPs (endosome degradable moieties) will be used to determine the peptide sequence that demonstrates optimal endosomal escape resulting in the best knockdown of target genes compared to controls.

Example 48. Formulation of ABC conjugate using nanoparticles

Exemplary ABC conjugates are packaged into self-assembled nanoparticles using cyclodextrin polymer (10 kDa) and excess unconjugated siRNA (ED 40-60 nm, PDI 0.1-0.2). In these particles, exemplary ABC conjugates retain the ability to interact with antibody targets. The stability and target binding capacity of the particles in circulation in vivo are regulated through modification of the packaging siRNA.

Nanoparticle formation

Nanoparticles are prepared at a final siRNA concentration of 1.6 mg/mL. First dilute siRNA containing CY5-siRNA at a ratio of 1:20 to 2x final concentration in water. Dilute cyclodextrin polymer (CDP) to 2x final concentration necessary to achieve a nitrogen to phosphorus ratio (N:P) of 3:1 in 10 mM phosphate buffer at neutral pH. CDP is quickly added to the siRNA and further mixed by pipetting. Incubate particles for at least 15 minutes before administration or analysis.

in vitro EGFR Combination

Nanoparticles containing various amounts of exemplary ABC conjugates were diluted with fetal bovine serum to a final concentration of 10 nM and incubated with Protein G Dynabeads (Thermofisher) loaded with 150 nM of purified EGFR-Fc protein (Sino Biological). Incubate for 1 hour at room temperature. The beads are washed twice with PBS containing 0.01% Tween 20 and 0.05% BSA, and then the nanoparticles bound to the beads are destroyed with water containing 0.01% Tween 20 and 100 ug/ml heparin. The amount of CY5-siRNA contained in the input, unbound fraction, wash and bead eluate is quantified by fluorescence using a TECAN Infinite M200 Pro (excitation 635 nm; emission 675 nm).

CY5- ASC Plasma Quantification

Quantification of nanoparticles in mouse plasma is performed as shown in Example 43. CY5-siRNA bound to EGFR beads is released using heparin to compete the electrostatic interaction between CDP and siRNA.

While preferred embodiments of the disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Various modifications, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be used in practicing the disclosure. The following claims define the scope of the present disclosure, and methods and structures falling within the scope of these claims and their equivalents are intended to be encompassed by them.

SEQUENCE LISTING <110> AVIDITY BIOSCIENCES LLC <120> NUCLEIC ACID-POLYPEPTIDE COMPOSITIONS AND USES THEREOF <130> 45532-707.601 <140> <141> <150> 62/316,919 <151> 2016-04-01 <160> 2117 <170> PatentIn version 3.5 <210> 1 <211> 23 <212> RNA <213> Homo sapiens <400> 1 aaaugacuga auauaaacuu gug 23 <210> 2 <211> 23 <212> RNA <213> Homo sapiens <400> 2 aaugacugaa uauaaacuug ugg 23 <210> 3 <211> 23 <212> RNA <213> Homo sapiens <400> 3 aacuuggu aguuggagcu ggu 23 <210> 4 <211> 23 <212> RNA <213> Homo sapiens <400> 4 uaggcaagag ugccuugacg aua 23 <210> 5 <211> 23 <212> RNA <213> Homo sapiens <400> 5 ggcaagagug ccuugacgau aca 23 <210> 6 <211> 23 <212> RNA <213> Homo sapiens <400> 6 gcaagagugc cuugacgaua cag 23 <210> 7 <211> 23 <212> RNA <213> Homo sapiens <400> 7 caagagugcc uugacgauac agc 23 <210> 8 <211> 23 <212> RNA <213> Homo sapiens <400> 8 agugccuuga cgauacagcu aau 23 <210> 9 <211> 23 <212> RNA <213> Homo sapiens <400> 9 gugccuugac gauacagcua auu 23 <210> 10 <211> 23 <212> RNA <213> Homo sapiens <400> 10 ccuugacgau acagcuaauu cag 23 <210> 11 <211> 23 <212> RNA <213> Homo sapiens <400> 11 cuugacgaua cagcuaauuc aga 23 <210> 12 <211> 23 <212> RNA <213> Homo sapiens <400> 12 uacagcuaau ucagaaucau uuu 23 <210> 13 <211> 23 <212> RNA <213> Homo sapiens <400> 13 uugggacga aauugaucca aca 23 <210> 14 <211> 23 <212> RNA <213> Homo sapiens <400> 14 uggacgaaua ugauccaaca aua 23 <210> 15 <211> 23 <212> RNA <213> Homo sapiens <400> 15 ggacgaauau gauccaacaa uag 23 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 16 augacugaau auaaacuugt t 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 17 caaguuuauauucagucaut t 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 18 ugacugaaua uaaacuugut t 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 19 acaaguuuauauucagucat t 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 20 cuugguguag uuggagcugt t 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 21 cagcuccaac uaccacaagt t 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 22 ggcaagagug ccuugacgat t 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 23 ucgucaaggc acucuugcct t 21 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 24 caagagugcc uugacgauat t 21 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 25 uaucgucaag gcacucuugt t 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 26 aagagugccu ugacgauact t 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 27 guaucgucaa ggcacucuut t 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 28 agagugccuu gacgauacat t 21 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 29 uguaucguca aggcacucut t 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>30 ugccuugacg auacagcuat t 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 31 uagcuguauc gucaaggcat t 21 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 32 gccuugacga uacagcuaat t 21 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 33 uuagcuguau cgucaaggct t 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 34 uugacgauac agcuaauuct t 21 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 35 gaauuagcug uaucgucaat t 21 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 36 ugacgauaca gcuaauucat t 21 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 37 ugaauuagcu guaucgucat t 21 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 38 cagcuaauuc agaaucauut t 21 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 39 aaugauucug aauuagcugt t 21 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 40 guggacgaau augauccaat t 21 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 41 uuggaucaua uucguccact t 21 <210> 42 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 42 gacgaauaug auccaacaat t 21 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 43 uuguuggauc auauucguct t 21 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 44 acgaauauga uccaacaaut t 21 <210> 45 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 45 auuguuggau cauauucgut t 21 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 46 augacugaau auaaacuugt t 21 <210> 47 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 47 caaguuuauauucagucaut t 21 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 48 ugacugaaua uaaacuugut t 21 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 49 acaaguuuauauucagucat t 21 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 50 cuugguguag uuggagcugt t 21 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 51 cagcuccaac uaccacaagt t 21 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 52 ggcaagagug ccuugacgat t 21 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 53 ucgucaaggc acucuugcct t 21 <210> 54 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 54 caagagugcc uugacgauat t 21 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 55 uaucgucaag gcacucuugt t 21 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 56 aagagugccu ugacgauact t 21 <210> 57 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 57 guaucgucaa ggcacucuut t 21 <210> 58 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 58 agagugccuu gacgauacat t 21 <210> 59 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 59 uguaucguca aggcacucut t 21 <210>60 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>60 ugccuugacg auacagcuat t 21 <210> 61 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 61 uagcuguauc gucaaggcat t 21 <210> 62 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>62 gccuugacga uacagcuaat t 21 <210> 63 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 63 uuagcuguau cgucaaggct t 21 <210> 64 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>64 uugacgauac agcuaauuct t 21 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>65 gaauuagcug uaucgucaat t 21 <210> 66 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 66 ugacgauaca gcuaauucat t 21 <210> 67 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 67 ugaauuagcu guaucgucat t 21 <210> 68 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 68 cagcuaauuc agaaucauut t 21 <210> 69 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 69 aaugauucug aauuagcugt t 21 <210>70 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>70 guggacgaau augauccaat t 21 <210> 71 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 71 uuggaucaua uucguccact t 21 <210> 72 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 72 gacgaauaug auccaacaat t 21 <210> 73 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 73 uuguuggauc auauucguct t 21 <210> 74 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 74 acgaauauga uccaacaaut t 21 <210> 75 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 75 auuguuggau cauauucgut t 21 <210> 76 <211> 23 <212> RNA <213> Homo sapiens <400> 76 ggcggccgga gucccgagcu agc 23 <210> 77 <211> 23 <212> RNA <213> Homo sapiens <400> 77 ggccggaguc ccgagcuagc ccc 23 <210> 78 <211> 23 <212> RNA <213> Homo sapiens <400> 78 gccggagucc cgagcuagcc ccg 23 <210> 79 <211> 23 <212> RNA <213> Homo sapiens <400> 79 ccggaguccc gagcuagccc cgg 23 <210>80 <211> 23 <212> RNA <213> Homo sapiens <400>80 cggagucccg agcuagcccc ggc 23 <210> 81 <211> 23 <212> RNA <213> Homo sapiens <400> 81 ggagucccga gcuagccccg gcg 23 <210> 82 <211> 23 <212> RNA <213> Homo sapiens <400> 82 gagucccgag cuagccccgg cgg 23 <210> 83 <211> 23 <212> RNA <213> Homo sapiens <400> 83 gucccgagcu agccccggcg gcc 23 <210> 84 <211> 23 <212> RNA <213> Homo sapiens <400> 84 ccggacgaca ggccacccucg ucg 23 <210> 85 <211> 23 <212> RNA <213> Homo sapiens <400> 85 cggacgacag gccaccucgu cgg 23 <210> 86 <211> 23 <212> RNA <213> Homo sapiens <400> 86 ggacgacagg ccaccucguc ggc 23 <210> 87 <211> 23 <212> RNA <213> Homo sapiens <400> 87 gacgacaggc caccucgucg gcg 23 <210> 88 <211> 23 <212> RNA <213> Homo sapiens <400> 88 acgacaggcc accucgucgg cgu 23 <210> 89 <211> 23 <212> RNA <213> Homo sapiens <400> 89 gacaggccac cucgucggcg ucc 23 <210> 90 <211> 23 <212> RNA <213> Homo sapiens <400>90 acaggccacc ucgucggcgu ccg 23 <210> 91 <211> 23 <212> RNA <213> Homo sapiens <400> 91 caggccaccu cgucggcguc cgc 23 <210> 92 <211> 23 <212> RNA <213> Homo sapiens <400> 92 aggccaccuc gucggcgucc gcc 23 <210> 93 <211> 23 <212> RNA <213> Homo sapiens <400> 93 ggccacccucg ucggcguccg ccc 23 <210> 94 <211> 23 <212> RNA <213> Homo sapiens <400> 94 gccaccucgu cggcguccgc ccg 23 <210> 95 <211> 23 <212> RNA <213> Homo sapiens <400> 95 ccaccucguc ggcguccgcc cga 23 <210> 96 <211> 23 <212> RNA <213> Homo sapiens <400> 96 caccucgucg gcguccgccc gag 23 <210> 97 <211> 23 <212> RNA <213> Homo sapiens <400> 97 accucgucgg cguccgcccg agu 23 <210> 98 <211> 23 <212> RNA <213> Homo sapiens <400> 98 ccucgucggc guccgcccga guc 23 <210> 99 <211> 23 <212> RNA <213> Homo sapiens <400> 99 cucgucggcg uccgcccgag ucc 23 <210> 100 <211> 23 <212> RNA <213> Homo sapiens <400> 100 ucgucggcgu ccgcccgagu ccc 23 <210> 101 <211> 23 <212> RNA <213> Homo sapiens <400> 101 cgucggcguc cgcccgaguc ccc 23 <210> 102 <211> 23 <212> RNA <213> Homo sapiens <400> 102 cggcguccgc ccgagucccc gcc 23 <210> 103 <211> 23 <212> RNA <213> Homo sapiens <400> 103 ggcguccgcc cgaguccccg ccu 23 <210> 104 <211> 23 <212> RNA <213> Homo sapiens <400> 104 ccgcccgagu ccccgccucg ccg 23 <210> 105 <211> 23 <212> RNA <213> Homo sapiens <400> 105 ccaacgccac aaccaccgcg cac 23 <210> 106 <211> 23 <212> RNA <213> Homo sapiens <400> 106 caacgccaca accaccgcgc acg 23 <210> 107 <211> 23 <212> RNA <213> Homo sapiens <400> 107 aacgccacaa ccaccgcgca cgg 23 <210> 108 <211> 23 <212> RNA <213> Homo sapiens <400> 108 cgccacaacc accgcgcacg gcc 23 <210> 109 <211> 23 <212> RNA <213> Homo sapiens <400> 109 gccacaacca ccgcgcacgg ccc 23 <210> 110 <211> 23 <212> RNA <213> Homo sapiens <400> 110 ccacaaccac cgcgcacggc ccc 23 <210> 111 <211> 23 <212> RNA <213> Homo sapiens <400> 111 cgaugcgacc cuccgggacg gcc 23 <210> 112 <211> 23 <212> RNA <213> Homo sapiens <400> 112 gaugcgaccc uccgggacgg ccg 23 <210> 113 <211> 23 <212> RNA <213> Homo sapiens <400> 113 augcgacccu ccgggacggc cgg 23 <210> 114 <211> 23 <212> RNA <213> Homo sapiens <400> 114 gcgacccucc gggacggccg ggg 23 <210> 115 <211> 23 <212> RNA <213> Homo sapiens <400> 115 cgacccuccg ggacggccgg ggc 23 <210> 116 <211> 23 <212> RNA <213> Homo sapiens <400> 116 acccuccggg acggccgggg cag 23 <210> 117 <211> 23 <212> RNA <213> Homo sapiens <400> 117 aaagaaaguu ugccaaggca cga 23 <210> 118 <211> 23 <212> RNA <213> Homo sapiens <400> 118 aagaaaguuu gccaaggcac gag 23 <210> 119 <211> 23 <212> RNA <213> Homo sapiens <400> 119 gaaaguuugc caaggcacga gua 23 <210> 120 <211> 23 <212> RNA <213> Homo sapiens <400> 120 aaaguuugcc aaggcacgag uaa 23 <210> 121 <211> 23 <212> RNA <213> Homo sapiens <400> 121 aaguuugcca aggcacgagu aac 23 <210> 122 <211> 23 <212> RNA <213> Homo sapiens <400> 122 aguuugccaa ggcacgagua aca 23 <210> 123 <211> 23 <212> RNA <213> Homo sapiens <400> 123 guuugccaag gcacgaguaa caa 23 <210> 124 <211> 23 <212> RNA <213> Homo sapiens <400> 124 uuugccaagg cacgaguaac aag 23 <210> 125 <211> 23 <212> RNA <213> Homo sapiens <400> 125 uugccaaggc acgaguaaca agc 23 <210> 126 <211> 23 <212> RNA <213> Homo sapiens <400> 126 ucacgcaguu gggcacuuuu gaa 23 <210> 127 <211> 23 <212> RNA <213> Homo sapiens <400> 127 cacgcaguug ggcacuuuug aag 23 <210> 128 <211> 23 <212> RNA <213> Homo sapiens <400> 128 acgcaguugg gcacuuuuga aga 23 <210> 129 <211> 23 <212> RNA <213> Homo sapiens <400> 129 cgcaguuggg cacuuuugaa gau 23 <210> 130 <211> 23 <212> RNA <213> Homo sapiens <400> 130 gcaguugggc acuuuugaag auc 23 <210> 131 <211> 23 <212> RNA <213> Homo sapiens <400> 131 caguugggca cuuuugaaga uca 23 <210> 132 <211> 23 <212> RNA <213> Homo sapiens <400> 132 aguugggcac uuuugaagau cau 23 <210> 133 <211> 23 <212> RNA <213> Homo sapiens <400> 133 guugggcacu uuugaagauc auu 23 <210> 134 <211> 23 <212> RNA <213> Homo sapiens <400> 134 uugggcacuu uugaagauca uuu 23 <210> 135 <211> 23 <212> RNA <213> Homo sapiens <400> 135 uuuugaagau cauuuucuca gcc 23 <210> 136 <211> 23 <212> RNA <213> Homo sapiens <400> 136 uugaagauca uuuucucacc cuc 23 <210> 137 <211> 23 <212> RNA <213> Homo sapiens <400> 137 ugaagaucau uuucucaccc ucc 23 <210> 138 <211> 23 <212> RNA <213> Homo sapiens <400> 138 aucauuuucu cagccuccag agg 23 <210> 139 <211> 23 <212> RNA <213> Homo sapiens <400> 139 ucagccucca gaggauguuc aau 23 <210> 140 <211> 23 <212> RNA <213> Homo sapiens <400> 140 agccuccaga ggauguucaa uaa 23 <210> 141 <211> 23 <212> RNA <213> Homo sapiens <400> 141 gccuccagag gauguucaau aac 23 <210> 142 <211> 23 <212> RNA <213> Homo sapiens <400> 142 ccagaggaug uucauaacu gug 23 <210> 143 <211> 23 <212> RNA <213> Homo sapiens <400> 143 agaggauguu caauaacugu gag 23 <210> 144 <211> 23 <212> RNA <213> Homo sapiens <400> 144 gauguucaau aacugugagg ugg 23 <210> 145 <211> 23 <212> RNA <213> Homo sapiens <400> 145 uguucauaaa cugugaggug guc 23 <210> 146 <211> 23 <212> RNA <213> Homo sapiens <400> 146 guucaauaac ugugaggugg ucc 23 <210> 147 <211> 23 <212> RNA <213> Homo sapiens <400> 147 uucauaacu gugagguggu ccu 23 <210> 148 <211> 23 <212> RNA <213> Homo sapiens <400> 148 ucaauaacug ugaggugguc cuu 23 <210> 149 <211> 23 <212> RNA <213> Homo sapiens <400> 149 caauaacugu gaggguggucc uug 23 <210> 150 <211> 23 <212> RNA <213> Homo sapiens <400> 150 aauaacugg aggugguccu ugg 23 <210> 151 <211> 23 <212> RNA <213> Homo sapiens <400> 151 uaacugugag gugguccuug gga 23 <210> 152 <211> 23 <212> RNA <213> Homo sapiens <400> 152 acugugaggu gguccuuggg aau 23 <210> 153 <211> 23 <212> RNA <213> Homo sapiens <400> 153 cugugaggug guccuuggga auu 23 <210> 154 <211> 23 <212> RNA <213> Homo sapiens <400> 154 ggugguccuu gggaauuugg aaa 23 <210> 155 <211> 23 <212> RNA <213> Homo sapiens <400> 155 ccuugggaau uuggaaauua ccu 23 <210> 156 <211> 23 <212> RNA <213> Homo sapiens <400> 156 cuugggaauu uggaaauuac cua 23 <210> 157 <211> 23 <212> RNA <213> Homo sapiens <400> 157 uugggaauuu ggaaauuacc uau 23 <210> 158 <211> 23 <212> RNA <213> Homo sapiens <400> 158 ugggaauuug gaaauuaccu Aug 23 <210> 159 <211> 23 <212> RNA <213> Homo sapiens <400> 159 gcagaggaau uaugaucuuu ccu 23 <210> 160 <211> 23 <212> RNA <213> Homo sapiens <400> 160 cagaggaauu augaucuuuc cuu 23 <210> 161 <211> 23 <212> RNA <213> Homo sapiens <400> 161 ggaauuauga ucuuuccuuc uua 23 <210> 162 <211> 23 <212> RNA <213> Homo sapiens <400> 162 gaauuaugau cuuuccuucu uaa 23 <210> 163 <211> 23 <212> RNA <213> Homo sapiens <400> 163 auuaugaucu uuccuucuua aag 23 <210> 164 <211> 23 <212> RNA <213> Homo sapiens <400> 164 uaugaucuuu ccuucuuaaa gac 23 <210> 165 <211> 23 <212> RNA <213> Homo sapiens <400> 165 gaucuuuccu ucuuaaagac cau 23 <210> 166 <211> 23 <212> RNA <213> Homo sapiens <400> 166 uuccuucuua aagaccaucc agg 23 <210> 167 <211> 23 <212> RNA <213> Homo sapiens <400> 167 uccuucuuaa agaccaucca gga 23 <210> 168 <211> 23 <212> RNA <213> Homo sapiens <400> 168 cuucuuaaag accauccagg agg 23 <210> 169 <211> 23 <212> RNA <213> Homo sapiens <400> 169 ucuuaaagac cauccaggag gug 23 <210> 170 <211> 23 <212> RNA <213> Homo sapiens <400> 170 cuuaaagacc auccaggagg ugg 23 <210> 171 <211> 23 <212> RNA <213> Homo sapiens <400> 171 auccagggagg uggcugguua ugu 23 <210> 172 <211> 23 <212> RNA <213> Homo sapiens <400> 172 uccaggaggu ggcugguuau guc 23 <210> 173 <211> 23 <212> RNA <213> Homo sapiens <400> 173 ccaggagggg gcugguuaug ucc 23 <210> 174 <211> 23 <212> RNA <213> Homo sapiens <400> 174 caggagggugg cugguuaugu ccu 23 <210> 175 <211> 23 <212> RNA <213> Homo sapiens <400> 175 aggaggguggc ugguuauguc cuc 23 <210> 176 <211> 23 <212> RNA <213> Homo sapiens <400> 176 ggagguggcu gguuaugucc uca 23 <210> 177 <211> 23 <212> RNA <213> Homo sapiens <400> 177 agguggcugg uuauguccuc auu 23 <210> 178 <211> 23 <212> RNA <213> Homo sapiens <400> 178 uugcccucaa cacaguggag cga 23 <210> 179 <211> 23 <212> RNA <213> Homo sapiens <400> 179 aauuccuuug gaaaaccugc aga 23 <210> 180 <211> 23 <212> RNA <213> Homo sapiens <400> 180 auuccuuugg aaaaccugca gau 23 <210> 181 <211> 23 <212> RNA <213> Homo sapiens <400> 181 uggaaaaccu gcagaucauc aga 23 <210> 182 <211> 23 <212> RNA <213> Homo sapiens <400> 182 ggaaaaccug cagaucauca gag 23 <210> 183 <211> 23 <212> RNA <213> Homo sapiens <400> 183 aaaaccugca gaucaucaga gga 23 <210> 184 <211> 23 <212> RNA <213> Homo sapiens <400> 184 accugcagau caucagagga aau 23 <210> 185 <211> 23 <212> RNA <213> Homo sapiens <400> 185 acgaaaauuc cuaugccuua gca 23 <210> 186 <211> 23 <212> RNA <213> Homo sapiens <400> 186 cgaaaauucc uaugccuuag cag 23 <210> 187 <211> 23 <212> RNA <213> Homo sapiens <400> 187 aaaauuccua ugccuuagca guc 23 <210> 188 <211> 23 <212> RNA <213> Homo sapiens <400> 188 auuccuaugc cuuagcaguc uua 23 <210> 189 <211> 23 <212> RNA <213> Homo sapiens <400> 189 uuccuaugcc uuagcagucu uau 23 <210> 190 <211> 23 <212> RNA <213> Homo sapiens <400> 190 uccuaugccu uagcagucuu auc 23 <210> 191 <211> 23 <212> RNA <213> Homo sapiens <400> 191 cuaugccuua gcagucuuau cua 23 <210> 192 <211> 23 <212> RNA <213> Homo sapiens <400> 192 uaugccuuag cagucuuauc uaa 23 <210> 193 <211> 23 <212> RNA <213> Homo sapiens <400> 193 augccuuagc agucuuaucu aac 23 <210> 194 <211> 23 <212> RNA <213> Homo sapiens <400> 194 ugccuuagca gucuuaucua acu 23 <210> 195 <211> 23 <212> RNA <213> Homo sapiens <400> 195 gccuuagcag ucuuaucuaa cua 23 <210> 196 <211> 23 <212> RNA <213> Homo sapiens <400> 196 ccuuagcagu cuuaucuaac uau 23 <210> 197 <211> 23 <212> RNA <213> Homo sapiens <400> 197 cuuagcaguc uuaucuacu aug 23 <210> 198 <211> 23 <212> RNA <213> Homo sapiens <400> 198 uuagcagucu uaucuaacua uga 23 <210> 199 <211> 23 <212> RNA <213> Homo sapiens <400> 199 uagcagucuu aucuaacuau gau 23 <210> 200 <211> 23 <212> RNA <213> Homo sapiens <400> 200 agcagucuua ucuaacuaug aug 23 <210> 201 <211> 23 <212> RNA <213> Homo sapiens <400> 201 agucuuaucu aacuaugaug caa 23 <210> 202 <211> 23 <212> RNA <213> Homo sapiens <400> 202 gucuuaucua acuauugaugc aaa 23 <210> 203 <211> 23 <212> RNA <213> Homo sapiens <400> 203 ucuuaucuaa cuaugaugca aau 23 <210> 204 <211> 23 <212> RNA <213> Homo sapiens <400> 204 cuuaucuaac uaugaugcaa aua 23 <210> 205 <211> 23 <212> RNA <213> Homo sapiens <400> 205 uuaucuacu augaugcaaa uaa 23 <210> 206 <211> 23 <212> RNA <213> Homo sapiens <400> 206 uaucuaacua ugaugcaaau aaa 23 <210> 207 <211> 23 <212> RNA <213> Homo sapiens <400> 207 aucuaacuau gaugcaaaua aaa 23 <210> 208 <211> 23 <212> RNA <213> Homo sapiens <400> 208 cuaacuauga ugcaaauaaa acc 23 <210> 209 <211> 23 <212> RNA <213> Homo sapiens <400> 209 augaugcaaa uaaaaccggga cug 23 <210> 210 <211> 23 <212> RNA <213> Homo sapiens <400> 210 ugaugcaaau aaaaccggac uga 23 <210> 211 <211> 23 <212> RNA <213> Homo sapiens <400> 211 gaugcaaaua aaaccggacu gaa 23 <210> 212 <211> 23 <212> RNA <213> Homo sapiens <400> 212 ugcaaauaaa accggacuga agg 23 <210> 213 <211> 23 <212> RNA <213> Homo sapiens <400> 213 gcaaauaaaa ccggacugaa gga 23 <210> 214 <211> 23 <212> RNA <213> Homo sapiens <400> 214 caaauaaaac cggacugaag gag 23 <210> 215 <211> 23 <212> RNA <213> Homo sapiens <400> 215 aauaaaaccg gacugaagga gcu 23 <210> 216 <211> 23 <212> RNA <213> Homo sapiens <400> 216 auaaaaccgg acugaaggag cug 23 <210> 217 <211> 23 <212> RNA <213> Homo sapiens <400> 217 uaaaaccgga cugaaggagc ugc 23 <210> 218 <211> 23 <212> RNA <213> Homo sapiens <400> 218 aaaaccggac ugaaggagcu gcc 23 <210> 219 <211> 23 <212> RNA <213> Homo sapiens <400> 219 gaaggagcug cccaugagaa auu 23 <210> 220 <211> 23 <212> RNA <213> Homo sapiens <400> 220 uuuacaggaa auccugcaug gcg 23 <210> 221 <211> 23 <212> RNA <213> Homo sapiens <400> 221 acaggaaauc cugcauggcg ccg 23 <210> 222 <211> 23 <212> RNA <213> Homo sapiens <400> 222 caggaaaucc ugcauggcgc cgu 23 <210> 223 <211> 23 <212> RNA <213> Homo sapiens <400> 223 aggaaauccu gcauggcgcc gug 23 <210> 224 <211> 23 <212> RNA <213> Homo sapiens <400> 224 ggaaauccug cauggcgccg ugc 23 <210> 225 <211> 23 <212> RNA <213> Homo sapiens <400> 225 gaaauccugc auggcgccgu gcg 23 <210> 226 <211> 23 <212> RNA <213> Homo sapiens <400> 226 aauccugcau ggcgccgugc ggu 23 <210> 227 <211> 23 <212> RNA <213> Homo sapiens <400> 227 uccugcaugg cgccgugcgg uuc 23 <210> 228 <211> 23 <212> RNA <213> Homo sapiens <400> 228 ccugcauggc gccgugcggu uca 23 <210> 229 <211> 23 <212> RNA <213> Homo sapiens <400> 229 cugcauggcg ccgugcgguu cag 23 <210> 230 <211> 23 <212> RNA <213> Homo sapiens <400> 230 gcauggcgcc gugcgguuca gca 23 <210> 231 <211> 23 <212> RNA <213> Homo sapiens <400> 231 cauggcgccg ugcgguucag caa 23 <210> 232 <211> 23 <212> RNA <213> Homo sapiens <400> 232 auggcgccgu gcgguucagc aac 23 <210> 233 <211> 23 <212> RNA <213> Homo sapiens <400> 233 uggcgccgug cgguucagca aca 23 <210> 234 <211> 23 <212> RNA <213> Homo sapiens <400> 234 ggcgccgugc gguucagcaa caa 23 <210> 235 <211> 23 <212> RNA <213> Homo sapiens <400> 235 gcgccgugcg guucagcaac aac 23 <210> 236 <211> 23 <212> RNA <213> Homo sapiens <400> 236 cgccgugcgg uucagcaaca acc 23 <210> 237 <211> 23 <212> RNA <213> Homo sapiens <400> 237 ccgugcgguu cagcaacaac ccu 23 <210> 238 <211> 23 <212> RNA <213> Homo sapiens <400> 238 gugcgguuca gcaacaaccc ugc 23 <210> 239 <211> 23 <212> RNA <213> Homo sapiens <400> 239 gcgguucagc aacaacccug ccc 23 <210> 240 <211> 23 <212> RNA <213> Homo sapiens <400> 240 cagcaacaac ccugcccugu gca 23 <210> 241 <211> 23 <212> RNA <213> Homo sapiens <400> 241 gcaacaaccc ugcccugugc aac 23 <210> 242 <211> 23 <212> RNA <213> Homo sapiens <400> 242 caacguggag agcauccagu ggc 23 <210> 243 <211> 23 <212> RNA <213> Homo sapiens <400> 243 aacguggaga gcauccagug gcg 23 <210> 244 <211> 23 <212> RNA <213> Homo sapiens <400> 244 acguggagag cauccagugg cgg 23 <210> 245 <211> 23 <212> RNA <213> Homo sapiens <400> 245 uggagagcau ccaguggcgg gac 23 <210> 246 <211> 23 <212> RNA <213> Homo sapiens <400> 246 ggagagcauc caguggcggg aca 23 <210> 247 <211> 23 <212> RNA <213> Homo sapiens <400> 247 gagagcaucc aguggcggga cau 23 <210> 248 <211> 23 <212> RNA <213> Homo sapiens <400> 248 uccaguggcg ggacauaguc agc 23 <210> 249 <211> 23 <212> RNA <213> Homo sapiens <400> 249 ccaguggcgg gacauaguca gca 23 <210> 250 <211> 23 <212> RNA <213> Homo sapiens <400> 250 aguggcggga cauagucagc agu 23 <210> 251 <211> 23 <212> RNA <213> Homo sapiens <400> 251 guggcgggac auagucagca gug 23 <210> 252 <211> 23 <212> RNA <213> Homo sapiens <400> 252 uucucagcaa caugucgaug gac 23 <210> 253 <211> 23 <212> RNA <213> Homo sapiens <400> 253 cucagcaaca ugucgaugga cuu 23 <210> 254 <211> 23 <212> RNA <213> Homo sapiens <400> 254 ucagcaacau gucgauggac uuc 23 <210> 255 <211> 23 <212> RNA <213> Homo sapiens <400> 255 cagcaacaug ucgauggacu ucc 23 <210> 256 <211> 23 <212> RNA <213> Homo sapiens <400> 256 gcaacauguc gauggacuuc cag 23 <210> 257 <211> 23 <212> RNA <213> Homo sapiens <400> 257 caacaugucg auggacuucc aga 23 <210> 258 <211> 23 <212> RNA <213> Homo sapiens <400> 258 aacaugucga uggacuucca gaa 23 <210> 259 <211> 23 <212> RNA <213> Homo sapiens <400> 259 acaugucgau ggacuuccag aac 23 <210> 260 <211> 23 <212> RNA <213> Homo sapiens <400> 260 ugucgaugga cuuccagaac cac 23 <210> 261 <211> 23 <212> RNA <213> Homo sapiens <400> 261 cagaaccacc ugggcagcug cca 23 <210> 262 <211> 23 <212> RNA <213> Homo sapiens <400> 262 cugggcagcu gccaaaagug uga 23 <210> 263 <211> 23 <212> RNA <213> Homo sapiens <400> 263 gggcagcugc caaaagugg auc 23 <210> 264 <211> 23 <212> RNA <213> Homo sapiens <400> 264 gcugccaaaa gugugaucca agc 23 <210> 265 <211> 23 <212> RNA <213> Homo sapiens <400> 265 cugccaaaaag ugugauccaa gcu 23 <210> 266 <211> 23 <212> RNA <213> Homo sapiens <400> 266 ugccaaaagu gugauccaag cug 23 <210> 267 <211> 23 <212> RNA <213> Homo sapiens <400> 267 caaaagugg auccaagcug ucc 23 <210> 268 <211> 23 <212> RNA <213> Homo sapiens <400> 268 agugugaucc aagcuguccc aau 23 <210> 269 <211> 23 <212> RNA <213> Homo sapiens <400> 269 gugugaucca agcuguccca aug 23 <210> 270 <211> 