KR102639805B1 - Primer set composition for discriminating Schisandra chinensis 'Ssumred' cultivar and uses thereof - Google Patents

Abstract

The present invention relates to a primer set composition for determining Schisandra chinensis 'Some Red' cultivar and its use. The SSR marker-based primer set composition of the present invention can simply and quickly distinguish Schisandra chinensis 'Some Red' cultivar, and is therefore available on the market. In the process, 'Some Red' can be clearly identified and used as an indicator to prevent mixing of raw materials and control raw material quality.

Description

Primer set composition for discriminating Schisandra chinensis 'Ssumred' cultivar and uses thereof}

The present invention relates to a primer set composition for determining Schisandra chinensis 'Some Red' cultivar and its use.

Schisandra chinensis occupies about 18% of the cultivation area of special crops (bellflower root, deodeok, round root, ground aralia, Schisandra chinensis, Schisandra chinensis, Cornus officinalis, spatula, kudzu, etc.) excluding ginseng in Korea, and is used for food and medicinal purposes, making it economically viable. , it is an industrially important crop. The main components of Schisandra chinensis are lignan and triterpenoid, which are effective in treating systemic weakness, mental and physical fatigue, nervous breakdown, low blood pressure, and decreased heart function. Due to its diverse efficacy, Schisandra chinensis is receiving increasing attention and use not only as a simple herbal medicine ingredient but also as a general food.

Two genera and three species of Schisandra grow naturally in Korea. Schisandra chinensis (Turcz.) Baill., which is the most widely cultivated deciduous broad-leaved vine, and Black Schisandra (Schisandra repanda), which grows naturally in the mid-mountainous areas of Hallasan Mountain in Jeju Island, and the evergreen broad-leaved vine Southern Schisandra (Kadsura japonica), which is classified into a different genus. There is. In general, Schisandra chinensis is distributed in the mountains and fields of the central and southern inland regions, such as Taebaeksan Mountain, Songnisan Mountain, and Jirisan Mountain, and is cultivated and produced by local growers by excavating and propagating it in the wild, or by growing it.

Recently, the Gyeongsangbuk-do Agricultural Research and Extension Services Bonghwa Medicinal Crop Research Institute developed Schisandra large-fruited species (Hanomi) and early-maturing species (Somered). In order to improve the competitiveness of the medicinal crop industry, the development of varieties that can be distributed to farms must take precedence, and it is urgent to secure and distribute excellent varieties in order to gain an upper hand in international domestic agricultural genetic resource protectionism and seed disputes.

With recent radical developments in the field of molecular biology, a variety of molecular biological methods are being used to classify plants within genera, between species, or between species, and for this purpose, various DNA markers have been developed that enable the study of the diversity of genetic resources at the DNA level. It is becoming. Molecular markers can reliably search for and identify genetic mutations in all tissues regardless of plant growth by using a small amount of DNA, complementing limitations in morphological and physicochemical discrimination and providing reliability in a short period of time at a relatively low cost. High level analysis is possible. SSR (Simple Sequence Repeat) marker is a molecular marker widely used in plants. It can detect polymorphisms in a relatively simple way using PCR (Polymerase Chain Reaction) technology, so it is one of the methods preferred by actual breeders and breeding researchers. . In addition, SSR markers have the advantage of being able to detect multiple alleles at each genetic locus, showing high reproducibility, ensuring compatibility within related species, and enabling efficient analysis in automated fluorescence genotyping.

Meanwhile, Korean Patent Publication No. 2023-0067046 discloses 'molecular markers based on mitochondrial genome sequence for distinguishing pure varieties of Schisandra chinensis and their use', but the primer set composition for distinguishing Schisandra 'Some Red' varieties of the present invention and its composition There is nothing described about its intended use.

The present invention was derived from the above-mentioned needs, and the present inventor selected common SSR mutations between samples through SSR analysis of the nuclear genome using re-sequencing data of Schisandra chinensis 'Some Red' and 'Han Omi' cultivars. Using SSR-GBS (genotyping by sequencing) data from 81 Schisandra chinensis samples, six SSR markers that could distinguish Schisandra 'Some Red' cultivar were selected. In addition, PCR was performed on Schisandra chinensis samples other than the 'Some Red' variety using a primer set based on the six SSR markers, and then the genotype of each sample was analyzed to accurately distinguish only the 'Some Red' variety. By confirming the set combination, the present invention was completed.

In order to solve the above problems, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; and oligonucleotide primer sets of SEQ ID NOs: 11 and 12; providing a primer set composition for distinguishing Schisandra chinensis 'Some Red' varieties, comprising three or more primer sets selected from the group consisting of.

In addition, the present invention provides the primer set composition; and a kit for distinguishing Schisandra chinensis 'Some Red' varieties, including reagents for performing an amplification reaction.

In addition, the present invention includes the steps of isolating genomic DNA from Schisandra chinensis samples; Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition according to the present invention to amplify the target sequence; and analyzing the genotype of the amplification step.

The SSR marker of the present invention can simply and quickly distinguish Schisandra chinensis 'Some Red' varieties, and is therefore useful as an indicator for preventing mixing of raw materials and controlling raw material quality by clearly identifying 'Some Red' during the distribution process in the market. It is expected that this can be done.

Figure 1 is a schematic diagram showing the SSR marker development process of the present invention.
Figure 2 shows the results of confirming the amplification efficiency through PCR reaction and electrophoresis by applying the six SSR marker-based primer sets of the present invention to five Schisandra chinensis samples.
Figure 3 shows the results of PCoA (principal coordinate analysis) analysis using candidate SSR markers on 81 Schisandra chinensis samples.

In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 3 and 4; Oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Oligonucleotide primer sets of SEQ ID NOs: 9 and 10; and oligonucleotide primer sets of SEQ ID NOs: 11 and 12; providing a primer set composition for distinguishing Schisandra chinensis 'Some Red' varieties, comprising three or more primer sets selected from the group consisting of.

The Schisandra chinensis variety 'Some Red' of the present invention is a Schisandra chinensis variety with variety protection application number 2020-03.

The primer set composition of the present invention may include three or more primer sets among six primer sets, and more preferably, the oligonucleotide primer sets of SEQ ID NOs: 3 and 4, the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, and ‘Primer set combination 1’ consisting of oligonucleotide primer sets of SEQ ID NOs: 9 and 10; 'Primer set combination 2' consisting of the oligonucleotide primer sets of SEQ ID NOs: 1 and 2, the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, and the oligonucleotide primer sets of SEQ ID NOs: 9 and 10; 'Primer set combination 3' consisting of the oligonucleotide primer sets of SEQ ID NOs: 1 and 2, the oligonucleotide primer sets of SEQ ID NOs: 3 and 4, the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, and the oligonucleotide primer sets of SEQ ID NOs: 9 and 10. '; Oligonucleotide primer sets of SEQ ID NOs: 1 and 2, oligonucleotide primer sets of SEQ ID NOs: 3 and 4, oligonucleotide primer sets of SEQ ID NOs: 5 and 6, oligonucleotide primer sets of SEQ ID NOs: 7 and 8, and oligonucleotide primer sets of SEQ ID NOs: 9 and 10 ‘Primer set combination 4’ consisting of an oligonucleotide primer set; Oligonucleotide primer sets of SEQ ID NOs: 1 and 2, oligonucleotide primer sets of SEQ ID NOs: 3 and 4, oligonucleotide primer sets of SEQ ID NOs: 5 and 6, oligonucleotide primer sets of SEQ ID NOs: 9 and 10, and oligonucleotide primer sets of SEQ ID NOs: 11 and 12 ‘Primer set combination 5’ consisting of an oligonucleotide primer set; and oligonucleotide primer sets of SEQ ID NOs: 1 and 2, oligonucleotide primer sets of SEQ ID NOs: 3 and 4, oligonucleotide primer sets of SEQ ID NOs: 5 and 6, oligonucleotide primer sets of SEQ ID NOs: 7 and 8, and SEQ ID NOs: 9 and 10. 'Primer set combination 6' consisting of the oligonucleotide primer set of and the oligonucleotide primer set of SEQ ID NOs: 11 and 12; may include, but is not limited to, any one primer set combination selected from the group consisting of.

The primer of the present invention is an oligo consisting of a fragment of 15 or more, 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NOs. 1 to 12, depending on the sequence length of each primer. May contain nucleotides. For example, the primer (20 oligonucleotides) of SEQ ID NO: 1 may include an oligonucleotide consisting of a segment of 17 or more, 18 or more, or 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 1. In addition, the primer may also include sequences added, deleted, or substituted in each base sequence of SEQ ID NOs: 1 to 12, which can bind to the amplification site. Among the above sequence numbers, the odd-numbered oligonucleotide primer is a forward primer, and the even-numbered oligonucleotide primer is a reverse primer.

The oligonucleotide primer set of SEQ ID NOs. 1 to 12 according to the present invention is a primer set capable of amplifying the SSR marker located on the Schisandra chinensis genome. Three or more primer sets are selected among six primer sets to produce Schisandra chinensis 'Some Red.' 'You can distinguish between varieties.

In the present invention, “primer” refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow for initiation of synthesis of the extension product. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target desired as well as the conditions under which the primer is used, such as temperature and ionic strength.

In the present specification, the oligonucleotide used as a primer may include a nucleotide analogue, for example, phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or may contain an insert It may contain an intercalating agent.

The present invention also provides the primer set composition; and a kit for distinguishing Schisandra chinensis 'Some Red' varieties, including reagents for performing an amplification reaction.

In the kit of the present invention, the primer set composition is the same as described above.

In one embodiment of the present invention, reagents for performing the amplification reaction may include, but are not limited to, DNA polymerase, dNTPs, and buffer.

The kit of the present invention may also further include a user guide describing optimal reaction performance conditions. The guide is a printed material that explains how to use the kit, for example, how to prepare PCR buffer, and the suggested reaction conditions. Instructions include information leaflets in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

Isolating genomic DNA from Schisandra chinensis sample;

Using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition according to the present invention to amplify the target sequence; and

It provides a method for distinguishing Schisandra chinensis 'Some Red' varieties, including the step of analyzing the genotype of the amplification step.

In the method according to one embodiment of the present invention, the primer set composition is as described above.

The method of the present invention includes the step of isolating genomic DNA from a Schisandra chinensis sample. The method for isolating genomic DNA from the Schisandra chinensis sample can use methods known in the art, for example, the CTAB method or the Wizard prep kit (Promega). The target sequence can be amplified by using the isolated genomic DNA as a template and performing an amplification reaction using a primer set according to an embodiment of the present invention. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There are strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using polymerase. These PCR methods are well known in the art, and commercially available kits can also be used.

In the method according to one embodiment of the present invention, the Schisandra chinensis sample may be a plant leaf, stem, root, fruit, or seed, but is not limited thereto.

In one embodiment of the present invention, the genotyping method of the product of the amplification step may be performed using a DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. Capillary electrophoresis can be performed using, for example, the ABi Sequencer. Additionally, gel electrophoresis can be performed, and gel electrophoresis can use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, the fluorescence measurement method is to perform PCR by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorometer. can do. In addition, the radioactivity measurement method involves adding a radioisotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then using a radioactivity measurement device, such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter.

In the method according to one embodiment of the present invention, the product of the amplification step is obtained by detecting the fluorescence of the substance labeled at the 5' end of the primer set during amplification of the target sequence using a primer set combining a fluorescent labeling substance. It may be analyzing. If the product of the amplification step shows the same size as the 'Some Red' variety, it can be determined as the 'A' genotype, and if it shows a different size from the 'Some Red' variety, the 'B' genotype can be determined, and the SSR marker-based primer of the present invention The 'Some Red' variety can be distinguished through the combination of genotypes determined through the set (Table 14).

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Schisandra chinensis sample

The 81 samples of Schisandra chinensis used in the development of the SSR marker of the present invention were samples held at the Bonghwa Medicinal Crop Research Institute of the Gyeongsangbuk-do Agricultural Research and Extension Services (Table 1). The genome analysis of the samples was mainly repeated 4 times for each sample, and some of the Southern Schisandra and Black Schisandra were repeated 3 and 2 times, respectively.

Schisandra chinensis sample information No. Analysis ID No. Analysis ID No. Analysis ID One 71-1R 28 124-4R 55 21-3R 2 71-2R 29 125-1R 56 21-4R 3 71-3R 30 125-2R 57 13-1R 4 71-4R 31 125-3R 58 13-2R 5 105-1R 32 125-4R 59 13-3R 6 105-2R 33 122-1R 60 13-4R 7 105-3R 34 122-2R 61 3-1R 8 105-4R 35 122-3R 62 3-2R 9 120-1R 36 122-4R 63 3-3R 10 120-2R 37 123-1R 64 3-4R 11 120-3R 38 123-2R 65 4-1R 12 120-4R 39 123-3R 66 4-2R 13 121-1R 40 123-4R 67 4-3R 14 121-2R 41 135-1-1R 68 4-4R 15 121-3R 42 135-1-2R 69 77-1R 16 121-4R 43 135-1-3R 70 77-2R 17 127-1R 44 135-1-4R 71 77-3R 18 127-2R 45 136-1-1R 72 77-4R 19 127-3R 46 136-2-1R 73 81-1R 20 127-4R 47 136-3-1R 74 81-2R 21 128-1R 48 136-4-1R 75 81-3R 22 128-2R 49 45-1R 76 81-4R 23 128-3R 50 45-2R 77 Schisandra chinensis-1R 24 128-4R 51 45-3R 78 Schisandra chinensis-2R 25 124-1R 52 45-4R 79 Schisandra chinensis-3R 26 124-2R 53 21-1R 80 Black Schisandra-1R 27 124-3R 54 21-2R 81 Black Schisandra-2R

2. SSR marker development

2-1. SSR analysis using resequencing data of two species of Schisandra chinensis (Some Red, Han Omi)

NGS (next generation sequencing) was performed using the Illumina Hiseq 2500 platform (Illumuna, USA), and the nucleic acid fragments obtained through this were combined using SOAPdenovo2 (Table 2). Raw SSR was detected in the assembled contig sequence of each sample, and statistics were organized by SSR motif type (Table 3). Then, for comparative analysis of SSR between samples, an SSR size matrix between samples was created based on the reference. (Table 4). The reference was used by analyzing the genome using short reads obtained by whole-genome sequencing of the Schisandra chinensis 'Hanomi' cultivar (71-2R), producing data, and then assembling them. For the SSR size matrix between samples, flanking sequences of 20 bp before and after were extracted based on the SSR region found in the reference sequence, and then in silico PCR was performed on the surrounding sequences as reference and the reference genome of the analysis sample for each sample. The expected SSR size was integrated and created, and SSR variation between samples was then explored (Table 5).

Assembled Condig Information Sample Hash length
( k-mer ) Num.fo
contigs Length(bp) of contigs Total length MIN MAX AVG N50 105-4R 69 5,659,524 2,024,666,317 200 10,812 357 362 71-2R 6,338,400 2,406,509,556 200 10,875 379 390

Analysis by SSR motif type Motif type 71-2R 105-4R p2 (di-nucleotide) 238,287 181,793 p3 (tri-nucleotide) 39,205 32,036 p4 (tetra-nucleotide) 21,495 17,319 p5 (penta-nucleotide) 50,047 41,282 p6 (hexa-nucleotide) 1,197,651 1,002,192 p7 (hepta-nucleotide) 399,587 331,079 p8 (octa-nucleotide) 164,906 136,028 p9 (nona-nucleotide) 54,478 44,769 p10 (deca-nucleotide) 20,445 16,769 Total 2,186,101 1,803,221

SSR size matrix No. of SSR No. of Primer ^*1 No. of Recommended primer ^*2 No. of SSR size matrix ^*3 2,186,101 808,890 568,294 424,449 *1) No. of Primer: 71 Number of SSR primers designed to target the 2R SSR left
*2) No. of Recommended primer: Number of primers observed once by performing in silico PCR on the reference genome
*3) No. of SSR size matrix: The SSR size for each sample predicted by performing in silico PCR on the assembled contigs sequence of the flanking sequence near the SSR region was organized in matrix form, and the number of positions in the corresponding SSR size matrix was calculated.

SSR mutation search filter stage filter item No. of SSRs One No. of SSR size matrix selection ^*1 424,449 2 Selection of motif size polymorphic locus between comparative samples ^*2 27,664 3 Selection of left without repeat sequence within 30bp of SSR surrounding sequence ^*3 1,636 4 SSR type p 2~p6 left selection ^*4 1,206 5 Left starter with 1 Expected SSR size ^*5 484 6 Left selection with product size 450 bp ^*6 474 7 Remove expected SSR sequence if it is not a repetition of motif ^*7 132 8 Primer filter ^*8 122 *1No. of SSR size matrix selection: Perform in silico PCR to select an SSR primer set that aligns once in its own contigs sequence
*2 Selection of motif size polymorphic loci between comparison samples: Number of SSR loci showing differences in SSR motif size between comparison samples
*3 Selection of a locus without a repeat sequence within 30bp of the SSR surrounding sequence: When a repeat sequence exists within 30bp of the surrounding sequence before and after the SSR region found in the 71-2R sample, the corresponding locus is removed.
*4 SSR type p2~p6 left selection: Select a left with an SSR motif length of 26bp
*5 Selection of a locus with 1 Expected SSR size: Select a locus with 1 predicted SSR size for each sample through in silico PCR
*6 Selection of loci with product size≤450bp: Select loci with product size of 450bp or less predicted for each sample through in silico PCR
*7 Remove cases where the Expected SSR sequence is not a repeat of the motif: Remove cases where the difference in expected SSR sequence between samples is caused by InDel, etc., rather than a difference in the number of motif repeats.
*8 Primer filter: To reduce errors during the experiment, cases with similar sequences are removed through alignment between primers.

2-2. Marker selection using SSR-GBS data from 81 Schisandra chinensis samples

An SSR-GBS library was created using 81 Schisandra chinensis samples, and paired-end sequencing was performed using Illumina Miseq. After filtering using the SSR product size matrix of 81 Schisandra chinensis samples, PCoA (principal coordinate analysis) analysis was performed on the filtered SSR marker product size using the GenAlEx 6.5 program (Figure 3), through which the BH 71 variety Markers specific to the cultivars (Hanomi) and BH 105 (Somered) were selected (Table 6).

SSR marker-based primer set information of the present invention Primer name SSR motif Sequence information (5'-3') (SEQ ID NO) fluorescent dye SSR_005 (TGCAAG) ₂ F:GCCTAAGAGTTAGAACCCCAA (1)
R:CAAGCTTTTGTGTTTGACCTT (2) 5'-FAM SSR_038 (TCGGT) ₃ F:ACGAACTGAACACAAACATG (3)
R:AAAAAATCCATCCCAGTCCTC (4) 5'-FAM SSR_041 (ACCCAA) ₃ F:ATCCCCAAGAAGGAACATTC (5)
R:AGGGGCCTATAGTGATTGAT (6) 5'-FAM SSR_063 (ACACG) ₇ F:AAAGGAAAGTCAAAGACGC (7)
R:TCGTCGTAAAGCATCATCTC (8) 5'-FAM SSR_066 (GAGAGT) ₂ F:AGATTGGCATCTTGATGTGT (9)
R:TTTTCAAATTTACCGCTCGG (10) 5'-FAM SSR_096 (ATG) ₈ F:CTTACGTGTAACCCCTATGG (11)
R:AATCATAGGATTGCAGCCAA (12) 5'-FAM

3. PCR amplification and fragment analysis

Genomic DNA was extracted from 48 Schisandra chinensis samples and used for PCR amplification. For PCR amplification, mix 1.5 μl of gDNA (10-20 ng/μl), 0.3 μl each of 10 μM forward and reverse primers, 7.5 μl of 2 After preparing ㎕ of PCR reaction material, the reaction was performed using an ABI 2720 thermal cycler (Applied Biosystems, USA).

PCR pre-denaturation 94°C 5 minutes; Denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds were repeated a total of 35 times; Final elongation was performed at 72°C for 30 minutes. The PCR amplification product was confirmed for amplification through electrophoresis on a 1.2% agarose gel. Next, 1 μl of the PCR amplification product diluted 1/10 to 1/100 was mixed with 8.9 μl of Hi Diformamide (Applied Biosystems) and 0.1 μl of GeneScan ^TM 500 LIZ ^® Size Standard (Applied Biosystems), and the mixture was stored at 95°C. After denaturing for 5 minutes, it was left on ice. The amplified DNA fragments were separated through capillary electrophoresis on an ABI 3730 DNA analyzer (Applied Biosystems) equipped with a 50 cm capillary. The sizes of alleles were determined using GeneMapper software ver. Determination was made using 4.0 (Applied Biosystems). In the present invention, six SSR markers (Table 6) were applied to five randomly selected samples of Schisandra chinensis, and amplification efficiency was confirmed through PCR reaction and electrophoresis (Figure 2).

4. Schisandra genotype analysis

PCR was performed on the gDNA of 41 samples of Schisandra chinensis using 6 primer sets of the present invention, and then fragment analysis was performed to determine allele sizes, and the sizes of alleles were determined using GeneMapper software. The results for each primer set are summarized in Tables 7 to 12 below, where Size 1 and Size 2 refer to the cases where there is one amplification product (homozygous) and two amplification products (heterozygous), and Height refers to the case of each amplification product. Mean intensity of FAM fluorescence relative to size.

Example 1. Confirmation of differentiation of Schisandra chinensis ‘Some Red’ cultivar using the SSR marker of the present invention

Using the SSR marker-based primer set of the present invention (Table 6), PCR was performed on a total of 48 Schisandra samples, including 'Some Red (BH 105-1R, BH 105-2R)', and then genotype was analyzed. . Based on 'Somered', if the size was the same as that of the 'Somered' amplification product, the 'A' genotype was determined, and if it was different from the size of the 'Somered' amplification product, the 'B' genotype was determined (Table 13).

As a result of analyzing the genotypes of 48 Schisandra chinensis samples, primer sets SSR_041, SSR_066, and SSR_038; SSR_041, SSR_066 and SSR_005 primer sets; SSR_041, SSR_066, SSR_038, and SSR_005 primer sets; SSR_041, SSR_066, SSR_038, SSR_005, and SSR_063 primer sets; SSR_041, SSR_066, SSR_038, SSR_005, and SSR_096 primer sets; It was confirmed that only the 'Some Red' variety could be accurately distinguished when combining the analyzed genotypes with a combination of the SSR_041, SSR_066, SSR_038, SSR_005, SSR_096 and SSR_063 primer sets (Tables 14 and 15).

Claims (6)

'Primer set combination 1' consisting of the oligonucleotide primer sets of SEQ ID NOs: 3 and 4, the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, and the oligonucleotide primer sets of SEQ ID NOs: 9 and 10; 'Primer set combination 2' consisting of the oligonucleotide primer sets of SEQ ID NOs: 1 and 2, the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, and the oligonucleotide primer sets of SEQ ID NOs: 9 and 10; 'Primer set combination 3' consisting of the oligonucleotide primer sets of SEQ ID NOs: 1 and 2, the oligonucleotide primer sets of SEQ ID NOs: 3 and 4, the oligonucleotide primer sets of SEQ ID NOs: 5 and 6, and the oligonucleotide primer sets of SEQ ID NOs: 9 and 10. '; Oligonucleotide primer sets of SEQ ID NOs: 1 and 2, oligonucleotide primer sets of SEQ ID NOs: 3 and 4, oligonucleotide primer sets of SEQ ID NOs: 5 and 6, oligonucleotide primer sets of SEQ ID NOs: 7 and 8, and oligonucleotide primer sets of SEQ ID NOs: 9 and 10 ‘Primer set combination 4’ consisting of an oligonucleotide primer set; Oligonucleotide primer sets of SEQ ID NOs: 1 and 2, oligonucleotide primer sets of SEQ ID NOs: 3 and 4, oligonucleotide primer sets of SEQ ID NOs: 5 and 6, oligonucleotide primer sets of SEQ ID NOs: 9 and 10, and oligonucleotide primer sets of SEQ ID NOs: 11 and 12 ‘Primer set combination 5’ consisting of an oligonucleotide primer set; and oligonucleotide primer sets of SEQ ID NOs: 1 and 2, oligonucleotide primer sets of SEQ ID NOs: 3 and 4, oligonucleotide primer sets of SEQ ID NOs: 5 and 6, oligonucleotide primer sets of SEQ ID NOs: 7 and 8, and SEQ ID NOs: 9 and 10. 'Primer set combination 6' consisting of the oligonucleotide primer set of and the oligonucleotide primer set of SEQ ID NOs. 11 and 12; Schisandra 'Some Red' variety, characterized in that it comprises one or more primer set combinations selected from the group consisting of Primer set composition for distinguishing. delete The primer set composition of claim 1; and a kit for distinguishing Schisandra chinensis 'Somered' varieties, including reagents for performing an amplification reaction. The kit according to claim 3, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs, and buffer. Isolating genomic DNA from Schisandra chinensis sample;
Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the primer set composition of claim 1; and
A method for distinguishing between Schisandra chinensis 'Some Red' varieties, including the step of analyzing the genotype of the amplification step. The method according to claim 5, wherein the detection of the product of the amplification step is performed using a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement.