KR102599134B1 - Method for preparing dextrin-derived highly polymerized isomaltooligosaccharide by using a novel sugar transferase and the dextrin-derived highly polymerized isomaltooligosaccharide with the effect of improving bowel movements by the method - Google Patents

Abstract

The present invention relates to a method for producing highly polymerized isomaltooligosaccharide derived from dextrin with excellent efficacy in improving bowel movements using a glycosyltransferase for producing highly polymerized isomaltooligosaccharide, and to highly polymerized isomaltooligosaccharide derived from dextrin with excellent efficacy in improving bowel movements prepared thereby. Specifically, the highly polymerized isomaltooligosaccharide producing enzyme has the activity of producing new oligosaccharides by reacting with dextrin, thereby enabling the production of highly polymerized isomaltooligosaccharide derived from dextrin, which has excellent efficacy in improving bowel movements.

Description

Method for preparing dextrin-derived highly polymerized isomaltooligosaccharide by using a novel sugar transferase and the dextrin-derived highly polymerized isosomaltooligosaccharide with the effect of improving bowel movements by the method}

The present invention relates to a method for producing highly polymerized isomaltooligosaccharide derived from dextrin using a novel glycosyltransferase, and to highly polymerized isomaltooligosaccharide derived from dextrin produced through the same, which has the effect of improving bowel movements.

Sugars, the substances that produce sweet taste, are divided into monosaccharides, disaccharides, and polysaccharides depending on the number of sugar molecules. Glucose and fructose are monosaccharides with one molecule, sucrose is a disaccharide with two molecules, and oligosaccharide is a polysaccharide with three or more molecules bundled together. Since sugars are contained in most fruits, dairy products, and grains, they can be consumed through food and function to provide energy and mental satisfaction. Monosaccharides with smaller particles are faster to digest and ingest, but polysaccharides are difficult to digest and ingest, so they are low in calories (one-third the level of sugar) and are free to exert biological effects on individuals by stimulating the growth of symbiotic or beneficial microorganisms in the intestines. It is also called biotics and is known to act like soluble dietary fiber in the body.

Excessive intake of sugar and fructose, which account for a large amount of sugars, can increase calories and cause obesity, or increase triglycerides in the blood, which can increase the risk of developing adult diseases such as cardiovascular disease, and in children, diseases such as tooth decay and hyperactivity disorder. As controversy over its harmfulness continues, as it is reported to be related to the risk of occurrence, the number of consumers using oligosaccharides as a substitute for sugar to create a sweet taste for health reasons is increasing. Examples of oligosaccharides that can be easily found in Korea include fructooligosaccharide and isomaltooligosaccharide.

Fructo-oligosaccharide refers to a mixture of sugars with a structure similar to sugar, in which 1 to 3 fructose residues are bonded to the fructose residue of sugar. Its components are 1-Kestose (GF2), Nystose (GF3), and Fructosyl nystose (GF4). Isomalto-oligosaccharide (IMO) is a branched bond of glucose in the form of α-(1,4)- and/or α-(1,6)-glucosidic bonds, with a degree of polymerization (DP) of 2 to 2. 10 Refers to phosphorus sugars and includes other higher branched oligosaccharides such as isomaltose, panose, isomaltotriose, isomaltotetraose and isopanose. It is known to be a growth factor for bifidobacteria, which are representative of useful intestinal bacteria. Fructooligosaccharide and isomaltooligosaccharide both belong to oligosaccharides, which are polysaccharides, but the difference between the two appears in the components that make up oligosaccharides. Fructooligosaccharide is manufactured by processing sugar (fructose + glucose) and linking it to glucose, and isomaltooligosaccharide is made by processing starch powder (glucose + glucose) such as rice or corn and linking it to glucose.

Bifidobacteria in the intestines are closely related to the health of the host, including nutrition, immunity, aging, inhibition of intestinal decay substances, and vitamin synthesis. Foods containing bifidobacteria and bifidus growth promoting substances are being sold to promote the growth of bifidobacteria, and various types of oligosaccharides are being developed as bifidobacteria promoting substances. Most fructo-oligosaccharides are indigestible, so they are not decomposed in the small intestine, but reach the large intestine and are selectively used by bifidobacteria living in the intestine, thereby promoting their growth. Overdosage is known to cause diarrhea. On the other hand, isomaltooligosaccharide is located between indigestibility and digestibility, so it is less irritating to the intestinal tract and is known to be excellent in safety, with a maximum non-acting dose of 1.5 g/kg, similar to that of sugar. Recently, as awareness of oligosaccharides and bifidobacteria has expanded in Korea, oligosaccharides are being added to various types of foods such as beverages, dairy products, and sauces. In particular, isomaltooligosaccharides with a high degree of polymerization are known to have health functional effects (Toshiyuki Kaneko et al. Biosci. Biotech. Biochem., 58(12): 2288-2290, 1994).

The present inventors studied a method for producing oligosaccharides using dextrin as a substrate and found that the highly polymerized isomaltooligosaccharide producing enzyme has the ability to produce new oligosaccharides by reacting with dextrin, and from this, a new highly polymerized dextrin-derived oligosaccharide was discovered. It was confirmed that it was possible to produce isomaltooligosaccharide, and it was confirmed that the produced isomaltooligosaccharide had excellent efficacy in improving bowel movements, thereby completing the present invention.

One object of the present invention is to provide a method for producing highly polymerized isomaltooligosaccharide derived from dextrin with excellent efficacy in improving bowel movements and a highly polymerized isomaltooligosaccharide derived from dextrin prepared thereby with excellent efficacy in improving bowel movements. At this time, the highly polymerized isomaltooligosaccharide has a glucose content of 20 to 25%, which is close to half of that of commercially available isomaltooligosaccharides, and the type and content of oligosaccharides in the form of α-1,6 bonds, and polymerization ratio are significantly increased. Do it as

In order to achieve the above purpose,

The present invention provides a method for producing highly polymerized isomaltooligosaccharide derived from dextrin that has the effect of improving bowel movements, including the step of adding and reacting glycosyltransferase to dextrin.

In addition, the present invention provides a highly polymerized isomaltooligosaccharide derived from dextrin that is excellent in bowel movement improvement efficacy prepared through the above production method.

In addition, the present invention provides a highly polymerized isomaltooligosaccharide derived from dextrin, which contains a component consisting of only α-1,6 bonds among the sugar components and has a degree of polymerization (DP) of 7 to 13, and has an effect for improving bowel movements. do.

In addition, the present invention provides a composition for improving bowel movements containing highly polymerized isomaltooligosaccharide derived from dextrin, which has the effect of improving bowel movements, as an active ingredient.

In addition, the present invention provides a food composition for improving bowel movements containing highly polymerized isomaltooligosaccharide derived from dextrin, which has the effect of improving bowel movements, as an active ingredient.

The highly polymerized isomaltooligosaccharide producing enzyme of the present invention has the activity of producing novel highly polymerized isomaltooligosaccharide by reacting with dextrin, and the highly polymerized isomaltooligosaccharide derived from dextrin prepared therefrom has excellent efficacy in improving defecation and reduces blood insulin concentration when ingested. Because the increase and decrease is gradual, it can be used as a patient's diet such as a diabetic diet or in cases where long-term energy supply is needed, such as for sports people.

Figure 1 is a diagram showing the nucleotide sequence encoding highly polymerized isomaltooligosaccharide producing enzyme (Tt-LIMO) derived from dextrin derived from the Thermoanaerobacter thermocopriae strain.
Figure 2 is a diagram showing a dextrin-derived highly polymerized isomaltooligosaccharide producing enzyme (Tt-LIMO) recombinant vector in which the nucleotide sequence encoding dextrin-derived highly polymerized isomaltooligosaccharide producing enzyme (Tt-LIMO) has been cloned.
Figure 3 is a diagram showing the results confirming that the dextrin-derived highly polymerized isomaltooligosaccharide producing enzyme was successfully prepared through electrophoresis analysis.
Figure 4 shows maltose (M2, left graph) and maltotetraose (M4, right graph) by TG (commercial enzyme, solid line) and TtLIMO (dotted line) over time to explore substrates for the production of highly polymerized isomaltooligosaccharides. ) This is a diagram showing the results of analyzing the relative composition of the reaction product.
Figure 5 is a diagram showing the results of HPAEC-PAD analysis of dextrin substrates (D1, D2, and D3) of various degrees of polymerization.
Figure 6 is a diagram showing the results of analysis of dextrin standards (STD 1, STD 2) through HPAEC-PAD.
Figure 7 is a diagram showing the results of analysis of the production of highly polymerized isomaltooligosaccharides derived from dextrin substrates of various degrees of polymerization through HPAEC-PAD.
Figure 8 is a diagram showing the results of analyzing the constituent sugars of the reaction product according to the degree of polymerization of the dextrin substrate.
Figure 9 is a diagram showing the results of analyzing the production rate of highly polymerized isomaltooligosaccharide derived from dextrin according to the reaction time between the dextrin substrate and LIMOzyme.
Figure 10 is a diagram showing the results of analyzing the constituent sugars of the dextrin substrate, commercially available isomaltooligosaccharide, and highly polymerized isomaltooligosaccharide derived from dextrin according to the present invention.
Figure 11 is a diagram showing the results of confirming the degree of polymerization of the constituent sugars through MALDI-TOF MS analysis.
Figure 12 is a diagram showing the results of ¹ H-NMR analysis of dextrin substrate, isomaltooligosaccharide, and highly polymerized isomaltooligosaccharide derived from dextrin according to the present invention to analyze the α-1,4/α-1,6 binding ratio. .
Figure 13 is a diagram showing a test schematic diagram for evaluating the effectiveness of improving defecation in mice to confirm the efficacy of the highly polymerized isomaltooligosaccharide derived from dextrin according to the present invention in improving defecation.
Figure 14 is a diagram showing the results of analyzing changes in the number of mouse stools and water content in feces to confirm the efficacy of the highly polymerized isomaltooligosaccharide derived from dextrin according to the present invention for improving bowel movements.
Figure 15 is a diagram showing the results of analyzing the mouse digestive tract migration rate to confirm the efficacy of the highly polymerized isomaltooligosaccharide derived from dextrin according to the present invention in improving bowel movements.
Figure 16 is a diagram showing a comparison of the sugars and bonding ratios of commercially available isomaltooligosaccharides and highly polymerized isomaltooligosaccharides derived from dextrin according to the present invention. Compared to commercially available isomaltooligosaccharides, highly polymerized isomaltooligosaccharides according to the present invention have α It can be seen that the type and content of constituent sugars and polymerization ratio of oligosaccharides in the form of -1,6 bonds have significantly increased.

Hereinafter, the present invention will be described in detail.

The present invention provides a method for producing highly polymerized isomaltooligosaccharide derived from dextrin that has the effect of improving bowel movements, including the step of adding and reacting glycosyltransferase to dextrin.

The glycosyltransferase may be derived from the Thermoanaerobacter thermocopriae strain.

The glycosyltransferase includes the C-terminus of SEQ ID NO. 2 among the cyclic isomaltooligosaccharide glucanotransferase (TPCITase) of SEQ ID NO. 1, and is a glycosyltransferase that produces a glycosyltransfer product using dextrin as a substrate. It could be an enzyme.

The above reaction refers to a reaction carried out by glycosyltransferase. The reaction solution generally refers to a solution containing at least one of a solution containing dextrin as a substrate, solubilized starch, water, and any other components, and further containing an active glycosyltransferase. It is in the reaction solution that the steps of contacting water, dextrin as a substrate, solubilized starch, and glycosyltransferase are performed. In the above reaction, solubilized starch is transferred to dextrin through the activity of glycosyltransferase to form a bond, thereby producing highly polymerized isomaltooligosaccharide derived from dextrin.

The reaction between the substrates and the glycosyltransferase in the above step may be carried out at 20 to 60°C, and preferably at 30 to 50°C.

The reaction between the substrate and the glycosyltransferase in the above step may take place for 0.2 to 80 hours, may take place for 0.2 to 10 hours, may take place for 3 to 9 hours, or may take place for 4 to 8 hours. However, it is not necessarily limited to the above reaction time, and a person skilled in the art can select an appropriate reaction time through experimentation depending on the concentration of dextrin, the substrate. For example, when the concentration of dextrin is about 30%, 3 days (72 hour)

In the above step, 20 to 80 μl of glycosyltransferase may be added, preferably 30 to 70 μl, and more preferably 40 to 60 μl.

The present invention provides a dextrin-derived highly polymerized isomaltooligosaccharide with a defecation-improving effect, prepared by the method for producing the dextrin-derived highly polymerized isomaltooligosaccharide with a defecation-improving effect.

The highly polymerized isomaltooligosaccharide derived from dextrin, which has the effect of improving bowel movements, contains a component consisting of only α-1,6 bonds among the constituent sugar components, and may be characterized as having a degree of polymerization (DP) of 7 to 13. .Or, for example, the degree of polymerization may be 7 to 13, 8 to 12, or 9 to 11.

The heavy isomaltooligosaccharide with the effect of improving bowel movements may be an isomaltooligosaccharide composed of only α-1,6 bonds, and the ratio of α-1,6 bonds to α-1,4 bonds is 2:1 to 5:1. Alternatively, it may be 2:1 to 4:1. The highly polymerized isomaltooligosaccharide may include a component consisting of only α-1,6 bonds among the sugar components. In addition, the highly polymerized isomaltooligosaccharide contains 20 to 25% glucose, which is lower than that of commercially available isomaltooligosaccharides, which contain 40 to 50% glucose.

The present invention provides a highly polymerized isomaltooligosaccharide that contains only α-1,6 bonds among the sugar components and has a degree of polymerization (DP) of 7 to 13, and has an effect for improving bowel movements. Or, for example, the degree of polymerization may be 7 to 13, 8 to 12, or 9 to 11.

The heavy isomaltooligosaccharide with the effect of improving bowel movements may be an isomaltooligosaccharide composed of only α-1,6 bonds, and the ratio of α-1,6 bonds to α-1,4 bonds is 2:1 to 5:1. Alternatively, it may be 2:1 to 4:1. The highly polymerized isomaltooligosaccharide may include a component consisting of only α-1,6 bonds among the sugar components. In addition, the highly polymerized isomaltooligosaccharide contains 20 to 25% glucose, which is lower than that of commercially available isomaltooligosaccharides, which contain 40 to 50% glucose.

Before adding and reacting the glycosyltransferase to dextrin,

1) Preparing a culture of a transformant transformed with a recombinant vector containing a glycosyltransferase gene consisting of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5; and

2) obtaining glycosyltransferase from the culture; by further including dextrin-derived highly polymerized isomaltooligosaccharide as an active ingredient, dextrin-derived highly polymerized isomaltooligosaccharide having the effect of improving bowel movements can be prepared.

In the present invention, dextrin-derived oligosaccharide producing enzyme (Tt-LIMO) is used in the same sense as glycosyltransferase for producing highly polymerized isomaltooligosaccharide.

The glycosyltransferase for producing highly polymerized isomaltooligosaccharide consisting of the amino acid sequence of SEQ ID NO: 5 can produce isomaltooligosaccharide using dextrin as a substrate.

The isomaltooligosaccharide preferably has a structure of Formula 1 for isomaltose with a degree of polymerization of 2, Formula 2 for isomaltotriose with a degree of polymerization of 3, or Formula 3 for isomaltooligosaccharide with a degree of polymerization of 4 to 10.

<Formula 1>

<Formula 2>

<Formula 3>

The glycosyltransferase may be dextran dextrinase.

Carbohydrate-active enzymes in which glycosyltransferase reactions occur are broadly classified into four types: glycosyl transferase (GTase), transglucosidases (TGase), glycoside phosphorylase (GPase), and glycoside hydrolases (GHase). Among these, glycosyl transferase (GTase) is responsible for glycosyl transferase efficiency. It is good and has an excellent ability to transfer sugar to various receptors.

The glycosyl transferase (GTase) transfers the glucosyl terminal of the non-reducing α-1,4 bond to the α-1,6 bond. The α-1,4 bond refers to a type of covalent bond in which an α-D glucose molecule is linked to an adjacent α-D glucose molecule ring through carbons 1 and 4. The α-1,6 bond refers to a type of covalent bond in which an α-D glucose molecule is linked to an adjacent α-D glucose molecule ring through carbons 1 and 6.

The highly polymerized isomaltooligosaccharide derived from dextrin of the present invention refers to a polysaccharide with a degree of polymerization of 7 to 13 in which glucose is composed of branched bonds of α-(1,4)- and/or α-(1,6)-glucoside. desirable.

The molecular weight of the isomaltooligosaccharide of the present invention can be expressed as a weight average degree of polymerization (DPw) or a number average degree of polymerization (DPn).

In the present invention, the glycosyltransferase can produce not only isomaltooligosaccharides with a low degree of polymerization of 2 to 6, but also highly polymerized isomaltooligosaccharides with a degree of polymerization of 7 to 13.

In addition, the glycosyltransferase includes 'variants', and the 'variant' refers to a protein that has more than 90% homology to the glycosyltransferase having the amino acid sequence of SEQ ID NO: 5.

“Homology” refers to the degree of similarity to the amino acid sequence of a wild type protein, preferably 90% to the amino acid sequence (SEQ ID NO: 5) encoding the glycosyltransferase (TP-DDase) of the present invention. It contains amino acid sequences that may be at least 95% identical, more preferably at least 95% identical, and even more preferably at least 98% identical. This comparison of homologies can be performed with the naked eye or using a comparison program that is easily purchased. Commercially available computer programs can calculate the percent homology between two or more sequences, and the percent homology can be calculated for adjacent sequences.

Additionally, the glycosyltransferase or homolog thereof of the present invention includes an amino acid sequence variant having enzymatic activity. A sequence variant refers to a protein having a sequence that differs from the natural amino acid sequence by one or more amino acid residues. A mutant protein exhibits the same biological activity as the wild-type protein, but may be a mutant with modified protein characteristics. Preferably, the structural stability of the protein against heat, pH, etc. can be increased by mutations and modifications in the amino acid sequence. For example, it can show enzyme activity even in strong acids where natural proteins do not show enzyme activity, and it can also show enzyme activity at low or high temperatures. In addition, it may be a variant in which the substrate specificity of the glycosyltransferase is strengthened or the type of substrate that reacts with the enzyme is expanded through mutations and modifications in the amino acid sequence.

The glycosyltransferase of the present invention can be produced through genetic engineering methods using the amino acid sequence shown in SEQ ID NO: 5 or the nucleotide sequence encoding it. In the present invention, it is preferable to use an expression vector as the recombinant vector for efficient expression of the glycosyltransferase gene.

In the present invention, “expression vector” refers to a recombinant vector capable of expressing a target peptide in a suitable host cell, and refers to a gene construct containing essential regulatory elements operatively linked to express the gene insert. The expression vector of the present invention includes expression control elements such as a promoter, operator, and start codon, which are elements that suitable expression vectors generally have. Initiation codons and stop codons are generally considered to be part of the nucleotide sequence that encodes a polypeptide and must be functional in the subject when the genetic construct is administered and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible. Additionally, it may include a signal sequence for release of the fusion polypeptide to promote separation of the protein from the cell culture medium. A specific initiation signal may also be required for efficient translation of the inserted nucleic acid sequence. These signals include the ATG start codon and adjacent sequences. In some cases, an exogenous translation control signal, which may include an ATG initiation codon, must be provided. These exogenous translation control signals and initiation codons can be from a variety of natural and synthetic sources. Expression efficiency can be increased by introduction of appropriate transcription or translation enhancers.

All common expression vectors can be used as expression vectors. For example, plasmid DNA, phage DNA, etc. can be used. Specific examples of plasmid DNA include commercial plasmids such as pET28a and pET. Other examples of plasmids that can be used in the present invention include E. coli-derived plasmids (pET28a, pET, pGEX, pQE, pDEST, and pCOLD), Bacillus subtilis-derived plasmids (pUB110 and pTP5), and yeast-derived plasmids ( YEp13, YEp24 and YCp50). Specific examples of phage DNA include λ-phages (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, and λZAP). In addition, animal viruses such as retrovirus, adenovirus or vaccinia virus, insect viruses such as baculovirus can also be used, and the glycosyltransferase (TP-DDase) ) For efficient expression of genes, it is preferable to use the E. coli-derived plasmids (pET28a, pET, pGEX, pQE, pDEST, and pCOLD). Since these expression vectors have different protein expression levels and modifications depending on the host cell, the host cell most suitable for the purpose can be selected and used.

In the present invention, the transformant is obtained by introducing the recombinant vector of the present invention into a host suitable for the expression vector used in producing the recombinant vector. Types of hosts include Esherichia, Pseudomonas, Ralstonia, Alcaligenes, Comamonas, Burkholderia, Genus Agrobacterium, Flabobacterium, Vibrio, Enterobacter, Rhizobium, Gluconobacter, Acinetobacter ), Moraxella, Nitrosomonas, Aeromonas, Paracoccus, Bacillus, Clostridium, Lactobacillus (Lactobacillus), Corynebacterium, Arthrobacter, Achromobacter, Micrococcus, Mycobacterium, Streptococcus ), Streptomyces, Actinomyces, Nocardia, and Methylobacterium can be used. Additionally, in addition to the above bacteria, yeasts such as Saccharomyces and Candida, and various fungi can be used as hosts. In the present invention, one E. coli selected from the group consisting of BL21 (DE3), Rosetta (DE3), Rosetta2 (DE3), ArcticExpress (DE3), STAR (DE3), C41 (DE3) and C43 (DE3) is used as a host. It is more preferable. When using bacteria such as Escherichia coli as a host, the recombinant vector of the present invention is capable of autonomous replication in the host and is necessary for expression of DNA containing a promoter and glycosyltransferase gene, transcription termination sequence, etc. It is desirable to have a configuration. Methods for introducing recombinant DNA into bacteria include the calcium chloride method, electroporation method (Method Enzymol., 194, 182-187 (1990)), and spheroplast method (Proc. atl.Acad. Sci.USA, 84, 1929). -1933 (1978)), lithium acetate method (J. Bacteriol., 153, 63-168 (1983)), etc. are available.

In addition, recombinant vectors are fragments for expression suppression with various functions for suppression, amplification, or induction of expression, markers for selection of transformants, resistance genes to antibiotics, or for the purpose of secretion out of the bacterial cell. It is also possible to include a gene that encodes a signal.

In the present invention, the production of glycosyltransferase is performed by producing and accumulating glycosyltransferase, which is a gene product, in a culture (culture cell or culture supernatant) of the transformant, and then obtaining glycosyltransferase from the culture. It is done by doing. The method for cultivating the transformant of the present invention may be a conventional method used for host culture.

Additionally, the culture method can be any method used for cultivating ordinary microorganisms, such as batch culture, flow-batch culture, continuous culture, or reactor culture. The medium for the transformant obtained using a bacterium such as Escherichia coli as a host includes complete medium or synthetic medium, such as LB medium and M9 medium. In addition, glycosyltransferase can be accumulated and recovered within the bacterial cells by culturing within the above-mentioned appropriate temperature range.

Carbon sources necessary for the growth of microorganisms include, for example, sugars such as glucose, fructose, sucrose, maltose, galactose, and starch; Lower alcohols such as ethanol, propanol, and butanol; polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, and dodecanoic acid can be used.

Examples of nitrogen sources include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate, and ammonium phosphate, as well as those derived from natural products such as peptone, meat juice, yeast extract, malt extract, casein decomposition product, and corn steeping liquid. Moreover, examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, and sodium chloride. Additionally, antibiotics such as kanamycin, ampicillin, tetracycline, chloramphenicol, and streptomycin can be added to the culture medium.

When cultivating transformed microorganisms, the desired protein can be produced by adding an inducer suitable for the type of promoter to the medium. Examples of inducers include isopropyl-β-D-thiogalactopyranoside (IPTG), tetracycline, and indole acrylic acid (IAA). Acquisition and purification of glycosyltransferase is performed by centrifugal recovery of bacterial cells or supernatant from the resulting culture, cell disruption, extraction, affinity chromatography, cation or anion exchange chromatography, gel filtration, etc., alone or in appropriate combination. It can be done. Confirmation that the obtained purified material is the target enzyme can be performed by conventional methods, such as SDS-polyacrylamide gel electrophoresis (SDS-PAGE), western blotting, etc.

In addition, the culture of the transformant using a microorganism as a host, the production and accumulation of glycosyltransferase (TP-DDase) by the transformant in the bacterial cell, and the recovery of the glycotransferase (TP-DDase) from the bacterial cell are as described above. It is not limited to the method.

The dextrin can be classified according to D.E. (Dextrose equivalent). For example, it can be manufactured or used by appropriately selecting from the range of 1 to 20. For example, it may be 3 to 7, 13 to 17, or 16.5 to 19.5. Additionally, dextrins can be classified according to their degree of polymerization (DP), for example, 3 to 50, 5 to 20, 15 to 30, 25 to 50, 10 to 20, 15 to 25, 25 to 35 days. It can be 15 or less, 20 or less, or 30 or less. Preferably, the dextrin may be maltodextrin.

The dextrin may be a single substance or a mixture of glucose having a degree of polymerization (DP) of 2 or more bound in an α-1,4 form.

The concentration of the dextrin can be used at 0.5 to 60% (w/v), 0.5 to 20% (w/v), 1 to 10% (w/v), 0.5 to 1.5% (w/v), 4 to 6% (w/v), 8 to 12% (w/v), 5 to 15% (w/v), 15 to 25% (w/v), 25 to 35% (w/v), 35 to 45% (w/v), about 1% (w/v), about 5% (w/v), about 10% (w/v), about 20% (w/v), about 30% (w) /v), can be used at a concentration of about 40% (w/v), but is not limited thereto.

The highly polymerized isomaltooligosaccharide derived from dextrin, which has the effect of improving bowel movements, has a glucose content of 20 to 25%, which is close to half of that of general isomaltooligosaccharide, and the type and content of oligosaccharides in the form of α-1,6 bonds, and polymerization ratio. It increases significantly and has excellent efficacy in improving bowel movements.

The present invention provides a composition for improving bowel movements containing the highly polymerized isomaltooligosaccharide derived from dextrin as an active ingredient. In addition, the present invention provides a food composition for improving bowel movements, including a composition for improving bowel movements containing the highly polymerized isomaltooligosaccharide derived from dextrin as an active ingredient. Since the composition has excellent efficacy in improving bowel movements, it can be an excellent material for developing high value-added carbohydrate materials. For example, it can be preferably used in cases where long-term energy supply is required, such as for patients or sportspersons.

In a specific embodiment of the present invention, the present inventors used the gene encoding the glycolytic enzyme Tt-LIMO isolated from the Thermoan Aerobacter thermocopriae strain to produce Tt-ILMO of 2463 bp cut with restriction enzymes EcoRI and XhoI. A recombinant vector containing the coding base sequence was constructed (see FIGS. 1 and 2), and the recombinant vector was introduced into E. coli to produce dextrin-derived oligosaccharide synthase, a glycosyltransferase, in the constructed transformant. In addition, it was confirmed through experiments that the highly polymerized isomaltooligosaccharide derived from dextrin prepared by the above method had excellent efficacy in improving bowel movements (see FIGS. 13 to 15).

Hereinafter, examples and experimental examples of the present invention will be described in detail below. However, the examples and experimental examples described below only illustrate a part of the present invention and are not limited thereto.

< Example 1> Dextrin origin Isomaltooligosaccharide Manufacturing enzyme ( Tt - LIMO ) Preparation of recombinant expression vectors and transformants containing sequences encoding

<1-1> Origin of dextrin Isomaltooligosaccharide Manufacturing enzyme ( Tt - LIMO ) Amplification of the base sequence encoding

To produce the dextrin-derived isomaltooligosaccharide manufacturing enzyme (Tt-LIMO) protein, which is a glycosyltransferase, the base sequence encoding the enzyme was amplified.

Specifically, DNA isolated from Thermoanaerobacter thermocopriae strain (RIKEN, Tokyo, Japan) was used as a template, and the bases in Table 1 below including restriction enzyme sites (EcoRI, XhoI) were used as a template. Polymerase chain reaction (PCR) was performed using primer pairs with sequences.

As a result, the base encoding TP-DDase including 2463bp (SEQ ID NO: 2) of the C-terminus of the entire gene (cyclo-isomaltooligosaccharide glucanotransferase, TPCITase; 4680bp) (SEQ ID NO: 1) A PCR product of the sequence was obtained (Figure 1).

sequence number Sequence (5'-3') SEQ ID NO: 3 (forward direction) GGATCCCCGGAATTCATGATTTATGTAAAGCGTACGATAACCAC SEQ ID NO: 4 (reverse) ATGCGGCCGCTCGAGTTAAAAATCAGGTAATCGTAGATCAAACC

<1-2> Preparation of recombinant vectors and transformants

For cloning of glycosyltransferase, a recombinant vector (Tt-LIMO plasmid vector) was created using the PCR product obtained in large quantities through the polymerase chain reaction (PCR) as an expression vector, pET28a, using restriction enzymes NdeI and XhoI. .

The constructed recombinant vector was transformed into E. coli BL21(DE3) strain using a conventional transformation method. After analyzing the activity of the dextrin-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) of the produced transformants, the transformant showing the highest activity was isolated, and the introduced dextrin-derived isomaltooligosaccharide producing enzyme (Tt-LIMO) was analyzed. LIMO) was analyzed to obtain the amino acid sequence of SEQ ID NO: 5.

< Example 2> Dextrin origin High polymerization Isomaltooligosaccharide Manufacturing enzyme ( Tt - LIMO ) Manufacture and recovery of

The transformant into which the nucleotide sequence encoding the dextrin-derived isomaltooligosaccharide manufacturing enzyme (Tt-LIMO) prepared in <Example 1-2> was introduced was placed in 500 ml of LB (Difco) containing 50 μg/ml kanamycin. , Sparks, MD, USA), and colonies of transformants containing the base sequence encoding the dextrin-derived isomaltooligosaccharide producing enzyme were obtained and pre-cultured at 37°C. During culture, when the optical density (OD) of the culture medium reached 0.5 at 600 nm, 0.1mM IPTG (isopropyl-β-D-1-thiogalactopyranoside), a protein expression inducer, was added, and incubated at 150 rev for 21 hours at 18°C. The culture was performed while stirring at /min. The cultured cells were recovered by centrifugation at 10,000 rpm at 4°C for 10 minutes, suspended in 25 ml of lysis buffer, and disrupted using a sonicator. The cell lysate was centrifuged at 12,000 rpm for 30 minutes, and the obtained supernatant was loaded onto a DEAE-650M column and purified. 20mM sodium phosphate buffer (pH 7.4) was used as an adsorbent for protein, and purification was completed by taking the protein that was not adsorbed on the column. The purity of the final purified protein was confirmed by 10% Tris-Glycine SDS-PAGE Gel analysis. The results of the SDS-PAGE electrophoresis analysis are shown in Figure 3 (M, size marker; 1, soluble fraction of E. coli BL21 (DE3) containing pET28a(+) cultured overnight at 25°C. ; 2, soluble fraction of E. coli BL21 (DE3) containing pET28a(+) cultured overnight at 25°C after IPTG induction; 3, E. coli BL21 (DE3) containing pET28a-LIMO cultured overnight at 25°C ) Soluble fraction; 4, Soluble fraction of E. coli BL21 (DE3) containing pET28a(+) cultured overnight at 25°C after IPTG induction; 5, TtTG purified by His Trap HP column. A 10% (w) /v) Acrylamide gel was used and stained using Coomassie Brilliant Blue). As a result, it was confirmed that the dextrin-derived isomaltooligosaccharide manufacturing enzyme (Tt-LIMO) recombinant protein was successfully produced (Figure 3). Hereinafter, the enzyme is also referred to as LIMOzyme, meaning that it is an enzyme that produces highly polymerized (long) isomaltooligosaccharide (L-IMO).

< Example 3> Dextrin origin High polymerization Isomaltooligosaccharide Manufacturing enzyme ( Tt - LIMO ) to search for substrates for the production of highly polymerized isomaltooligosaccharides

Originally, as a raw material for producing isomaltooligosaccharides, maltose with a degree of polymerization (DP) of 2 was used as a substrate and reacted with transferase (TG), so that the glucose located at the non-reducing end of the glucose constituting maltose is converted to another maltose. It produces panose, isomaltose, and isomaltotriose, which are isomaltooligosaccharides composed of α-1,6 bonds. Meanwhile, the substrate specificity of the highly polymerized isomaltooligosaccharide producing enzyme (Tt-LIMO) prepared in Examples 1 and 2 was confirmed to be different from the existing one, and the degree of substrate consumption and product conversion material were analyzed using substrates of various degrees of polymerization. and the results are shown in Figure 4.

Figure 4 shows the reaction of maltose (M2) and maltotetraose (M4) over time, the reaction products with M2 (A) and M4 (B) by TG (commercial enzyme, solid line) and TtLIMO (dotted line). The relative composition of is shown graphically (in the left graph: ●, G1; ○, IG2; ▼, IG3; △, G2; ■, IG4; □, P; in the right graph: ●, G1; ○, IG2; ▼, G2 ; △, P; ■, G3; □, G4; ◆, O-GMT; ◇, G5; ▲, G6).

Specifically, Tt-LIMO purified in 80 mM BR buffer (pH 4.0) containing 1% (w/v) maltose (M2) and 1% (w/v) maltotetraose (M4) as each substrate solution. After incubation at 50°C for 3 hours, the product was sampled every 5 minutes, deactivated, and analyzed using HPAEC-PAD (ICS 5000 Dionex). As a result, as can be seen in Figure 4, the commercially available TG enzyme rapidly consumes maltose as a substrate and is converted into a hydrolysis and transglycosylation product, whereas the developed Tt-LIMO enzyme cannot use M2 as a substrate and uses M4 to produce various enzymes. It was confirmed that the sugar content was converted to a product. Through this, it was confirmed that Tt-LIMO effectively uses polysaccharides of M4 or higher instead of M2, which has a low degree of polymerization, and the product using maltodextrin was analyzed through the following experiment.

< Example 4> HPAEC -PAD (High Performance Anion Exchange Chromatography with pulsed amperometric Dextrin origin using detection) analysis Isomaltooligosaccharide Analysis of products by substrate using manufactured enzymes

<4-1> Various things degree of polymerization dextrin HPAEC analyze

To explore the optimal production conditions for LIMOzyme using dextrin as a substrate, dextrins with various degrees of polymerization were analyzed by HPAEC-PAD. Dextrins are divided into three levels according to the degree of polymerization, and dextrins with D.E (dextrose equivalent) of 3-7, 13-17, and 16.5-19.5, respectively, are designated D1, D2, and D3, and are dissolved in 0.1% (w/v) in tertiary distilled water. ) It was prepared as a solution, and in order to completely dissolve it, it was heated in a microwave oven (800W, Daewoo, Korea) for 30 seconds until the contents became transparent.

DIONEX ICS-5000+ SP (Thermo Fisher Scientific, USA) and DIONEX ICS-5000+ DC (Thermo Fisher Scientific) were used as analysis instruments, and HPAEC-PAD analysis was performed according to the analysis conditions in Table 2 below, and the results were is shown in Figure 5.

column (Column) CarboPacPA-200 eluent One ( eluent One) D.W. eluent 2 ( eluent 2) 500mM NaOH eluent 3 ( eluent 3) 1M Na-Acetate Gradient condition (Gradient) hour E1 E2 E3 0.00 78.0 22.0 00.0 20.00 80.0 18.0 02.0 30.00 65.0 20.0 15.0 70.00 00.0 30.0 70.0 80.00 78.0 22.0 00.0 Flow Rate 0.5㎖/min Detection Pulsed amperometry, gold electrode

As a result of the analysis, the degree of polymerization of the maltodextrin substrate was confirmed to be 30 for D1, 20 for D2, and 15 for D3. In order to explore the degree of polymerization of the optimal substrate for the highly polymerized isomaltooligosaccharide enzyme, the oligosaccharide composition of the product as a result of the reaction between substrates D1, D2, and D3 and LIMOzyme was confirmed as follows.

<4-2> Dextrin By degree of polymerization (D.E.) Product analysis

In order to determine the effect on the production of highly polymerized isomaltooligosaccharides according to the degree of polymerization (dextrose equivalent, D.E.) of dextrin according to the LIMOzyme enzyme reaction, D1, D2, and D3 prepared in <3-1> above were each added to 5% (w/ v) After mixing in 40 nM sodium acetate buffer (pH 4.5), mix with the reaction mixture so that the purified LIMOzyme protein concentration is 10% (v/v) (0.05 mg/mL) and react at 40°C overnight. After doing so, it was analyzed by HPAEC-PAD. The standard products STD1 and STD2 to confirm the product composition profile and its substances and the analysis results are shown in Table 3, Figures 6 and 7.

Abbreviation Compound Retention time(min) G1 D-(+)-Glucose 2.23 IG2 isomaltose 2.85 IG3 isosomal totriose 4.11 G2 maltose 5.30 IG4 isomaltotetraose 6.55 P Panose 9.96 IG5 isomaltopentaose 11.08 G3 maltotriose 13.30 IG6 isosomaltohexaose 14.08 IG7 isomaltopeptide 15.85 G4 maltotetraose 18.46 G5 maltopentaose 22.40 G6 maltohexaose 25.66 G7 maltoheptaose 28.28

As a result, as can be seen in Figures 6 and 7, it can be seen that the LIMOzyme reaction product using D3, which has a low degree of polymerization of dextrin, has excellent isomaltooligosaccharide production activity with a large DP value. In addition, the sugar constituent of the reaction product of the LIMOzyme and substrate mixture is alpha 1,6-linked, in which alpha 1,4-linked glucose transfers one molecule of glucose from the NRE (non reducing end) to the donor substrate by LIMOzyme. Since oligosaccharide is produced, it is presumed that sugars with mixed alpha 1,6 or 1,4 bonds remain. As can be confirmed by the STD1 chromatogram, it is a substance different from G4~G7 and is called Anomalously linked oligosaccharide (ALO). It can be assumed to be an oligosaccharide composed of DP8~10 of a specific linear type or containing an α-1,6 bond. The degree of polymerization of the reaction product was confirmed through MALDI-TOF molecular weight analysis.

<4-3> Dextrin By degree of polymerization (D.E.) Analysis of per composition of product

The constituent sugars of the product were analyzed for each degree of dextrin polymerization, and the results are shown in Figure 8. As can be seen in Figure 8, as a result of the reaction of D1 to D3 at a concentration of 5%, the peak content of highly polymerized isomaltooligosaccharide products was confirmed to be high in D2 and D3. In addition, each substrate and enzyme reaction product contains glucose and maltooligosaccharides (MOs) such as G2 to G7, which consist of glucose only with α-1,4 bonds and contain one or more α-1,6 bonds and have a low degree of polymerization. As a result of calculating the content ratio by dividing into (>=DP4) isomaltooligosaccharides (IMOs) and highly polymerized isomaltooligosaccharides (LIMOs, ALOs) that contain one or more α-1,6 bonds and have a high degree of polymerization (<DP5) , Compared to the D1 substrate reaction product, the glucose content of D2 and D3 was confirmed to be lower and the content of highly polymerized isomaltooligosaccharide to be higher. Through this, the Tt-LIMO enzyme uses D1 dextrin, which has a low glucose content and a high degree of polymerization, as a substrate. It was confirmed that highly polymerized isomaltooligosaccharides derived from dextrin can be efficiently produced using dextrin with a polymerization degree of DP ~15 and DP ~20, such as D2 and D3, as a substrate.

< Example 5> By concentration of dextrin substrate High polymerization Isomaltooligosaccharide Product analysis

In order to determine the effect of producing highly polymerized isomaltooligosaccharides according to the LIMOzyme enzyme reaction at different concentrations of dextrin, D1, D2, and D3 were completely dissolved at 2%, 10%, and 20%, respectively, and added as 50% of the reactants to reactants 1, 5, and 5. After mixing with 40 mM sodium acetate buffer (pH 4.5) at a concentration of 10 (w/v), mix with the reaction mixture so that the protein ratio of purified LIMOzyme is 10% (v/v) (0.05 mg/mL) and store at 40°C. The reaction was performed overnight and used for analysis. The results are shown in Table 4 below.

One% 5% 10% D1 D2 D3 D1 D2 D3 D1 D2 D3 Glucose (by-product) 40.03 25.76 22.86 34.76 22.65 20.74 27.49 16.28 15.2 MOs (residual substrates) 5.66 8.54 9.69 4.98 7.49 9.24 7.05 8.5 9.7 IMO 27.36 17.99 25.97 14.45 17.20 17.68 12.27 16.14 17.19 LIMO 23.9 34.17 35.69 31.12 40.32 37.34 33.61 45.13 44.33

Isomaltooligosaccharide produced as a result of 10% LIMOzyme reaction (15 hours) of the total reaction solution was confirmed at dextrin substrate concentrations of 1%, 5%, and 10%. It can be seen that even at a low concentration of substrate equivalent to 1%, the affinity (Km) between the enzyme and substrate is low, so the product is easily dissociated. It can be seen that the production activity of highly polymerized isomaltooligosaccharides is excellent even at a sufficient substrate concentration of 5% and 10%, and the glycotransferase activity of the LIMOzyme according to the present invention is excellent. In addition, unlike existing commercially available TG enzymes for producing isomaltooligosaccharides, it was confirmed that there were many IG4-7 products in addition to short isomaltooligosaccharides.

< Example 6> Depending on reaction time High polymerization Isomaltooligosaccharide Product analysis

To confirm the production pattern of highly polymerized isomaltooligosaccharide according to the reaction time of dextrin and LIMOzyme, D2 was mixed with 80 mM B-R buffer (pH 4.0) at a final concentration of 1% (w/v), and then purified LIMOzyme protein. was mixed at a 10% ratio with the reactant so that the concentration was 0.05 mg/mL and reacted overnight (o/n) at 40°C, and HPAEC-PAD analysis was performed every 0.5, 1, 3, 6, hours. .

The results are shown in Figure 9. As a result, it was confirmed that the production rate of highly polymerized isomaltooligosaccharide was highest when reacted for 0.5 to 1 hour.

< Example 7> Using high concentration substrate High polymerization Isomaltooligosaccharide Product analysis

To compare the production of highly polymerized isomaltooligosaccharide from a low concentration substrate of 1-10% and the highly polymerized isomaltooligosaccharide preparation prepared using a high concentration substrate, D2 was dissolved at 80%. In the case of high-concentration maltodextrin, water was added in small amounts and microwaved several times for short periods of time to prevent boiling over when heated. The sugar solution was evenly mixed using a vortexer and completely dissolved until a clear solution was formed. Afterwards, add it to the reaction solution in ratios of 1/8, 2/8, 3/8, and 4/8 to adjust the concentration to 10, 20, 30, and 40%, and purify LIMOzyme with 80 mM B-R buffer (pH 4.0) and purified LIMOzyme at a concentration of 0.05 mg/mL. After mixing, it was reacted at 40°C for 3 days and then inactivated by heating at 100°C for 5 minutes. The reaction was appropriately diluted more than 400 times and analyzed by HPAEC-PAD. The results of the reaction for 1 and 3 days are shown in Tables 5 and 6 below.

1 day reaction D2 Dextrin concentration (%) 10% 20% 30% 40% glucose
(by-product) 24.92 29.27 27.11 24.18 MOs (non-iso, residual substrate) 1.56 1.09 1.28 2.57 IMO+LIMO 62.25 66.32 62.75 59.94

3 day reaction D2 Dextrin concentration (%) 10% 20% 30% 40% glucose
(by-product) 38.57 27.66 24.79 22.01 MOs (non-iso, residual substrate) 0.70 0.89 0.84 1.02 IMO+LIMO 59.90 68.38 70.27 67.31

As a result, IMO+LIMO production was highest when 30% concentration of D2 was reacted for 3 days. On the other hand, at 10% concentration, the production of IMO+LIMO was actually reduced when reacted for 3 days compared to when reacted for 1 day, and at 20%, 30%, and 40% concentrations, when reacted for 3 days compared to when reacted for 1 day. In this case, IMO+LIMO production increased.

< Example 8> Dextrin substrate and Isomaltooligosaccharide Analysis of product constituents and α-1,4/α-1,6 binding ratio analysis

<8-1> Dextrin substrate and Isomaltooligosaccharide Analysis of per composition of product

In order to comparatively analyze the constituent sugars of the substrate (maltodextrin), commercially available isomaltooligosaccharide, and highly polymerized isomaltooligosaccharide according to the present invention, the constituent sugars were analyzed in the same manner as in Example 4-3. For sugar analysis, 30% dextrin D.E. was used as a substrate. Using 13-17, mix purified LIMOzyme, a manufacturing enzyme, at a concentration of 0.05 mg/mL under the reaction conditions of 80 mM B-R buffer (pH 4.0), 40°C, 3 days, and inactivate by heating at 100°C for 5 minutes after reaction. It was prepared, and the reaction product was diluted 400 times and analyzed. The results are shown in Figures 10 and 11.

As a result of the analysis of the constituent sugars of the substrate, monosaccharides (Glucose), disaccharides (Maltose), and maltooligosaccharides (MOs, α-1,4 linked) in the DP15 range were confirmed. Using maltose syrup as a substrate, commercially available isotopes prepared with commercial TG enzyme were identified. It was confirmed that the constituent sugars of maltooligosaccharide are about 50% of G1 and G2, as well as IG2 (isomaltose), IG3 (isomaltotriose), and P (panose), which are considered isomaltooligosaccharides. On the other hand, as a result of applying a new discovery enzyme using dextrin as a substrate, linear type isomlatooligosaccharides of DP5 or higher from IG2, IG3, to IG5 were confirmed in addition to about 20% of glucose, and Anomalously linked after RT (retension time) of 18 minutes. It was confirmed that oligosaccharides were produced. Unlike dextrins (MOs), this is an oligosaccharide with indigestible characteristics and is presumed to be a constituent saccharide with mixed α-1,4/α-1,6 bonds. To confirm the characteristics of this unknown substance, H-NMR was performed as follows to confirm the bond between glucose molecules.

<8-2> Analysis of α-1,4/α-1,6 binding ratio through H-NMR structural analysis

¹ α of the substrate (maltodextrin), isomaltooligosaccharide (IMO), highly polymerized isomaltooligosaccharide (LIMO), and highly polymerized isomaltooligosaccharide fractions using H-NMR analysis (DMX-500 spectrometer, Bruker, Karlsruhe, Germany). The relative fractions of -1,4 and α-1,6 bonds were measured. Freeze-dried enzyme-modified starch samples (20 mg/mL) were dissolved in D ₂ O and heated with stirring for 30 minutes. After the sample was freeze-dried again, the sample was dissolved in D ₂ O to a concentration of 20 mg/mL and ¹ H-NMR analysis was performed. ¹ H-NMR analysis results were collected at 75°C, and the binding percentage (%) was calculated by measuring the branching ratio of the sample. The results are shown in Figure 12 and Table 7 below.

Sample Glycosidic linkage ratio α-1,4 α-1,6 Maltodextrin (MD2) 1.00 0.0395 Isomaltooligosaccharide (IMO) 1.00 1.1363 30% highly polymerized isomaltooligosaccharide (LIMO) 1.00 3.7037

< Experiment example 1> High polymerization of isomaltooligosaccharide Analysis of efficacy in improving bowel movements

<1-1> Constipation model derivation and sample administration

As shown in Figure 13, administration began after the experimental animals were obtained and acclimatized. The control group was administered saline for 8 days, and the test group was administered IMO and L-IMO at a concentration of 240 mg/kg for 8 days. The constipation-inducing substance was loperamide hydrochloride at 5 mg/kg (in saline solution). Loperamide, which acts as an antidiarrheal drug, was selected as a constipation-inducing substance based on the fact that a common side effect is known to be constipation. On the 7th day of sample administration, feces were collected after inducing constipation, and an autopsy was performed after inducing constipation on the 8th day. After autopsy, colonic tissue was removed for intestinal length measurement and staining, and serum was separated.

<1-2> High polymerization Isomaltooligosaccharide To validate the defecation function of ingested mice feces count and feces measure my moisture content

Feces from experimental animals were collected 6 hours after administration of loperamide (5 mg/kg, body weight) on the 7th day of sample administration, and the weight and number of feces for each individual were measured. To check the amount of moisture in the feces, the weight was measured immediately after collection, and the weight was measured and compared after drying at 105°C for 48 hours. The results are shown in Figure 14.

As a result of comparing the number of feces and moisture content of the feces between normal experimental animals and mice in which constipation was induced by administering loperamide, the number of feces in the normal group increased to a significance level of ^† p < 0.0001 compared to the control group, and the IMO group also increased compared to the control group. It was confirmed that there was a significant increase ( ^* p<0.05, ^# p<0.005) compared to . The collected feces were measured before and after drying at 105°C for 48 hours, and the difference in weight was compared as the moisture content. As a result, the fecal moisture content of the normal group significantly increased ( ^† p<0.0001) compared to the control group, and the IMO group and The L-IMO group also showed an increase at ^* p<0.05 significance level compared to the control group, confirming that the highly polymerized isomaltooligosaccharide according to the present invention is very effective in improving bowel movements.

<1-3> High polymerization Isomaltooligosaccharide Check the digestive tract transit rate (IT, % )

To check the digestive tract transit rate, 5 mg/kg of loperamide was orally administered 1 hour after sample administration, and 0.5% phenol red (in 1.5% methylcellulose), an indicator, was orally administered 30 minutes after administration. After administration, an autopsy was performed 20 minutes later, the total intestinal length and the migration distance of phenol red were measured, and the digestive tract migration rate was calculated. The results are shown in Figure 15.

After administering phenol red to mice, the digestive tract travel distance was converted using the formula below.

[Equation 1]

(phenol red)/(total long length) = IT (%)

It was confirmed that the IT (%) of the normal mouse model not administered loperamide increased the distance traveled by phenol red compared to the constipation-induced mouse model, and the IT (%) value also increased to a significance level of ^† p < 0.0001. The IMO group showed a tendency to increase IT (%) compared to the control group, although not at a significant level, and the L-IMO group showed an increase in IT (%) at the *p<0.05 significance level. Through this, it can be seen that the highly polymerized isomaltooligosaccharide according to the present invention helps smooth intestinal motility. According to previous studies, improvement in digestive tract mobility is known to have an effect on improving constipation, and it has been reported that defecation time is prolonged and intestinal peristalsis is inhibited in animal models induced by loperamide. In the control group (14.7 ±1.3%), it was confirmed that loperamide reduced intestinal motility compared to the normal group, IMO group, and L-IMO group. On the other hand, the L-IMO group (26.7 ±3.5%) showed an increase at the p<0.05 significance level, showing an excellent effect in improving constipation by improving the digestive tract movement ability. Therefore, the highly polymerized isomaltooligosaccharide according to the present invention can be used as a material showing intestinal health improvement functionality and related efficacy characteristics.

Above, the present invention has been described in detail through preferred manufacturing examples, examples and experimental examples, but the scope of the present invention is not limited to the specific examples and should be interpreted in accordance with the appended claims. Additionally, those skilled in the art should understand that many modifications and variations are possible without departing from the scope of the present invention.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Method for preparing dextrin-derived highly polymerized isomaltooligosaccharide by using a novel sugar transferase and the dextrin-derived highly polymerized isomaltooligosaccharide with the effect of improving bowel movements by the method < 130> 2020P-09-022 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 4680 <212> DNA <213> Artificial Sequence <220> <223> TPCITase coding sequence <400> 1 atgttgtctc tttatagaag aaaactcttt ataacaattt taatagtaat tttcgtgttg 60 tctaactttt tcacattatt tacttatcct atctcaccag gagtttctgt tgcttatgcc 120 gcttcaacag gtaatttgat tcaacgggtt tatacagata aagctcgata taatccaggg 180 gatcttgtta ccattagtgc tgatttaatt aataaaactg gt tcgacatg gtccggcact 240 ttaactcttc agattaataa actagaaagc caaatttaca ctgcaagtca gtcagttact 300 cttgccaatg gggattcaac tacaatcaca tttacatgga ctgctccacc taccgacttt 360 gttggttatt atgccggaat tgcggcagga agtacagatt tcaatgg aac aggtatcgat 420 gtaagttcct ctccgcttcg gtttcctcgc tatggtttta tctcaaactt tcctgtttca 480 cagactgccc agcaatccac agatatagtt aaacagatgg tggaagacta tcatcttaat 540 atttttcaat tttacgactg gatgtggcgg catgagaagc taattaagcg aaccaatgga 600 gttatagatt ctacttgggt ggatcttttt gatcgcacac tttcttgg ca aactatacaa 660 aacaatgttg cagcagttca ttcctttaat gcttatgcca tggcttacgc tatgagttat 720 gcagctcgtg aaggatatga acaaatgtgg ggaatcagcc ctagctgggg tatctttcaa 780 gatacggcac atcaaagcca gtttaacgtg gattttcata at ggcaagtt tctgtggctt 840 tttaatccag caaatgtgaa ttggcagagt tggatcatta gtgaatacaa agatgctatc 900 aatacggcag gttttgatgg catacagatc gatcaaatgg ggcagcgaga caatgtttac 960 gattatacta gcttttccgt tactttgcct agtacattcg ctcagtttct tcaacaagtt 1020 aagtcagaat tagaatctaa taatgcaaaa aaaaatgttg ttactt ttaa tattgttgat 1080 ggtacagtga acggttgggg ggcgggagaa attgctcgtt atggtgccag cgactttgac 1140 ttcagcgaga tttggtggaa agctaacaca tataatgatc tccgaaatta catcgaatgg 1200 ctcaggcaaa acaatggtgg caagcctgtt gt acttgcag cttatatgaa ttacaacgag 1260 gaatacggtc caatatatga agctgaatcc gctattctat caggcgttag tgtcaataca 1320 aacattctg gttatacggg cactggcttt gtcgatgggt ttgaaacggt gggtgattct 1380 atcacgtgga caattgactt ccctgagact ggtgattatt cgtttgtttt tcgttatgca 1440 aatgccactg gtgctactgc tactcgtaat gtttatgtag atggacgatt tct gggacaa 1500 gtctcatttg ctaatcaggt ggattgggat acttgggcga cggacgcgtg gattcaaata 1560 gagggactta ctgctggtac tcatagtgtg acattaaagt atgacagtga caatataggc 1620 gctataaacg tcgatcattt aactcttgga gagtttgagg aacattcagt tcgattggca 1680 gatgcaatga tgtttgctag cggtgctaca cacattgagc ttggtgatac taatcagatg 1740 ttagcgcatg aatattatcc gaaccgttcc aagtcaatgc gtaattctct caaggcagcg 1800 atgagagact actatagttt tgctactgct tatgaaaatt tactctttga tcctgatata 1860 gttccagctg accaaggcaa ccaatggatt gcactgacaa ccggacaacc tttaagcggc 1920 aacggaact t ctggtactat ttggcaaatg attaaacgca agtctgatta tgatatcata 1980 catttgatta atctaatggg caatgatgat cagtggcgta acccagctgt tcagcctact 2040 ttccaaagca acattggagt taaatactat ccaggacta atgccgctgt cagtggcgta 2100 tatct tgcca gtccggatct cgatcacggt atgaccattc cactcactta tacgacgggt 2160 aatgatagcc gaggtaacta tatccagttt gttgtgccaa gcttaaagta ctggggatatg 2220 atttatgtaa agcgtacgat aaccacaccg ccagatggac agtatgaagc agaatatgct 2280 attaaaagtg gcactaacat caataccgat catacaggat atactggcag cggttttgta 2340 gacaactttg atgctagtga taaaggtgta tcgtttatta taaatgttcc aactagtgat 2400 acctacacgc ttcgattccg atatggaaac ggcggtacta ctattgccac gcgaacttta 2460 tttatgatg gtcagtatgc aggtactctc caattccgaa atctttataa ctgggatgtg 2520 t gggatacag tggaaaccac tgtgtggctt tcagcgggtg ttcatcaagt ggtactttgg 2580 tacagttccg aaaatgatgg tgctattaat cttgataacc tgattgttct acaacaaact 2640 actccaacaa gaacttcggc tcgctccttt tggatgaata actggtccaa cttgataggt 2700 attcacatgg ctagcaaatt aagcccgact gataatggaa attatggccc tcgcctggct 2760 gaacttcatt tcagaggcga ttggcct act aatcaaatcg tagatgcaac tgcttttttc 2820 cgagatgaaa cggatcttac tcccataaag tataccaatg ctcatagctt tgattctgaa 2880 gcatggtttg aaaacgacgg gactcttacc gtgagatatc tgacctataa tggctcagcc 2940 ttgccagtac agattaccaa acaat acgcc atggtgccta accaaaattt tcttgtgatc 3000 aaatatactt ttttaaacca gacaagtagc gcacgtactt taaactttct agaacaagtt 3060 catttgaaca acaggactag tagcgatccg aatccagggt ggcaacatgg ctggtgggac 3120 gtgagtcgaa atgcacttgg tactgacatg agccagactg gtcagttcta tattgaattg 3180 ggtgcttttc agactatgga tagttatcag gtgggtaatg acgccgattc caatcctaac 3240 agtcagacgt catcaccgtg gtatcagttc gacgccaacg gtgttctaaa taggtgcggt 3300 gatctttggt cacagaatct tagcatgggt tttcagaaac ttattaccgt gcctgctgga 3360 ggtagtgtaa cat tggcttt ttattatgct atcggttcaa ctcaggagga agcggaagca 3420 gcagcagatt tagctcgatc tcagacagct gactactggt ttacccaaac tgctgccgag 3480 tataataatt ggcttaacag cggccagcgg gttaatacgt ctgatattgg tatcaatact 3540 gcctttgatc ggagcctcat cataaacaaa caggcacaac atccggagtt tggttcctgg 3600 cccgcggcta caaatccctc ttatcagtac aaggtgtggg tt cgtgactc agctgtaaca 3660 gctatgggaa tggatgctgc taatcatctt tctgaggcgg aaaagtattg gaactggatg 3720 gcctctgttc aaaatacaga tgggacatgg catacaaatt ataatgtatg gaaggcaaat 3780 gaatggatct cgtttgtgga gcctgaacac gat gccattg gactttttct catcggggtt 3840 tatcaacatt acagtttact caaatcccgc gattcctcgg cagcgacgac ttttctgaat 3900 aacatttgga cgcagataac ccgcgctggt gatttcatct acaaaaacat tggcgcttct 3960 gggtttggtc cggctgatgc ttctatctgg gaggagcagg tcgagtataa tatttttact 4020 caagttactt atgccgcagg attgaatgct ggacggttgt tagcccaaga aaaa ggtgat 4080 attactcgtt caaataacta tttgtcgggt gctcaaacca tcaaggatgc gattctacga 4140 tcgtttttgt cttcaccacg aggtctctgg aataaatcta atcgctattt taatcgggcg 4200 atcaatacag acggtacagc gcgaacgacg gttgat gctt catcggactt gatttgggtt 4260 tttggtctcc tttcaccgac tgatactagg attcgagatc accgcattaa ggtactatca 4320 cggctgaccc atgataggta cggcattgct cgatatgaaa acgatgagtt ctattattct 4380 agtccatata gccccggtgg acagtatgag gctggcgcag ccgaaccagt ttggccacaa 4440 atgactatgt acgcgtctat gattgagcat tggaggggtg atgatgccac tgcactggct 4500 cggcttaagt ggtatgtcag ccgaactgct cgcggctatg tcacaccgg tgaagctgtg 4560 gactggacca atggtcaacc gcttatcagt acagcagttg aaccagtaac gggctcctgg 4620 tttcagatgg cggtccttac ttacttaaac cggtttgatc tacgattacc tgatttttaa 4680 4680 <210> 2 <211> 2463 <212> DNA <213> Artificial Sequence <220> <223> DDase coding sequence <400> 2 atgatttatg taaagcgtac gataaccaca ccgccagatg gacagtatga agcagaatat 60 gctattaaaa gtggcactaa catcaatacc gatcatacag gatatactgg cagcggtttt 120 gt agacaact ttgatgctag tgataaaggt gtatcgttta ttataaatgt tccaactagt 180 gatacctaca cgcttcgatt ccgatatgga aacggcggta ctactattgc cacgcgaact 240 ttatttattg atggtcagta tgcaggtact ctccaattcc gaaatcttta taactgggat 300 gtgtgggata cagtggaaac cactgtgtgg ctttcagcgg gtgttcatca agtggtactt 360 tggtacagtt ccgaaaatga tggtgctatt aatcttgata acctgattgt t ctacaacaa 420 actactccaa caagaacttc ggctcgctcc ttttggatga ataactggtc caacttgata 480 ggtattcaca tggctagcaa attaagcccg actgataatg gaaattatgg ccctcgcctg 540 gctgaacttc atttcagagg cgattggcct actaatcaaa tcgtagatgc aactgctt tt 600 ttccgagatg aaacggatct tactcccata aagtatacca atgctcatag ctttgattct 660 gaagcatggt ttgaaaacga cgggactctt accgtgagat atctgaccta taatggctca 720 gccttgccag tacagattac caaacaatac gccatggtgc ctaaccaaaa ttttcttgtg 780 atcaaatata cttttttaaa ccagacaagt agcgcacgta ctttaaactt tctagaacaa 840 gttcatttga acaacaggac tagtagcgat ccgaatccag ggtggcaaca tggctggtgg 900 gacgtgagtc gaaatgcact tggtactgac atgagccaga ctggtcagtt ctatattgaa 960 ttgggtgctt ttcagactat ggatagttat caggtgggta atgacgccga ttccaatcct 1020 aacagtcaga cgtcatcacc gtggtatcag ttcgacgcca acggtgttct aaataggtgc 1080 ggtgatcttt ggtcacagaa tcttagcatg ggttttcaga aacttattac cgtgcctgct 1140 ggaggtagtg taacattggc tttttattat gctatcggtt caactcagga ggaagcggaa 1200 gcagcagcag atttagctcg atctcagaca gctgactact ggtttaccca aactgctgcc 1260 gagtataata attggcttaa cagcggccag cgggttaata cgtctgatat tggtatcaat 1320 actgcctttg atcggagcct catcataaac aaacaggcac aacatccgga gtttggttcc 1380 tggcccgcgg ctacaaatcc ctcttatcag tacaaggtgt gggttcgtga ctcagctgta 144 0 acagctatgg gaatggatgc tgctaatcat ctttctgagg cggaaaagta ttggaactgg 1500 atggcctctg ttcaaaatac agatgggaca tggcatacaa attataatgt atggaaggca 1560 aatgaatgga tctcgtttgt ggagcctgaa cacgatgcca ttggactttt tctcatcggg 1620 gtttatcaac attacagttt actcaaatcc cgcgattcct cggcagcgac gacttttctg 1680 aataacatt t ggacgcagat aacccgcgct ggtgatttca tctacaaaaa cattggcgct 1740 tctgggtttg gtccggctga tgcttctatc tgggaggagc aggtcgagta taatattttt 1800 actcaagtta cttatgccgc aggattgaat gctggacggt tgttagccca agaaaaaggt 1860 gatattactc gttcaaataa ctatttgtcg ggtgctcaaa ccatcaagga tgcgattcta 1920 cgatcgtttt tgtcttcacc acgaggtctc tggaataaat ctaatcgcta ttttaatcgg 1980 gcgatcaata cagacggtac agcgcgaacg acggttgatg cttcatcgga cttgatttgg 2040 gtttttggtc tcctttcacc gactgatact aggattcgag atcaccgcat taaggtacta 2100 tcacggctga cc catgatag gtacggcatt gctcgatatg aaaacgatga gttctattat 2160 tctagtccat atagccccgg tggacagtat gaggctggcg cagccgaacc agtttggcca 2220 caaatgacta tgtacgcgtc tatgattgag cattggaggg gtgatgatgc cactgcactg 2280 gctc ggctta agtggtatgt cagccgaact gctcgcggct atgtcacacc cggtgaagct 2340 gtggactgga ccaatggtca accgcttatc agtacagcag ttgaaccagt aacgggctcc 2400 tggtttcaga tggcggtcct tacttactta aaccggtttg atctacgatt acctgatttt 2460 taa 2463 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer1 forward <400> 3 gg atccccgg aattcatgat ttatgtaaag cgtacgataa ccac 44 <210> 4 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer2 reverse <400> 4 atgcggccgc tcgagttaaa aatcaggtaa tcgtagatca aacc 44 <210> 5 <211> 821 <212> PRT <213> Artificial Sequence < 220> <223> TP-DDase <400> 5 Asp Met Ile Tyr Val Lys Arg Thr Ile Thr Thr Pro Pro Asp Gly Gln 1 5 10 15 Tyr Glu Ala Glu Tyr Ala Ile Lys Ser Gly Thr Asn Ile Asn Thr Asp 20 25 30 His Thr Gly Tyr Thr Gly Ser Gly Phe Val Asp Asn Phe Asp Ala Ser 35 40 45 Asp Lys Gly Val Ser Phe Ile Ile Asn Val Pro Thr Ser Asp Thr Tyr 50 55 60 Thr Leu Arg Phe Arg Tyr Gly Asn Gly Gly Thr Thr Ile Ala Thr Arg 65 70 75 80 Thr Leu Phe Ile Asp Gly Gln Tyr Ala Gly Thr Leu Gln Phe Arg Asn 85 90 95 Leu Tyr Asn Trp Asp Val Trp Asp Thr Val Glu Thr Thr Val Trp Leu 100 105 110 Ser Ala Gly Val His Gln Val Val Leu Trp Tyr Ser Ser Glu Asn Asp 115 120 125 Gly Ala Ile Asn Leu Asp Asn Leu Ile Val Leu Gln Gln Thr Thr Pro 130 135 140 Thr Arg Thr Ser Ala Arg Ser Phe Trp Met Asn Asn Trp Ser Asn Leu 145 150 155 160 Ile Gly Ile His Met Ala Ser Lys Leu Ser Pro Thr Asp Asn Gly Asn 165 170 175 Tyr Gly Pro Arg Leu Ala Glu Leu His Phe Arg Gly Asp Trp Pro Thr 180 185 190 Asn Gln Ile Val Asp Ala Thr Ala Phe Phe Arg Asp Glu Thr Asp Leu 195 200 205 Thr Pro Ile Lys Tyr Thr Asn Ala His Ser Phe Asp Ser Glu Ala Trp 210 215 220 Phe Glu Asn Asp Gly Thr Leu Thr Val Arg Tyr Leu Thr Tyr Asn Gly 225 230 235 240 Ser Ala Leu Pro Val Gln Ile Thr Lys Gln Tyr Ala Met Val Pro Asn 245 250 255 Gln Asn Phe Leu Val Ile Lys Tyr Thr Phe Leu Asn Gln Thr Ser Ser 260 265 270 Ala Arg Thr Leu Asn Phe Leu Glu Gln Val His Leu Asn Asn Arg Thr 275 280 285 Ser Ser Asp Pro Asn Pro Gly Trp Gln His Gly Trp Trp Asp Val Ser 290 295 300 Arg Asn Ala Leu Gly Thr Asp Met Ser Gln Thr Gly Gln Phe Tyr Ile 305 310 315 320 Glu Leu Gly Ala Phe Gln Thr Met Asp Ser Tyr Gln Val Gly Asn Asp 325 330 335 Ala Asp Ser Asn Pro Asn Ser Gln Thr Ser Ser Pro Trp Tyr Gln Phe 340 345 350 Asp Ala Asn Gly Val Leu Asn Arg Cys Gly Asp Leu Trp Ser Gln Asn 355 360 365 Leu Ser Met Gly Phe Gln Lys Leu Ile Thr Val Pro Ala Gly Gly Ser 370 375 380 Val Thr Leu Ala Phe Tyr Tyr Ala Ile Gly Ser Thr Gln Glu Glu Ala 385 390 395 400 Glu Ala Ala Ala Asp Leu Ala Arg Ser Gln Thr Ala Asp Tyr Trp Phe 405 410 415 Thr Gln Thr Ala Ala Glu Tyr Asn Asn Trp Leu Asn Ser Gly Gln Arg 420 425 430 Val Asn Thr Ser Asp Ile Gly Ile Asn Thr Ala Phe Asp Arg Ser Leu 435 440 445 Ile Asn Lys Gln Ala Gln His Pro Glu Phe Gly Ser Trp Pro Ala 450 455 460 Ala Thr Asn Pro Ser Tyr Gln Tyr Lys Val Trp Val Arg Asp Ser Ala 465 470 475 480 Val Thr Ala Met Gly Met Asp Ala Ala Asn His Leu Ser Glu Ala Glu 485 490 495 Lys Tyr Trp Asn Trp Met Ala Ser Val Gln Asn Thr Asp Gly Thr Trp 500 505 510 His Thr Asn Tyr Asn Val Trp Lys Ala Asn Glu Trp Ile Ser Phe Val 515 520 525 Glu Pro Glu His Asp Ala Ile Gly Leu Phe Leu Ile Gly Val Tyr Gln 530 535 540 His Tyr Ser Leu Leu Lys Ser Arg Asp Ser Ser Ala Ala Thr Thr Phe 545 550 555 560 Leu Asn Asn Ile Trp Thr Gln Ile Thr Arg Ala Gly Asp Phe Ile Tyr 565 570 575 Lys Asn Ile Gly Ala Ser Gly Phe Gly Pro Ala Asp Ala Ser Ile Trp 580 585 590 Glu Glu Gln Val Glu Tyr Asn Ile Phe Thr Gln Val Thr Tyr Ala Ala 595 600 605 Gly Leu Asn Ala Gly Arg Leu Leu Ala Gln Glu Lys Gly Asp Ile Thr 610 615 620 Arg Ser Asn Asn Tyr Leu Ser Gly Ala Gln Thr Ile Lys Asp Ala Ile 625 630 635 640 Leu Arg Ser Phe Leu Ser Ser Pro Arg Gly Leu Trp Asn Lys Ser Asn 645 650 655 Arg Tyr Phe Asn Arg Ala Ile Asn Thr Asp Gly Thr Ala Arg Thr Thr 660 665 670 Val Asp Ala Ser Ser Asp Leu Ile Trp Val Phe Gly Leu Leu Ser Pro 675 680 685 Thr Asp Thr Arg Ile Arg Asp His Arg Ile Lys Val Leu Ser Arg Leu 690 695 700 Thr His Asp Arg Tyr Gly Ile Ala Arg Tyr Glu Asn Asp Glu Phe Tyr 705 710 715 720 Tyr Ser Ser Pro Tyr Ser Pro Gly Gly Gln Tyr Glu Ala Gly Ala Ala 725 730 735 Glu Pro Val Trp Pro Gln Met Thr Met Tyr Ala Ser Met Ile Glu His 740 745 750 Trp Arg Gly Asp Asp Ala Thr Ala Leu Ala Arg Leu Lys Trp Tyr Val 755 760 765 Ser Arg Thr Ala Arg Gly Tyr Val Thr Pro Gly Glu Ala Val Asp Trp 770 775 780 Thr Asn Gly Gln Pro Leu Ile Ser Thr Ala Val Glu Pro Val Thr Gly 785 790 795 800 Ser Trp Phe Gln Met Ala Val Leu Thr Tyr Leu Asn Arg Phe Asp Leu 805 810 815 Arg Leu Pro Asp Phe 820

Claims (21)

1) Preparing a culture of a transformant transformed with a recombinant vector containing a glycosyltransferase gene consisting of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5;
2) Obtaining glycosyltransferase from the culture; and
3) adding the glycosyltransferase to dextrin and reacting it,
The dextrin is a single substance or a mixture of glucose bound in an α-1,4 form with a degree of polymerization (DP) of 3 to 25,
A method for producing highly polymerized isomaltooligosaccharide (LIMO), which contains a component consisting of only α-1,6 bonds among the sugar components and has a degree of polymerization of 7 to 13 derived from dextrin, which has an effect of improving bowel movements. According to paragraph 1,
A method for producing a highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, characterized in that the glycosyltransferase is derived from the Thermoanaerobacter thermocopriae strain. According to paragraph 1,
The glycosyltransferase includes SEQ ID NO: 2, which encodes the amino acid C-terminal sequence in the entire base sequence SEQ ID NO: 1, which encodes the amino acid sequence of cycloisomaltooligosaccharide glucanotransferase (TPCITase), and uses dextrin as a substrate. A method for producing a highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin, which has a bowel movement improvement effect, characterized in that a glycosyltransfer product is produced by: delete According to paragraph 1,
The recombinant vector in step 1) is a highly polymerized isomaltooligosaccharide with a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, characterized in that it is a vector selected from the group consisting of pET28a, pET, pGEX, pQE, pDEST and pCOLD. Manufacturing method. According to paragraph 1,
The transformant in step 1) is one selected from the group consisting of BL21 (DE3), Rosetta (DE3), Rosetta2 (DE3), ArcticExpress (DE3), STAR (DE3), C41 (DE3) and C43 (DE3). A method for producing a highly polymerized isomaltooligosaccharide with a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, characterized in that it is transformed into E. coli. According to paragraph 1,
A method for producing highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with an effect of improving bowel movements, wherein the dextrin is maltodextrin.
delete delete According to paragraph 1,
A method for producing a highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, characterized in that the concentration of the dextrin is 0.5 to 60% (w/v). According to paragraph 1,
The method for producing highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, characterized in that the reaction time is 0.2 to 80 hours.
delete According to paragraph 1,
The highly polymerized isomaltooligosaccharide is a highly polymerized iso-oligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin, which has an effect of improving bowel movements, characterized in that the ratio of α-1,6 bonds to α-1,4 bonds is 2:1 to 5:1. Method for producing maltooligosaccharide. According to paragraph 1,
A method for producing highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, wherein the highly polymerized isomaltooligosaccharide has a glucose content of 20 to 25%.
A highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with an effect of improving bowel movements prepared by the production method of claim 1.
According to clause 15,
The highly polymerized isomaltooligosaccharide is a dextrin-derived highly polymerized isomaltooligosaccharide with a degree of polymerization of 7 to 13 that has a bowel movement improvement effect, characterized in that it contains a component consisting of only α-1,6 bonds among the constituent sugar components.
According to clause 15,
The highly polymerized isomaltooligosaccharide is a highly polymerized iso-oligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin, which has an effect of improving bowel movements, characterized in that the ratio of α-1,6 bonds to α-1,4 bonds is 2:1 to 5:1. Maltooligosaccharide.
According to clause 15,
The highly polymerized isomaltooligosaccharide is a highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with a bowel movement improvement effect, characterized in that the glucose content is 20 to 25%.
A composition for improving bowel movements comprising, as an active ingredient, highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin, which has the effect of improving bowel movements according to claim 15.
A food composition for improving bowel movements comprising, as an active ingredient, highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin, which has the effect of improving bowel movements according to claim 15. In paragraph 1,
A method for producing highly polymerized isomaltooligosaccharide having a degree of polymerization of 7 to 13 derived from dextrin with an effect of improving bowel movements, wherein the highly polymerized isomaltooligosaccharide is 33 to 46% by weight of the weight of the sugar component.