23 <212> RNA <213> Homo sapiens <400> 270 gugauccaag cugucccaau ggg 23 <210> 271 <211> 23 <212> RNA <213> Homo sapiens <400> 271 ugauccaagc ugucccaaug gga 23 <210> 272 <211> 23 <212> RNA <213> Homo sapiens <400> 272 gauccaagcu gucccaaugg gag 23 <210> 273 <211> 23 <212> RNA <213> Homo sapiens <400> 273 auccaagcug ucccaauggg agc 23 <210> 274 <211> 23 <212> RNA <213> Homo sapiens <400> 274 uccaagcugu cccaauggga gcu 23 <210> 275 <211> 23 <212> RNA <213> Homo sapiens <400> 275 caagcugucc caaugggagc ugc 23 <210> 276 <211> 23 <212> RNA <213> Homo sapiens <400> 276 gcugucccaa ugggagcugc ugg 23 <210> 277 <211> 23 <212> RNA <213> Homo sapiens <400> 277 ggggugcagg agaggagaac ugc 23 <210> 278 <211> 23 <212> RNA <213> Homo sapiens <400> 278 agaaacugac caaaaucauc ugu 23 <210> 279 <211> 23 <212> RNA <213> Homo sapiens <400> 279 gaaacugacc aaaaucaucu gug 23 <210> 280 <211> 23 <212> RNA <213> Homo sapiens <400> 280 aaacugacca aaaucaucug ugc 23 <210> 281 <211> 23 <212> RNA <213> Homo sapiens <400> 281 ugaccaaaau caucugucc cag 23 <210> 282 <211> 23 <212> RNA <213> Homo sapiens <400> 282 gaccaaaauc aucugugccc agc 23 <210> 283 <211> 23 <212> RNA <213> Homo sapiens <400> 283 caaaaucauc ugugcccagc agu 23 <210> 284 <211> 23 <212> RNA <213> Homo sapiens <400> 284 cugugcccag cagugcuccg ggc 23 <210> 285 <211> 23 <212> RNA <213> Homo sapiens <400> 285 gugcccagca gugcuccggg cgc 23 <210> 286 <211> 23 <212> RNA <213> Homo sapiens <400> 286 ccccagugac ugcugccaca acc 23 <210> 287 <211> 23 <212> RNA <213> Homo sapiens <400> 287 cccagugacu gcugccacaa cca 23 <210> 288 <211> 23 <212> RNA <213> Homo sapiens <400> 288 gggagagcga cugccugguc ugc 23 <210> 289 <211> 23 <212> RNA <213> Homo sapiens <400> 289 ggagagcgac ugccuggucu gcc 23 <210> 290 <211> 23 <212> RNA <213> Homo sapiens <400> 290 gagagcgacu gccuggucug ccg 23 <210> 291 <211> 23 <212> RNA <213> Homo sapiens <400> 291 agagcgacug ccuggucugc cgc 23 <210> 292 <211> 23 <212> RNA <213> Homo sapiens <400> 292 gagcgacugc cuggucugcc gca 23 <210> 293 <211> 23 <212> RNA <213> Homo sapiens <400> 293 agcgacugcc uggucugccg caa 23 <210> 294 <211> 23 <212> RNA <213> Homo sapiens <400> 294 cugccugguc ugccgcaaau ucc 23 <210> 295 <211> 23 <212> RNA <213> Homo sapiens <400> 295 ugccuggucu gccgcaaauu ccg 23 <210> 296 <211> 23 <212> RNA <213> Homo sapiens <400> 296 gccuggucug ccgcaaauuc cga 23 <210> 297 <211> 23 <212> RNA <213> Homo sapiens <400> 297 ccuggucugc cgcaaauucc gag 23 <210> 298 <211> 23 <212> RNA <213> Homo sapiens <400> 298 uggucugccg caaauuccga gac 23 <210> 299 <211> 23 <212> RNA <213> Homo sapiens <400> 299 ggucugccgc aaauuccgag acg 23 <210>300 <211> 23 <212> RNA <213> Homo sapiens <400> 300 gucugccgca aauuccgaga cga 23 <210> 301 <211> 23 <212> RNA <213> Homo sapiens <400> 301 ucugccgcaa auuccgagac gaa 23 <210> 302 <211> 23 <212> RNA <213> Homo sapiens <400> 302 ugccgcaaau uccgagacga agc 23 <210> 303 <211> 23 <212> RNA <213> Homo sapiens <400> 303 caaauuccga gacgaagcca cgu 23 <210> 304 <211> 23 <212> RNA <213> Homo sapiens <400> 304 aaauuccgag acgaagccac gug 23 <210> 305 <211> 23 <212> RNA <213> Homo sapiens <400> 305 aauuccgaga cgaagccacg ugc 23 <210> 306 <211> 23 <212> RNA <213> Homo sapiens <400> 306 auuccgagac gaagccacgu gca 23 <210> 307 <211> 23 <212> RNA <213> Homo sapiens <400> 307 uuccgagacg aagccacgug caa 23 <210> 308 <211> 23 <212> RNA <213> Homo sapiens <400> 308 ccgagacgaa gccacgugca agg 23 <210> 309 <211> 23 <212> RNA <213> Homo sapiens <400> 309 agacgaagcc acgugcaagg aca 23 <210> 310 <211> 23 <212> RNA <213> Homo sapiens <400> 310 gacgaagcca cgugcaagga cac 23 <210> 311 <211> 23 <212> RNA <213> Homo sapiens <400> 311 acgaagccac gugcaaggac acc 23 <210> 312 <211> 23 <212> RNA <213> Homo sapiens <400> 312 cgaagccacg ugcaaggaca ccu 23 <210> 313 <211> 23 <212> RNA <213> Homo sapiens <400> 313 ccccccacuc augcucuaca acc 23 <210> 314 <211> 23 <212> RNA <213> Homo sapiens <400> 314 ccccacucau gcucuacaac ccc 23 <210> 315 <211> 23 <212> RNA <213> Homo sapiens <400> 315 ccacucaugc ucuacaaccc cac 23 <210> 316 <211> 23 <212> RNA <213> Homo sapiens <400> 316 cucaugcucu acaaccccac cac 23 <210> 317 <211> 23 <212> RNA <213> Homo sapiens <400> 317 uaccagaugg augugaaccc cga 23 <210> 318 <211> 23 <212> RNA <213> Homo sapiens <400> 318 ccagauggau gugaaccccg agg 23 <210> 319 <211> 23 <212> RNA <213> Homo sapiens <400> 319 cagauggaug ugaacccga ggg 23 <210> 320 <211> 23 <212> RNA <213> Homo sapiens <400> 320 agauggaugu gaaccccgag ggc 23 <210> 321 <211> 23 <212> RNA <213> Homo sapiens <400> 321 auggauguga accccgaggg caa 23 <210> 322 <211> 23 <212> RNA <213> Homo sapiens <400> 322 uggaugugaa ccccgagggc aaa 23 <210> 323 <211> 23 <212> RNA <213> Homo sapiens <400> 323 gaugugaacc ccgagggcaa aua 23 <210> 324 <211> 23 <212> RNA <213> Homo sapiens <400> 324 ugaaccccga gggcaaauac agc 23 <210> 325 <211> 23 <212> RNA <213> Homo sapiens <400> 325 gaacccccgag ggcaaauaca gcu 23 <210> 326 <211> 23 <212> RNA <213> Homo sapiens <400> 326 accccgaggg caaauacagc uuu 23 <210> 327 <211> 23 <212> RNA <213> Homo sapiens <400> 327 ccccgagggc aaauacagcu uug 23 <210> 328 <211> 23 <212> RNA <213> Homo sapiens <400> 328 cccgagggca aauacagcuu ugg 23 <210> 329 <211> 23 <212> RNA <213> Homo sapiens <400> 329 gcaaauacag cuuuggugcc acc 23 <210> 330 <211> 23 <212> RNA <213> Homo sapiens <400> 330 caaauacagc uuuggugcca ccu 23 <210> 331 <211> 23 <212> RNA <213> Homo sapiens <400> 331 aaauacagcu uuggugccac cug 23 <210> 332 <211> 23 <212> RNA <213> Homo sapiens <400> 332 agcuuuggug ccaccugcgu gaa 23 <210> 333 <211> 23 <212> RNA <213> Homo sapiens <400> 333 cuuuggugcc accugcguga aga 23 <210> 334 <211> 23 <212> RNA <213> Homo sapiens <400> 334 ugccaccugc gugaagaagu guc 23 <210> 335 <211> 23 <212> RNA <213> Homo sapiens <400> 335 accugcguga agaagugucc ccg 23 <210> 336 <211> 23 <212> RNA <213> Homo sapiens <400> 336 ccugcgugaa gaaguguccc cgu 23 <210> 337 <211> 23 <212> RNA <213> Homo sapiens <400> 337 cugcgugaag aagugucccc gua 23 <210> 338 <211> 23 <212> RNA <213> Homo sapiens <400> 338 ugcgugaaga aguguccccg uaa 23 <210> 339 <211> 23 <212> RNA <213> Homo sapiens <400> 339 gcgugaagaa guguccccgu aau 23 <210> 340 <211> 23 <212> RNA <213> Homo sapiens <400> 340 cgugaagaag uguccccgua auu 23 <210> 341 <211> 23 <212> RNA <213> Homo sapiens <400> 341 gugaagaagu guccccguaa uua 23 <210> 342 <211> 23 <212> RNA <213> Homo sapiens <400> 342 ugaagaagug uccccguaau uau 23 <210> 343 <211> 23 <212> RNA <213> Homo sapiens <400> 343 gaagaagugu ccccguaauu aug 23 <210> 344 <211> 23 <212> RNA <213> Homo sapiens <400> 344 aagaaguguc cccguaauua ugu 23 <210> 345 <211> 23 <212> RNA <213> Homo sapiens <400> 345 agaagugucc ccguaauuau gug 23 <210> 346 <211> 23 <212> RNA <213> Homo sapiens <400> 346 gaaguguccc cguaauuaug ugg 23 <210> 347 <211> 23 <212> RNA <213> Homo sapiens <400> 347 aagugucccc guaauuaugu ggu 23 <210> 348 <211> 23 <212> RNA <213> Homo sapiens <400> 348 aguguccccg uaauuaugug gug 23 <210> 349 <211> 23 <212> RNA <213> Homo sapiens <400> 349 guguccccgu aauuauggg uga 23 <210>350 <211> 23 <212> RNA <213> Homo sapiens <400> 350 guccccguaa uuauguggug aca 23 <210> 351 <211> 23 <212> RNA <213> Homo sapiens <400> 351 ccccguaauu auguggugac aga 23 <210> 352 <211> 23 <212> RNA <213> Homo sapiens <400> 352 ccguaauuau guggugacag auc 23 <210> 353 <211> 23 <212> RNA <213> Homo sapiens <400> 353 cguaauuaug uggugacaga uca 23 <210> 354 <211> 23 <212> RNA <213> Homo sapiens <400> 354 guaauuaugu ggugacagau cac 23 <210> 355 <211> 23 <212> RNA <213> Homo sapiens <400> 355 uaauuauugug gugacagauc acg 23 <210> 356 <211> 23 <212> RNA <213> Homo sapiens <400> 356 aauuauggg ugacagauca cgg 23 <210> 357 <211> 23 <212> RNA <213> Homo sapiens <400> 357 uuaugggug acagaucacg gcu 23 <210> 358 <211> 23 <212> RNA <213> Homo sapiens <400> 358 ugguggugaca gaucacggcu cgu 23 <210> 359 <211> 23 <212> RNA <213> Homo sapiens <400> 359 uggugacaga ucacggcucg ugc 23 <210> 360 <211> 23 <212> RNA <213> Homo sapiens <400> 360 ggugacagau cacggcucgu gcg 23 <210> 361 <211> 23 <212> RNA <213> Homo sapiens <400> 361 gugacagauc acggcucgug cgu 23 <210> 362 <211> 23 <212> RNA <213> Homo sapiens <400> 362 ugacagauca cggcucgugc guc 23 <210> 363 <211> 23 <212> RNA <213> Homo sapiens <400> 363 gacagaucac ggcucgugcg ucc 23 <210> 364 <211> 23 <212> RNA <213> Homo sapiens <400> 364 acagaucacg gcucgugcgu ccg 23 <210> 365 <211> 23 <212> RNA <213> Homo sapiens <400> 365 cagaucacgg cucgugcguc cga 23 <210> 366 <211> 23 <212> RNA <213> Homo sapiens <400> 366 agaucacggc ucgugcgucc gag 23 <210> 367 <211> 23 <212> RNA <213> Homo sapiens <400> 367 gaucacggcu cgugcguccg agc 23 <210> 368 <211> 23 <212> RNA <213> Homo sapiens <400> 368 aucacggcuc gugcguccga gcc 23 <210> 369 <211> 23 <212> RNA <213> Homo sapiens <400> 369 ucacggcucg ugcguccgag ccu 23 <210> 370 <211> 23 <212> RNA <213> Homo sapiens <400> 370 cggcucgugc guccgagccu gug 23 <210> 371 <211> 23 <212> RNA <213> Homo sapiens <400> 371 auggaggaag acggcguccg caa 23 <210> 372 <211> 23 <212> RNA <213> Homo sapiens <400> 372 uggaggaaga cggcguccgc aag 23 <210> 373 <211> 23 <212> RNA <213> Homo sapiens <400> 373 gaggaagacg gcguccgcaa gug 23 <210> 374 <211> 23 <212> RNA <213> Homo sapiens <400> 374 aggaagacgg cguccgcaag ugu 23 <210> 375 <211> 23 <212> RNA <213> Homo sapiens <400> 375 ggaagacggc guccgcaagu gua 23 <210> 376 <211> 23 <212> RNA <213> Homo sapiens <400> 376 aagacggcgu ccgcaagugu aag 23 <210> 377 <211> 23 <212> RNA <213> Homo sapiens <400> 377 agacggcguc cgcaagugua aga 23 <210> 378 <211> 23 <212> RNA <213> Homo sapiens <400> 378 cggcguccgc aaguguaaga agu 23 <210> 379 <211> 23 <212> RNA <213> Homo sapiens <400> 379 ggcguccgca aguguaagaa gug 23 <210> 380 <211> 23 <212> RNA <213> Homo sapiens <400> 380 gcguccgcaa guguaagaag ugc 23 <210> 381 <211> 23 <212> RNA <213> Homo sapiens <400> 381 cguccgcaag uguaagaagu gcg 23 <210> 382 <211> 23 <212> RNA <213> Homo sapiens <400> 382 guccgcaagu guaagaagug cga 23 <210> 383 <211> 23 <212> RNA <213> Homo sapiens <400> 383 uccgcaagug uaagaagugc gaa 23 <210> 384 <211> 23 <212> RNA <213> Homo sapiens <400> 384 ccgcaagugu aagaagugcg aag 23 <210> 385 <211> 23 <212> RNA <213> Homo sapiens <400> 385 gcaaguguaa gaagugcgaa ggg 23 <210> 386 <211> 23 <212> RNA <213> Homo sapiens <400> 386 caaguguaag aagugcgaag ggc 23 <210> 387 <211> 23 <212> RNA <213> Homo sapiens <400> 387 aaguguaaga agugcgaagg gcc 23 <210> 388 <211> 23 <212> RNA <213> Homo sapiens <400> 388 aguguaagaa gugcgaaggg ccu 23 <210> 389 <211> 23 <212> RNA <213> Homo sapiens <400> 389 guguaagaag ugcgaagggc cuu 23 <210> 390 <211> 23 <212> RNA <213> Homo sapiens <400> 390 uguaagaagu gcgaagggcc uug 23 <210> 391 <211> 23 <212> RNA <213> Homo sapiens <400> 391 guaagaagug cgaagggccu ugc 23 <210> 392 <211> 23 <212> RNA <213> Homo sapiens <400> 392 uaagaagugc gaagggccuu gcc 23 <210> 393 <211> 23 <212> RNA <213> Homo sapiens <400> 393 gaagugcgaa gggccuugcc gca 23 <210> 394 <211> 23 <212> RNA <213> Homo sapiens <400> 394 aagugcgaag ggccuugccg caa 23 <210> 395 <211> 23 <212> RNA <213> Homo sapiens <400> 395 agugcgaagg gccuugccgc aaa 23 <210> 396 <211> 23 <212> RNA <213> Homo sapiens <400> 396 gugcgaaggg ccuugccgca aag 23 <210> 397 <211> 23 <212> RNA <213> Homo sapiens <400> 397 ugcgaagggc cuugccgcaa agu 23 <210> 398 <211> 23 <212> RNA <213> Homo sapiens <400> 398 cgaagggccu ugccgcaaag ugu 23 <210> 399 <211> 23 <212> RNA <213> Homo sapiens <400> 399 gaagggccuu gccgcaaagu gug 23 <210>400 <211> 23 <212> RNA <213> Homo sapiens <400> 400 aagggccuug ccgcaaagug ugu 23 <210> 401 <211> 23 <212> RNA <213> Homo sapiens <400> 401 agggccuugc cgcaaagugu gua 23 <210> 402 <211> 23 <212> RNA <213> Homo sapiens <400> 402 gggccuugcc gcaaagugg uaa 23 <210> 403 <211> 23 <212> RNA <213> Homo sapiens <400> 403 gccuugccgc aaagugugua acg 23 <210> 404 <211> 23 <212> RNA <213> Homo sapiens <400> 404 acgggauagg uauuggugaa uuu 23 <210> 405 <211> 23 <212> RNA <213> Homo sapiens <400> 405 cggaauaggu auuggugaau uua 23 <210> 406 <211> 23 <212> RNA <213> Homo sapiens <400> 406 ggaauaggua uuggugaauu uaa 23 <210> 407 <211> 23 <212> RNA <213> Homo sapiens <400> 407 gaauagguau uggugaauuu aaa 23 <210> 408 <211> 23 <212> RNA <213> Homo sapiens <400> 408 auagguauug gugaauuuaa aga 23 <210> 409 <211> 23 <212> RNA <213> Homo sapiens <400> 409 uagguauugg ugaauuuaaa gac 23 <210> 410 <211> 23 <212> RNA <213> Homo sapiens <400> 410 cucacucucc auaaaugcua cga 23 <210> 411 <211> 23 <212> RNA <213> Homo sapiens <400> 411 uauuaaacac uucaaaacu gca 23 <210> 412 <211> 23 <212> RNA <213> Homo sapiens <400> 412 cacuucaaaa acugcaccuc cau 23 <210> 413 <211> 23 <212> RNA <213> Homo sapiens <400> 413 acuucaaaaaa cugcaccucc auc 23 <210> 414 <211> 23 <212> RNA <213> Homo sapiens <400> 414 cuucaaaaac ugcaccucca uca 23 <210> 415 <211> 23 <212> RNA <213> Homo sapiens <400> 415 uucaaaaacu gcaccuccau cag 23 <210> 416 <211> 23 <212> RNA <213> Homo sapiens <400> 416 ucaaaaacug caccuccauc agu 23 <210> 417 <211> 23 <212> RNA <213> Homo sapiens <400> 417 aaacugcacc uccaucagug gcg 23 <210> 418 <211> 23 <212> RNA <213> Homo sapiens <400> 418 ugcaccucca ucaguggcga ucu 23 <210> 419 <211> 23 <212> RNA <213> Homo sapiens <400> 419 gcaccuccau caguggcgau cuc 23 <210> 420 <211> 23 <212> RNA <213> Homo sapiens <400> 420 accuccauca guggcgaucu cca 23 <210> 421 <211> 23 <212> RNA <213> Homo sapiens <400> 421 uccaucagug gcgaucucca cau 23 <210> 422 <211> 23 <212> RNA <213> Homo sapiens <400> 422 aguggcgauc uccacauccu gcc 23 <210> 423 <211> 23 <212> RNA <213> Homo sapiens <400> 423 guggcgaucu ccacauccug ccg 23 <210> 424 <211> 23 <212> RNA <213> Homo sapiens <400> 424 uggcgaucuc cacauccugc cgg 23 <210> 425 <211> 23 <212> RNA <213> Homo sapiens <400> 425 ggcgaucucc acauccugcc ggu 23 <210> 426 <211> 23 <212> RNA <213> Homo sapiens <400> 426 gcgaucucca cauccugccg gug 23 <210> 427 <211> 23 <212> RNA <213> Homo sapiens <400> 427 cuccacaucc ugccgguggc auu 23 <210> 428 <211> 23 <212> RNA <213> Homo sapiens <400> 428 uccacauccu gccgguggca uuu 23 <210> 429 <211> 23 <212> RNA <213> Homo sapiens <400> 429 ccacauccug ccgguggcau uua 23 <210> 430 <211> 23 <212> RNA <213> Homo sapiens <400> 430 acauccugcc gguggcauuu agg 23 <210> 431 <211> 23 <212> RNA <213> Homo sapiens <400> 431 uccugccggu ggcauuuagg ggu 23 <210> 432 <211> 23 <212> RNA <213> Homo sapiens <400> 432 ccugccggug gcauuuaggg gug 23 <210> 433 <211> 23 <212> RNA <213> Homo sapiens <400> 433 cugccggugg cauuuagggg uga 23 <210> 434 <211> 23 <212> RNA <213> Homo sapiens <400> 434 ugccgguggc auuuaggggu gac 23 <210> 435 <211> 23 <212> RNA <213> Homo sapiens <400> 435 cggggcauu uagggugac ucc 23 <210> 436 <211> 23 <212> RNA <213> Homo sapiens <400> 436 uggcauuuag gggugacucc uuc 23 <210> 437 <211> 23 <212> RNA <213> Homo sapiens <400> 437 ggcauuuagg ggugacuccu uca 23 <210> 438 <211> 23 <212> RNA <213> Homo sapiens <400> 438 gcauuuaggg gugacuccuu cac 23 <210> 439 <211> 23 <212> RNA <213> Homo sapiens <400> 439 cauuuagggg ugacuccuuc aca 23 <210> 440 <211> 23 <212> RNA <213> Homo sapiens <400> 440 auuuaggggu gacuccuuca cac 23 <210> 441 <211> 23 <212> RNA <213> Homo sapiens <400> 441 uuuaggggug acuccuucac aca 23 <210> 442 <211> 23 <212> RNA <213> Homo sapiens <400> 442 ccucuggauc cacaggaacu gga 23 <210> 443 <211> 23 <212> RNA <213> Homo sapiens <400> 443 uggauccaca ggaacuggau auu 23 <210> 444 <211> 23 <212> RNA <213> Homo sapiens <400> 444 ggauccacag gaacuggaua uuc 23 <210> 445 <211> 23 <212> RNA <213> Homo sapiens <400> 445 auccacagga acuggauauu cug 23 <210> 446 <211> 23 <212> RNA <213> Homo sapiens <400> 446 uccacaggaa cuggauauuc uga 23 <210> 447 <211> 23 <212> RNA <213> Homo sapiens <400> 447 gaacuggaua uucugaaaac cgu 23 <210> 448 <211> 23 <212> RNA <213> Homo sapiens <400> 448 auauucugaa aaccguaaag gaa 23 <210> 449 <211> 23 <212> RNA <213> Homo sapiens <400> 449 uauucugaaa accguaaagg aaa 23 <210>450 <211> 23 <212> RNA <213> Homo sapiens <400> 450 ucugaaaacc guaaaggaaa uca 23 <210> 451 <211> 23 <212> RNA <213> Homo sapiens <400> 451 cugaaaaccg uaaaaggaaau cac 23 <210> 452 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 452 cggccggagu cccgagcuat t 21 <210> 453 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 453 uagcucggga cuccggccgt t 21 <210> 454 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 454 ccggaguccc gagcuagcct t 21 <210> 455 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 455 ggcuagcucg ggacuccggt t 21 <210> 456 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 456 cggagccccg agcuagccct t 21 <210> 457 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 457 gggcuagcuc gggacuccgt t 21 <210> 458 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 458 ggagccccga gcuagcccct t 21 <210> 459 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 459 ggggcuagcu cgggacucct t 21 <210> 460 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 460 gagccccgag cuagccccgt t 21 <210> 461 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 461 cggggcuagc ucgggacuct t 21 <210> 462 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 462 agucccgagc uagccccggt t 21 <210> 463 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 463 ccggggcuag cucgggacut t 21 <210> 464 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 464 gucccgagcu agccccggct t 21 <210> 465 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 465 gccggggcua gcucgggact t 21 <210> 466 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 466 cccgagcuag ccccggcggt t 21 <210> 467 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 467 ccgccggggc uagcucgggt t 21 <210> 468 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 468 ggacgacagg ccaccucgut t 21 <210> 469 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 469 acgagguggc cugucgucct t 21 <210> 470 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 470 gacgacaggc caccucguct t 21 <210> 471 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 471 gacgaggugg ccugucguct t 21 <210> 472 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 472 acgacaggcc accucgucgt t 21 <210> 473 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 473 cgacgaggug gccugucgut t 21 <210> 474 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 474 cgacaggcca ccucgucggt t 21 <210> 475 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 475 ccgacgaggu ggccugucgt t 21 <210> 476 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 476 gacaggccac cucgucggct t 21 <210> 477 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 477 gccgacgagg uggccuguct t 21 <210> 478 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 478 caggccaccu cgucggcgut t 21 <210> 479 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 479 acgccgacga gguggccugt t 21 <210>480 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 480 aggccaccuc gucggcguct t 21 <210> 481 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 481 gacgccgacg agguggccut t 21 <210> 482 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 482 ggccacccucg ucggcgucct t 21 <210> 483 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 483 ggacgccgac gagggggcct t 21 <210> 484 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 484 gccaccucgu cggcguccgt t 21 <210> 485 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 485 cggacgccga cgagguggct t 21 <210> 486 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 486 ccaccucguc ggcguccgct t 21 <210> 487 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 487 gcggacgccg acgagguggt t 21 <210> 488 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 488 caccucgucg gcguccgcct t 21 <210> 489 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 489 ggcggacgcc gacgaggugt t 21 <210> 490 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 490 accucgucgg cguccgccct t 21 <210> 491 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 491 gggcggacgc cgacgaggut t 21 <210> 492 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 492 ccucgucggc guccgcccgt t 21 <210> 493 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 493 cgggcggacg ccgacgaggt t 21 <210> 494 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 494 cucgucggcg uccgcccgat t 21 <210> 495 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 495 ucgggcggac gccgacgagt t 21 <210> 496 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 496 ucgucggcgu ccgcccgagt t 21 <210> 497 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 497 cucgggcgga cgccgacgat t 21 <210> 498 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 498 cgucggcguc cgcccgagut t 21 <210> 499 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 499 accgggcgg acgccgacgt t 21 <210> 500 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 500 gucggcgucc gcccgaguct t 21 <210> 501 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 501 gacucgggcg gacgccgact t 21 <210> 502 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 502 ucggcguccg cccgagucct t 21 <210> 503 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 503 ggacucgggc ggacgccgat t 21 <210> 504 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 504 gcguccgccc gagucccgt t 21 <210> 505 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 505 cggggacucg ggcggacgct t 21 <210> 506 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 506 cguccgcccg aguccccgct t 21 <210> 507 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 507 gcggggacuc gggcggacgt t 21 <210> 508 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 508 gcccgagucc ccgccucgct t 21 <210> 509 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 509 gcgaggcggg gacucgggct t 21 <210> 510 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 510 aacgccacaa ccaccgcgct t 21 <210> 511 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 511 gcgcgguggu ugguggcguut t 21 <210> 512 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 512 acgccacaac caccgcgcat t 21 <210> 513 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 513 ugcgcggugg uugggcgut t 21 <210> 514 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 514 cgccacaacc accgcgcact t 21 <210> 515 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 515 gugcgcggug gugguggcgt t 21 <210> 516 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 516 ccacaaccac cgcgcacggt t 21 <210> 517 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 517 ccgugcgcgg uggguugggt t 21 <210> 518 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 518 cacaaccacc gcgcacggct t 21 <210> 519 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 519 gccgugcgcg gugguugugt t 21 <210> 520 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 520 acaaccaccg cgcacggcct t 21 <210> 521 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 521 ggccgugcgc gggguugut t 21 <210> 522 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 522 augcgacccu ccgggacggt t 21 <210> 523 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 523 ccguccccgga gggucgcaut t 21 <210> 524 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 524 ugcgacccuc cgggacggct t 21 <210> 525 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 525 gccgucccgg agggucgcat t 21 <210> 526 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 526 gcgacccucc gggacggcct t 21 <210> 527 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 527 ggccgucccg gagggucgct t 21 <210> 528 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 528 gacccuccgg gacggccggt t 21 <210> 529 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 529 ccggccgucc cggaggguct t 21 <210> 530 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 530 acccuccggg acggccgggt t 21 <210> 531 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 531 cccggccguc ccggagggut t 21 <210> 532 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 532 ccuccgggac ggccggggct t 21 <210> 533 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 533 gccccggccg ucccggaggt t 21 <210> 534 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 534 agaaaguuug ccaaggcact t 21 <210> 535 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 535 gugccuuggc aaacuuucut t 21 <210> 536 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 536 gaaaguuugc caaggcacgt t 21 <210> 537 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 537 cgugccuugg caaacuuuct t 21 <210> 538 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 538 aaguuugcca aggcacgagt t 21 <210> 539 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 539 cucgugccuu ggcaaacuut t 21 <210> 540 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 540 aguuugccaa ggcacgagut t 21 <210> 541 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 541 acucgugccu uggcaaacut t 21 <210> 542 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 542 guuugccaag gcacgaguat t 21 <210> 543 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 543 uacucgugcc uuggcaaact t 21 <210> 544 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 544 uuugccaagg cacgaguaat t 21 <210> 545 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 545 uuacucgugc cuuggcaaat t 21 <210> 546 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 546 uugccaaggc acgaguaact t 21 <210> 547 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 547 guuacucgug ccuuggcaat t 21 <210> 548 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 548 ugccaaggca cgaguaacat t 21 <210> 549 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 549 uguuacucgu gccuuggcat t 21 <210> 550 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>550 gccaaggcac gaguaacaat t 21 <210> 551 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 551 uuguuacucg ugccuuggct t 21 <210> 552 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 552 acgcaguugg gcacuuuugt t 21 <210> 553 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 553 caaaagugcc caacugcgut t 21 <210> 554 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 554 cgcaguuggg cacuuuugat t 21 <210> 555 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 555 ucaaaagugc ccaacugcgt t 21 <210> 556 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 556 gcaguugggc acuuuugaat t 21 <210> 557 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 557 uucaaaaagug cccaacugct t 21 <210> 558 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 558 caguugggca cuuuugaagt t 21 <210> 559 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 