KR102606763B1 - A Composition for Improving or Alleviating Stress-related Disorders Comprising Nerol Compound - Google Patents

Abstract

The present invention relates to a composition for preventing, treating, improving or alleviating stress containing a nerol compound or an acceptable salt thereof as an active ingredient, by significantly inhibiting stress-related gene expression in human skin fibroblasts and human nerve cells, thereby reducing stress. It can improve or alleviate various stress-related diseases, including neurological and skin diseases caused by .

Description

A composition for improving or alleviating stress-related disorders comprising a nerol compound as an active ingredient {A Composition for Improving or Alleviating Stress-related Disorders Comprising Nerol Compound}

The present invention relates to a composition that can prevent, treat, improve or alleviate stress by containing a nerol compound or an acceptable salt thereof as an active ingredient.

The World Health Organization defined mental health as 'a state of well-being in which an individual recognizes his or her abilities, can cope with the daily stresses of life, can work productively, and can contribute to the community.' Stress here refers to changes within an organism caused by internal and external stimuli that disrupt the balance of the body. Selye, a pioneer in stress research, defined stress as a non-specific response of the body to demands, and defined it as one of the typical stress responses from the adrenal cortex. Secretion of glucocorticoids was viewed as an important factor in establishing biological stress responses.

Stimuli that cause stress are classified into physical, psychological, and physiological stimulation. The physical stimulus refers to temperature, ultraviolet rays, etc. that exist in the natural world, the psychological stimulus refers to mental pain, anger, anxiety, tension, etc., and the physiological stimulus refers to bacteria, viruses, allergic substances, etc. In particular, repeated symptoms such as depression, anxiety, insomnia, and loss of appetite caused by psychological stimulation cause diseases such as depression, anxiety, and sleep disorder.

In cases of excessive mental stress, hormones are secreted into the blood through the circulatory system leading to the hypothalamic-pituitary-adrenal axis (HPA axis). Corticotropin releasing factor (CRF) is produced in the hypothalamus of the brain, which binds to the CRF receptor expressed in the pituitary gland to release adrenocorticotropic hormone (ACTH). The ACTH reaches the adrenal glands through the blood and lymph nodes and promotes the secretion of glucocorticoids such as cortisol, and the glucocorticoids secreted into the blood are delivered to each organ of the body.

In each tissue, glucocorticoids (glucocorticoids) exert their effects by binding to and activating glucocorticoid receptors (GR). Specifically, activated GR translocates into the nucleus and binds to a specific promoter sequence in DNA called a glucocorticoid response element (GRE). The GR/DNA complex mediates stress responses by activating GRE and transcribing various downstream mRNAs with GRE regulatory regions in their promoters. Representative examples of glucocorticoid-responsive genes include GILZ (Glucocorticoid-induced leucine zipper) and FK506 binding protein 5 (FKBP5).

The continuous secretion of cortisol hormone due to repetitive stress increases its blood concentration, and when it acts on nerve cells, it damages nerve cells, leading to stress-related mental diseases such as anxiety, depression, and sleep disorders. This again becomes a cause of mental stress, and the vicious cycle of causing depressive symptoms continues.

When the ability to control cortisol secretion is lost due to extreme mental stress, cortisol secretion is excessively secreted, causing brain atrophy and damage throughout the nervous system, resulting in severe depression symptoms and the possibility of suicide.

The skin is also considered one of the important tissues on which stress acts. The skin is largely composed of the epidermis layer, the dermis layer, and hair follicles between the two layers. The epidermal layer and hair follicles produce keratin to protect the tissue from the external environment, and the dermal layer produces collagen to maintain the structure of the skin.

In addition, this skin structure is weakened by biological aging, mental stress, as well as stress caused by external stimuli. Recently, the proportion of skin aging caused by stress is increasing due to environmental changes such as stronger ultraviolet rays and worsening fine dust. There is a trend. It has since been reported that these stress hormones can cause skin aging by reducing collagen synthesis in the dermis (Chen et al., Inflammation & Allergy , 13(3):177-190, 2014 Gras et al., Experimental Dermatology , 10: 28-34, 2001).

