KR102608571B1 - Composition for treatment, prevention or reducing atopic dermatitis, psoriasis or dermatitis comprising ganoderic acid - Google Patents

Abstract

The present invention relates to a novel method for producing ganoderic acid, and a composition for treating, preventing, or alleviating atopy, psoriasis, or skin inflammation using ganoderic acid. The active ingredient of the present invention or a composition containing the same can be used to treat existing steroid-based substances and Unlike antihistamines, it is effective in preventing, treating, or alleviating psoriasis, atopy, and skin inflammation without any side effects.

Description

Composition for treatment, prevention or reducing atopic dermatitis, psoriasis or dermatitis comprising ganoderic acid}

This specification relates to a novel method for producing ganoderic acid and a composition for treating, preventing, or alleviating atopy, psoriasis, or skin inflammation using ganoderic acid.

Chronic inflammatory skin disease refers to a disease caused by skin hypersensitivity caused by environmental or genetic triggers. The body has an immune response that removes foreign substances and regulates induced inflammatory responses to protect itself from external stimuli. When an abnormality occurs in the immune system, an immune disease occurs. Inflammatory skin diseases are caused by skin-related immune system reactions and include allergic dermatitis, allergic rhinitis, asthma, allergic conjunctivitis, and atopic urticaria (Donald Y.M.Leung et al, J. Clin Invest., 113 (5)651-657(2004)).

It is known that atopic dermatitis is largely influenced by genetics, but according to the results of a survey by the Health Insurance Review and Assessment Service in 2018, the number of domestic patients who received treatment for atopic dermatitis reached 942,927, of whom adults aged 20 or older accounted for 42.7%. occupied. This type of atopic dermatitis in adults was determined to be caused by changes in living and working environments, social stress, etc., rather than genetic effects.

Psoriasis, another type of dermatitis, is a disease caused by abnormal activity of cells in the skin, and the cause of the disease is not yet clearly known. Psoriasis is a common autoimmune skin disease that presents with silvery-white, scaly papules. Depending on the distribution and severity, the symptoms can vary depending on the individual, including systemic deprivation, erythema, itching, dryness, and burning. Although it occurs worldwide, there are significant differences in the frequency of occurrence among races and ethnic groups, and the clinical course may vary, but it generally persists with repeated improvement and deterioration. Although the pathogenesis of psoriasis has not yet been fully elucidated, research results have reported that inflammation plays an important role, including infiltration of inflammatory cells, increased immune activation molecules, Th1 and Th17 responses, and abnormal changes in inflammation-related cytokines. In this type of psoriasis, skin cells that produce keratin are overly stimulated and grow rapidly compared to normal skin, resulting in multiple layers of keratin like dandruff. Unlike atopic dermatitis, the incidence rate is high in adults and it mainly occurs on the elbows and knees. The main symptoms are reported to be a millet-like rash and thick keratin.

Currently used treatments for skin diseases include steroids and antihistamines that suppress the secretion of histamine, a product of allergic reactions, or suppress inflammatory reactions, which are one of the symptoms of allergies. In the case of these atopic disease treatment ointments, they are not inflammatory diseases that prevent and suppress the formation of fundamental inflammation, and may cause side effects when used for a long period of time. Steroids are known to cause side effects such as obesity, diabetes, high blood pressure, and depression, and antihistamines are known to cause side effects such as depression, concentration problems, lethargy, drowsiness, and sexual dysfunction. Therefore, discovering natural materials that can be used for atopic diseases and developing treatments through them. This is becoming important.

Skin inflammation is initiated by cytokines, which are signaling molecules that are induced when abnormalities occur in the skin barrier due to stimulation by internal and external factors. Cytokines are mainly produced by immune cells such as T cells and macrophages, including interleukins, tumor necrosis factor-α (TNF-α), and interferon gamma. ,IFNγ), etc. (SM Opal et al, CHEST, 117(4) 1162-1172, 2000).

Chemokine is a type of low-molecular-weight protein secreted from wounded tissue, tissue infected with bacteria or viruses, etc., and has an attracting and activating effect on white blood cells. It is classified according to the four cysteine residues in the molecule and is broadly classified into CXCL, CCL, CX3CL and XCL. It is classified as Additionally, S100 calcium binding proteins such as S100A7, S100A8, and S100A9 are located within the S100 gene cluster on chromosome 1q21 and are known to be related to psoriasis.

Therefore, in order to confirm the effectiveness of skin inflammatory disease prevention and treatment, factors such as chemokines (CXCL8, CCL5, CCL20), cytokines (IL-6, IL-23/p19), and S100 calcium binding proteins (S100A7, S100A8, S100A9) Suppression of expression becomes important.

However, steroids or antihistamines are currently used as effective substances for atopy, psoriasis or skin inflammatory diseases, and these treatment substances are known to cause various side effects as mentioned above. In addition, since these therapeutic substances suppress the production stage of histamine, which is a symptom of the above disease, they do not show the effect of preventing or suppressing the production of fundamental inflammation.

Therefore, for the treatment of atopy, psoriasis or skin inflammation, it is necessary to develop a treatment that suppresses more fundamental inflammatory mechanisms and reduces side effects.

Korean Patent Publication No. 10-2009-0018886

In order to solve the above problems, the present inventors discovered that ganoderic acid, among ingredients extracted from natural products, contains chemokines (CXCL8, CCL5, CCL20) and cytokines (IL-6, IL-23/p19) that cause atopy, psoriasis, and skin inflammation. , S100 calcium binding proteins (S100A7, S100A8, S100A9) were confirmed to be excellent in suppressing the expression of elements, which led to the present invention.

Accordingly, one aspect of the present invention seeks to provide a composition for preventing, treating or alleviating atopy, psoriasis or skin inflammation, containing ganoderic acid as an active ingredient.

In addition, one aspect of the present invention seeks to provide a method for producing a composition for preventing, treating or alleviating atopy, psoriasis or skin inflammation containing ganoderic acid as an active ingredient.

In addition, one aspect of the present invention seeks to provide a method for producing ganoderic acid for preventing, treating, or alleviating atopy, psoriasis, or skin inflammation.

The object of the present invention is not limited to the objects mentioned above. The object of the present invention will become clearer from the following description and may be realized by means and combinations thereof as set forth in the claims.

One aspect of the present invention provides a composition for preventing, treating or alleviating skin inflammation containing ganoderic acid or a derivative thereof as an active ingredient.

One aspect of the present invention provides a composition for preventing, treating or alleviating atopy containing ganoderic acid or a derivative thereof as an active ingredient.

One aspect of the present invention provides a composition for preventing, treating or alleviating psoriasis containing ganoderic acid or a derivative thereof as an active ingredient.

In one aspect of the present invention, the ganoderic acid or a derivative thereof is ganoderic acid eta (GAeta), butyl ganoderic acid A (BGAA), ganoderic acid C2 (GAC2), ganoderic acid A (GAA), ganoderic acid Derrickic acid G (GAG), ganodrenic acid B (GDAB), ganoderic acid B (GAB), ganoderic acid K (GDAK), ganoderic acid K (GAK), ganodrenic acid D (GDAD), ganoderic acid Provided is a composition that is at least one selected from D (GAD), ganoderic acid H (GAH), ganoderic acid C6 (GAC6), and lucidenic acid D.

In one aspect of the present invention, a composition is provided wherein the ganoderic acid or a derivative thereof is isolated or obtained from an extract of reishi mushroom ( ganoderma lucidum ).

In one aspect of the present invention, a composition is provided wherein the extract of reishi mushroom is an ethanol extract.

In one aspect of the present invention, a composition is provided wherein the extract of reishi mushroom is extracted at a temperature of 30 to 80° C. for 2 to 40 hours.

In one aspect of the present invention, a composition is provided wherein the active ingredient inhibits any one or more of chemokines, cytokines, and S100 calcium binding proteins.

In one aspect of the invention, the chemokine is any one or more of CXCL8, CCL5, and CCL20, the cytokine is any one or more of IL-6 and IL-23/p19, and the S100 calcium binding protein is S100A7, S100A8. And it provides a composition that is any one or more of S100A9.

In one aspect of the present invention, a composition is provided, wherein the composition is a pharmaceutical composition.

In one aspect of the present invention, the composition provides a composition that is a cosmetic composition.

In one aspect of the present invention, the composition provides a composition that is a health functional food composition.

Another aspect of the present invention is a method for producing ganoderic acid or a derivative thereof for preventing, treating or alleviating skin inflammation, atopy or psoriasis, using reishi mushroom ( ganoderma lucidum ) at a temperature of 30 to 80° C., 2 to 40° C. A manufacturing method is provided, comprising the step of extraction using an ethanol solvent for a period of time.

In another aspect of the present invention, a manufacturing method is provided wherein the extracting step is ultrasonic extraction.

In another aspect of the present invention, the method further includes the step of re-dissolving the crude extract obtained after extraction.

The active ingredient of the present invention or a composition containing it is excellent in preventing, treating or alleviating psoriasis.

The active ingredient of the present invention or a composition containing it is excellent in preventing, treating or alleviating atopy.

The active ingredient of the present invention or a composition containing the same is excellent in preventing, treating or alleviating skin inflammation.

Unlike existing steroid-based substances and antihistamines, the active ingredient of the present invention or a composition containing the same is excellent in preventing, treating, or alleviating psoriasis, atopy, and skin inflammation without side effects.

The active ingredient of the present invention or a composition containing the same has an mRNA level of expression of inflammatory cytokines (IL-6, S100A7, S100A8, S100A9, CCL5, CCL20, CXCL8), which are factors that cause inflammation, in HeCaT cells, which are skin keratinocytes. can be significantly reduced.

The method for producing ganoderic acid or a derivative thereof, which is the active ingredient of the present invention, can obtain the active ingredient in high yield.

The effects of the present invention are not limited to the effects mentioned above. The effects of the present invention should be understood to include all effects that can be inferred from the following description.

Figure 1 is a diagram depicting the manufacturing process of the reishi mushroom extract and its fractions in Example 1 of the present invention.
Figure 2 shows the results of analyzing the components of the reishi mushroom extract of Example 1 of the present invention by UPLC-QTOF-MS/MS according to Experimental Example 1.
Figure 3 shows the results of semi-quantitative analysis of Example 1 of the present invention.
Figure 4 (Figures 4a to 4c) shows the results of confirming cytotoxicity according to Experimental Example 2 of the present invention.
Figure 5 shows the results of inhibition of IL-6 gene expression in extracts according to each extraction condition in Experimental Example 3 of the present invention.
Figure 6 shows the results of inhibition of S100A7 gene expression in extracts according to each extraction condition in Experimental Example 3 of the present invention.
Figure 7 (Figure 7a to 7c) shows the results of measuring the expression activity of genes related to skin inflammation activity in extracts extracted under specific conditions of 40°C for 12 hours, 55°C for 12 hours, 24 hours, and 70°C for 1 hour.

Unless otherwise specified, all numbers, values and/or expressions used herein to express components, reaction conditions or contents of components are intended to refer to, among other things, the measurements that occur to obtain these values. Since they are approximations reflecting uncertainty, they should be understood in all cases as being qualified by the term “approximately.” Additionally, where numerical ranges are disclosed in this disclosure, such ranges are continuous and, unless otherwise indicated, include all values from the minimum to the maximum of such range inclusively. Furthermore, when such range refers to an integer, all integers from the minimum value up to and including the maximum value are included, unless otherwise indicated.

In this specification, when a range is stated for a variable, the variable will be understood to include all values within the stated range, including the stated endpoints of the range. For example, the range "5 to 10" includes the values 5, 6, 7, 8, 9, and 10, as well as any subranges such as 6 to 10, 7 to 10, 6 to 9, 7 to 9, etc. It will be understood that it also includes any values between integers that fall within the scope of the stated range, such as 5.5, 6.5, 7.5, 5.5 to 8.5, and 6.5 to 9, etc. Also, for example, the range "10% to 30%" includes values such as 10%, 11%, 12%, 13%, etc. and all integers up to and including 30%, as well as 10% to 15%, 12% to 12%, etc. It will be understood that it includes any subranges, such as 18%, 20% to 30%, etc., and any value between reasonable integers within the range of the stated range, such as 10.5%, 15.5%, 25.5%, etc.

Hereinafter, the present invention will be described in detail.

Ganoderic acid is a representative triterpenoid ingredient consisting of three cyclohexane rings and one cyclopentane ring. It not only has antioxidant, anti-diabetic, anti-obesity, and anti-inflammatory physiological activities, but also improves immune function and has particularly excellent anti-inflammatory activity. It is an ingredient. About 120 components of ganoderic acid, the main functional ingredient of reishi mushroom ( Ganoderma lucidum ), have been reported so far, and according to existing studies, it is linked to carbon numbers 3, 7, 11, 12, and 15. It is known that physiological activity varies depending on the type and presence of functional groups such as roxyl group, carbonyl group, and acetyl group. However, there has been no report on under what conditions ganoderic acid is effective for skin inflammation.

This patent relates to a reishi mushroom (ganoderma lucidum) extract and extraction method that is excellent for skin inflammation effects. The reishi mushroom extract of the present invention contains inflammatory cytokines (IL-6), which are factors that cause inflammation in HeCaT cells, which are skin keratinocytes. , S100A7, S100A8, S100A9, CCL5, CCL20, CXCL8) expression levels were confirmed to be decreased at the mRNA level.

Steroids, which are existing synthetic anti-inflammatory drugs, cause side effects such as nausea and indigestion, so interest in and demand for natural anti-inflammatory drugs is increasing. Accordingly, the inventors of the present invention invented a method for producing a reishi mushroom extract containing a high content of ganoderic acid, an anti-inflammatory active ingredient of reishi mushrooms, and with enhanced anti-inflammatory activity, and were able to provide a composition containing a high content of ganoderic acid. .

Hereinafter, various aspects of the present invention will be described.

One aspect of the present invention provides a composition for preventing, treating or alleviating skin inflammation containing ganoderic acid or a derivative thereof as an active ingredient.

One aspect of the present invention provides a composition for preventing, treating or alleviating atopy containing ganoderic acid or a derivative thereof as an active ingredient.

One aspect of the present invention provides a composition for preventing, treating or alleviating psoriasis containing ganoderic acid or a derivative thereof as an active ingredient.

In one aspect of the present invention, a composition is provided in which the active ingredient is contained in an amount of 0.1% by weight to 90% by weight.

In one aspect of the present invention, the ganoderic acid or a derivative thereof is ganoderic acid eta (GAeta), butyl ganoderic acid A (BGAA), ganoderic acid C2 (GAC2), ganoderic acid A (GAA), ganoderic acid Derrickic acid G (GAG), ganodrenic acid B (GDAB), ganoderic acid B (GAB), ganoderic acid K (GDAK), ganoderic acid K (GAK), ganodrenic acid D (GDAD), ganoderic acid Provided is a composition that is at least one selected from D (GAD), ganoderic acid H (GAH), ganoderic acid C6 (GAC6), and lucidenic acid D.

In one aspect of the present invention, a composition is provided wherein the ganoderic acid or a derivative thereof is isolated or obtained from an extract of reishi mushroom ( ganoderma lucidum ).

In this specification, the term “extract” includes any substance obtained by extracting its components from a natural product, regardless of the extraction method or type of component. For example, it is a broad concept that includes both extraction of solvent-soluble components from natural products using water or organic solvents, and extraction of only specific components of natural products. In one embodiment of the present invention, the organic solvent is not particularly limited and includes lower C1 to C5 alcohols such as methanol, ethanol, isopropyl alcohol, n-propyl alcohol, n-butanol, and isobutanol, glycerol, and ethylene. Polyhydric alcohols such as glycol, propylene glycol, and 1,3-butylene glycol; hydrocarbon solvents such as methyl acetate, ethyl acetate, benzene, n-hexane, diethyl ether, dichloromethane, and chloroform; and petroleum ether, It may be a non-polar organic solvent such as methyl acetate, benzene, hexane, chloroform, methylene chloride, dimethyl ether, and ethyl acetate.

In one aspect of the present invention, the extract provides a composition that is an extract extracted using water, C ₁ -C ₅ alcohol, acetone, acetone aqueous solution, or C ₁ -C ₅ alcohol aqueous solution.

In one aspect of the present invention, the C1-C5 alcohol provides a composition using at least one selected from the group consisting of methanol, ethanol, isopropyl alcohol, n-propyl alcohol, n-butanol, and isobutanol.

In one aspect of the present invention, a composition is provided wherein the concentrations of the C ₁ -C ₅ alcohol aqueous solution and the acetone aqueous solution are each independently 10% to 90% (v/v).

In one aspect of the present invention, the active ingredient may be included in an amount of 0.001 to 90% by weight based on the total weight of the composition. In one embodiment, the active ingredient is 0.001% by weight or more, 0.01% by weight or more, 0.1% by weight or more, 1% by weight or more, 1.1% by weight or more, 1.5% by weight or more, 2% by weight or more, It may be 3% by weight or more, 5% by weight or more, 10% by weight or more, 20% by weight or more, or 30% by weight or more. In addition, the ginseng flower stalk extract is used in an amount of 90% by weight or less, 85% by weight or less, 80% by weight or less, 70% by weight or less, 50% by weight or less, 40% by weight or less, 30% by weight or less, 20% by weight or less. It may be less than 1% by weight, less than 10% by weight, less than 5% by weight, less than 4% by weight, less than 3% by weight, less than 2% by weight, less than 1% by weight, less than 0.1% by weight, or less than 0.05% by weight.

In one aspect of the present invention, a composition is provided wherein the extract of Ganoderma lucidum is an ethanol extract.

In one aspect of the present invention, a composition is provided wherein the extract of reishi mushroom is extracted at a temperature of 30 to 80° C. for 2 to 40 hours.

In one aspect of the present invention, a composition is provided wherein the extract of reishi mushroom is extracted at a temperature of 30 to 60°C for 2 to 15 hours.

In one aspect of the present invention, a composition is provided wherein the extract of reishi mushroom is extracted at a temperature of 35 to 45°C for 10 to 14 hours.

In one aspect of the present invention, a composition is provided wherein the extract of reishi mushroom is extracted at a temperature of 50 to 60°C for 10 to 14 hours.

In one aspect of the present invention, a composition is provided wherein the active ingredient inhibits any one or more of chemokines, cytokines, and S100 calcium binding proteins.

In one aspect of the invention, the chemokine is any one or more of CXCL8, CCL5, and CCL20, the cytokine is any one or more of IL-6 and IL-23/p19, and the S100 calcium binding protein is S100A7, S100A8. And it provides a composition that is any one or more of S100A9.

In one aspect of the present invention, a composition is provided, wherein the composition is a pharmaceutical composition. The pharmaceutical composition of the present invention can be prepared in the form of a pharmaceutical preparation suitable for oral or parenteral administration by further including appropriate carriers, excipients, and/or diluents commonly used in the manufacture of pharmaceuticals. Additionally, a pharmaceutical formulation can be prepared using the pharmaceutical composition of the present invention according to a conventional method. In preparing a dosage form, the active ingredient may be mixed with a carrier, diluted with a carrier, or encapsulated in a carrier in the form of a capsule, sachet, or other container. Therefore, dosage forms include tablets, pills, powders, capsules, sashes, elixirs, suspensions, emulsions, solutions, syrups, aerosols, soft or hard gelatin capsules, injectable solutions or suspensions, ointments, creams, gels or lotions. It may be in the form of, etc.

Suitable carriers, excipients and diluents that may be included in the pharmaceutical compositions of the invention include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone. , water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. commonly used in formulation manufacturing may be additionally included. Pharmaceutical compositions of the present invention can be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

The dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art. The active ingredient relative to the patient's body weight may range from 0.001 mg/kg to 500 mg/kg, and is preferably administered at 0.001 to 200 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.

In one aspect of the present invention, the composition provides a composition that is a cosmetic composition.

The formulation of the cosmetic composition is not particularly limited and can be appropriately selected depending on the purpose. For example, skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutritional lotion, massage cream, nutritional cream, moisture cream, hand cream, foundation, essence, nutritional essence, pack, soap, cleansing. It may be manufactured in one or more formulations selected from the group consisting of foam, cleansing lotion, cleansing cream, body lotion, and body cleanser, but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier ingredient. You can.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder can be used as the carrier component. In particular, when the formulation is a spray, chlorofluorohydrocarbon and propane may be used as carrier ingredients. /May contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 , 3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan.

When the formulation of the present invention is a suspension, the carrier ingredients include water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, and microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, the carrier ingredients include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, and fatty acid amide. Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linoline derivative, or ethoxylated glycerol fatty acid ester can be used.

The content of the active ingredient is not particularly limited, but may be included in 0.001 to 100% by weight based on the total weight of the composition. If the active ingredient satisfies the above content, it can exhibit excellent efficacy without side effects.

The cosmetic composition may additionally include functional additives and ingredients included in general cosmetic compositions. The functional additive may include ingredients selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, sphingolipids, and seaweed extract.

In addition to the above-mentioned functional additives, the cosmetic composition of the present invention may also contain ingredients included in general cosmetic compositions, if necessary. Other ingredients included include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, disinfectants, antioxidants, plant extracts, pH adjusters, alcohol, pigments, fragrances, and blood circulation agents. Examples include accelerators, cooling agents, restrictors, and purified water.

In one aspect of the present invention, the composition provides a composition that is a health functional food composition.

The health food composition of the present invention contains the above-mentioned active ingredients, and there is no particular limitation on its type. Examples of the above foods include drinks, meat, sausages, bread, biscuits, rice cakes, snacks, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, and alcoholic beverages. and vitamin complexes, dairy and processed milk products, etc. In addition, it includes all health functional foods in the conventional sense. As an active ingredient, the reishi mushroom extract or the solvent fraction obtained therefrom can be added as is to food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. The effective content can be appropriately determined depending on the purpose of use (prevention or improvement), and may be included in the range of 0.001 to 70% by weight based on the total weight of the health food. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range. For example, when manufacturing a health drink, in addition to the above active ingredients, natural carbohydrates or flavoring agents may be contained as additives commonly used in beverage production. The natural carbohydrates include conventional carbohydrates such as monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, etc.), and polysaccharides (e.g., dextrins, cyclodextrins, etc.). It may include phosphorus sugar and sugar alcohols such as xylitol, sorbitol, and erythritol. The natural carbohydrate may be contained in the range of 1 to 20% by weight, preferably 5 to 10% by weight, based on the total weight of the health food. The flavoring agent may include natural flavoring agents (thaumatin, stevia extract, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.). In addition, various nutrients, vitamins, minerals (electrolytes), flavors (synthetic or natural flavors), colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, and preservatives. , glycerin, alcohol, carbonating agents used in carbonated drinks, etc. Additionally, it may contain pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages. There is no particular limitation on the content of these additives, but they may be included in the range of 0.1 to 20% by weight based on the total weight of the health food.

Another aspect of the present invention is a method for producing ganoderic acid or a derivative thereof for preventing, treating or alleviating skin inflammation, atopy or psoriasis, using reishi mushroom ( ganoderma lucidum ) at a temperature of 30 to 80° C., 2 to 40° C. A manufacturing method is provided, comprising the step of extraction using an ethanol solvent for a period of time.

In another aspect of the present invention, a manufacturing method is provided wherein the extracting step is ultrasonic extraction.

In another aspect of the present invention, the method further includes the step of re-dissolving the crude extract obtained after extraction.

Hereinafter, the present invention will be described in more detail through specific examples. The following examples are merely examples to aid understanding of the present invention, and the scope of the present invention is not limited thereto.

Example

Example 1: Preparation of reishi mushroom extract

In this example, reishi mushroom ( Ganoderma lucidum ) was used and extracted with ethanol using an ultrasonic extractor. Specifically, reishi mushroom extract was prepared as follows.

After heat-drying the fruiting bodies of Reishi mushrooms, about 2 g of Reishi mushrooms were extracted using an ultrasonic extractor in 100% ethanol at different temperature conditions (40, 55, and 70°C) for various times (1, 3, 6, 12, and 24 hours). . The solution was filtered through filter paper, and the resulting filtrate was concentrated through a nitrogen concentrator to obtain about 0.2 g of crude extract. Figure 1 is a diagram depicting the manufacturing process of reishi mushroom extract and its fractions.

[Experimental example]

Experimental Example 1: Ganoderic acid content analysis

The crude extract prepared in Example 1 was re-dissolved using DMSO, and filtered once more through an analytical 0.2 ㎛ membrane filter for UPLC-QTOF-MS/MS analysis.

(1) Content analysis

Analysis of ganoderic acid was performed by connecting Agilent's UPLC 1290 infinity series/6470 triple quadrupole MS, and the analysis conditions were as shown in Table 1.

UPLC conditions Machine Agilent series 1290 UPLC-QTOF instrument (Agilent, Waldbroon, Germany) Column YMC C18 Column ExRS (100 Х 2.0 mm; particle size, 3 μm) Solvent system (A) distilled water containing 0.2% formic acid
(B) acetonitrile containing 0.2% formic acid Flow rate 0.2 mL/min Injection volume 10 μL Temperature 45°C Gradient system 0.0 min, 20.0% B; 10.0 min; 30.0% B; 380 min, 30.0% B; 45.0 min, 35.0% B; 46.0 min, 20.0% B; 47.0 min, 20.0% B The electrospray (ESI)-Quadrupole Time-of-Flight (QTOF) spectra conditions Capillary 4,000V Gas flow 5.0 L/min Gas temperature 300°C Collision energy 10.0 eV Mode Negative Mass range 20 - 6000

(2) Analysis Results As a result of UPLC-QTOF-MS/MS analysis, a total of 19 components were detected and analyzed as shown in Figure 2.

Ganoderic acid eta (GAeta; RT = 15.179 min, C30H44O8, m/z 532), butyl ganoderic acid A (BGAA; RT = 16.183 min, C34H52O7, m/z 572), ganoderic acid C2 (GAC2; RT = Similar cleavage patterns were observed for ganoderic acid A (GAA; RT = 28.159, C30H44O7, m/z 515). In the case of these ingredients, characteristic cleavage of the D ring was previously reported, and this was qualitatively analyzed.

Ganoderic acid G (GAG; RT = 20.556 min, C30H44O8, m/z 532), Ganoderic acid B (GDAB; RT = 20.965 min, C30H42O7, m/z 514), Ganoderic acid B (GAB; RT = 22.753) min, C30H44O7, m/z 516), ganodrenic acid K (GDAK; RT = 24.227 min, C32H44O9, m/z 572), ganoderic acid K (GAK; RT = 25.604 min, C32H46O9, m/z 574), hydes at carbon numbers 7 and 15 for ganodrenic acid D (GDAD; RT = 34.453 min, C30H44O7, m/z 512) and ganoderic acid D (GAD; RT = 38.331 min, C30H42O7, m/z 514). It is reported to show the characteristic splitting pattern of C-ring and D-ring in the form of a locking ring.

In addition, ganoderic acid C6 (a form in which carbon 12 of ganoderic acid H is deacetylated), which has a similar skeleton to ganoderic acid H (GAH; RT = 28.731 min, C32H44O9, m/z), and lucidenic acid. D (a form in which carbon 3 of ganoderic acid H is oxidized and an alcohol group is attached) was analyzed by referring to the characteristic splitting pattern of the D ring and the splitting pattern of ganoderic acid H.

(3) Semi-quantitative analysis

Based on the above qualitative analysis results, semi-quantitative analysis was performed using the Agilent MassHunter Workstation program. The quantitative analysis results were shown in Table 2-4 and Figure 3 below.

40°C 1 h 3h 6h 12h 24h GAeta 687,985
±123,225 441,578
±109,382 486,832
±49,710 754,764
±143,358 635,989
±143,358 BGAA 3,085,383
±1,127,036 1,908,072
±354,719 1,838,681
±629,661 2,055,515
±293,521 1,618,223
±127,658 GAC2 1,928,533
±989,677 1,234,696
±234,913 1,134,606
±454,288 1,958,492
±382,696 1,443,624
±69,795 GAA 9,644,429
±6,645,407 3,285,273
±1,058,376 2,441,869
±1,503,994 4,006,304
±386,165 3,161,750
±63,670 GAG 3,867,549
±1,154,655 2,990,578
±333,758 2,688,483
±459,926 4,027,345
±316,643 3,242,556
±170,264 GDAB 2,887,333±1,556,079 1,276,931
±606,558 1,444,309
±855,412 2,228,511
±746,762 1,834,914
±861,394 GAB 8,510,996±1,888,807 6,321,831
±613,208 5,884,623
±771,439 9,117,802
±1,170,575 6,664,291
±712,028 GDAK 6,875,411±3,982,071 6,283,350
±560,849 5,828,423
±342,269 7,870,545
±1,590,851 5,187,842
±1,170,614 GAK 5,691,979±3,021,494 4,507,415
±744,843 3,745,784
±203,656 6,249,796
±782,113 4,916,080
±66,352 GDAD 941,749±519,366 412,156
±173,409 225,836
±173,409 437,149
±82,178 292,770
±78,717 GAD 1,486,360
±1,283,862 1,126,862
±505,211 771,711
±505,211 1,361,551
±218,849 891,869
±121.041 GAH 18,509,502
±17,348,859 19,668,856
±2,244,619 17,761,856
±2,244,619 25,304,038
±2,996,656 19,011,430
±5,653,637 GAC6 816,581
±499,139 455,234
±142,435 221,516
±45,054 582,234
±217,656 492,103
±126,799 GAF 414,670
±105,905 236,548
±257,206 217,720
±257,206 419,209
±246,776 328,699
±72,220 LAD 1,653,494
±1,409,604 270,295
±53,344 216,907
±131,570 707,365
±274,630 271,856
±221,051

55°C 1 h 3h 6h 12h 24h GAeta 542,856
±121,733 562,522
±138,904 532,654
±26,843 664,083
±23,875 532,835
±146,692 BGAA 2,001,953
±247,800 2,121,054
±448,372 1,949,150
±143,436 1,904,119
±78,395 1,901,536
±149,227 GAC2 1,071,238
±230,529 1,495,767
±223,672 1,132,470
±216,308 1,622,025
±60,520 1,652,953
±111,599 GAA 2,382,995
±200,290 3,437,828
±527,606 3,120,484
±200,200 3,721,425
±98,357 4,026,071
±789,997 GAG 3,266,650
±659,231 3,672,913
±519,177 3,408,274
±330,483 3,782,335
±123,505 2,954,402
±358,431 GDAB 1,741,720±658,063 1,589,884
±281,143 1,502,420
±96,060 2,307,602
±778,451 1,739,445
±314,391 GAB 6,470,893±1,490,037 7,381,283
±518,635 6,503,499
±787,345 7,928,823
±209,213 6,695,543
±929,009 GDAK 5,919,433±1,233,761 6,336,495
±1,070,762 6,589,417
±235,986 6,487,146
±1,792,884 5,823,095
±753,247 GAK 4,691,137±756,325 5,172,934
±777,400 4,279,321
±202,946 5,469,604
±317,882 4,891,262
±254,426 GDAD 255,488±58,370 368,514
±154,774 382,247
±76,483 456,110
±45,906 539,720
±124,789 GAD 795,031
±239,558 1,126,113
±126,696 989,253
±130,745 1,163,133
±60,833 1,299,144
±138,383 GAH 20,546,554
±3,830,184 20,726,567
±4,649,890 20,934,648
±1,031,015 24,007,141
±458,305 20,765,807
±456,776 GAC6 294,814
±96,886 463,096
±138,108 389,374
±106,798 571,470
±164,250 371,354
±102,081 GAF 257,529
±37,769 337,331
±134,608 212,895
±40,473 441,487
±99,244 336,078
±110,462 LAD 214,116
±122,069 478,375
±106,479 480,299
±50,525 644,068
±62,203 588,694
±57,734

70°C 1 h 3h 6h 12h 24h GAeta 556,031
±15,265 630,941
±285,846 716,231
±258,827 444,246
±123,512 530,803
±62,433 BGAA 2,006,266
±79,646 3,071,147
±674,918 1,967,742
±1,847,306 1,523,017
±209,980 1,364,371
±395,388 GAC2 1,278,516
±47,793 2,037,182
±512,274 2,006,049
±484,823 924,466
±36,276 957,878
±108,382 GAA 3,448,465
±129,714 5,299,831
±1,231,148 5,410,893
±1,497,681 2,711,540
±287,561 3,099,484
±530,017 GAG 3,020,139
±118,312 4,268,714
578,709 3,432,200
±1,148,735 2,394,703
±280,526 2,053,254
±651,900 GDAB 1,130,602±290,356 2,093,764
±362,282 2,011,968
±727,789 1,140,992
±153,189 1,687,263
±270,443 GAB 5,966,316±255,515 7,808,492
±1,641,347 8,197,545
±1,414,929 5,511,315
±314,841 5,831,774
±626,569 GDAK 5,982,481±440,564 6,736,017
±405,616 7,570,685
±1,656,389 5,167,895
±878,680 5,464,273
±763,090 GAK 4,416,11150,512 6,323,832
±1,089,998 6,192,761
±1,191,509 3,670,495
±481,824 4,300,834
±679,432 GDAD 340,986±64,265 602,901
±269,814 769,422
±293,042 325,918
±87,156 394,652
±102,662 GAD 1,264,147
±83,867 2,001,808
±537,984 2,148,930
±833,675 1,002,904
±139,813 914,033
±235,385 GAH 19,108,336
±139,134 25,319,052
±3,871,722 23,650,335
±4,002,364 16,795,556
±1,511,138 17,485,663
±232,142 GAC6 460,934
±126,622 638,748
±298,311 702,606
±224,491 204,210
±37,959 518,725
±385,306 GAF 371,037
±154,974 676,132
±223,624 862,544
±283,319 309,923
±186,447 369,043
±154,459 LAD 521,145
±16,216 887,398
±236,681 497,079
±97,258 218,790
±208,577 356,004
±29,822

It was confirmed that the content and ratio of ganoderic acid components differed depending on each extraction condition.

In particular, in the case of extracts at 40℃ and 55℃, the contents of ganoderic acid components were found to differ depending on time, and the contents of GAG, GAB, GDAK, GAK, and GAH were highest in the 12-hour extract. However, a decrease in the content of ingredients was confirmed during long-term extraction of 24 hours. Accordingly, it was found that the extraction time suitable for extracting ganoderic acid was also different.

Experimental Example 2: Confirmation of cytotoxic effect

The cell proliferation effect of the ganoderic acid extract prepared in Example 1 was measured using cell culture.

Cytotoxicity experiments were conducted according to the method described in Mosmann T. et al, J. Immunol. Meth., 65 55-63 (1983). The medium used for cell proliferation and toxicity tests contained 10% FBS (fetal bovine serum). Adult skin cell lines (KCLB, HaCaT; Keratinocyte cell) were inoculated into DMEM (Dulbeco"s Modified Eagle"s Medium/high glucose, Gibco) containing 1 x 10 ² cells/ml in a 96-well plate. 24 hours after inoculation, the medium was replaced with FBS-free medium, ganoderic acid extract was added at various concentrations (3, 10, 30 ug/ml), and the culture was incubated at 37°C, 5% CO ₂ incubator for 24 hours. ), and in the control group, only the culture medium was added. After the culture was completed, the cells were washed with DPBS and added with MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5- Diphenyltetrazolium at a concentration of 0.5 mg/ml. Bromide, Dojindo Laboratories ZY903) solution (1 mL/well) was added and after 2 hours in a 37°C CO ₂ incubator, the medium was removed and washed again with DPBS. After adding 100 μl of DMSO (dimethylsulfoxide, Sigma D 4540), the absorbance was measured at 550 nm, and the cytotoxicity rate was calculated according to the following equation (1).

Equation 1

The experimental results are shown in Figure 4.

As can be seen from the results in Figure 4, in the case of the extract containing the ganoderic acid extract of the present invention, it was found that the cell survival rate decreased as the concentration increased, and it was found to be toxic at a concentration of 30 ug/ml. . In addition, it was found that cytotoxicity appeared differently depending on the extraction conditions.

Experimental Example 3: Gene expression analysis

The medium used for cell proliferation and toxicity tests was DMEM (Dulbeco's Modified Eagle's Medium/high glucose, Gibco) containing 10% FBS (fetal bovine serum, Gibco), and adult skin keratin cell lines (KCLB, HeCaT) were mixed for 6 days. -It was used by inoculating a well plate at 1X10 ⁶ cells/ml. After mixing with 10 ug/ml sample and culturing for one hour, 50 ng/ml rhIL-17a and 10 ng/ml rhTNF-α were added and cultured for 24 hours to induce skin inflammation.

After extracting RNA using the RNeasy kit (Qiagen, MD, USA), 1 ug of RNA was used to synthesize cDNA using a reverse transcription system (cDNA with RevertAid First Strand cDNA Synthesis Kit; Thermo Fisher Scientific, MA, USA). Afterwards, quantitative PCR was performed using the cDNA to measure the expression level of each gene. Primers used in this PCR are shown in Table 5.

No. Primer name Sequence One H_Q_IL-1b_F TGAGCTCGCCAGTGAATGA 2 H_Q_IL-1b_R AGATTCGTAGCTGGATGCCG 3 H_Q_IL-6_F TTCGGTTCAGTTGCCTTCTC 4 H_Q_IL-6_R TCTTCTCCTGGGGGTACTGG 5 H_Q_IL-23p19_F ACAGAAGCTCTGCACACTGG 6 H_Q_IL-23p19_R GTTGTCCCTGAGTCCTTGGG 7 H_Q_IFN-y_F GGGAAGCGAACAAGGAGGTCA 8 H_Q_IFN-y_R CTGGGATGCTCTTCGACCTC 9 H_Q_TNF-a_F TCTTCTCGAACCCCGAGTGA 10 H_Q_TNF-a_R GGGTTTGCTACAACATGGGC 11 H_Q_CCL5_F CAGTCGTCTTTGTCACCCGA 12 H_Q_CCL5_R TCTTCTCTGGGTTGGCACACAC 13 H_Q_CCL20_F TGTCAGTGCTGCTACTCCAC 14 H_Q_CCL20_R CCGTGTGAAGCCCCACAATAA 15 H_Q_S100A7_F GCACAAATTACCTGCCGAT 16 H_Q_S100A7_R TGCTTGTGGTAGTCTGTGGC 17 H_Q_S100A8_F AAGGGGAATTTCCATGCCGT 18 H_Q_S100A8_R AGGACACTCGGTCTCTAGCA 19 H_Q_S100A9_F CATGCTGATGCGAGGCTAA 20 H_Q_S100A9_R CCCTCGTGCATCTTCTCGTG 21 H_Q_GAPDH_F GAAGGTGAAGGTCGGAGTC 22 H_Q_GAPDH_R GAAGATGGTGATGGGATTTC

Real-time PCR using SYBR green was performed using the StepOne Real Time PCR System (Applied Biosystems, Foster City, CA, USA), and GAPDH was used as a housekeeping gene and analyzed by comparative CT method. Primers used in the present invention include chemokines (CCL5, CCL20), cytokines (IL-6, IL, IL-23/p19), and S100 calcium binding proteins (S100A7, S100A8, S100A9), which cause atopic dermatitis and epilepsy. Proteins reported to affect the mechanism were targeted.

The experimental results were the same as Figures 5 and 6. As can be seen from the results in Figures 5 and 6, the expression inhibitory activity of interleukin-6 (IL-6), S100A7, etc. was low in the case of the ganoderic acid extract of the present invention under other conditions, but at 40°C for 12 hours. In the case of the extract at 55°C for 1-24 hours, excellent anti-inflammatory activity was confirmed at the mRNA level.

Excellent anti-inflammatory activity at the mRNA level was confirmed by inhibiting the expression of interleukin-6 (IL-6), S100A7, etc. under specific conditions at 40°C for 12 hours. At 55°C, IL-6 expression inhibition activity was observed at 6 and 12 hours, and significant S100A7 inhibition activity was observed at 1 hour, 3 hours, 6 hours, 12 hours, and 24 hours. In the case of 70°C, the inhibitory activity of S100A7 was confirmed under short-term extraction conditions of 1 hour and 3 hours. Accordingly, various gene expression activities were confirmed for extracts extracted under conditions that showed excellent activity at 40°C for 12 hours, 55°C for 12 hours and 24 hours, and 70°C for 1 hour.

In the case of skin inflammation, the activated pathway is complex, and various primers were used to determine whether they were effective in anti-inflammatory activity. The experimental results were the same as Figure 7. As shown in Figure 7, the reishi mushroom extract extracted at 40°C for 12 hours showed high anti-inflammatory activity, and especially in the case of CCL5, S100A8, and S100A9, the activity was found to be superior compared to the negative control group.

Above, embodiments of the present invention have been described with reference to the attached drawings, but those skilled in the art will understand that the present invention can be implemented in other specific forms without changing its technical idea or essential features. You will understand that it exists. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive.

Claims (12)

delete delete delete delete delete delete In the pharmaceutical composition for preventing, treating or alleviating atopy caused by expression of any one or more of CCL5, S100A8 and S100A9,
The composition contains ethanol extract of reishi mushroom ( ganoderma lucidum ) as an active ingredient,
The extract of the reishi mushroom was extracted at a temperature of 40°C for 12 hours,
The active ingredient inhibits any one or more of CCL5, S100A8, and S100A9,
The ethanol extract of the reishi mushroom contains ganoderic acid; or ganoderic acid eta (GAeta), butyl ganoderic acid A (BGAA), ganoderic acid C2 (GAC2), ganoderic acid A (GAA), ganoderic acid G (GAG), ganoderenic acid B (GDAB), Ganoderic Acid B (GAB), Ganoderic Acid K (GDAK), Ganoderic Acid K (GAK), Ganoderic Acid D (GDAD), Ganoderic Acid D (GAD), Ganoderic Acid H (GAH), Ganoderic Acid A ganoderic acid derivative comprising at least one selected from acid C6, acetyl ganoderic acid F, and lucidenic acid D;
A pharmaceutical composition for preventing, treating or alleviating atopy caused by expression of any one or more of CCL5, S100A8 and S100A9.
delete delete In the food composition for improving atopy caused by the expression of any one or more of CCL5, S100A8, and S100A9,
The composition contains ethanol extract of ganoderma lucidum as an active ingredient,
The extract of the reishi mushroom was extracted at a temperature of 40°C for 12 hours,
The active ingredient inhibits any one or more of CCL5, S100A8, and S100A9,
The ethanol extract of the reishi mushroom contains ganoderic acid; or ganoderic acid eta (GAeta), butyl ganoderic acid A (BGAA), ganoderic acid C2 (GAC2), ganoderic acid A (GAA), ganoderic acid G (GAG), ganoderenic acid B (GDAB), Ganoderic Acid B (GAB), Ganoderic Acid K (GDAK), Ganoderic Acid K (GAK), Ganoderic Acid D (GDAD), Ganoderic Acid D (GAD), Ganoderic Acid H (GAH), Ganoderic Acid A ganoderic acid derivative comprising at least one selected from acid C6, acetyl ganoderic acid F, and lucidenic acid D;
A food composition for improving atopy caused by the expression of any one or more of CCL5, S100A8, and S100A9.
delete delete