559 cuucaaaagu gcccaacugt t 21 <210> 560 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 560 aguugggcac uuuugagat t 21 <210> 561 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 561 ucuucaaaaag ugcccaacut t 21 <210> 562 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 562 guugggcacu uuugaagaut t 21 <210> 563 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 563 aucuucaaaa gugcccaact t 21 <210> 564 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 564 uugggcacuu uugaagauct t 21 <210> 565 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 565 gaucuucaaa agugcccaat t 21 <210> 566 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 566 ugggcacuuu ugaagaucat t 21 <210> 567 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 567 ugaucuucaa aagugcccat t 21 <210> 568 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 568 gggcacuuuu gaagaucaut t 21 <210> 569 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 569 augaucuucaaaagugccct t 21 <210> 570 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 570 uugaagauca uuuucucagt t 21 <210> 571 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 571 cugagaaaau gaucuucaat t 21 <210> 572 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 572 gaagaucauu uucucagcct t 21 <210> 573 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 573 ggcugagaaa augaucuuct t 21 <210> 574 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 574 aagaucauuu ucucacccut t 21 <210> 575 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 575 aggcugagaa aaugaucuut t 21 <210> 576 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 576 cauuuucuca gccuccagat t 21 <210> 577 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 577 ucuggaggcu gagaaaaugt t 21 <210> 578 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 578 agccuccaga ggauguucat t 21 <210> 579 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 579 ugaacauccu cuggaggcut t 21 <210> 580 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>580 ccuccagagg auguucaut t 21 <210> 581 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 581 auugaacauc cucuggaggt t 21 <210> 582 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 582 cuccagagga uguucauat t 21 <210> 583 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 583 uauugaacau ccucuggagt t 21 <210> 584 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 584 agaggauguu caauaacugt t 21 <210> 585 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 585 caguuauuga acauccucut t 21 <210> 586 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 586 aggauguuca auaacugugt t 21 <210> 587 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 587 cacaguuauu gaacauccut t 21 <210> 588 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 588 uguucauaaa cugugaggut t 21 <210> 589 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 589 accucacagu uauugaacat t 21 <210> 590 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 590 uucauaacu gugagguggt t 21 <210> 591 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 591 ccaccucaca guuauugaat t 21 <210> 592 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 592 ucaauaacug ugagguggut t 21 <210> 593 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 593 accaccucac aguuauugat t 21 <210> 594 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 594 caauaacugu gagggugguct t 21 <210> 595 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 595 gaccaccuca caguuauugt t 21 <210> 596 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 596 aauaacugg agguggucct t 21 <210> 597 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 597 ggaccaccuc acaguuauut t 21 <210> 598 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 598 auaacuguga ggugguccut t 21 <210> 599 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 599 aggaccaccu cacaguuaut t 21 <210>600 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>600 uaacugugag gugguccuut t 21 <210> 601 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 601 aaggaccacc ucacaguuat t 21 <210> 602 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>602 acugugaggu gguccuuggt t 21 <210> 603 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 603 ccaaggacca ccucacagut t 21 <210> 604 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 604 ugugaggugg uccuugggat t 21 <210> 605 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 605 ucccaaggac caccucacat t 21 <210> 606 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 606 gugagguggu ccuugggaat t 21 <210> 607 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 607 uucccaaagga ccaccucact t 21 <210> 608 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 608 ugguccuugg gaauuuggat t 21 <210> 609 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 609 uccaaauucc caaggaccat t 21 <210> 610 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>610 uugggaauuu ggaaauuact t 21 <210> 611 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 611 guaauuucca aauuccaat t 21 <210> 612 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 612 ugggaauuug gaaauuacct t 21 <210> 613 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 613 gguaauuucc aaauucccat t 21 <210> 614 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 614 gggaauuugg aaauuaccut t 21 <210> 615 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 615 agguaauuuc caaauuccct t 21 <210> 616 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 616 ggaauuugga aauuaccuat t 21 <210> 617 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 617 uagguaauuu ccaaauucct t 21 <210> 618 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 618 agaggaauua ugaucuuuct t 21 <210> 619 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 619 gaaagaucau aauuccucut t 21 <210>620 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>620 gaggaauuau gaucuuucct t 21 <210> 621 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 621 ggaaagauca uaauuccuct t 21 <210> 622 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 622 aauuaugauc uuuccuucut t 21 <210> 623 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 623 agaaggaaag aucauaauut t 21 <210> 624 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 624 auuaugaucu uuccuucuut t 21 <210> 625 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 625 aagaaggaaa gaucauaaut t 21 <210> 626 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 626 uaugaucuuu ccuucuuaat t 21 <210> 627 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 627 uuaagaagga aagaucauat t 21 <210> 628 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 628 ugaucuuucc uucuuaaagt t 21 <210> 629 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 629 cuuuaagaag gaaagaucat t 21 <210>630 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>630 ucuuuccuuc uuaaagacct t 21 <210> 631 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 631 ggucuuuaag aaggaaagat t 21 <210> 632 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 632 ccuucuuaaa gaccauccat t 21 <210> 633 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 633 uggauggucu uuaagaaggt t 21 <210> 634 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 634 cuucuuaaag accauccagt t 21 <210> 635 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 635 cuggaugguc uuuaagaagt t 21 <210> 636 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 636 ucuuaaagac cauccaggat t 21 <210> 637 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 637 uccuggaugg ucuuuaagat t 21 <210> 638 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 638 uuaaaagacca uccagggaggt t 21 <210> 639 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 639 ccuccuggau ggucuuuaat t 21 <210>640 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>640 uaaaagaccau ccaggaggut t 21 <210> 641 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 641 accuccugga uggucuuuat t 21 <210> 642 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 642 ccaggagggggcugguuaut t 21 <210> 643 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 643 auaaccagcc accuccuggt t 21 <210> 644 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 644 caggaggugg cugguuaugt t 21 <210> 645 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 645 cauaaccagc caccuccugt t 21 <210> 646 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 646 aggaggguggc ugguuaugut t 21 <210> 647 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 647 acauaaccag ccaccuccut t 21 <210> 648 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 648 ggagguggcu gguuauguct t 21 <210> 649 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 649 gacauaacca gccaccucct t 21 <210>650 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>650 gagggggcug guuaugucct t 21 <210> 651 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 651 ggacauaacc agccaccuct t 21 <210> 652 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 652 agguggcugg uuauguccut t 21 <210> 653 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 653 aggacauaac cagccaccut t 21 <210> 654 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 654 guggcuggu auguccucat t 21 <210> 655 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>655 ugaggacaua accagccact t 21 <210> 656 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 656 gcccucaaca caguggagct t 21 <210> 657 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 657 gcuccacugu guugagggct t 21 <210> 658 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 658 uuccuuugga aaaaccugcat t 21 <210> 659 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 659 ugcagguuuu ccaaaggaat t 21 <210>660 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>660 uccuuuggaa aaccugcagt t 21 <210> 661 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 661 cugcagguuu uccaaaggat t 21 <210> 662 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 662 gaaaaccugc agaucaucat t 21 <210> 663 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 663 ugaugaucug cagguuuuct t 21 <210> 664 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 664 aaaaccugca gaucaucagt t 21 <210> 665 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 665 cugaugaucu gcagguuuut t 21 <210> 666 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 666 aaccugcaga ucaucagagt t 21 <210> 667 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 667 cucugaugau cugcagguut t 21 <210> 668 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 668 cugcagauca ucagaggaat t 21 <210> 669 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 669 uuccucugau gaucugcagt t 21 <210>670 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>670 gaaaauuccu augccuuagt t 21 <210> 671 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 671 cuaaggcaua ggaauuuuct t 21 <210> 672 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 672 aaaauuccua ugccuuagct t 21 <210> 673 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 673 gcuaaggcau aggaauuuut t 21 <210> 674 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 674 aauuccuaug ccuuagcagt t 21 <210> 675 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 675 cugcuaaggc auaggaaut t 21 <210> 676 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 676 uccuaugccu uagcagucut t 21 <210> 677 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 677 agacuagcuaa ggcauaggat t 21 <210> 678 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 678 ccuaugccuu agcagucuut t 21 <210> 679 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 679 aagacugcua aggcauaggt t 21 <210>680 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>680 cuaugccuua gcagucuuat t 21 <210> 681 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 681 uaagacugcu aaggcauagt t 21 <210> 682 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 682 augccuuagc agucuuauct t 21 <210> 683 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 683 gauaagacug cuaaggcaut t 21 <210> 684 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 684 ugccuuagca gucuuaucut t 21 <210> 685 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 685 agauaagacu gcuaaggcat t 21 <210> 686 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 686 gccuuagcag ucuuaucuat t 21 <210> 687 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 687 uagauaagac ugcuaaggct t 21 <210> 688 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 688 ccuuagcagu cuuaucuaat t 21 <210> 689 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 689 uuagauaaga cugcuaaggt t 21 <210> 690 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>690 cuuagcaguc uuaucuaact t 21 <210> 691 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 691 guuagauaag acugcuaagt t 21 <210> 692 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 692 uuagcagucu uaucuaacut t 21 <210> 693 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 693 aguuagauaa gacugcuaat t 21 <210> 694 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 694 uagcagucuu aucuaacuat t 21 <210> 695 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 695 uaguuagaua agacugcuat t 21 <210> 696 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 696 agcagucuua ucuaacuaut t 21 <210> 697 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 697 auaguuagau aagacugcut t 21 <210> 698 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 698 gcagucuuau cuaacuaugt t 21 <210> 699 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 699 cauaguuaga uaagacugct t 21 <210>700 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 700 cagucuuauc uaacuaugat t 21 <210> 701 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 701 ucauaguuag auaagacugt t 21 <210> 702 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 702 ucuuaucuaa cuaugaugct t 21 <210> 703 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 703 gcaucauagu uagauaagat t 21 <210> 704 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 704 cuuaucuaac uaugaugcat t 21 <210> 705 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 705 ugcaucauag uuagauaagt t 21 <210> 706 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 706 uuaucuacu augaugcaat t 21 <210> 707 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 707 uugcaucaua guuagauaat t 21 <210> 708 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 708 uaucuaacua ugaugcaaat t 21 <210> 709 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 709 uuugcaucau aguuagauat t 21 <210> 710 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>710 aucuaacuau gaugcaaaut t 21 <210> 711 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 711 auuugcauca uaguuagaut t 21 <210> 712 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 712 ucuaacuaug augcaaauat t 21 <210> 713 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 713 uauuugcauc auaguuagat t 21 <210> 714 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 714 cuaacuauga ugcaaauaat t 21 <210> 715 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 715 uuauuugcau cauaguuagt t 21 <210> 716 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 716 aacuaugaug caaauaaaat t 21 <210> 717 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 717 uuuuauuugc aucauaguut t 21 <210> 718 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 718 gaugcaaaua aaaccggact t 21 <210> 719 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 719 guccgguuuu auuugcauct t 21 <210> 720 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>720 augcaaaauaa aaccggacut t 21 <210> 721 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 721 aguccgguuu uauuugcaut t 21 <210> 722 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 722 ugcaaauaaa accggacugt t 21 <210> 723 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 723 caguccgguu uuauuugcat t 21 <210> 724 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 724 caaauaaaac cggacugaat t 21 <210> 725 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 725 uucaguccgg uuuuauuugt t 21 <210> 726 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 726 aaauaaaacc ggacugaagt t 21 <210> 727 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 727 cuucaguccg guuuuauuut t 21 <210> 728 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 728 aauaaaaccg gacugaaggt t 21 <210> 729 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 729 ccuucagucc gguuuuauut t 21 <210>730 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>730 uaaaaccggga cugaaggagt t 21 <210> 731 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 731 cuccuucagu ccgguuuuat t 21 <210> 732 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 732 aaaaccggac ugaaggagct t 21 <210> 733 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 733 gcuccuucag uccgguuuut t 21 <210> 734 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 734 aaaacgggacu gaaggagcut t 21 <210> 735 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 735 agcuccuuca guccgguuut t 21 <210> 736 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 736 aaccggacug aaggagcugt t 21 <210> 737 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 737 cagcuccuuc aguccggguut t 21 <210> 738 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 738 aggagcugcc caugagaaat t 21 <210> 739 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 739 uuucucaugg gcagcuccut t 21 <210>740 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>740 uacaggaaau ccugcauggt t 21 <210> 741 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 741 ccaugcagga uuuccuguat t 21 <210> 742 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 742 aggaaauccu gcauggcgct t 21 <210> 743 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 743 gcgccaugca ggauuuccut t 21 <210> 744 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 744 ggaaauccug cauggcgcct t 21 <210> 745 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 745 ggcgccaugc aggauuucct t 21 <210> 746 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 746 gaaauccugc auggcgccgt t 21 <210> 747 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 747 cggcgccaug caggauuuct t 21 <210> 748 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 748 aaauccugca uggcgccgut t 21 <210> 749 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 749 acggcgccau gcaggauuut t 21 <210>750 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>750 aauccugcau ggcgccgugt t 21 <210> 751 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 751 cacggcgcca ugcaggauut t 21 <210> 752 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 752 uccugcaugg cgccgugcgt t 21 <210> 753 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 753 cgcacggcgc caugcaggat t 21 <210> 754 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 754 cugcauggcg ccgugcggut t 21 <210> 755 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 755 accgcacggc gccaugcagt t 21 <210> 756 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 756 ugcauggcgc cgugcgguut t 21 <210> 757 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 757 aaccgcacgg cgccaugcat t 21 <210> 758 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 758 gcauggcgcc gugcggguuct t 21 <210> 759 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 759 gaaccgcacg gcgccaugct t 21 <210>760 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>760 auggcgccgu gcgguucagt t 21 <210> 761 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 761 cugaaccgca cggcgccaut t 21 <210> 762 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 762 uggcgccgug cgguucagct t 21 <210> 763 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 763 gcugaaccgc acggcgccat t 21 <210> 764 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 764 ggcgccgugc gguucagcat t 21 <210> 765 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 765 ugcugaaccg cacggcgcct t 21 <210> 766 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 766 gcgccgugcg guucagcaat t 21 <210> 767 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 767 uugcugaacc gcacggcgct t 21 <210> 768 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 768 cgccgugcgg uucagcaact t 21 <210> 769 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 769 guugcugaac cgcacggcgt t 21 <210> 770 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>770 gccgugcggu ucagcaacat t 21 <210> 771 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 771 uguugcugaa ccgcacggct t 21 <210> 772 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 772 ccgugcgguu cagcaacaat t 21 <210> 773 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 773 uuguugcuga accgcacggt t 21 <210> 774 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 774 gugcggguuca gcaacacacct t 21 <210> 775 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 775 gguuguugcu gaaccgcact t 21 <210> 776 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 776 gcgguucagc aacaacccut t 21 <210> 777 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 777 aggguuguug cugaaccgct t 21 <210> 778 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 778 gguucagcaa caacccugct t 21 <210> 779 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 779 gcaggguugu ugcugaacct t 21 <210> 780 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>780 gcaacaaccc ugcccugugt t 21 <210> 781 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 781 cacaggggcag gguuguugct t 21 <210> 782 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 782 aacaacccug cccugucat t 21 <210> 783 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 783 ugcacagggc aggguuguut t 21 <210> 784 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 784 acguggagag cauccagugt t 21 <210> 785 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 785 cacuggaugc ucuccacgut t 21 <210> 786 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 786 cguggagagc auccaguggt t 21 <210> 787 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 787 ccacuggaug cucuccacgt t 21 <210> 788 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 788 guggagagca uccaguggct t 21 <210> 789 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 789 gccacuggau gcucuccact t 21 <210> 790 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 790 gagagcaucc aguggcgggt t 21 <210> 791 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 791 cccgccacug gaugcucuct t 21 <210> 792 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 792 agagcaucca guggcgggat t 21 <210> 793 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 793 ucccgccacu ggaugcucut t 21 <210> 794 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 794 gagcauccag uggcgggact t 21 <210> 795 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 795 gucccgccac uggaugcuct t 21 <210> 796 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 796 caguggcggg acauagucat t 21 <210> 797 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 797 ugacuauguc ccgccacugt t 21 <210> 798 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 798 aguggcggga cauagucagt t 21 <210> 799 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 799 cugacuaugu cccgccacut t 21 <210>800 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>800 uggcgggaca uagucagcat t 21 <210> 801 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 801 ugcugacuau gucccgccat t 21 <210> 802 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 802 ggcgggacau agucagcagt t 21 <210> 803 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 803 cugcugacua ugucccgcct t 21 <210> 804 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 804 cucagcaaca ugucgauggt t 21 <210> 805 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 805 ccaucgacau guugcugagt t 21 <210> 806 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 806 cagcaacaug ucgauggact t 21 <210> 807 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 807 guccaucgac auguugcugt t 21 <210> 808 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 808 agcaacaugu cgauggacut t 21 <210> 809 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 809 aguccaucga cauguugcut t 21 <210> 810 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>810 gcaacauguc gauggacuut t 21 <210> 811 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 811 aaguccaucg acauguugct t 21 <210> 812 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 812 aacaugucga uggacuucct t 21 <210> 813 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 813 ggaaguccau cgacauguut t 21 <210> 814 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 814 acaugucgau ggacuuccat t 21 <210> 815 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 815 uggaagucca ucgacaugut t 21 <210> 816 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 816 caugucgaug gacuuccagt t 21 <210> 817 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 817 cuggaagucc aucgacaugt t 21 <210> 818 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 818 augucgaugg acuuccagat t 21 <210> 819 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 819 ucuggaaguc caucgacaut t 21 <210>820 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>820 ucgauggacu ucgaacct t 21 <210> 821 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 821 gguucuggaa guccaucgat t 21 <210> 822 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 822 gaaccaccug ggcagcugct t 21 <210> 823 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 823 gcagcugccc aggugguuct t 21 <210> 824 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 824 gggcagcugc caaaagugut t 21 <210> 825 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 825 acacuuuugg cagcugccct t 21 <210> 826 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 826 gcagcugcca aaagugugat t 21 <210> 827 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 827 ucacacuuuu ggcagcugct t 21 <210> 828 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 828 ugccaaaagu gugauccaat t 21 <210> 829 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 829 uuggaucaca cuuuuggcat t 21 <210>830 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>830 gccaaaagug ugauccaagt t 21 <210> 831 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 831 cuuggaucac acuuuuggct t 21 <210> 832 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 832 ccaaaaagugu gauccaagct t 21 <210> 833 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 833 gcuuggauca cacuuuuggt t 21 <210> 834 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 834 aaaagugugau ccaagcugut t 21 <210> 835 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 835 acagcuugga ucacacuuut t 21 <210> 836 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 836 ugugauccaa gcugucccat t 21 <210> 837 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 837 ugggacagcu uggaucacat t 21 <210> 838 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 838 gugauccaag cugucccaat t 21 <210> 839 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 839 uugggacagc uuggaucact t 21 <210>840 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>840 gauccaagcu gucccaaugt t 21 <210> 841 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 841 cauugggaca gcuuggauct t 21 <210> 842 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 842 auccaagcug ucccaauggt t 21 <210> 843 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 843 ccauugggac agcuuggaut t 21 <210> 844 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 844 uccaagcugu cccaaugggt t 21 <210> 845 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 845 cccauuggga cagcuuggat t 21 <210> 846 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 846 ccaaagcuguc ccaaugggat t 21 <210> 847 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 847 ucccauggg acagcuuggt t 21 <210> 848 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 848 caagcugucc caaugggagt t 21 <210> 849 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 849 cucccauugg gacagcuugt t 21 <210>850 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>850 agcuguccca augggagcut t 21 <210> 851 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 851 agcucccauu gggacagcut t 21 <210> 852 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 852 ugucccaaug ggagcugcut t 21 <210> 853 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 853 agcagcuccc auugggacat t 21 <210> 854 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 854 ggugcaggag aggagaacut t 21 <210> 855 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>855 agucuccuc uccugcacct t 21 <210> 856 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 856 aaacugacca aaaucaucut t 21 <210> 857 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 857 agaugauuuu ggucaguuut t 21 <210> 858 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 858 aacugaccaa aaucaucugt t 21 <210> 859 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 859 cagaugauuu uggucaguut t 21 <210>860 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>860 acugaccaaa aucaucugut t 21 <210> 861 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 861 acagaugauu uuggucagut t 21 <210> 862 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 862 accaaauca ucuugccct t 21 <210> 863 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 863 gggcacagau gauuuuggut t 21 <210> 864 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 864 ccaaaaaucau cugugcccat t 21 <210> 865 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 865 ugggcacaga ugauuuuggt t 21 <210> 866 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 866 aaaucaucug ugcccagcat t 21 <210> 867 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 867 ugcugggcac agaugauuut t 21 <210> 868 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 868 gugcccagca gugcuccggt t 21 <210> 869 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 869 ccggagcacu gcugggcact t 21 <210>870 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>870 gcccagcagu gcuccgggct t 21 <210> 871 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 871 gcccggagca cugcugggct t 21 <210> 872 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 872 ccaguacug cugccacaat t 21 <210> 873 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 873 uugggcagc agucacuggt t 21 <210> 874 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 874 cagugacugc ugccacaact t 21 <210> 875 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 875 guugggcag cagucacugt t 21 <210> 876 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 876 gagagcgacu gccuggucut t 21 <210> 877 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 877 agaccaggca gucgcucuct t 21 <210> 878 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 878 agagcgacug ccuggucugt t 21 <210> 879 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 879 cagaccaggc agucgcucut t 21 <210>880 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>880 gagcgacugc cuggucugct t 21 <210> 881 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 881 gcagaccagg cagucgcuct t 21 <210> 882 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 882 agcgacugcc uggucugcct t 21 <210> 883 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 883 ggcagaccag gcagucgcut t 21 <210> 884 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 884 gcgacugccu ggucugccgt t 21 <210> 885 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 885 cggcagacca ggcagucgct t 21 <210> 886 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 886 cgacugccug gucugccgct t 21 <210> 887 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 887 gcggcagacc aggcagucgt t 21 <210> 888 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 888 gccuggucug ccgcaaauut t 21 <210> 889 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 889 aauuugcggc agaccaggct t 21 <210> 890 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>890 ccuggucugc cgcaaauuct t 21 <210> 891 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 891 gaauuugcgg cagaccaggt t 21 <210> 892 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 892 cuggucugcc gcaaauucct t 21 <210> 893 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 893 ggaauuugcg gcagaccagt t 21 <210> 894 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 894 uggucugccg caaauuccgt t 21 <210> 895 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 895 cggaauuugc ggcagaccat t 21 <210> 896 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 896 gucugccgca aauuccgagt t 21 <210> 897 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 897 cucggaauuu gcggcagact t 21 <210> 898 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 898 ucugccgcaa auuccgagat t 21 <210> 899 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 899 ucucgggaauu ugcggcagat t 21 <210>900 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 900 cugccgcaaa uuccgagact t 21 <210> 901 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 901 guccgggaau uugcggcagt t 21 <210> 902 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 902 ugccgcaaau uccgagacgt t 21 <210> 903 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 903 cgucucggaa uuugcggcat t 21 <210> 904 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 904 ccgcaaauuc cgagacgaat t 21 <210> 905 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 905 uucgucucgg aauuugcggt t 21 <210> 906 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 906 aauuccgaga cgaagccact t 21 <210> 907 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 907 guggcuucgu cucgggaauut t 21 <210> 908 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 908 auuccgagac gaagccacgt t 21 <210> 909 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 909 cguggcuucg ucucggaaut t 21 <210> 910 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>910 uuccgagacg aagccacgut t 21 <210> 911 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 911 acguggcuuc guccgggaat t 21 <210> 912 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 912 uccgagacga agccacgugt t 21 <210> 913 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 913 cacguggcuu cgucucggat t 21 <210> 914 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 914 ccgagacgaa gccacgugct t 21 <210> 915 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 915 gcacguggcu ucgucucggt t 21 <210> 916 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 916 gagacgaagc cacgugcaat t 21 <210> 917 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 917 uugcacgugg cuucgucuct t 21 <210> 918 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 918 acgaagccac gugcaaggat t 21 <210> 919 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 919 uccuugcacg uggcuucgut t 21 <210> 920 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>920 cgaagccacg ugcaaggact t 21 <210> 921 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 921 guccuugcac guggcuucgt t 21 <210> 922 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 922 gaagccacgu gcaaggacat t 21 <210> 923 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 923 uguccuugca cguggcuuct t 21 <210> 924 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 924 aagccacgug caaggacact t 21 <210> 925 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 925 guguccuugc acguggcuut t 21 <210> 926 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 926 ccccacucau gcucuacaat t 21 <210> 927 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 927 uuguagagca ugagggggt t 21 <210> 928 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 928 ccacucaugc ucuacaacct t 21 <210> 929 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 929 gguuguagag caugaguggt t 21 <210> 930 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>930 acucaugcuc uacaacccct t 21 <210> 931 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 931 gggguuguag agcaugagut t 21 <210> 932 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 932 caugcucuac aaccccacct t 21 <210> 933 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 933 gguggggguug uagagcaugt t 21 <210> 934 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 934 ccagauggau gugaacccct t 21 <210> 935 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 935 gggguucaca uccaucuggt t 21 <210> 936 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 936 agauggaugu gaacccccgat t 21 <210> 937 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 937 ucggggguuca cauccaucut t 21 <210> 938 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 938 gauggauug aacccgagt t 21 <210> 939 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 939 cucggggguuc acauccauct t 21 <210> 940 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>940 auggauguga accccgaggt t 21 <210> 941 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 941 ccucggggguu cacauccaut t 21 <210> 942 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 942 ggaugugaac cccgagggct t 21 <210> 943 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 943 gcccucgggg uucacaucct t 21 <210> 944 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 944 gaugugaacc ccgagggcat t 21 <210> 945 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 945 ugcccccggg guucacauct t 21 <210> 946 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 946 ugugaacccc gagggcaaat t 21 <210> 947 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 947 uuugccccg ggguucacat t 21 <210> 948 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 948 aacccgagg gcaaauacat t 21 <210> 949 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 949 uguauuugcc cucggggguut t 21 <210> 950 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>950 accccgaggg caaauacagt t 21 <210> 951 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 951 cuguauuugc ccucggggut t 21 <210> 952 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 952 cccgagggca aauacagcut t 21 <210> 953 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 953 agcuguauuu gcccucgggt t 21 <210> 954 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 954 ccgaggggcaa auacagcuut t 21 <210> 955 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 955 aagcuguauu ugccccggt t 21 <210> 956 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 956 cgagggcaaa uacagcuuut t 21 <210> 957 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 957 aaagcuguau uugcccucgt t 21 <210> 958 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 958 aaaauacagcu uuggugccat t 21 <210> 959 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 959 uggcaccaaa gcuguauuut t 21 <210> 960 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>960 aauacagcuu uggugccact t 21 <210> 961 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 961 guggcaccaa agcuguauut t 21 <210> 962 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 962 auacagcuuu ggugccacct t 21 <210> 963 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 963 gguggcacca aagcuguaut t 21 <210> 964 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 964 cuuuggugcc accugcgugt t 21 <210> 965 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 965 cacgcaggug gcaccaaagt t 21 <210> 966 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 966 uuggugccac cugcgugaat t 21 <210> 967 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 967 uucacgcagg uggcaccaat t 21 <210> 968 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 968 ccaccugcgu gaagaagugt t 21 <210> 969 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 969 cacuucuuca cgcagguggt t 21 <210> 970 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>970 cugcgugaag aaguguccct t 21 <210> 971 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 971 gggacacuuc uucacgcagt t 21 <210> 972 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 972 ugcgugaaga agugucccct t 21 <210> 973 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 973 ggggacacuu cuucacgcat t 21 <210> 974 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 974 gcgugaagaa guguccccgt t 21 <210> 975 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 975 cggggacacu ucuucacgct t 21 <210> 976 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 976 cgugaagaag uguccccgut t 21 <210> 977 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 977 acggggacac uucuucacgt t 21 <210> 978 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 978 gugaagaagu guccccguat t 21 <210> 979 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 979 uacggggaca cuucuucact t 21 <210> 980 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>980 ugaagaagug uccccguaat t 21 <210> 981 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 981 uuacggggac acuucuucat t 21 <210> 982 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 982 gaagaagugu ccccguaaut t 21 <210> 983 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 983 auuacgggga cacuucuuct t 21 <210> 984 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 984 aagaaguguc cccguaauut t 21 <210> 985 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 985 aauuacgggg acacuucuut t 21 <210> 986 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 986 agaagugucc ccguaauuat t 21 <210> 987 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 987 uaauuacggg gacacuucut t 21 <210> 988 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 988 gaaguguccc cguaauuaut t 21 <210> 989 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 989 auaauuacgg ggacacuuct t 21 <210> 990 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>990 aagugucccc guaauuaugt t 21 <210> 991 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 991 cauaauuacg gggacacuut t 21 <210> 992 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 992 aguguccccg uaauuaugut t 21 <210> 993 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 993 acauaauuac ggggacacut t 21 <210> 994 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 994 guguccccgu aauuauugt t 21 <210> 995 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 995 cacauaauua cggggacact t 21 <210> 996 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 996 uguccccgua auuaugggt t 21 <210> 997 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 997 ccacauaauu acgggggacat t 21 <210> 998 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 998 guccccguaa uuauguggut t 21 <210> 999 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 999 accacauaau uacggggact t 21 <210> 1000 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1000 ccccguaauu auguggugat t 21 <210> 1001 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1001 ucaccacaua auuacggggt t 21 <210> 1002 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1002 ccguaauuau guggugacat t 21 <210> 1003 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1003 ugucaccaca uaauuacggt t 21 <210> 1004 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1004 guaauuaugu ggugacagat t 21 <210> 1005 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1005 ucugucacca cauaauuact t 21 <210> 1006 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1006 uaauuauugug gugacagaut t 21 <210> 1007 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1007 aucugucacc acauaauuat t 21 <210> 1008 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1008 aauuauggg ugacagauct t 21 <210> 1009 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1009 gaucugucac cacauaauut t 21 <210> 1010 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1010 auuauuggu gacagaucat t 21 <210> 1011 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1011 ugaucuguca ccacauaaut t 21 <210> 1012 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1012 uuaugggug acagaucact t 21 <210> 1013 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1013 gugaucuguc accacauaat t 21 <210> 1014 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1014 auguggugac agaucacggt t 21 <210> 1015 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1015 ccgugaucug ucaccacaut t 21 <210> 1016 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1016 uggugacaga ucacggcuct t 21 <210> 1017 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1017 gagccgugau cugucaccat t 21 <210> 1018 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1018 gugacagauc acggcucgut t 21 <210> 1019 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1019 acgagccgug aucugucact t 21 <210> 1020 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1020 ugacagauca cggcucgugt t 21 <210> 1021 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1021 cacgagccgu gaucugucat t 21 <210> 1022 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1022 gacagaucac ggcucgugct t 21 <210> 1023 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1023 gcacgagccg ugaucuguct t 21 <210> 1024 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1024 acagaucacg gcucgugcgt t 21 <210> 1025 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1025 cgcacgagcc gugaucugut t 21 <210> 1026 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1026 cagaucacgg cucgugcgut t 21 <210> 1027 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1027 acgcacgagc cgugaucugt t 21 <210> 1028 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1028 agaucacggc ucgugcguct t 21 <210> 1029 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1029 gacgcacgag ccgugaucut t 21 <210> 1030 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1030 gaucacggcu cgugcgucct t 21 <210> 1031 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1031 ggacgcacga gccgugauct t 21 <210> 1032 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1032 aucacggcuc gugcguccgt t 21 <210> 1033 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1033 cggacgcacg agccgugaut t 21 <210> 1034 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1034 ucacggcucg ugcguccgat t 21 <210> 1035 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1035 ucggacgcac gagccgugat t 21 <210> 1036 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1036 cacggcucgu gcguccgagt t 21 <210> 1037 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1037 cucggacgca cgagccgugt t 21 <210> 1038 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1038 acggcucgug cguccgagct t 21 <210> 1039 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1039 gcucggacgc acgagccgut t 21 <210> 1040 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1040 gcuccugcgu ccgagccugt t 21 <210> 1041 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1041 caggcucggga cgcacgagct t 21 <210> 1042 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1042 gggaggagac ggcguccgct t 21 <210> 1043 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1043 gcggacgccg ucuuccucct t 21 <210> 1044 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1044 gaggaagacg gcguccgcat t 21 <210> 1045 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1045 ugcggacgcc gucuuccuct t 21 <210> 1046 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1046 ggaagacggc guccgcaagt t 21 <210> 1047 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1047 cuugcggacg ccgucuucct t 21 <210> 1048 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1048 gaagacggcg uccgcaagut t 21 <210> 1049 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1049 acuugcggac gccgucuuct t 21 <210> 1050 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400>1050 aagacggcgu ccgcaagugt t 21 <210> 1051 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1051 cacuugcgga cgccgucuut t 21 <210> 1052 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1052 gacggcgucc gcaaguguat t 21 <210> 1053 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1053 uacacuugcg gacgccguct t 21 <210> 1054 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1054 acggcguccg caaguguaat t 21 <210> 1055 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1055 uuacacuugc ggacgccgut t 21 <210> 1056 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1056 gcguccgcaa guguaagaat t 21 <210> 1057 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1057 uucuuacacu ugcggacgct t 21 <210> 1058 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1058 cguccgcaag uguaagaagt t 21 <210> 1059 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1059 cuucuuacac uugcggacgt t 21 <210> 1060 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1060 guccgcaagu guaagaagut t 21 <210> 1061 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1061 acuucuuaca cuugcggact t 21 <210> 1062 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1062 uccgcaagug uaagaagugt t 21 <210> 1063 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1063 cacuucuuac acuugcggat t 21 <210> 1064 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1064 ccgcaagugu aagaagugct t 21 <210> 1065 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1065 gcacuucuua cacuugcggt t 21 <210> 1066 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1066 cgcaagugua agaagugcgt t 21 <210> 1067 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1067 cgcacuucuu acacuugcgt t 21 <210> 1068 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1068 gcaaguguaa gaagugcgat t 21 <210> 1069 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1069 ucgcacuucu uacacuugct t 21 <210> 1070 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1070 aaguguaaga agugcgaagt t 21 <210> 1071 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1071 cuucgcacuu cuuacacuut t 21 <210> 1072 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1072 aguguaagaa gugcgaaggt t 21 <210> 1073 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1073 ccuucgcacu ucuuacacut t 21 <210> 1074 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1074 guguaagaag ugcgaagggt t 21 <210> 1075 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1075 cccuucgcac uucuuacact t 21 <210> 1076 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1076 uguaagaagu gcgaagggct t 21 <210> 1077 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1077 gcccuucgca cuucuuacat t 21 <210> 1078 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1078 guaagaagug cgaagggcct t 21 <210> 1079 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1079 ggcccuucgc acuucuuact t 21 <210> 1080 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1080 uaagaagugc gaagggccut t 21 <210> 1081 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1081 aggcccuucg cacuucuuat t 21 <210> 1082 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1082 aagaagugcg aagggccuut t 21 <210> 1083 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1083 aaggcccuuc gcacuucuut t 21 <210> 1084 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1084 agaagugcga agggccuugt t 21 <210> 1085 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1085 caaggcccuu cgcacuucut t 21 <210> 1086 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1086 agugcgaagg gccuugccgt t 21 <210> 1087 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1087 cggcaaggcc cuucgcacut t 21 <210> 1088 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1088 gugcgaaggg ccuugccgct t 21 <210> 1089 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1089 gcggcaaggc ccuucgcact t 21 <210> 1090 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1090 ugcgaagggc cuugccgcat t 21 <210> 1091 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1091 ugcggcaagg cccuucgcat t 21 <210> 1092 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1092 gcgaagggcc uugccgcaat t 21 <210> 1093 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1093 uugcggcaag gcccuucgct t 21 <210> 1094 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1094 cgaagggccu ugccgcaaat t 21 <210> 1095 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1095 uuugcggcaa ggcccuucgt t 21 <210> 1096 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1096 aagggccuug ccgcaaagut t 21 <210> 1097 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1097 acuuugcggc aaggcccuut t 21 <210> 1098 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1098 agggccuugc cgcaaagugt t 21 <210> 1099 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1099 cacuuugcgg caaggcccut t 21 <210> 1100 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1100 gggccuugcc gcaaagugut t 21 <210> 1101 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1101 acacuuugcg gcaaggccct t 21 <210> 1102 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1102 ggccuugccg caaaguggt t 21 <210> 1103 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1103 cacacuuugc ggcaaggcct t 21 <210> 1104 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1104 gccuugccgc aaagugugut t 21 <210> 1105 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1105 acacacuuug cggcaaggct t 21 <210> 1106 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1106 cuugccgcaa aguguguaat t 21 <210> 1107 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1107 uuacacacuu ugcggcaagt t 21 <210> 1108 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1108 ggaauaggua uuggugaaut t 21 <210> 1109 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1109 auucaccaau accuauucct t 21 <210> 1110 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1110 gaauagguau uggugaauut t 21 <210> 1111 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1111 aauucaccaa uaccuauuct t 21 <210> 1112 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1112 aauagguauu ggugaauuut t 21 <210> 1113 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1113 aaauucacca auaccuauut t 21 <210> 1114 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1114 auagguauug gugaauuuat t 21 <210> 1115 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1115 uaaauucacc aauaccuaut t 21 <210> 1116 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1116 agguauuggu gaauuuaaat t 21 <210> 1117 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1117 uuuaaauuca ccaauaccut t 21 <210> 1118 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1118 gguauuggug aauuuaaagt t 21 <210> 1119 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1119 cuuuaaauuc accaauacct t 21 <210> 1120 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1120 cacucuccau aaaugcuact t 21 <210> 1121 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1121 guagcauuua uggagagugt t 21 <210> 1122 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1122 uuaaacacuu caaaaacugt t 21 <210> 1123 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1123 caguuuuuga aguguuuaat t 21 <210> 1124 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1124 cuucaaaaac ugcaccucct t 21 <210> 1125 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1125 ggaggugcag uuuuugaagt t 21 <210> 1126 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1126 uucaaaaacu gcaccuccat t 21 <210> 1127 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1127 uggagggugca guuuuugaat t 21 <210> 1128 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1128 ucaaaaacug caccuccaut t 21 <210> 1129 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1129 auggagggugc aguuuuugat t 21 <210> 1130 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1130 caaaaacugc accuccauct t 21 <210> 1131 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1131 gauggaggg caguuuuugt t 21 <210> 1132 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1132 aaaaacugca ccuccaucat t 21 <210> 1133 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1133 ugauggaggu gcaguuuuut t 21 <210> 1134 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1134 acugcaccuc caucaguggt t 21 <210> 1135 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1135 ccacugaugg aggugcagut t 21 <210> 1136 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1136 caccuccauc aguggcgaut t 21 <210> 1137 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1137 aucgccacug auggaggggt t 21 <210> 1138 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1138 accuccauca guggcgauct t 21 <210> 1139 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1139 gaucgccacu gauggaggut t 21 <210> 1140 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1140 cuccaucagu ggcgaucuct t 21 <210> 1141 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1141 gagaucgcca cugauggagt t 21 <210> 1142 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1142 caucaguggc gaucuccact t 21 <210> 1143 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1143 guggagaucg ccacugaugt t 21 <210> 1144 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1144 uggcgaucuc cacauccugt t 21 <210> 1145 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1145 caggauggg agaucgccat t 21 <210> 1146 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1146 ggcgaucucc acauccugct t 21 <210> 1147 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1147 gcaggauugggaucgcct t 21 <210> 1148 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1148 gcgaucucca cauccugcct t 21 <210> 1149 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1149 ggcaggaugu ggagaucgct t 21 <210> 1150 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1150 cgaucuccac auccugccgt t 21 <210> 1151 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1151 cggcaggaug uggagaucgt t 21 <210> 1152 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1152 gaucuccaca uccugccggt t 21 <210> 1153 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1153 ccggcaggau guggagauct t 21 <210> 1154 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1154 ccacauccug ccgguggcat t 21 <210> 1155 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1155 ugccaccggc aggauguggt t 21 <210> 1156 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1156 cacauccugc cgguggcaut t 21 <210> 1157 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1157 augccaccgg caggauugt t 21 <210> 1158 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1158 acauccugcc gguggcauut t 21 <210> 1159 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1159 aaugccaccg gcaggaugut t 21 <210> 1160 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1160 auccugccgg uggcauuuat t 21 <210> 1161 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1161 uaaaugccac cggcaggaut t 21 <210> 1162 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1162 cugccggugg cauuuagggt t 21 <210> 1163 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1163 cccuaaaugc caccggcagt t 21 <210> 1164 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1164 ugccgguggc auuuaggggt t 21 <210> 1165 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1165 ccccuaaaug ccaccggcat t 21 <210> 1166 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1166 gccgguggca uuuaggggut t 21 <210> 1167 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1167 accccuaaau gccaccggct t 21 <210> 1168 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1168 ccggggcau uuaggggugt t 21 <210> 1169 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1169 caccccuaaa ugccaccggt t 21 <210> 1170 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1170 guggcauuua ggggugacut t 21 <210> 1171 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1171 agucaccccu aaaugccact t 21 <210> 1172 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1172 gcauuuaggg gugacuccut t 21 <210> 1173 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1173 aggagucacc ccuaaaugct t 21 <210> 1174 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1174 cauuuagggg ugacuccuut t 21 <210> 1175 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1175 aaggagucac cccuaaaugt t 21 <210> 1176 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1176 auuuaggggu gacuccuuct t 21 <210> 1177 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1177 gaaggaguca ccccuaaaut t 21 <210> 1178 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1178 uuuaggggug acuccuucat t 21 <210> 1179 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1179 ugaaggaguc accccuaaat t 21 <210> 1180 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1180 uuagggguga cuccuucact t 21 <210> 1181 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1181 gugaaggagu caccccuaat t 21 <210> 1182 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1182 uaggggugac uccuucacat t 21 <210> 1183 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1183 ugugaaggag ucaccccuat t 21 <210> 1184 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1184 ucuggaucca caggaacugt t 21 <210> 1185 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1185 caguuccugu ggauccagat t 21 <210> 1186 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1186 gauccacagg aacuggauat t 21 <210> 1187 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1187 uauccaguuc cuguggauct t 21 <210> 1188 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1188 auccacagga acuggauaut t 21 <210> 1189 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1189 aauuccaguu ccuguggaut t 21 <210> 1190 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1190 ccacaggaac uggauauuct t 21 <210> 1191 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1191 gaauauccag uuccugggt t 21 <210> 1192 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1192 cacaggaacu ggauauucut t 21 <210> 1193 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1193 agaauaucca guuccugugt t 21 <210> 1194 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1194 acuggauauu cugaaaacct t 21 <210> 1195 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1195 gguuuucaga auauccagut t 21 <210> 1196 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1196 auucugaaaa ccguaaaggt t 21 <210> 1197 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1197 ccuuuacggu uuucagaaut t 21 <210> 1198 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1198 uucugaaaac cguaaaggat t 21 <210> 1199 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1199 uccuuuacgg uuuucagaat t 21 <210> 1200 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1200 ugaaaaccgu aaaaggaaaut t 21 <210> 1201 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1201 auuuccuuua cgguuuucat t 21 <210> 1202 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1202 gaaaaaccgua aaggaaauct t 21 <210> 1203 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1203 gauuuccuuu acgguuuuct t 21 <210> 1204 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1204 cggccggagu cccgagcuat t 21 <210> 1205 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1205 uagcucggga cuccggccgt t 21 <210> 1206 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1206 ccggaguccc gagcuagcct t 21 <210> 1207 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1207 ggcuagcucg ggacuccggt t 21 <210> 1208 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1208 cggagccccg agcuagccct t 21 <210> 1209 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1209 gggcuagcuc gggacuccgt t 21 <210> 1210 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1210 ggagccccga gcuagcccct t 21 <210> 1211 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1211 ggggcuagcu cgggacucct t 21 <210> 1212 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1212 gagccccgag cuagccccgt t 21 <210> 1213 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1213 cggggcuagc ucgggacuct t 21 <210> 1214 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1214 agucccgagc uagccccggt t 21 <210> 1215 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1215 ccggggcuag cucgggacut t 21 <210> 1216 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1216 gucccgagcu agccccggct t 21 <210> 1217 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1217 gccggggcua gcucgggact t 21 <210> 1218 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1218 cccgagcuag ccccggcggt t 21 <210> 1219 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1219 ccgccggggc uagcucgggt t 21 <210> 1220 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1220 ggacgacagg ccaccucgut t 21 <210> 1221 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1221 acgagguggc cugucgucct t 21 <210> 1222 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1222 gacgacaggc caccucguct t 21 <210> 1223 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1223 gacgaggugg ccugucguct t 21 <210> 1224 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1224 acgacaggcc accucgucgt t 21 <210> 1225 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1225 cgacgaggug gccugucgut t 21 <210> 1226 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1226 cgacaggcca ccucgucggt t 21 <210> 1227 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1227 ccgacgaggu ggccugucgt t 21 <210> 1228 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1228 gacaggccac cucgucggct t 21 <210> 1229 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1229 gccgacgagg uggccuguct t 21 <210> 1230 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1230 caggccaccu cgucggcgut t 21 <210> 1231 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1231 acgccgacga gguggccugt t 21 <210> 1232 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1232 aggccaccuc gucggcguct t 21 <210> 1233 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1233 gacgccgacg agguggccut t 21 <210> 1234 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1234 ggccacccucg ucggcgucct t 21 <210> 1235 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1235 ggacgccgac gagggggcct t 21 <210> 1236 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1236 gccaccucgu cggcguccgt t 21 <210> 1237 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1237 cggacgccga cgagguggct t 21 <210> 1238 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1238 ccaccucguc ggcguccgct t 21 <210> 1239 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1239 gcggacgccg acgagguggt t 21 <210> 1240 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1240 caccucgucg gcguccgcct t 21 <210> 1241 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1241 ggcggacgcc gacgaggugt t 21 <210> 1242 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1242 accucgucgg cguccgccct t 21 <210> 1243 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1243 gggcggacgc cgacgaggut t 21 <210> 1244 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1244 ccucgucggc guccgcccgt t 21 <210> 1245 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1245 cgggcggacg ccgacgaggt t 21 <210> 1246 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1246 cucgucggcg uccgcccgat t 21 <210> 1247 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1247 ucgggcggac gccgacgagt t 21 <210> 1248 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1248 ucgucggcgu ccgcccgagt t 21 <210> 1249 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1249 cucgggcgga cgccgacgat t 21 <210> 1250 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1250 cgucggcguc cgcccgagut t 21 <210> 1251 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1251 accgggcgg acgccgacgt t 21 <210> 1252 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1252 gucggcgucc gcccgaguct t 21 <210> 1253 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1253 gacucgggcg gacgccgact t 21 <210> 1254 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1254 ucggcguccg cccgagucct t 21 <210> 1255 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1255 ggacucgggc ggacgccgat t 21 <210> 1256 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1256 gcguccgccc gagucccgt t 21 <210> 1257 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1257 cggggacucg ggcggacgct t 21 <210> 1258 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1258 cguccgcccg aguccccgct t 21 <210> 1259 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1259 gcggggacuc gggcggacgt t 21 <210> 1260 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1260 gcccgagucc ccgccucgct t 21 <210> 1261 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1261 gcgaggcggg gacucgggct t 21 <210> 1262 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1262 aacgccacaa ccaccgcgct t 21 <210> 1263 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1263 gcgcgguggu ugguggcguut t 21 <210> 1264 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1264 acgccacaac caccgcgcat t 21 <210> 1265 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1265 ugcgcggugg uugggcgut t 21 <210> 1266 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1266 cgccacaacc accgcgcact t 21 <210> 1267 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1267 gugcgcggug gugguggcgt t 21 <210> 1268 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1268 ccacaaccac cgcgcacggt t 21 <210> 1269 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1269 ccgugcgcgg uggguugggt t 21 <210> 1270 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1270 cacaaccacc gcgcacggct t 21 <210> 1271 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1271 gccgugcgcg gugguugugt t 21 <210> 1272 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1272 acaaccaccg cgcacggcct t 21 <210> 1273 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1273 ggccgugcgc gggguugut t 21 <210> 1274 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1274 augcgacccu ccgggacggt t 21 <210> 1275 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1275 ccguccccgga gggucgcaut t 21 <210> 1276 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1276 ugcgacccuc cgggacggct t 21 <210> 1277 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1277 gccgucccgg agggucgcat t 21 <210> 1278 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1278 gcgacccucc gggacggcct t 21 <210> 1279 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1279 ggccgucccg gagggucgct t 21 <210> 1280 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1280 gacccuccgg gacggccggt t 21 <210> 1281 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1281 ccggccgucc cggaggguct t 21 <210> 1282 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1282 acccuccggg acggccgggt t 21 <210> 1283 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1283 cccggccguc ccggagggut t 21 <210> 1284 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1284 ccuccgggac ggccggggct t 21 <210> 1285 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1285 gccccggccg ucccggaggt t 21 <210> 1286 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1286 agaaaguuug ccaaggcact t 21 <210> 1287 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1287 gugccuuggc aaacuuucut t 21 <210> 1288 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1288 gaaaguuugc caaggcacgt t 21 <210> 1289 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1289 cgugccuugg caaacuuuct t 21 <210> 1290 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1290 aaguuugcca aggcacgagt t 21 <210> 1291 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1291 cucgugccuu ggcaaacuut t 21 <210> 1292 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1292 aguuugccaa ggcacgagut t 21 <210> 1293 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1293 acucgugccu uggcaaacut t 21 <210> 1294 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1294 guuugccaag gcacgaguat t 21 <210> 1295 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1295 uacucgugcc uuggcaaact t 21 <210> 1296 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1296 uuugccaagg cacgaguaat t 21 <210> 1297 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1297 uuacucgugc cuuggcaaat t 21 <210> 1298 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1298 uugccaaggc acgaguaact t 21 <210> 1299 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1299 guuacucgug ccuuggcaat t 21 <210> 1300 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1300 ugccaaggca cgaguaacat t 21 <210> 1301 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1301 uguuacucgu gccuuggcat t 21 <210> 1302 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1302 gccaaggcac gaguaacaat t 21 <210> 1303 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1303 uuguuacucg ugccuuggct t 21 <210> 1304 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1304 acgcaguugg gcacuuuugt t 21 <210> 1305 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1305 caaaagugcc caacugcgut t 21 <210> 1306 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1306 cgcaguuggg cacuuuugat t 21 <210> 1307 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1307 ucaaaagugc ccaacugcgt t 21 <210> 1308 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1308 gcaguugggc acuuuugaat t 21 <210> 1309 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1309 uucaaaaagug cccaacugct t 21 <210> 1310 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1310 caguugggca cuuuugaagt t 21 <210> 1311 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1311 cuucaaaagu gcccaacugt t 21 <210> 1312 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1312 aguugggcac uuuugagat t 21 <210> 1313 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1313 ucuucaaaaag ugcccaacut t 21 <210> 1314 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1314 guugggcacu uuugaagaut t 21 <210> 1315 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1315 aucuucaaaa gugcccaact t 21 <210> 1316 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1316 uugggcacuu uugaagauct t 21 <210> 1317 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1317 gaucuucaaa agugcccaat t 21 <210> 1318 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1318 ugggcacuuu ugaagaucat t 21 <210> 1319 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1319 ugaucuucaa aagugcccat t 21 <210> 1320 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1320 gggcacuuuu gaagaucaut t 21 <210> 1321 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1321 augaucuucaaaagugccct t 21 <210> 1322 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1322 uugaagauca uuuucucagt t 21 <210> 1323 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1323 cugagaaaau gaucuucaat t 21 <210> 1324 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1324 gaagaucauu uucucagcct t 21 <210> 1325 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1325 ggcugagaaa augaucuuct t 21 <210> 1326 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1326 aagaucauuu ucucacccut t 21 <210> 1327 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1327 aggcugagaa aaugaucuut t 21 <210> 1328 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1328 cauuuucuca gccuccagat t 21 <210> 1329 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1329 ucuggaggcu gagaaaaugt t 21 <210> 1330 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1330 agccuccaga ggauguucat t 21 <210> 1331 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1331 ugaacauccu cuggaggcut t 21 <210> 1332 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1332 ccuccagagg auguucaut t 21 <210> 1333 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1333 auugaacauc cucuggaggt t 21 <210> 1334 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1334 cuccagagga uguucauat t 21 <210> 1335 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1335 uauugaacau ccucuggagt t 21 <210> 1336 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1336 agaggauguu caauaacugt t 21 <210> 1337 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1337 caguuauuga acauccucut t 21 <210> 1338 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1338 aggauguuca auaacugugt t 21 <210> 1339 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1339 cacaguuauu gaacauccut t 21 <210> 1340 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1340 uguucauaaa cugugaggut t 21 <210> 1341 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1341 accucacagu uauugaacat t 21 <210> 1342 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1342 uucauaacu gugagguggt t 21 <210> 1343 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1343 ccaccucaca guuauugaat t 21 <210> 1344 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1344 ucaauaacug ugagguggut t 21 <210> 1345 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1345 accaccucac aguuauugat t 21 <210> 1346 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1346 caauaacugu gagggugguct t 21 <210> 1347 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1347 gaccaccuca caguuauugt t 21 <210> 1348 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1348 aauaacugg agguggucct t 21 <210> 1349 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1349 ggaccaccuc acaguuauut t 21 <210> 1350 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1350 auaacuguga ggugguccut t 21 <210> 1351 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1351 aggaccaccu cacaguuaut t 21 <210> 1352 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1352 uaacugugag gugguccuut t 21 <210> 1353 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1353 aaggaccacc ucacaguuat t 21 <210> 1354 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1354 acugugaggu gguccuuggt t 21 <210> 1355 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1355 ccaaggacca ccucacagut t 21 <210> 1356 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1356 ugugaggugg uccuugggat t 21 <210> 1357 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1357 ucccaaggac caccucacat t 21 <210> 1358 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1358 gugagguggu ccuugggaat t 21 <210> 1359 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1359 uucccaaagga ccaccucact t 21 <210> 1360 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1360 ugguccuugg gaauuuggat t 21 <210> 1361 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1361 uccaaauucc caaggaccat t 21 <210> 1362 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1362 uugggaauuu ggaaauuact t 21 <210> 1363 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1363 guaauuucca aauuccaat t 21 <210> 1364 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1364 ugggaauuug gaaauuacct t 21 <210> 1365 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1365 gguaauuucc aaauucccat t 21 <210> 1366 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1366 gggaauuugg aaauuaccut t 21 <210> 1367 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1367 agguaauuuc caaauuccct t 21 <210> 1368 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1368 ggaauuugga aauuaccuat t 21 <210> 1369 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1369 uagguaauuu ccaaauucct t 21 <210> 1370 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1370 agaggaauua ugaucuuuct t 21 <210> 1371 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1371 gaaagaucau aauuccucut t 21 <210> 1372 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1372 gaggaauuau gaucuuucct t 21 <210> 1373 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1373 ggaaagauca uaauuccuct t 21 <210> 1374 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1374 aauuaugauc uuuccuucut t 21 <210> 1375 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1375 agaaggaaag aucauaauut t 21 <210> 1376 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1376 auuaugaucu uuccuucuut t 21 <210> 1377 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1377 