Therefore, there is a need for a composition that has the effect of preventing, treating, improving, or alleviating stress-related neurological diseases, stress-related skin diseases, or stress-related infectious diseases.

Republic of Korea Patent No. 1855737 Japanese Patent Publication No. 2019-0522707

The purpose of the present invention is to provide a cosmetic composition that can improve or relieve stress by containing a nerol compound or an acceptable salt thereof as an active ingredient.

In addition, another object of the present invention is to provide a food composition that can improve or alleviate stress by containing a nerol compound or an acceptable salt thereof as an active ingredient.

In addition, another object of the present invention is to provide a pharmaceutical composition capable of preventing or treating stress-related diseases, including a nerol compound or an acceptable salt thereof as an active ingredient.

In addition, another object of the present invention is to provide a fragrance composition that can relieve stress by containing a nerol compound or an acceptable salt thereof as an active ingredient.

The cosmetic composition capable of improving or relieving stress of the present invention to achieve the above-described object may include a nerol compound or a cosmetically acceptable salt thereof as an active ingredient.

The cosmetic composition may have an improvement or alleviation effect on stress-related neurological diseases, stress-related skin diseases, or stress-related infectious diseases.

The stress-related neurological disease may be selected from the group consisting of depression, sleep disturbance, anxiety disorder, and panic disorder.

The stress skin diseases include stress dermatitis, atopic dermatitis, lichen simplex chronicus, alopecia areata, prurigo, stress skin aging, stress acne, and acute bullous hand eczema. It may be selected from the group consisting of.

In addition, the food composition for improving or alleviating stress of the present invention to achieve the above-described other purposes may include a nerol compound or a foodologically acceptable salt thereof as an active ingredient.

The food composition may have an improvement or alleviation effect on stress-related neurological diseases, stress-related skin diseases, or stress-related infectious diseases.

In addition, the pharmaceutical composition for preventing or treating stress-related diseases of the present invention to achieve the above-described other object may contain Nerol compound or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the perfume composition for relieving stress of the present invention to achieve the above-described other object may include Nerol compound or a perfumeryologically acceptable salt thereof as an active ingredient.

The fragrance composition may have a relieving effect on stress-related neurological diseases, stress-related skin diseases, or stress-related infectious diseases.

The composition for preventing, treating, improving or alleviating stress containing the nerol compound or an acceptable salt thereof of the present invention as an active ingredient significantly inhibits stress-related gene expression in human skin fibroblasts and human nerve cells, thereby preventing stress as a cause. It can prevent, treat, improve or alleviate various stress-related diseases, including neurological diseases and skin diseases.

The composition of the present invention has excellent stress prevention, treatment, improvement or alleviation effects and can be usefully used as a cosmetic composition, food composition, pharmaceutical composition or perfume composition.

In addition, the composition of the present invention contains natural compounds approved as safe as flavoring agents and food additives as active ingredients, so it has few side effects even when administered for a long period of time, and can be effectively used for various stress-related diseases, most of which are chronic diseases. .

Figure 1A is a graph showing the activity of the GRE promoter after treating human skin fibroblasts (HS68) with dexamethasone and the mixture of dexamethasone and Example 1 (nerol), respectively; Figure 1B is a graph showing the activity of the GRE promoter after treating human nerve cells (SH-SY5Y) with dexamethasone and the mixture of dexamethasone and Example 1; Figure 1C is a graph measuring the expression levels of GILZ and FKBP5 genes after treating human skin fibroblasts (HS68) with dexamethasone and the mixture of dexamethasone and Example 1, respectively; Figure 1D is a graph measuring the expression levels of GILZ and FKBP5 genes after treating human nerve cells (SH-SY5Y) with dexamethasone and the mixture of dexamethasone and Example 1, respectively. CON is the group treated with DMSO (dimethyl sulfoxide).
Figure 2 is a graph measuring cell survival rate after treating human nerve cells (SH-SY5Y) with dexamethasone and the mixture of dexamethasone and Example 1, respectively. CON is the group treated with DMSO (dimethyl sulfoxide).
Figure 3 is a graph measuring procollagen after treating skin fibroblasts (HS68) with dexamethasone and the mixture of dexamethasone and Example 1, respectively. CON is the group treated with DMSO (dimethyl sulfoxide).

The present invention relates to a composition that can prevent, treat, improve or alleviate stress by containing a nerol compound or an acceptable salt thereof as an active ingredient.

Hereinafter, the present invention will be described in detail.

The composition for improving or relieving stress of the present invention contains Nerol compound or a cosmetically acceptable salt thereof as an active ingredient.

The Nerol compound is a monoterpenoid compound also called cis-Geraniol, Neryl alcohol, etc. The molecular formula is C ₁₀ H ₁₈ O and the molecular weight is 154.25 g. /mol, and is expressed as [Chemical Formula 1] below.

[Formula 1]

The nerol is a light yellow transparent liquid with a melting point of -15°C and a boiling point of 227.5°C. It is insoluble in water but is soluble in most organic solvents. The nerol is contained in vegetable essential oils such as rose oil, orange oil, and lavender oil, and is a fragrance ingredient that creates a rose scent and a sweet fruity scent, and is mainly used as a fragrance for perfume, soap, shampoo, and cosmetics. It is also registered as a food additive as a flavoring agent by the FDA, and is approved as safe as a flavoring agent and food additive by FEMA (Flavor and Extract Manufacturers Association) and JECFA (Joint FAO/WHO Expert Committee on Food Additives), respectively.

In the toxicity test of nerol, nerol was orally administered to rats at 2,560, 4,000, 6,250, and 9,800 mg/kg, respectively, and the LD ₅₀ value was more than 4,500 mg/kg bw, proving its safety (European Chemicals Agency, ECHA).

The nerol compound and its salt of the present invention can improve or alleviate various stress-related diseases, including neurological and skin diseases caused by stress, by significantly suppressing the expression of stress-related genes in human skin fibroblasts and human nerve cells. You can.

Specifically, the composition of the present invention has an improving or alleviating effect on stress-related neurological diseases, stress-related skin diseases, or stress-related infectious diseases.

As used herein, the term “Stress-related Neurological Disorder” refers to any disease that causes dysfunction in the brain, spine, and nervous system connecting them by exposure of an individual to a stressful situation, such as depression. , sleep disorders, anxiety disorders, panic disorders, fatigue syndrome, headaches, neurodegenerative diseases, Alzheimer's, eating disorders, anorexia nervosa, alcohol withdrawal syndrome, and stress-related mental disorders. More specifically, stress-related neurological diseases that can be improved or alleviated with the composition of the present invention include a group consisting of depression, sleep disturbance, anxiety disorder, and panic disorder. is selected from

As used herein, the term “Stress-related Skin Neurological Disorder” refers to a disease in which various types of damage are inflicted on skin tissue by exposure of an individual to stressful situations, not only when psychological factors are the main cause of skin tissue damage. As a secondary cause, it is meant to encompass all pathological conditions that further worsen or accelerate the progression of skin diseases caused by other causes. Approximately 40% of all skin diseases are reported to be directly related to stress, and continuous stress also reduces the effectiveness of treatment, so suppressing the stress response in stress-related skin diseases is key to fundamental treatment of chronic diseases. . Skin diseases caused by stress include, for example, psoriasis, acne, scales, rashes, stress dermatitis, atopic dermatitis, lichen simplex chronicus, alopecia areata, prurigo, stress-related skin aging, and stress. Including, but not limited to, acne and acute vesiculobullous hand eczema.

More specifically, stress-related skin diseases that can be improved or alleviated with the composition of the present invention include stress dermatitis, atopic dermatitis, lichen simplex chronicus, alopecia areata, prurigo, stress-related skin aging, It is selected from the group consisting of stress acne and acute vesiculobullous hand eczema.

In this specification, the term “cosmetically acceptable salt” refers to a salt in a form that can be used cosmetically among salts that are substances in which cations and anions are combined by electrostatic attraction, and specific examples of the type are provided. includes salts derived from inorganic acids, organic acids, or bases. Examples of suitable acids include perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, trifluoroacetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid. , naphthalene-2-sulfonic acid, benzenesulfonic acid, etc. Salts derived from suitable bases may include alkali metals such as sodium, alkaline earth metals such as magnesium, ammonium, and the like.

Ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions in addition to the nerol compound as an active ingredient and its cosmetically acceptable salt, such as antioxidants, stabilizers, solubilizers, vitamins, and pigments. and carriers as well as conventional auxiliaries such as flavorings.

The cosmetic composition of the present invention can be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing agents. , oil, powder foundation, emulsion foundation, wax foundation, spray, etc., but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier ingredient. You can.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder can be used as the carrier ingredient. In particular, when the formulation is a spray, chlorofluorohydrocarbon and propane may be used as carrier ingredients. /May contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent, or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 , 3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan.

When the formulation of the present invention is a suspension, the carrier component includes water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, the carrier ingredients include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, and fatty acid. Amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester can be used.

In addition, the present invention provides a food composition for improving or alleviating stress containing a nerol compound or a foodologically acceptable salt thereof as an active ingredient.

Since the stress condition or stress-related disease that can be improved or alleviated using the nerol compound of the present invention or a food-acceptable salt thereof has already been described in detail, the description thereof is omitted to avoid excessive duplication.

In this specification, the term “foodologically acceptable salt” refers to a salt in a form that can be used in food compositions among salts in which cations and anions are combined by electrostatic attraction, and specific examples thereof include the above-mentioned “cosmetologically acceptable salt.” Includes examples of “acceptable salts.”

When the composition of the present invention is manufactured as a food composition, it may contain not only the compound of the present invention as an active ingredient, but also carbohydrates, seasonings, and flavoring agents commonly added during food production. Examples of carbohydrates include monosaccharides such as glucose and fructose; It includes, but is not limited to, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a flavoring agent, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is manufactured as a drink, in addition to the nerol compound, which is the active ingredient of the present invention, and its foodologically acceptable salt, citric acid, high-fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia extract, jujube Extract, licorice extract, etc. may be additionally included.

In addition, the present invention provides a fragrance composition for stress relief comprising a nerol compound or a fragranceologically acceptable salt thereof as an active ingredient.

Since the stress condition or stress-related disease that can be alleviated by using the nerol compound of the present invention or its aromatically acceptable salt has already been described in detail, the description thereof is omitted to avoid excessive duplication.

As used herein, the term “perfumeically acceptable salt” refers to a salt that can be used in a perfume composition among salts in which cations and anions are combined by electrostatic attraction, and specific examples thereof include the above-mentioned “cosmetically acceptable salt.” Includes examples of “acceptable salts.”

Additionally, the present invention provides a pharmaceutical composition for preventing or treating stress-related diseases, comprising a nerol compound or a pharmaceutically acceptable salt thereof as an active ingredient.

Stress-related diseases that can be prevented or treated with the composition of the present invention are selected from the group consisting of stress-related neurological diseases, stress-related skin diseases, stress-related cardiovascular diseases, and stress-related infectious diseases.

It is reported that people who are easily stressed have a three-fold higher incidence of cardiovascular disease than those who are not stressed, and even people who do not have specific cardiovascular lesions and have normal blood lipid levels or inflammatory indicators are at risk of myocardial infarction if exposed to psychological stress for a long period of time. It can cause this, and it is called ‘stress cardiomyopathy’. In addition, cortisol, a stress hormone, reduces the number of lymphocytes produced in the thymus and lymph nodes, weakening immune function, making it easier to be infected with various pathogens such as viruses and bacteria.

Therefore, the composition of the present invention, which expresses a gene that significantly reduces cortisol in various tissues, including plasma and skin, can be used as an efficient treatment composition for cardiovascular diseases and infectious diseases caused by stress.

As used herein, the term “pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids or bases. Examples of suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, trifluoroacetic acid, citric acid, methane. Examples include sulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, and benzenesulfonic acid. Salts derived from suitable bases may include alkali metals such as sodium, alkaline earth metals such as magnesium, ammonium, and the like.

As used herein, the term “prevention” refers to suppressing the occurrence of a disease or disease in a subject who has not been diagnosed as having the disease or disease but is likely to develop the disease or disease.

As used herein, the term “treatment” refers to (a) inhibiting the development of a disease, condition or symptom; (b) alleviation of a disease, condition or symptom; or (c) means eliminating a disease, condition or symptom. When the composition of the present invention is administered to a subject, it significantly improves behavioral indicators under a stressful environment, significantly reduces plasma corticosterone concentration, and reduces the expression of stress-related genes, thereby inhibiting the development of symptoms of stress-related diseases, eliminating or eliminating them. Or it plays a role in alleviating it. Accordingly, the composition of the present invention may itself be a composition for treating these diseases, or may be administered together with other pharmacological ingredients and applied as a treatment adjuvant for these diseases. Accordingly, in this specification, the term “treatment” or “therapeutic agent” includes the meaning of “therapeutic aid” or “therapeutic aid.”

As used herein, the term “administration” or “administer” refers to directly administering a therapeutically effective amount of the composition of the present invention to a subject so that the same amount is formed in the subject's body.

In the present invention, the term “therapeutically effective amount” refers to the content of the composition in which the pharmacological ingredients in the composition are contained in a sufficient amount to provide a therapeutic or preventive effect to the individual who intends to administer the pharmaceutical composition of the present invention, and thus “ It is meant to include a “prophylactic effective amount.”

As used herein, the term “subject” includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cows, pigs, monkeys, chimpanzees, baboons, or rhesus monkeys. Specifically, the subject of the present invention is a human.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Includes, but is limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. It doesn't work. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, specifically, orally, intravenously, subcutaneously, or intraperitoneally.

The appropriate dosage of the pharmaceutical composition of the present invention is prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be. The preferred dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg/kg for adults.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally contain a dispersant or stabilizer.

Hereinafter, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are merely illustrative of the present invention, and it is clear to those skilled in the art that various changes and modifications are possible within the scope and spirit of the present invention. It is natural that such variations and modifications fall within the scope of the attached patent claims.

Example 1.

Nerol compound was used.

<Test example>

Cell lines and culture methods

Human foreskin fibroblasts (Hs68) and human neurons (SH-SY5Y) used in the experiment were purchased from American Type Culture Collection (Manassas, VA, USA) and used in Dulbecco's Modified Eagle Medium (Gibco, Grand Island, USA). NY, USA) culture medium containing 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Sigma-Aldrich, St. Louis, MO, USA) was used and conditions were maintained at 37°C and 5% ^CO2 . were cultured in an incubator.

statistical analysis

All experimental results were expressed as mean ± standard error, and significance was verified at the p < 0.05 level by performing an independent sample t-test (student's t-test) using SPSS Statistics (version 25.0, Chicago, IL, USA). .

Test Example 1. Measurement of stress relief effect

To confirm the stress-relieving effect of the nerol compound, the activity of the GRE promoter, which mediates stress response, and the mRNA expression level of its downstream responsive genes (GILZ and FKBP5) were measured.

GRE Luciferase Expression Assessment

The level of GRE promoter activity according to treatment with the stress hormone Dexamethasone was confirmed through dual luciferase analysis. Human skin fibroblasts (HS68) or human neurons (SH-SY5Y) were cultured in a ¹² well plate at a concentration of 2.0 The vector containing GRE was transfected into HS68 cells and SH-SY5Y cells and cultured for 24 hours. After removing the existing medium and washing with phosphate buffered saline (PBS), dexamethasone (1 μM) and a mixture of dexamethasone (1 μM) and the compound of Example 1 (100 μM) were added to each medium and incubated for 24 hours. Cultured. Afterwards, the cells were lysed and the luminescence signal was measured using a luminometer (BMG LABTECH, Ortenberg, Germany) using the Dual-glo Luciferase assay system (Promega, Madison, WI, USA) reagent.

Real-time quantitative PCR (RT-qPCR) analysis

Hs68 cells and SH-SY5Y cells were cultured in a ⁶ -well plate at a concentration of 1.0 The added mixture was added to each medium and cultured for 24 hours. After incubation, the medium was removed, washed with PBS, and total RNA was extracted using Trizol reagent (Thermo Fisher Scientifc). The isolated RNA was synthesized into cDNA using a cDNA synthesis kit (Takara, Shiga, Japan) by reacting at 42°C for 2 minutes, 37°C for 15 minutes, and 85°C for 5 seconds. Using cDNA as a template, 10 μL of iQ SYBR green supermix (Bio-Rad, Hercules, CA, USA) and each primer set (1 μM) were added, and CFX Connect Real-Time PCR Detection System (Bio-Rad) was used. Real-time quantitative PCR (RT-qPCR) was performed.

Each primer base sequence was created based on the gene sequence registered in Genbank (Table 1). PCR was performed in 2 steps for 35 cycles: initial denaturation (95°C, 2 min), denaturation (95°C, 30 sec), and binding and elongation reaction (57°C, 30 sec). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to correct the quantitative expression level of each gene.

gene Primer sequence (5′→3′) GILZ (Glucocorticoid-induced leucine zipper) F TCCTGTCTGAGCCCTGAAGAG R AGCCACTTACACCGCAGAAC FKBP5 (FK506 binding protein 5) F AGAGCTTCGAAAAGGCCAAAG R CGCCTGCATGTATTTGCCTC COL1A1 (collagen type I alpha 1 chain) F TTGCTCCCCAGCTGTCTTAT R AGACCACGAGGACCAGAGG GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) F AAATCAAGTGGGGCGATGC R AGGGGGCAGAGATGATGACC

Figure 1A is a graph showing the activity of the GRE promoter after treating human skin fibroblasts (HS68) with dexamethasone and the mixture of dexamethasone and Example 1 (nerol), respectively; Figure 1B is a graph showing the activity of the GRE promoter after treating human nerve cells (SH-SY5Y) with dexamethasone and the mixture of dexamethasone and Example 1; Figure 1C is a graph measuring the expression levels of GILZ and FKBP5 genes after treating human skin fibroblasts (HS68) with dexamethasone and the mixture of dexamethasone and Example 1, respectively; Figure 1D is a graph measuring the expression levels of GILZ and FKBP5 genes after treating human nerve cells (SH-SY5Y) with dexamethasone and the mixture of dexamethasone and Example 1, respectively. CON is the group treated with DMSO (dimethyl sulfoxide).

As shown in Figures 1A and 1B, GRE promoter activity was significantly increased compared to the CON group when human skin fibroblasts (HS68) and human neurons (SH-SY5Y) were treated with dexamethasone (DEX; 1 μM), respectively. On the other hand, when DEX (1 μM) and nerol (Example 1, 100 μM) were treated together, it was confirmed that it significantly decreased compared to when treated with dexamethasone (DEX) alone.

In addition, as shown in Figures 1C to 1D, the gene expression levels of GILZ and FKBP5 were confirmed through RT-qPCR. As a result, dexamethasone (1 μM) was applied to human skin fibroblasts (HS68) and human neurons (SH-SY5Y), respectively. ), the expression levels of GILZ and FKBP5 genes were significantly increased compared to the CON group, and when treated together with DEX (1 μM) and nerol (Example 1, 100 μM), the expression level of GILZ and FKBP5 genes was significantly increased compared to the treatment with dexamethasone (DEX) alone. It was confirmed that the expression levels of GILZ and FKBP5 genes were significantly decreased.

Test Example 2. Cytotoxicity measurement

To determine the effect of stress on nerve cells and the stress relieving effect of the compound of Example 1, cell viability was measured based on the Cell Counting Kit-8 (CCK-8) assay. Human neural cells (SH-SY5Y) cells were cultured in a ⁹⁶ well plate for 24 hours at a concentration of 3.0 Afterwards, dexamethasone (1 μM) and a mixture of Example 1 (100 μM) added to dexamethasone (1 μM) were added to each medium and cultured for 48 hours. After incubation, the medium was removed and replaced with new medium containing CCK-8 (Dojindo, Tokyo, Japan), then cultured for an additional 2 hours at 37°C, and the absorbance was measured at 450 nm. The degree of reduction of intracellular dehydrogenase, which is a representative indicator of cell viability, was measured.

Figure 2 is a graph measuring cell survival rate after treating human nerve cells (SH-SY5Y) with dexamethasone and the mixture of dexamethasone and Example 1, respectively. CON is the group treated with DMSO (dimethyl sulfoxide).

As shown in Figure 2, the cell viability of human neural cells (SH-SY5Y) was significantly reduced when treated with dexamethasone (DEX) alone compared to the CON group, whereas DEX (1 μM) and nerol (Example 1) , 100 μM), it was confirmed that the cell viability decreased due to dexamethasone (DEX) was significantly improved.

Test Example 3. Procollagen concentration measurement

To measure ^procollagen concentration, skin fibroblasts (HS68) were distributed in a 12 well plate at 2 ) was added to each medium. After culturing for 48 hours, the amount of procollagen secreted into the medium was measured using a procollagen type IC-peptide (PIP) ELISA kit (Takara Bio, Japan).

Figure 3 is a graph measuring procollagen after treating skin fibroblasts (HS68) with dexamethasone and the mixture of dexamethasone and Example 1, respectively. CON is the group treated with DMSO (dimethyl sulfoxide).

As shown in Figure 3, the group treated with dexamethasone (DEX) alone significantly reduced the amount of procollagen compared to the CON group, and the group treated with dexamethasone (DEX) and nerol (Example 1, 100 μM) together It was confirmed that the amount of procollagen was significantly increased compared to the group treated with dexamethasone alone.

Below, a formulation example of a composition containing the powder of the present invention is described, but the present invention is not intended to be limited, but merely explained in detail.

Formulation Example 1. Preparation of powder

500 mg of compound of Example 1

100 mg lactose

Talc 10 mg

The above ingredients are mixed and filled into an airtight bubble to prepare a powder.

Formulation Example 2. Preparation of tablets

300 mg of compound of Example 1

Corn starch 100 mg

100 mg lactose

Magnesium stearate 2 mg

After mixing the above ingredients, tablets are manufactured by compressing them according to a typical tablet manufacturing method.

Formulation Example 3. Preparation of capsules

200 mg of compound of Example 1

3 mg crystalline cellulose

Lactose 14.8 mg

Magnesium stearate 0.2 mg

Capsules are prepared by mixing the above ingredients and filling them into gelatin capsules according to a typical capsule manufacturing method.

Formulation Example 4. Preparation of injections

600 mg of compound of Example 1

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Na ₂ HPO _4, 12H ₂ O 26 mg

It is prepared with the above ingredients per ampoule according to the usual manufacturing method for injections.

Formulation Example 5. Preparation of liquid formulation

4 g of compound of Example 1

10 g isomerized sugar

5 g mannitol

Proper amount of purified water

According to the usual liquid preparation method, add and dissolve each ingredient in purified water, add an appropriate amount of lemon flavor, mix the above ingredients, add purified water, adjust the total to 100g by adding purified water, and then fill it in a brown bottle and sterilize it. to produce a liquid.

Formulation Example 6. Preparation of granules

1,000 mg of compound of Example 1

Vitamin mixture dosage

Vitamin A acetate 70 μg

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

Vitamin B12 0.2 ㎍

Vitamin C 10 mg

Biotin 10 μg

Nicotinamide 1.7 mg

Folic acid 50 μg

Calcium pantothenate 0.5 mg

Mineral mixture appropriate amount

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Monobasic Potassium Phosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 90 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

The composition ratio of the above vitamin and mineral mixture is a mixture of ingredients relatively suitable for granules in a preferred embodiment, but the mixing ratio may be modified arbitrarily. The above ingredients are mixed according to a typical granule manufacturing method, and then the granules are mixed. It can be prepared and used to manufacture a health functional food composition according to a conventional method.

Formulation Example 7. Preparation of functional beverage

1,000 mg of compound of Example 1

1,000 mg citric acid

100 g oligosaccharides

2 g plum concentrate

1 g taurine

Add purified water to make a total of 900 mL.

After mixing the above ingredients according to a typical health drink manufacturing method, stirring and heating at 85°C for about 1 hour, the resulting solution was filtered, placed in a sterilized 2 L container, sealed, sterilized, stored in the refrigerator, and then refrigerated. Used for manufacturing the functional beverage composition of the invention.

The composition ratio is a preferred embodiment of mixing ingredients that are relatively suitable for beverages of preference, but the mixing ratio may be arbitrarily modified according to regional and ethnic preferences such as demand class, country of demand, and intended use.

An example of manufacturing a cosmetic composition suitable for applying the present invention will be presented.

Preparation Example 8: Toner

The preparation example of lotion among cosmetics containing the compound of Example 1 is shown in Table 2 below.

ingredient Content (% by weight) Example 1 5.0 glycerin 6.0 1,3-butylene glycol 3.0 PEG 1500 1.0 allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Benzophenone-9 0.04 Sodium Hyaluronate 5.0 ethanol 10.0 Polysorbate 20 0.2 Preservatives, fragrance, coloring a very small amount Distilled water remaining amount Sum 100

Preparation Example 9: Lotion

Preparation examples of lotions among cosmetics containing the compound of Example 1 are shown in Table 3 below.

ingredient Content (% by weight) Example 1 3.0 propylene glycol 6.0 glycerin 4.0 Triethanolamine 1.2 Tocopheryl Acetate 3.0 liquid paraffin 5.0 squalane 3.0 macadami nut oil 2.0 Polysorbate 60 1.5 Sorbitan sesquioleate 1.0 Carboxy vinyl polymer 1.0 Preservatives, fragrance, coloring a very small amount Distilled water remaining amount Sum 100

Preparation Example 10: Nutritional Cream

Preparation examples of nutritional creams among cosmetics containing the compound of Example 1 are shown in Table 4 below.

ingredient Content (% by weight) Example 1 1.0 Lipophilic glycerin monostearate 1.5 cetearyl alcohol 1.5 stearic acid 1.0 Polysorbate 60 1.5 Sorbitan Stearate 0.6 Isostearyl isostearate 5.0 squalane 5.0 mineral oil 35.0 Dimethicone 0.5 Hydroxyethylcellulose 0.12 glycerin 6.0 Triethanolamine 0.7 Preservatives, fragrance, coloring a very small amount Distilled water remaining amount Sum 100

Preparation Example 11: Essence

Examples of preparation of essence among cosmetics containing the compound of Example 1 are shown in Table 5 below.

ingredient Content (% by weight) Example 1 1.5 glycerin 10.0 Betaine 5.0 PEG 1500 2.0 allantoin 0.1 DL-panthenol 0.3 EDTA-2Na 0.02 Benzophenone-9 0.04 Hydroxyethylcellulose 0.1 Sodium Hyaluronate 8.0 Carboxy vinyl polymer 0.2 Triethanolamine 0.18 octyldodecanol 0.3 Octyldodeceth-16 0.4 ethanol 6.0 Preservatives, fragrance, coloring a very small amount Distilled water remaining amount Sum 100

Preparation Example 12: Emulsion for mask pack

Preparation examples of emulsions for mask packs among cosmetics containing the compound of Example 1 are shown in Table 6 below.

ingredient Content (% by weight) Example 1 1.0 polyvinyl alcohol 15.0 cellulose gum 0.15 glycerin 3.0 PEG 1500 2.0 Cyclodextrin 0.15 DL-panthenol 0.4 allantoin 0.1 Monoammonium glycyrrhizinate 0.3 nicotinamide 0.5 ethanol 6.0 PEG 40 Hydrogenated Castor Oil 0.3 Preservatives, fragrance, coloring a very small amount Distilled water remaining amount Sum 100

An example of manufacturing a fragrance composition suitable for applying the present invention will be presented.

Preparation Example 8: Seonhyang

ingredient Content (% by weight) Example 1 5.0 Hwangchil 5.0 teak tree 5.0 pine bark 5.0 pine cone 5.0 dragon brain 5.0 elm tree 10.0 chicha extract 1.0 Distilled water remaining amount Sum 100

Claims (11)

A cosmetic composition for improving stress-related skin diseases that improves the concentration of procollagen by containing nerol compound or a cosmetically acceptable salt thereof as an active ingredient,
A cosmetic composition, wherein the stress-related skin disease is skin wrinkles or skin elasticity. delete delete delete delete delete delete delete delete delete Containing Nerol compound or an acceptable salt thereof as an active ingredient, it reduces the GRE promoter activity of human skin fibroblasts and human neurons in vitro and reduces mRNA expression of GILZ and FKBP5 genes. Reagent composition.