aagaaggaaa gaucauaaut t 21 <210> 1378 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1378 uaugaucuuu ccuucuuaat t 21 <210> 1379 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1379 uuaagaagga aagaucauat t 21 <210> 1380 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1380 ugaucuuucc uucuuaaagt t 21 <210> 1381 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1381 cuuuaagaag gaaagaucat t 21 <210> 1382 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1382 ucuuuccuuc uuaaagacct t 21 <210> 1383 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1383 ggucuuuaag aaggaaagat t 21 <210> 1384 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1384 ccuucuuaaa gaccauccat t 21 <210> 1385 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1385 uggauggucu uuaagaaggt t 21 <210> 1386 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1386 cuucuuaaag accauccagt t 21 <210> 1387 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1387 cuggaugguc uuuaagaagt t 21 <210> 1388 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1388 ucuuaaagac cauccaggat t 21 <210> 1389 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1389 uccuggaugg ucuuuaagat t 21 <210> 1390 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1390 uuaaaagacca uccagggaggt t 21 <210> 1391 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1391 ccuccuggau ggucuuuaat t 21 <210> 1392 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1392 uaaaagaccau ccaggaggut t 21 <210> 1393 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1393 accuccugga uggucuuuat t 21 <210> 1394 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1394 ccaggagggggcugguuaut t 21 <210> 1395 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1395 auaaccagcc accuccuggt t 21 <210> 1396 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1396 caggaggugg cugguuaugt t 21 <210> 1397 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1397 cauaaccagc caccuccugt t 21 <210> 1398 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1398 aggaggguggc ugguuaugut t 21 <210> 1399 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1399 acauaaccag ccaccuccut t 21 <210> 1400 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1400 ggagguggcu gguuauguct t 21 <210> 1401 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1401 gacauaacca gccaccucct t 21 <210> 1402 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1402 gagggggcug guuaugucct t 21 <210> 1403 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1403 ggacauaacc agccaccuct t 21 <210> 1404 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1404 agguggcugg uuauguccut t 21 <210> 1405 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1405 aggacauaac cagccaccut t 21 <210> 1406 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1406 guggcuggu auguccucat t 21 <210> 1407 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1407 ugaggacaua accagccact t 21 <210> 1408 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1408 gcccucaaca caguggagct t 21 <210> 1409 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1409 gcuccacugu guugagggct t 21 <210> 1410 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1410 uuccuuugga aaaaccugcat t 21 <210> 1411 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1411 ugcagguuuu ccaaaggaat t 21 <210> 1412 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1412 uccuuuggaa aaccugcagt t 21 <210> 1413 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1413 cugcagguuu uccaaaggat t 21 <210> 1414 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1414 gaaaaccugc agaucaucat t 21 <210> 1415 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1415 ugaugaucug cagguuuuct t 21 <210> 1416 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1416 aaaaccugca gaucaucagt t 21 <210> 1417 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1417 cugaugaucu gcagguuuut t 21 <210> 1418 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1418 aaccugcaga ucaucagagt t 21 <210> 1419 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1419 cucugaugau cugcagguut t 21 <210> 1420 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1420 cugcagauca ucagaggaat t 21 <210> 1421 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1421 uuccucugau gaucugcagt t 21 <210> 1422 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1422 gaaaauuccu augccuuagt t 21 <210> 1423 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1423 cuaaggcaua ggaauuuuct t 21 <210> 1424 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1424 aaaauuccua ugccuuagct t 21 <210> 1425 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1425 gcuaaggcau aggaauuuut t 21 <210> 1426 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1426 aauuccuaug ccuuagcagt t 21 <210> 1427 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1427 cugcuaaggc auaggaaut t 21 <210> 1428 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1428 uccuaugccu uagcagucut t 21 <210> 1429 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1429 agacuagcuaa ggcauaggat t 21 <210> 1430 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1430 ccuaugccuu agcagucuut t 21 <210> 1431 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1431 aagacugcua aggcauaggt t 21 <210> 1432 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1432 cuaugccuua gcagucuuat t 21 <210> 1433 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1433 uaagacugcu aaggcauagt t 21 <210> 1434 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1434 augccuuagc agucuuauct t 21 <210> 1435 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1435 gauaagacug cuaaggcaut t 21 <210> 1436 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1436 ugccuuagca gucuuaucut t 21 <210> 1437 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1437 agauaagacu gcuaaggcat t 21 <210> 1438 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1438 gccuuagcag ucuuaucuat t 21 <210> 1439 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1439 uagauaagac ugcuaaggct t 21 <210> 1440 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1440 ccuuagcagu cuuaucuaat t 21 <210> 1441 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1441 uuagauaaga cugcuaaggt t 21 <210> 1442 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1442 cuuagcaguc uuaucuaact t 21 <210> 1443 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1443 guuagauaag acugcuaagt t 21 <210> 1444 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1444 uuagcagucu uaucuaacut t 21 <210> 1445 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1445 aguuagauaa gacugcuaat t 21 <210> 1446 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1446 uagcagucuu aucuaacuat t 21 <210> 1447 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1447 uaguuagaua agacugcuat t 21 <210> 1448 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1448 agcagucuua ucuaacuaut t 21 <210> 1449 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1449 auaguuagau aagacugcut t 21 <210> 1450 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1450 gcagucuuau cuaacuaugt t 21 <210> 1451 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1451 cauaguuaga uaagacugct t 21 <210> 1452 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1452 cagucuuauc uaacuaugat t 21 <210> 1453 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1453 ucauaguuag auaagacugt t 21 <210> 1454 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1454 ucuuaucuaa cuaugaugct t 21 <210> 1455 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1455 gcaucauagu uagauaagat t 21 <210> 1456 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1456 cuuaucuaac uaugaugcat t 21 <210> 1457 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1457 ugcaucauag uuagauaagt t 21 <210> 1458 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1458 uuaucuacu augaugcaat t 21 <210> 1459 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1459 uugcaucaua guuagauaat t 21 <210> 1460 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1460 uaucuaacua ugaugcaaat t 21 <210> 1461 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1461 uuugcaucau aguuagauat t 21 <210> 1462 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1462 aucuaacuau gaugcaaaut t 21 <210> 1463 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1463 auuugcauca uaguuagaut t 21 <210> 1464 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1464 ucuaacuaug augcaaauat t 21 <210> 1465 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1465 uauuugcauc auaguuagat t 21 <210> 1466 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1466 cuaacuauga ugcaaauaat t 21 <210> 1467 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1467 uuauuugcau cauaguuagt t 21 <210> 1468 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1468 aacuaugaug caaauaaaat t 21 <210> 1469 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1469 uuuuauuugc aucauaguut t 21 <210> 1470 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1470 gaugcaaaua aaaccggact t 21 <210> 1471 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1471 guccgguuuu auuugcauct t 21 <210> 1472 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1472 augcaaaauaa aaccggacut t 21 <210> 1473 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1473 aguccgguuu uauuugcaut t 21 <210> 1474 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1474 ugcaaauaaa accggacugt t 21 <210> 1475 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1475 caguccgguu uuauuugcat t 21 <210> 1476 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1476 caaauaaaac cggacugaat t 21 <210> 1477 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1477 uucaguccgg uuuuauuugt t 21 <210> 1478 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1478 aaauaaaacc ggacugaagt t 21 <210> 1479 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1479 cuucaguccg guuuuauuut t 21 <210> 1480 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1480 aauaaaaccg gacugaaggt t 21 <210> 1481 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1481 ccuucagucc gguuuuauut t 21 <210> 1482 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1482 uaaaaccggga cugaaggagt t 21 <210> 1483 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1483 cuccuucagu ccgguuuuat t 21 <210> 1484 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1484 aaaaccggac ugaaggagct t 21 <210> 1485 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1485 gcuccuucag uccgguuuut t 21 <210> 1486 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1486 aaaacgggacu gaaggagcut t 21 <210> 1487 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1487 agcuccuuca guccgguuut t 21 <210> 1488 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1488 aaccggacug aaggagcugt t 21 <210> 1489 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1489 cagcuccuuc aguccggguut t 21 <210> 1490 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1490 aggagcugcc caugagaaat t 21 <210> 1491 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1491 uuucucaugg gcagcuccut t 21 <210> 1492 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1492 uacaggaaau ccugcauggt t 21 <210> 1493 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1493 ccaugcagga uuuccuguat t 21 <210> 1494 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1494 aggaaauccu gcauggcgct t 21 <210> 1495 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1495 gcgccaugca ggauuuccut t 21 <210> 1496 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1496 ggaaauccug cauggcgcct t 21 <210> 1497 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1497 ggcgccaugc aggauuucct t 21 <210> 1498 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1498 gaaauccugc auggcgccgt t 21 <210> 1499 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1499 cggcgccaug caggauuuct t 21 <210> 1500 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1500 aaauccugca uggcgccgut t 21 <210> 1501 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1501 acggcgccau gcaggauuut t 21 <210> 1502 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1502 aauccugcau ggcgccgugt t 21 <210> 1503 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1503 cacggcgcca ugcaggauut t 21 <210> 1504 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1504 uccugcaugg cgccgugcgt t 21 <210> 1505 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1505 cgcacggcgc caugcaggat t 21 <210> 1506 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1506 cugcauggcg ccgugcggut t 21 <210> 1507 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1507 accgcacggc gccaugcagt t 21 <210> 1508 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1508 ugcauggcgc cgugcgguut t 21 <210> 1509 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1509 aaccgcacgg cgccaugcat t 21 <210> 1510 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1510 gcauggcgcc gugcggguuct t 21 <210> 1511 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1511 gaaccgcacg gcgccaugct t 21 <210> 1512 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1512 auggcgccgu gcgguucagt t 21 <210> 1513 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1513 cugaaccgca cggcgccaut t 21 <210> 1514 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1514 uggcgccgug cgguucagct t 21 <210> 1515 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1515 gcugaaccgc acggcgccat t 21 <210> 1516 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1516 ggcgccgugc gguucagcat t 21 <210> 1517 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1517 ugcugaaccg cacggcgcct t 21 <210> 1518 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1518 gcgccgugcg guucagcaat t 21 <210> 1519 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1519 uugcugaacc gcacggcgct t 21 <210> 1520 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1520 cgccgugcgg uucagcaact t 21 <210> 1521 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1521 guugcugaac cgcacggcgt t 21 <210> 1522 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1522 gccgugcggu ucagcaacat t 21 <210> 1523 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1523 uguugcugaa ccgcacggct t 21 <210> 1524 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1524 ccgugcgguu cagcaacaat t 21 <210> 1525 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1525 uuguugcuga accgcacggt t 21 <210> 1526 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1526 gugcggguuca gcaacacacct t 21 <210> 1527 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1527 gguuguugcu gaaccgcact t 21 <210> 1528 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1528 gcgguucagc aacaacccut t 21 <210> 1529 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1529 aggguuguug cugaaccgct t 21 <210> 1530 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1530 gguucagcaa caacccugct t 21 <210> 1531 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1531 gcaggguugu ugcugaacct t 21 <210> 1532 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1532 gcaacaaccc ugcccugugt t 21 <210> 1533 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1533 cacaggggcag gguuguugct t 21 <210> 1534 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1534 aacaacccug cccugucat t 21 <210> 1535 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1535 ugcacagggc aggguuguut t 21 <210> 1536 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1536 acguggagag cauccagugt t 21 <210> 1537 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1537 cacuggaugc ucuccacgut t 21 <210> 1538 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1538 cguggagagc auccaguggt t 21 <210> 1539 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1539 ccacuggaug cucuccacgt t 21 <210> 1540 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1540 guggagagca uccaguggct t 21 <210> 1541 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1541 gccacuggau gcucuccact t 21 <210> 1542 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1542 gagagcaucc aguggcgggt t 21 <210> 1543 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1543 cccgccacug gaugcucuct t 21 <210> 1544 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1544 agagcaucca guggcgggat t 21 <210> 1545 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1545 ucccgccacu ggaugcucut t 21 <210> 1546 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1546 gagcauccag uggcgggact t 21 <210> 1547 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1547 gucccgccac uggaugcuct t 21 <210> 1548 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1548 caguggcggg acauagucat t 21 <210> 1549 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1549 ugacuauguc ccgccacugt t 21 <210> 1550 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1550 aguggcggga cauagucagt t 21 <210> 1551 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1551 cugacuaugu cccgccacut t 21 <210> 1552 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1552 uggcgggaca uagucagcat t 21 <210> 1553 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1553 ugcugacuau gucccgccat t 21 <210> 1554 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1554 ggcgggacau agucagcagt t 21 <210> 1555 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1555 cugcugacua ugucccgcct t 21 <210> 1556 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1556 cucagcaaca ugucgauggt t 21 <210> 1557 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1557 ccaucgacau guugcugagt t 21 <210> 1558 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1558 cagcaacaug ucgauggact t 21 <210> 1559 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1559 guccaucgac auguugcugt t 21 <210> 1560 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1560 agcaacaugu cgauggacut t 21 <210> 1561 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1561 aguccaucga cauguugcut t 21 <210> 1562 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1562 gcaacauguc gauggacuut t 21 <210> 1563 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1563 aaguccaucg acauguugct t 21 <210> 1564 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1564 aacaugucga uggacuucct t 21 <210> 1565 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1565 ggaaguccau cgacauguut t 21 <210> 1566 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1566 acaugucgau ggacuuccat t 21 <210> 1567 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1567 uggaagucca ucgacaugut t 21 <210> 1568 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1568 caugucgaug gacuuccagt t 21 <210> 1569 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1569 cuggaagucc aucgacaugt t 21 <210> 1570 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1570 augucgaugg acuuccagat t 21 <210> 1571 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1571 ucuggaaguc caucgacaut t 21 <210> 1572 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1572 ucgauggacu ucgaacct t 21 <210> 1573 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1573 gguucuggaa guccaucgat t 21 <210> 1574 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1574 gaaccaccug ggcagcugct t 21 <210> 1575 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1575 gcagcugccc aggugguuct t 21 <210> 1576 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1576 gggcagcugc caaaagugut t 21 <210> 1577 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1577 acacuuuugg cagcugccct t 21 <210> 1578 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1578 gcagcugcca aaagugugat t 21 <210> 1579 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1579 ucacacuuuu ggcagcugct t 21 <210> 1580 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1580 ugccaaaagu gugauccaat t 21 <210> 1581 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1581 uuggaucaca cuuuuggcat t 21 <210> 1582 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1582 gccaaaagug ugauccaagt t 21 <210> 1583 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1583 cuuggaucac acuuuuggct t 21 <210> 1584 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1584 ccaaaaagugu gauccaagct t 21 <210> 1585 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1585 gcuuggauca cacuuuuggt t 21 <210> 1586 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1586 aaaagugugau ccaagcugut t 21 <210> 1587 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1587 acagcuugga ucacacuuut t 21 <210> 1588 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1588 ugugauccaa gcugucccat t 21 <210> 1589 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1589 ugggacagcu uggaucacat t 21 <210> 1590 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1590 gugauccaag cugucccaat t 21 <210> 1591 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1591 uugggacagc uuggaucact t 21 <210> 1592 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1592 gauccaagcu gucccaaugt t 21 <210> 1593 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1593 cauugggaca gcuuggauct t 21 <210> 1594 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1594 auccaagcug ucccaauggt t 21 <210> 1595 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1595 ccauugggac agcuuggaut t 21 <210> 1596 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1596 uccaagcugu cccaaugggt t 21 <210> 1597 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1597 cccauuggga cagcuuggat t 21 <210> 1598 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1598 ccaaagcuguc ccaaugggat t 21 <210> 1599 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1599 ucccauggg acagcuuggt t 21 <210> 1600 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1600 caagcugucc caaugggagt t 21 <210> 1601 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1601 cucccauugg gacagcuugt t 21 <210> 1602 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1602 agcuguccca augggagcut t 21 <210> 1603 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1603 agcucccauu gggacagcut t 21 <210> 1604 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1604 ugucccaaug ggagcugcut t 21 <210> 1605 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1605 agcagcuccc auugggacat t 21 <210> 1606 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1606 ggugcaggag aggagaacut t 21 <210> 1607 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1607 agucuccuc uccugcacct t 21 <210> 1608 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1608 aaacugacca aaaucaucut t 21 <210> 1609 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1609 agaugauuuu ggucaguuut t 21 <210> 1610 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1610 aacugaccaa aaucaucugt t 21 <210> 1611 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1611 cagaugauuu uggucaguut t 21 <210> 1612 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1612 acugaccaaa aucaucugut t 21 <210> 1613 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1613 acagaugauu uuggucagut t 21 <210> 1614 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1614 accaaauca ucuugccct t 21 <210> 1615 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1615 gggcacagau gauuuuggut t 21 <210> 1616 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1616 ccaaaaaucau cugugcccat t 21 <210> 1617 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1617 ugggcacaga ugauuuuggt t 21 <210> 1618 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1618 aaaucaucug ugcccagcat t 21 <210> 1619 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1619 ugcugggcac agaugauuut t 21 <210> 1620 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1620 gugcccagca gugcuccggt t 21 <210> 1621 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1621 ccggagcacu gcugggcact t 21 <210> 1622 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1622 gcccagcagu gcuccgggct t 21 <210> 1623 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1623 gcccggagca cugcugggct t 21 <210> 1624 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1624 ccaguacug cugccacaat t 21 <210> 1625 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1625 uugggcagc agucacuggt t 21 <210> 1626 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1626 cagugacugc ugccacaact t 21 <210> 1627 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1627 guugggcag cagucacugt t 21 <210> 1628 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1628 gagagcgacu gccuggucut t 21 <210> 1629 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1629 agaccaggca gucgcucuct t 21 <210> 1630 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1630 agagcgacug ccuggucugt t 21 <210> 1631 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1631 cagaccaggc agucgcucut t 21 <210> 1632 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1632 gagcgacugc cuggucugct t 21 <210> 1633 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1633 gcagaccagg cagucgcuct t 21 <210> 1634 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1634 agcgacugcc uggucugcct t 21 <210> 1635 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1635 ggcagaccag gcagucgcut t 21 <210> 1636 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1636 gcgacugccu ggucugccgt t 21 <210> 1637 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1637 cggcagacca ggcagucgct t 21 <210> 1638 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1638 cgacugccug gucugccgct t 21 <210> 1639 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1639 gcggcagacc aggcagucgt t 21 <210> 1640 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1640 gccuggucug ccgcaaauut t 21 <210> 1641 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1641 aauuugcggc agaccaggct t 21 <210> 1642 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1642 ccuggucugc cgcaaauuct t 21 <210> 1643 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1643 gaauuugcgg cagaccaggt t 21 <210> 1644 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1644 cuggucugcc gcaaauucct t 21 <210> 1645 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1645 ggaauuugcg gcagaccagt t 21 <210> 1646 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1646 uggucugccg caaauuccgt t 21 <210> 1647 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1647 cggaauuugc ggcagaccat t 21 <210> 1648 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1648 gucugccgca aauuccgagt t 21 <210> 1649 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1649 cucggaauuu gcggcagact t 21 <210> 1650 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1650 ucugccgcaa auuccgagat t 21 <210> 1651 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1651 ucucgggaauu ugcggcagat t 21 <210> 1652 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1652 cugccgcaaa uuccgagact t 21 <210> 1653 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1653 guccgggaau uugcggcagt t 21 <210> 1654 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1654 ugccgcaaau uccgagacgt t 21 <210> 1655 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1655 cgucucggaa uuugcggcat t 21 <210> 1656 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1656 ccgcaaauuc cgagacgaat t 21 <210> 1657 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1657 uucgucucgg aauuugcggt t 21 <210> 1658 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1658 aauuccgaga cgaagccact t 21 <210> 1659 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1659 guggcuucgu cucgggaauut t 21 <210> 1660 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1660 auuccgagac gaagccacgt t 21 <210> 1661 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1661 cguggcuucg ucucggaaut t 21 <210> 1662 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1662 uuccgagacg aagccacgut t 21 <210> 1663 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1663 acguggcuuc guccgggaat t 21 <210> 1664 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1664 uccgagacga agccacgugt t 21 <210> 1665 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1665 cacguggcuu cgucucggat t 21 <210> 1666 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1666 ccgagacgaa gccacgugct t 21 <210> 1667 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1667 gcacguggcu ucgucucggt t 21 <210> 1668 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1668 gagacgaagc cacgugcaat t 21 <210> 1669 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1669 uugcacgugg cuucgucuct t 21 <210> 1670 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1670 acgaagccac gugcaaggat t 21 <210> 1671 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1671 uccuugcacg uggcuucgut t 21 <210> 1672 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1672 cgaagccacg ugcaaggact t 21 <210> 1673 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1673 guccuugcac guggcuucgt t 21 <210> 1674 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1674 gaagccacgu gcaaggacat t 21 <210> 1675 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1675 uguccuugca cguggcuuct t 21 <210> 1676 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1676 aagccacgug caaggacact t 21 <210> 1677 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1677 guguccuugc acguggcuut t 21 <210> 1678 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1678 ccccacucau gcucuacaat t 21 <210> 1679 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1679 uuguagagca ugagggggt t 21 <210> 1680 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1680 ccacucaugc ucuacaacct t 21 <210> 1681 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1681 gguuguagag caugaguggt t 21 <210> 1682 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1682 acucaugcuc uacaacccct t 21 <210> 1683 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1683 gggguuguag agcaugagut t 21 <210> 1684 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1684 caugcucuac aaccccacct t 21 <210> 1685 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1685 gguggggguug uagagcaugt t 21 <210> 1686 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1686 ccagauggau gugaacccct t 21 <210> 1687 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1687 gggguucaca uccaucuggt t 21 <210> 1688 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1688 agauggaugu gaacccccgat t 21 <210> 1689 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1689 ucggggguuca cauccaucut t 21 <210> 1690 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1690 gauggauug aacccgagt t 21 <210> 1691 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1691 cucggggguuc acauccauct t 21 <210> 1692 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1692 auggauguga accccgaggt t 21 <210> 1693 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1693 ccucggggguu cacauccaut t 21 <210> 1694 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1694 ggaugugaac cccgagggct t 21 <210> 1695 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1695 gcccucgggg uucacaucct t 21 <210> 1696 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1696 gaugugaacc ccgagggcat t 21 <210> 1697 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1697 ugcccccggg guucacauct t 21 <210> 1698 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1698 ugugaacccc gagggcaaat t 21 <210> 1699 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1699 uuugccccg ggguucacat t 21 <210> 1700 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1700 aacccgagg gcaaauacat t 21 <210> 1701 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1701 uguauuugcc cucggggguut t 21 <210> 1702 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1702 accccgaggg caaauacagt t 21 <210> 1703 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1703 cuguauuugc ccucggggut t 21 <210> 1704 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1704 cccgagggca aauacagcut t 21 <210> 1705 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1705 agcuguauuu gcccucgggt t 21 <210> 1706 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1706 ccgaggggcaa auacagcuut t 21 <210> 1707 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1707 aagcuguauu ugccccggt t 21 <210> 1708 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1708 cgagggcaaa uacagcuuut t 21 <210> 1709 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1709 aaagcuguau uugcccucgt t 21 <210> 1710 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1710 aaaauacagcu uuggugccat t 21 <210> 1711 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1711 uggcaccaaa gcuguauuut t 21 <210> 1712 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1712 aauacagcuu uggugccact t 21 <210> 1713 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1713 guggcaccaa agcuguauut t 21 <210> 1714 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1714 auacagcuuu ggugccacct t 21 <210> 1715 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1715 gguggcacca aagcuguaut t 21 <210> 1716 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1716 cuuuggugcc accugcgugt t 21 <210> 1717 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1717 cacgcaggug gcaccaaagt t 21 <210> 1718 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1718 uuggugccac cugcgugaat t 21 <210> 1719 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1719 uucacgcagg uggcaccaat t 21 <210> 1720 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1720 ccaccugcgu gaagaagugt t 21 <210> 1721 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1721 cacuucuuca cgcagguggt t 21 <210> 1722 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1722 cugcgugaag aaguguccct t 21 <210> 1723 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1723 gggacacuuc uucacgcagt t 21 <210> 1724 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1724 ugcgugaaga agugucccct t 21 <210> 1725 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1725 ggggacacuu cuucacgcat t 21 <210> 1726 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1726 gcgugaagaa guguccccgt t 21 <210> 1727 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1727 cggggacacu ucuucacgct t 21 <210> 1728 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1728 cgugaagaag uguccccgut t 21 <210> 1729 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1729 acggggacac uucuucacgt t 21 <210> 1730 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1730 gugaagaagu guccccguat t 21 <210> 1731 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1731 uacggggaca cuucuucact t 21 <210> 1732 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1732 ugaagaagug uccccguaat t 21 <210> 1733 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1733 uuacggggac acuucuucat t 21 <210> 1734 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1734 gaagaagugu ccccguaaut t 21 <210> 1735 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1735 auuacgggga cacuucuuct t 21 <210> 1736 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1736 aagaaguguc cccguaauut t 21 <210> 1737 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1737 aauuacgggg acacuucuut t 21 <210> 1738 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1738 agaagugucc ccguaauuat t 21 <210> 1739 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1739 uaauuacggg gacacuucut t 21 <210> 1740 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1740 gaaguguccc cguaauuaut t 21 <210> 1741 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1741 auaauuacgg ggacacuuct t 21 <210> 1742 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1742 aagugucccc guaauuaugt t 21 <210> 1743 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1743 cauaauuacg gggacacuut t 21 <210> 1744 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1744 aguguccccg uaauuaugut t 21 <210> 1745 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1745 acauaauuac ggggacacut t 21 <210> 1746 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1746 guguccccgu aauuauugt t 21 <210> 1747 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1747 cacauaauua cggggacact t 21 <210> 1748 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1748 uguccccgua auuaugggt t 21 <210> 1749 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1749 ccacauaauu acgggggacat t 21 <210> 1750 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1750 guccccguaa uuauguggut t 21 <210> 1751 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1751 accacauaau uacggggact t 21 <210> 1752 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1752 ccccguaauu auguggugat t 21 <210> 1753 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1753 ucaccacaua auuacggggt t 21 <210> 1754 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1754 ccguaauuau guggugacat t 21 <210> 1755 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1755 ugucaccaca uaauuacggt t 21 <210> 1756 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1756 guaauuaugu ggugacagat t 21 <210> 1757 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1757 ucugucacca cauaauuact t 21 <210> 1758 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1758 uaauuauugug gugacagaut t 21 <210> 1759 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1759 aucugucacc acauaauuat t 21 <210> 1760 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1760 aauuauggg ugacagauct t 21 <210> 1761 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1761 gaucugucac cacauaauut t 21 <210> 1762 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1762 auuauuggu gacagaucat t 21 <210> 1763 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1763 ugaucuguca ccacauaaut t 21 <210> 1764 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1764 uuaugggug acagaucact t 21 <210> 1765 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1765 gugaucuguc accacauaat t 21 <210> 1766 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1766 auguggugac agaucacggt t 21 <210> 1767 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1767 ccgugaucug ucaccacaut t 21 <210> 1768 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1768 uggugacaga ucacggcuct t 21 <210> 1769 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1769 gagccgugau cugucaccat t 21 <210> 1770 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1770 gugacagauc acggcucgut t 21 <210> 1771 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1771 acgagccgug aucugucact t 21 <210> 1772 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1772 ugacagauca cggcucgugt t 21 <210> 1773 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1773 cacgagccgu gaucugucat t 21 <210> 1774 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1774 gacagaucac ggcucgugct t 21 <210> 1775 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1775 gcacgagccg ugaucuguct t 21 <210> 1776 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1776 acagaucacg gcucgugcgt t 21 <210> 1777 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1777 cgcacgagcc gugaucugut t 21 <210> 1778 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1778 cagaucacgg cucgugcgut t 21 <210> 1779 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1779 acgcacgagc cgugaucugt t 21 <210> 1780 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1780 agaucacggc ucgugcguct t 21 <210> 1781 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1781 gacgcacgag ccgugaucut t 21 <210> 1782 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1782 gaucacggcu cgugcgucct t 21 <210> 1783 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1783 ggacgcacga gccgugauct t 21 <210> 1784 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1784 aucacggcuc gugcguccgt t 21 <210> 1785 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1785 cggacgcacg agccgugaut t 21 <210> 1786 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1786 ucacggcucg ugcguccgat t 21 <210> 1787 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1787 ucggacgcac gagccgugat t 21 <210> 1788 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1788 cacggcucgu gcguccgagt t 21 <210> 1789 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1789 cucggacgca cgagccgugt t 21 <210> 1790 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1790 acggcucgug cguccgagct t 21 <210> 1791 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1791 gcucggacgc acgagccgut t 21 <210> 1792 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1792 gcuccugcgu ccgagccugt t 21 <210> 1793 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1793 caggcucggga cgcacgagct t 21 <210> 1794 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1794 gggaggagac ggcguccgct t 21 <210> 1795 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1795 gcggacgccg ucuuccucct t 21 <210> 1796 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1796 gaggaagacg gcguccgcat t 21 <210> 1797 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1797 ugcggacgcc gucuuccuct t 21 <210> 1798 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1798 ggaagacggc guccgcaagt t 21 <210> 1799 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1799 cuugcggacg ccgucuucct t 21 <210> 1800 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1800 gaagacggcg uccgcaagut t 21 <210> 1801 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1801 acuugcggac gccgucuuct t 21 <210> 1802 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1802 aagacggcgu ccgcaagugt t 21 <210> 1803 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1803 cacuugcgga cgccgucuut t 21 <210> 1804 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1804 gacggcgucc gcaaguguat t 21 <210> 1805 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1805 uacacuugcg gacgccguct t 21 <210> 1806 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1806 acggcguccg caaguguaat t 21 <210> 1807 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1807 uuacacuugc ggacgccgut t 21 <210> 1808 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1808 gcguccgcaa guguaagaat t 21 <210> 1809 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1809 uucuuacacu ugcggacgct t 21 <210> 1810 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1810 cguccgcaag uguaagaagt t 21 <210> 1811 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1811 cuucuuacac uugcggacgt t 21 <210> 1812 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1812 guccgcaagu guaagaagut t 21 <210> 1813 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1813 acuucuuaca cuugcggact t 21 <210> 1814 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1814 uccgcaagug uaagaagugt t 21 <210> 1815 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1815 cacuucuuac acuugcggat t 21 <210> 1816 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1816 ccgcaagugu aagaagugct t 21 <210> 1817 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1817 gcacuucuua cacuugcggt t 21 <210> 1818 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1818 cgcaagugua agaagugcgt t 21 <210> 1819 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1819 cgcacuucuu acacuugcgt t 21 <210> 1820 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1820 gcaaguguaa gaagugcgat t 21 <210> 1821 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1821 ucgcacuucu uacacuugct t 21 <210> 1822 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1822 aaguguaaga agugcgaagt t 21 <210> 1823 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1823 cuucgcacuu cuuacacuut t 21 <210> 1824 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1824 aguguaagaa gugcgaaggt t 21 <210> 1825 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1825 ccuucgcacu ucuuacacut t 21 <210> 1826 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1826 guguaagaag ugcgaagggt t 21 <210> 1827 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1827 cccuucgcac uucuuacact t 21 <210> 1828 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1828 uguaagaagu gcgaagggct t 21 <210> 1829 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1829 gcccuucgca cuucuuacat t 21 <210> 1830 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1830 guaagaagug cgaagggcct t 21 <210> 1831 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1831 ggcccuucgc acuucuuact t 21 <210> 1832 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1832 uaagaagugc gaagggccut t 21 <210> 1833 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1833 aggcccuucg cacuucuuat t 21 <210> 1834 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1834 aagaagugcg aagggccuut t 21 <210> 1835 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1835 aaggcccuuc gcacuucuut t 21 <210> 1836 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1836 agaagugcga agggccuugt t 21 <210> 1837 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1837 caaggcccuu cgcacuucut t 21 <210> 1838 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1838 agugcgaagg gccuugccgt t 21 <210> 1839 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1839 cggcaaggcc cuucgcacut t 21 <210> 1840 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1840 gugcgaaggg ccuugccgct t 21 <210> 1841 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1841 gcggcaaggc ccuucgcact t 21 <210> 1842 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1842 ugcgaagggc cuugccgcat t 21 <210> 1843 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1843 ugcggcaagg cccuucgcat t 21 <210> 1844 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1844 gcgaagggcc uugccgcaat t 21 <210> 1845 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1845 uugcggcaag gcccuucgct t 21 <210> 1846 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1846 cgaagggccu ugccgcaaat t 21 <210> 1847 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1847 uuugcggcaa ggcccuucgt t 21 <210> 1848 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1848 aagggccuug ccgcaaagut t 21 <210> 1849 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1849 acuuugcggc aaggcccuut t 21 <210> 1850 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1850 agggccuugc cgcaaagugt t 21 <210> 1851 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1851 cacuuugcgg caaggcccut t 21 <210> 1852 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1852 gggccuugcc gcaaagugut t 21 <210> 1853 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1853 acacuuugcg gcaaggccct t 21 <210> 1854 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1854 ggccuugccg caaaguggt t 21 <210> 1855 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1855 cacacuuugc ggcaaggcct t 21 <210> 1856 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1856 gccuugccgc aaagugugut t 21 <210> 1857 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1857 acacacuuug cggcaaggct t 21 <210> 1858 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1858 cuugccgcaa aguguguaat t 21 <210> 1859 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1859 uuacacacuu ugcggcaagt t 21 <210> 1860 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1860 ggaauaggua uuggugaaut t 21 <210> 1861 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1861 auucaccaau accuauucct t 21 <210> 1862 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1862 gaauagguau uggugaauut t 21 <210> 1863 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1863 aauucaccaa uaccuauuct t 21 <210> 1864 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1864 aauagguauu ggugaauuut t 21 <210> 1865 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1865 aaauucacca auaccuauut t 21 <210> 1866 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1866 auagguauug gugaauuuat t 21 <210> 1867 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1867 uaaauucacc aauaccuaut t 21 <210> 1868 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1868 agguauuggu gaauuuaaat t 21 <210> 1869 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1869 uuuaaauuca ccaauaccut t 21 <210> 1870 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1870 gguauuggug aauuuaaagt t 21 <210> 1871 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1871 cuuuaaauuc accaauacct t 21 <210> 1872 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1872 cacucuccau aaaugcuact t 21 <210> 1873 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1873 guagcauuua uggagagugt t 21 <210> 1874 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1874 uuaaacacuu caaaaacugt t 21 <210> 1875 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1875 caguuuuuga aguguuuaat t 21 <210> 1876 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1876 cuucaaaaac ugcaccucct t 21 <210> 1877 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1877 ggaggugcag uuuuugaagt t 21 <210> 1878 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1878 uucaaaaacu gcaccuccat t 21 <210> 1879 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1879 uggagggugca guuuuugaat t 21 <210> 1880 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1880 ucaaaaacug caccuccaut t 21 <210> 1881 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1881 auggagggugc aguuuuugat t 21 <210> 1882 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1882 caaaaacugc accuccauct t 21 <210> 1883 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1883 gauggaggg caguuuuugt t 21 <210> 1884 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1884 aaaaacugca ccuccaucat t 21 <210> 1885 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1885 ugauggaggu gcaguuuuut t 21 <210> 1886 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1886 acugcaccuc caucaguggt t 21 <210> 1887 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1887 ccacugaugg aggugcagut t 21 <210> 1888 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1888 caccuccauc aguggcgaut t 21 <210> 1889 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1889 aucgccacug auggaggggt t 21 <210> 1890 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1890 accuccauca guggcgauct t 21 <210> 1891 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1891 gaucgccacu gauggaggut t 21 <210> 1892 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1892 cuccaucagu ggcgaucuct t 21 <210> 1893 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1893 gagaucgcca cugauggagt t 21 <210> 1894 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1894 caucaguggc gaucuccact t 21 <210> 1895 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1895 guggagaucg ccacugaugt t 21 <210> 1896 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1896 uggcgaucuc cacauccugt t 21 <210> 1897 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1897 caggauggg agaucgccat t 21 <210> 1898 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1898 ggcgaucucc acauccugct t 21 <210> 1899 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1899 gcaggauugggaucgcct t 21 <210> 1900 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1900 gcgaucucca cauccugcct t 21 <210> 1901 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1901 ggcaggaugu ggagaucgct t 21 <210> 1902 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1902 cgaucuccac auccugccgt t 21 <210> 1903 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1903 cggcaggaug uggagaucgt t 21 <210> 1904 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1904 gaucuccaca uccugccggt t 21 <210> 1905 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1905 ccggcaggau guggagauct t 21 <210> 1906 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1906 ccacauccug ccgguggcat t 21 <210> 1907 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1907 ugccaccggc aggauguggt t 21 <210> 1908 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1908 cacauccugc cgguggcaut t 21 <210> 1909 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1909 augccaccgg caggauugt t 21 <210> 1910 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1910 acauccugcc gguggcauut t 21 <210> 1911 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1911 aaugccaccg gcaggaugut t 21 <210> 1912 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1912 auccugccgg uggcauuuat t 21 <210> 1913 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1913 uaaaugccac cggcaggaut t 21 <210> 1914 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1914 cugccggugg cauuuagggt t 21 <210> 1915 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1915 cccuaaaugc caccggcagt t 21 <210> 1916 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1916 ugccgguggc auuuaggggt t 21 <210> 1917 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1917 ccccuaaaug ccaccggcat t 21 <210> 1918 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1918 gccgguggca uuuaggggut t 21 <210> 1919 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1919 accccuaaau gccaccggct t 21 <210> 1920 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1920 ccggggcau uuaggggugt t 21 <210> 1921 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1921 caccccuaaa ugccaccggt t 21 <210> 1922 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1922 guggcauuua ggggugacut t 21 <210> 1923 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1923 agucaccccu aaaugccact t 21 <210> 1924 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1924 gcauuuaggg gugacuccut t 21 <210> 1925 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1925 aggagucacc ccuaaaugct t 21 <210> 1926 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1926 cauuuagggg ugacuccuut t 21 <210> 1927 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1927 aaggagucac cccuaaaugt t 21 <210> 1928 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1928 auuuaggggu gacuccuuct t 21 <210> 1929 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1929 gaaggaguca ccccuaaaut t 21 <210> 1930 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1930 uuuaggggug acuccuucat t 21 <210> 1931 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1931 ugaaggaguc accccuaaat t 21 <210> 1932 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1932 uuagggguga cuccuucact t 21 <210> 1933 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1933 gugaaggagu caccccuaat t 21 <210> 1934 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1934 uaggggugac uccuucacat t 21 <210> 1935 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1935 ugugaaggag ucaccccuat t 21 <210> 1936 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1936 ucuggaucca caggaacugt t 21 <210> 1937 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1937 caguuccugu ggauccagat t 21 <210> 1938 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1938 gauccacagg aacuggauat t 21 <210> 1939 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1939 uauccaguuc cuguggauct t 21 <210> 1940 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1940 auccacagga acuggauaut t 21 <210> 1941 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1941 aauuccaguu ccuguggaut t 21 <210> 1942 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1942 ccacaggaac uggauauuct t 21 <210> 1943 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1943 gaauauccag uuccugggt t 21 <210> 1944 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1944 cacaggaacu ggauauucut t 21 <210> 1945 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1945 agaauaucca guuccugugt t 21 <210> 1946 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1946 acuggauauu cugaaaacct t 21 <210> 1947 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1947 gguuuucaga auauccagut t 21 <210> 1948 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1948 auucugaaaa ccguaaaggt t 21 <210> 1949 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1949 ccuuuacggu uuucagaaut t 21 <210> 1950 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1950 uucugaaaac cguaaaggat t 21 <210> 1951 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1951 uccuuuacgg uuuucagaat t 21 <210> 1952 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1952 ugaaaaccgu aaaaggaaaut t 21 <210> 1953 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1953 auuuccuuua cgguuuucat t 21 <210> 1954 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1954 gaaaaaccgua aaggaaauct t 21 <210> 1955 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1955 gauuuccuuu acgguuuuct t 21 <210> 1956 <211> 23 <212> RNA <213> Homo sapiens <400> 1956 caaagguucu cugcuagacg aca 23 <210> 1957 <211> 23 <212> RNA <213> Homo sapiens <400> 1957 ucuggguguc acuauggagc ucu 23 <210> 1958 <211> 23 <212> RNA <213> Homo sapiens <400> 1958 cuggguguca cuauggagcu cuc 23 <210> 1959 <211> 23 <212> RNA <213> Homo sapiens <400> 1959 gggugucacu auggagcucu cac 23 <210> 1960 <211> 23 <212> RNA <213> Homo sapiens <400> 1960 uacuacaacu uuccacuggc ucu 23 <210> 1961 <211> 23 <212> RNA <213> Homo sapiens <400> 1961 aagcuucugg gugucacuau gga 23 <210> 1962 <211> 23 <212> RNA <213> Homo sapiens <400> 1962 cuucugggug ucacuaugga gcu 23 <210> 1963 <211> 21 <212> RNA <213> Homo sapiens <400> 1963 cuguuggauu gauucgaaau u 21 <210> 1964 <211> 21 <212> RNA <213> Homo sapiens <400> 1964 uuucgaauca auccaacagu u 21 <210> 1965 <211> 21 <212> RNA <213> Homo sapiens <400> 1965 acgacuaguu caguugcuuu u 21 <210> 1966 <211> 21 <212> RNA <213> Homo sapiens <400> 1966 aagcaacuga acuagucguu u 21 <210> 1967 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (1)..(1) <223> Inverted basic nucleotide <220> <221> modified_base <222> (23)..(23) <223> Inverted basic nucleotide <400> 1967 ncuguuggau ugauucgaaa uun 23 <210> 1968 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 1968 uuucgaauca auccaacagu u 21 <210> 1969 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (1)..(1) <223> Inverted basic nucleotide <220> <221> modified_base <222> (23)..(23) <223> Inverted basic nucleotide <400> 1969 nacgacuagu ucaguugcuu uun 23 <210> 1970 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 1970 aagcaacuga acuagucguu u 21 <210> 1971 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1971 gcucaaagca auuucuacat t 21 <210> 1972 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1972 uguagaaauu gcuuugagct t 21 <210> 1973 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1973 ggaugaaaca caaaagguat t 21 <210> 1974 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1974 uaccuuuugu guuucaucct t 21 <210> 1975 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1975 ugucagaguu acuguuucat t 21 <210> 1976 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1976 ugaaacagua acucugacat t 21 <210> 1977 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1977 agcaagaaca gaaauaaaat t 21 <210> 1978 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1978 uuuuauuucuguucuugcut t 21 <210> 1979 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1979 cuaguucauu ucaaaauuat t 21 <210> 1980 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1980 uaauuuugaa augaacuagt t 21 <210> 1981 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1981 caaguucaca auuacccaat t 21 <210> 1982 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1982 uuggguaauu gugaacuugt t 21 <210> 1983 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1983 gcuugaagau gaaacacgat t 21 <210> 1984 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1984 ucguguuuca ucuucaagct t 21 <210> 1985 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1985 agaucaagaa aauguaugat t 21 <210> 1986 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1986 ucauacauuu ucuugaucut t 21 <210> 1987 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1987 ccaaagaaaa cacgaauuat t 21 <210> 1988 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1988 uaauucgugu uuucuuuggt t 21 <210> 1989 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1989 cuucgauaag auuauugaat t 21 <210> 1990 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1990 uucaaauaauc uuaucgaagt t 21 <210> 1991 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1991 aggacuaug accucgacut t 21 <210> 1992 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1992 agucgagguc auaguuccut t 21 <210> 1993 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1993 acgacgagac cuucaucaat t 21 <210> 1994 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1994 uugaugaagg ucucgucgut t 21 <210> 1995 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1995 aagaugagga agaaaucgat t 21 <210> 1996 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1996 ucgauuucuu ccucaucuut t 21 <210> 1997 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1997 aggaagaaau cgauguugut t 21 <210> 1998 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1998 acaacaucga uuucuuccut t 21 <210> 1999 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 1999 agcuuuuuug cccugcgugt t 21 <210> 2000 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 2000 cacgcagggc aaaaaagcut t 21 <210> 2001 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 2001 agguaguuau ccuuaaaaat t 21 <210> 2002 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 2002 uuuuuaagga uaacuaccut t 21 <210> 2003 <211> 97 <212> DNA <213> Homo sapiens <400> 2003 tgctgttgac agtgagcgcc agctcaaagc aatttctaca tagtgaagcc acagatgtat 60 gtagaaattg ctttgagctg ttgcctactg cctcgga 97 <210> 2004 <211> 97 <212> DNA <213> Homo sapiens <400> 2004 tgctgttgac agtgagcgaa aggatgaaac acaaaaggta tagtgaagcc acagatgtat 60 accttttgtg tttcatcctt ctgcctactg cctcgga 97 <210> 2005 <211> 97 <212> DNA <213> Homo sapiens <400> 2005 tgctgttgac agtgagcgcc atgtcagagt tactgtttca tagtgaagcc acagatgtat 60 gaaacagtaa ctctgacatg atgcctactg cctcggga 97 <210> 2006 <211> 97 <212> DNA <213> Homo sapiens <400> 2006 tgctgttgac agtgagcgca actagttcat ttcaaaatta tagtgaagcc acagatgtat 60 aattttgaaa tgaactagtt ttgcctactg cctcgga 97 <210> 2007 <211> 97 <212> DNA <213> Homo sapiens <400> 2007 tgctgttgac agtgagcgca cagcaagaac agaaataaaa tagtgaagcc acagatgtat 60 tttattctg ttcttgctgt atgcctactg cctcgga 97 <210> 2008 <211> 97 <212> DNA <213> Homo sapiens <400> 2008 tgctgttgac agtgagcgac aagatcaaga aaatgtatga tagtgaagcc acagatgtat 60 catacatttt cttgatcttg ctgcctactg cctcgga 97 <210> 2009 <211> 97 <212> DNA <213> Homo sapiens <400> 2009 tgctgttgac agtgagcgca gcaagttcac aattacccaa tagtgaagcc acagatgtat 60 tgggtaattg tgaacttgct ttgcctactg cctcgga 97 <210> 2010 <211> 97 <212> DNA <213> Homo sapiens <400> 2010 tgctgttgac agtgagcgcc ccttcgataa gattattgaa tagtgaagcc acagatgtat 60 tcaataatct tatcgaaggg atgcctactg cctcgga 97 <210> 2011 <211> 97 <212> DNA <213> Homo sapiens <400> 2011 tgctgttgac agtgagcgag agcttgaaga tgaaacacga tagtgaagcc acagatgtat 60 cgtgtttcat cttcaagctc ctgcctactg cctcgga 97 <210> 2012 <211> 97 <212> DNA <213> Homo sapiens <400> 2012 tgctgttgac agtgagcgac accaaagaaa acacgaatta tagtgaagcc acagatgtat 60 aattcgtgtt ttctttggtg gtgcctactg cctcgga 97 <210> 2013 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2013 uguagaaauu gcuuugagcu gu 22 <210> 2014 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2014 agcucaaagc aauuucuaca ua 22 <210> 2015 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2015 uaccuuuugu guuucauccu uc 22 <210> 2016 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2016 aggaugaaac acaaaaggua ua 22 <210> 2017 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2017 ugaaacagua acucugacau ga 22 <210> 2018 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2018 augucagagu uacuguuuca ua 22 <210> 2019 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2019 uaauuuugaa augaacuagu uu 22 <210> 2020 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2020 acuaguucau uucaaaaauua ua 22 <210> 2021 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2021 uuuuauuucu guucuugcug ua 22 <210> 2022 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2022 cagcaagaac agaaaauaaaa ua 22 <210> 2023 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2023 ucauacaucuu ucuugaucuu gc 22 <210> 2024 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2024 aagaucaaga aaauguauga ua 22 <210> 2025 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2025 uuggguaauu gugaacuugc uu 22 <210> 2026 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2026 gcaaguucac aauuacccaa ua 22 <210> 2027 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2027 uucaaauaauc uuaucgaagg ga 22 <210> 2028 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2028 ccuucgauaa gauuauugaa ua 22 <210> 2029 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2029 ucguguuuca ucuucaagcu cc 22 <210> 2030 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2030 agcuugaaga ugaaacacga ua 22 <210> 2031 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2031 uaauucgugu uuucuuuggu gg 22 <210> 2032 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2032 accaaagaaa acacgaauua ua 22 <210> 2033 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2033 ugaauuagcu guaucgucau u 21 <210> 2034 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2034 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaatgac g 51 <210> 2035 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2035 ggcggctgaa ttagctgtat cgt 23 <210> 2036 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2036 agtgcagggt ccgag 15 <210> 2037 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 2037 tggatacgac aatgac 16 <210> 2038 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2038 acucgugccu uggcaaacuu u 21 <210> 2039 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2039 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaaagtt tg 52 <210> 2040 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2040 ggcggcactc gtgccttggc a 21 <210> 2041 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2041 agtgcagggt ccgag 15 <210> 2042 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 2042 tggatacgac aaagtt 16 <210> 2043 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2043 cgccttgacg atacagctaa t 21 <210> 2044 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2044 tgtttcctgt aggagtcctc tat 23 <210> 2045 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 2045 tcactttgt 9 <210> 2046 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2046 gtgccttgac gatacagcta at 22 <210> 2047 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 2047 ccaagagaca ggtttctcca tc 22 <210> 2048 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 2048 ccaacaata 9 <210> 2049 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (1)..(1) <223> Inverted basic nucleotide <220> <221> modified_base <222> (23)..(23) <223> Inverted basic nucleotide <400> 2049 nugacgauac agcuaauuca uun 23 <210> 2050 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400>2050 ugaauuagcu guaucgucau u 21 <210> 2051 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (1)..(1) <223> Inverted basic nucleotide <220> <221> modified_base <222> (23)..(23) <223> Inverted basic nucleotide <400> 2051 naguuugcca aggcacgagu uun 23 <210> 2052 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2052 acucgugccu uggcaaacuu u 21 <210> 2053 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (1)..(1) <223> Inverted basic nucleotide <220> <221> modified_base <222> (23)..(23) <223> Inverted basic nucleotide <400> 2053 ncuguuggau ugauucgaaa uun 23 <210> 2054 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2054 uuucgaauca auccaacagu u 21 <210> 2055 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2055 Cys Gly Ile Phe Gly Glu Ile Glu Glu Leu Ile Glu Glu Gly Leu Glu 1 5 10 15 Asn Leu Ile Asp Trp Gly Asn Ala 20 <210> 2056 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2056 Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Trp Tyr Gly Cys 20 <210> 2057 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2057 Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Trp Asp Tyr Gly Ser Gly Ser Cys Gly 20 25 <210> 2058 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2058 Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Trp Tyr Gly 20 <210> 2059 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2059 Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Trp Asp Tyr Gly Ser Gly Ser Cys Lys 20 25 <210> 2060 <211> 27 <212> PRT <213> Apis mellifera <400> 2060 Cys Leu Ile Gly Ala Ile Leu Lys Val Leu Ala Thr Gly Leu Pro Thr 1 5 10 15 Leu Ile Ser Trp Ile Lys Asn Lys Arg Lys Gln 20 25 <210> 2061 <211> 26 <212> PRT <213> Apis mellifera <400> 2061 Gly Ile Gly Ala Val Leu Lys Val Leu Thr Thr Gly Leu Pro Ala Leu 1 5 10 15 Ile Ser Trp Ile Lys Arg Lys Arg Gln Gln 20 25 <210> 2062 <211> 13 <212> PRT <213> Mesobuthus eupeus <400> 2062 Ile Phe Gly Ala Ile Ala Gly Leu Leu Lys Asn Ile Phe 1 5 10 <210> 2063 <211> 18 <212> PRT <213> Mesobuthus eupeus <400> 2063 Phe Phe Gly His Leu Phe Lys Leu Ala Thr Lys Ile Ile Pro Ser Leu 1 5 10 15 Phe Gln <210> 2064 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2064 Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr Glu Trp Ser Gln Pro Lys 1 5 10 15 Lys Lys Arg Lys Val 20 <210> 2065 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2065 Leu Leu Ile Ile Leu Arg Arg Arg Arg Ile Arg Lys Gln Ala His Ala 1 5 10 15 His Ser Lys <210> 2066 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2066 Asp Pro Lys Gly Asp Pro Lys Gly Val Thr Val Thr Val Thr Val Thr 1 5 10 15 Val Thr Gly Lys Gly Asp Pro Lys Pro Asp 20 25 <210> 2067 <211> 17 <212> PRT <213> Unknown <220> <223> Description of Unknown: C105Y 1-antitrypsin peptide <400> 2067 Cys Ser Ile Pro Pro Glu Val Lys Phe Asn Lys Pro Phe Val Tyr Leu 1 5 10 15 Ile <210> 2068 <211> 27 <212> PRT <213> Unknown <220> <223> Description of Unknown: Transportan galanin and mastoparan peptide <400> 2068 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Lys Ile Asn Leu 1 5 10 15 Lys Ala Leu Ala Ala Leu Ala Lys Lys Ile Leu 20 25 <210> 2069 <211> 21 <212> PRT <213> Unknown <220> <223> Description of Unknown: TP10 Galanin and mastoparan peptide <400> 2069 Ala Gly Tyr Leu Leu Gly Lys Ile Asn Leu Lys Ala Leu Ala Ala Leu 1 5 10 15 Ala Lys Lys Ile Leu 20 <210> 2070 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2070 Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly 1 5 10 15 Ala <210> 2071 <211> 20 <212> PRT <213> Herpes simplex virus 1 <400> 2071 His Gly Leu Ala Ser Thr Leu Thr Arg Trp Ala His Tyr Asn Ala Leu 1 5 10 15 Ile Arg Ala Phe 20 <210> 2072 <211> 20 <212> PRT <213> Unknown <220> <223> Description of Unknown: CADY PPTG1 peptide <400> 2072 Gly Leu Trp Arg Ala Leu Trp Arg Leu Leu Arg Ser Leu Trp Arg Leu 1 5 10 15 Leu Trp Arg Ala 20 <210> 2073 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2073 Trp Glu Ala Ala Leu Ala Glu Ala Leu Ala Glu Ala Leu Ala Glu His 1 5 10 15 Leu Ala Glu Ala Leu Ala Glu Ala Leu Glu Ala Leu Ala Ala 20 25 30 <210> 2074 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2074 Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Trp Tyr Gly Cys 20 <210> 2075 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2075 Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Trp Tyr Gly 20 <210> 2076 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2076 Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met 20 25 30 Lys Trp Lys Lys 35 <210> 2077 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2077 Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Ser Ser Lys Lys Lys Lys 20 25 <210> 2078 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2078 Gly Leu Phe Glu Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Ile Asp Gly Gly Gly Tyr Cys 20 <210> 2079 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2079 Gly Leu Phe His Ala Ile Ala His Phe Ile His Gly Gly Trp His Gly 1 5 10 15 Leu Ile His Gly Trp Tyr Gly 20 <210> 2080 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2080 Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Leu Ala Glu Ala Leu Ala Glu Ala Leu Glu Ala Leu Ala Ala 20 25 30 <210> 2081 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2081 Lys Trp Lys Leu Phe Lys Lys Ile Gly Ala Val Leu Lys Val Leu Thr 1 5 10 15 Thr Gly Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 20 25 <210> 2082 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2082 acucgugccu uggcaaacuu u 21 <210> 2083 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2083 aguuugccaa ggcacgaguu u 21 <210> 2084 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2084 acucgugccu uggcaaacuu u 21 <210> 2085 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2085 aguuugccaa ggcacgaguu u 21 <210> 2086 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2086 acucgugccu uggcaaacuu u 21 <210> 2087 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2087 aguuugccaa ggcacgaguu u 21 <210> 2088 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2088 ugaauuagcu guaucgucau u 21 <210> 2089 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 2089 tgacgauaca gcuaauucau u 21 <210> 2090 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2090 ugaauuagcu guaucgucau u 21 <210> 2091 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2091 ugacgauaca gcuaauucau u 21 <210> 2092 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2092 ugaauuagcu guaucgucau u 21 <210> 2093 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2093 ugacgauaca gcuaauucau u 21 <210> 2094 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2094 uaaguauagg uccucauuau u 21 <210> 2095 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2095 uaaugaggac cuauacuuau u 21 <210> 2096 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 2096 tuucgaauca auccaacagu u 21 <210> 2097 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2097 cuguuggauu gauucgaaau u 21 <210> 2098 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2098 uuucgaauca auccaacagu u 21 <210> 2099 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2099 cuguuggauu gauucgaaau u 21 <210> 2100 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2100 uuucgaauca auccaacagu u 21 <210> 2101 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2101 cuguuggauu gauucgaaau u 21 <210> 2102 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2102 auaaaaucua cagucauagu u 21 <210> 2103 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2103 cuaugacugu agauuuuauu u 21 <210> 2104 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2104 uuaaaaucua cagucauagu u 21 <210> 2105 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2105 cuaugacugu agauuuuau u 21 <210> 2106 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2106 uuaaaaucua cagucauagu u 21 <210> 2107 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2107 cuaugacugu agauuuuau u 21 <210> 2108 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2108 gagagcucca uagugacacu u 21 <210> 2109 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2109 gugucacuau ggagcucucu u 21 <210> 2110 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2110 Glu Ala Phe Gln One <210> 2111 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2111 Gly Gly Phe Gly One <210> 2112 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2112 Ala Leu Ala Leu One <210> 2113 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 2113 Gly Phe Leu Gly One <210> 2114 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 2114 ggatgagtat gaccctacg 19 <210> 2115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic probe <400> 2115 gaggattcct acaggaagca 20 <210> 2116 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 2116 uaucgacgug uccagcuagu u 21 <210> 2117 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <223> Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide <400> 2117 tcucgugccu uggcaaacuu u 21

Claims (51)

Molecules of formula (I):
AXBYC
<Formula I>
In the above equation,
A is an antibody or antigen-binding fragment thereof;
B is a polynucleotide capable of hybridizing to the target sequence of the mRNA of a gene and mediating RNA interference to the gene;
X is a binding or non-polymeric linker;
Y is a bond or a second non-polymeric linker;
C is polyethylene glycol;
The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties;
A and C are not attached to the same end of B. 2. The method of claim 1, wherein the one or more 2' modified nucleotides are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-de Oxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'- O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-O-N-methylacetamido (2'-O-NMA) A molecule comprising modified nucleotides, locked nucleic acid (LNA) or ethylene nucleic acid (ENA). 2. The molecule of claim 1, wherein the one or more modified internucleotide linkages comprise a phosphorothioate linkage or a phosphorodithioate linkage. 2. The molecule of claim 1, wherein one or more inverted base moieties are at one or more termini. The molecule of claim 1, wherein the polynucleotide is single stranded. 2. The molecule of claim 1, wherein the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide, forming a double-stranded polynucleic acid molecule. 7. The molecule of claim 6, wherein X is conjugated to the 5' end of the first polynucleotide. 7. The molecule of claim 6, wherein the first polynucleotide and the second polynucleotide are RNA molecules. 7. The molecule of claim 6, wherein the first or second polynucleotide comprises the sequence of SEQ ID NO: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109 or 2117. The molecule of claim 1, wherein X is a bond. The molecule according to claim 1, wherein X is a C ₁ -C ₆ alkyl group. The molecule according to claim 1, wherein X is a homobifuctional linker or heterobifunctional linker, optionally conjugated to a C ₁ -C ₆ alkyl group. The method of claim 1, wherein the antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, monovalent Fab', divalent Fab2, or single-chain variable fragment. (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or antigen-binding fragment thereof. The molecule of claim 1, wherein A-X is conjugated to the 5' end of the polynucleotide. The molecule of claim 1, wherein A-X is conjugated to the 3' end of the polynucleotide. The molecule according to claim 1, further comprising D, wherein D is an endosomally degradable polymer, INF7 or melittin, and D is conjugated to A or C. delete delete A pharmaceutical composition for treating cancer in a patient in need of cancer treatment, comprising a molecule of formula (I):
AXBYC
<Formula I>
In the above equation,
A is an antibody or antigen-binding fragment thereof;
B is a polynucleotide;
X is a binding or non-polymeric linker;
Y is a bond or a second non-polymeric linker;
C is polyethylene glycol;
The polynucleotide comprises one or more 2' modified nucleotides, one or more modified internucleotide linkages, or one or more inverted base moieties;
A and C are not attached to the same end of B;
A pharmaceutical composition for treating cancer by knocking down the expression of a cancer-related gene by hybridizing a polynucleotide to the mRNA of the cancer-related gene. delete The molecule of claim 1, wherein C has a molecular weight of 1000 Da, 2000 Da, or 5000 Da. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete