KR102595580B1 - Single stranded DNA probe based RNA detection method - Google Patents

Single stranded DNA probe based RNA detection method Download PDF

Info

Publication number
KR102595580B1
KR102595580B1 KR1020200002259A KR20200002259A KR102595580B1 KR 102595580 B1 KR102595580 B1 KR 102595580B1 KR 1020200002259 A KR1020200002259 A KR 1020200002259A KR 20200002259 A KR20200002259 A KR 20200002259A KR 102595580 B1 KR102595580 B1 KR 102595580B1
Authority
KR
South Korea
Prior art keywords
rna
stranded dna
dna
present
virus
Prior art date
Application number
KR1020200002259A
Other languages
Korean (ko)
Other versions
KR20210089302A (en
Inventor
조규봉
임광일
김시원
장윤하
Original Assignee
서강대학교 산학협력단
숙명여자대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서강대학교 산학협력단, 숙명여자대학교산학협력단 filed Critical 서강대학교 산학협력단
Priority to KR1020200002259A priority Critical patent/KR102595580B1/en
Priority to PCT/KR2021/000103 priority patent/WO2021141369A1/en
Publication of KR20210089302A publication Critical patent/KR20210089302A/en
Application granted granted Critical
Publication of KR102595580B1 publication Critical patent/KR102595580B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00—Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50—Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027—Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01L—CHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00—Additional constructional details
    • B01L2300/08—Geometry, shape and general structure
    • B01L2300/0861—Configuration of multiple channels and/or chambers in a single devices
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/185—Nucleic acid dedicated to use as a hidden marker/bar code, e.g. inclusion of nucleic acids to mark art objects or animals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60—Detection means characterised by use of a special device
    • C12Q2565/629—Detection means characterised by use of a special device being a microfluidic device

Abstract

본 발명은 단일 DNA 분자 시각화 방법을 이용한 바이러스 및 세포 RNA 검출방법에 관한 것이다. 본 발명의 방법은 검출 대상 바이러스 또는 세포 RNA 단편이 혼성화된 표지 dsDNA를 시각화함으로써, 단시간 내에 단일 DNA 분자 수준에서 바이러스 및 세포 RNA의 검출이 가능한 장점이 있다.The present invention relates to a method for detecting viral and cellular RNA using a single DNA molecule visualization method. The method of the present invention has the advantage of enabling detection of viral and cellular RNA at the level of a single DNA molecule within a short period of time by visualizing labeled dsDNA hybridized with the viral or cellular RNA fragment to be detected.

Description

단일 가닥 DNA 탐침 기반 RNA 검출 방법 {Single stranded DNA probe based RNA detection method}Single stranded DNA probe based RNA detection method {Single stranded DNA probe based RNA detection method}

본 발명은 단일 DNA 분자 시각화 방법을 이용한 RNA 검출방법에 관한 것이다.The present invention relates to a method for detecting RNA using a single DNA molecule visualization method.

바이러스는 세균보다 크기가 작은 전염성 병원체로, 유전물질인 DNA 또는 RNA와 그 유전물질을 둘러싸고 있는 단백질로 구성된다. 바이러스는 숙주의 종류에 따라서 식물 바이러스, 동물 바이러스 및 세균 바이러스 (파지)로 구분할 수 있는데, 대부분의 경우 핵산의 종류에 따라 DNA 바이러스 아문과 RNA 바이러스 아문으로 나뉘며, 이들은 다시 강, 목, 과로 세분화된다.Viruses are infectious pathogens that are smaller than bacteria and are composed of genetic material, DNA or RNA, and proteins surrounding the genetic material. Viruses can be classified into plant viruses, animal viruses, and bacterial viruses (phages) depending on the type of host. In most cases, they are divided into DNA virus subphylum and RNA virus subphylum depending on the type of nucleic acid, and these are further subdivided into classes, orders, and families. .

최근 빈번하게 나타나고 있는 바이러스 감염은 전 세계적으로 중대한 사회적경제적 위기를 가져왔다. 예를 들어, 인플루엔자바이러스 (H1N1), 호흡기증후군 코로나바이러스 (SARS-CoV) 등 많은 경우, 바이러스가 전염성 질환을 유발하였다.Viral infections, which have been appearing frequently recently, have caused a major social and economic crisis around the world. For example, in many cases, viruses such as influenza virus (H1N1) and respiratory syndrome coronavirus (SARS-CoV) have caused infectious diseases.

특히, 2015년 우리나라를 덮쳤던 메르스 바이러스 (MERS-CoV)는 많은 희생자와 함께 사회적인 공포 및 막대한 사회경제적 손실을 야기하였으며, 2016년 지카 바이러스는 임산부들에게 공포의 대상이 되었다. 2019년에도 일본에서 200만명 이상의 독감 환자가 발생하여 수십 명의 사망자가 발생함으로써 많은 사회적 문제를 일으키고 있다.In particular, the MERS-CoV, which attacked Korea in 2015, caused social fear and enormous socioeconomic losses along with many victims, and the Zika virus in 2016 became an object of fear for pregnant women. In 2019, more than 2 million influenza cases occurred in Japan, resulting in dozens of deaths, causing many social problems.

바이러스 감염은 많은 경우 효과적인 치료제가 개발되지 못했고, 인플루엔자 바이러스 감염에 대한 대표적 치료제인 타미플루 (Tamiflu)의 경우 예상하지 못했던 심각한 부작용이 보고되고 있다. 바이러스 백신개발 또한 일반적으로 어렵고 가능하더라도 많은 시간이 걸린다. In many cases, effective treatments have not been developed for viral infections, and in the case of Tamiflu, a representative treatment for influenza virus infections, unexpected and serious side effects have been reported. Developing a virus vaccine is also generally difficult and takes a lot of time, even if possible.

따라서 심각한 질환을 유발하는 바이러스 감염이 발생하였을 때 감염 빈도와 확산 속도를 늦추기 위해 바이러스 검출과 감염 조기 진단 및 감염 환자의 격리는 필수적이다. 특히, 호흡기 감염의 경우 현장에서 신속하게 원인 바이러스 유무를 판별하여 환자를 격리, 치료하는 것이 가능하다면 감염의 확신을 방지할 수 있다. Therefore, when a viral infection that causes serious disease occurs, virus detection, early diagnosis of infection, and isolation of infected patients are essential to slow the frequency and spread of infection. In particular, in the case of respiratory infections, if it is possible to quickly determine the presence of the causative virus on site and isolate and treat the patient, confirmation of infection can be prevented.

바이러스 검출 방법으로는 효소 결합 면역 흡수 검정법 (ELISA), 효소 면역 검정법 (EIA) 및 면역 형광 검정법 (IFA) 등의 면역학적 검출방법과 RT-PCR에 의한 바이러스 핵산 (DNA, RNA) 검출방법 등이 사용되고 있으나, 이러한 방법은 바이러스 검출에 과도한 시간이 소요되거나, 고가의 거대 장비가 필요하거나, 불만족스러운 특이도 및 민감도 등의 문제가 있다.Virus detection methods include immunological detection methods such as enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunosorbent assay (EIA), and immunofluorescence assay (IFA), and viral nucleic acid (DNA, RNA) detection methods by RT-PCR. However, these methods have problems such as taking excessive time to detect viruses, requiring large and expensive equipment, and unsatisfactory specificity and sensitivity.

한편, 단일 DNA 분자의 시각화는 유전체 지도에서 유전체 구조의 분석이나 생화학 분석에 활용될 수 있다. 1 kb보다 작은 DNA는 일반적으로 중합효소연쇄반응 (PCR)에 의해 DNA를 증폭한 다음 전기영동을 이용하여 분석이 가능하다. 그러나, 이러한 PCR을 이용한 분석 방법은 온도가 제어되는 증폭 사이클이 필요하기 때문에 많은 시간이 소요된다는 점 및 젤 전기영동을 통한 결과 확인은 소비되는 시간이 크다는 점 등의 문제가 있다.Meanwhile, visualization of a single DNA molecule can be used for analysis of genome structure or biochemical analysis on a genome map. DNA smaller than 1 kb can generally be amplified by polymerase chain reaction (PCR) and then analyzed using electrophoresis. However, this analysis method using PCR has problems such as the fact that it requires a temperature-controlled amplification cycle, so it takes a lot of time, and confirming the results through gel electrophoresis takes a lot of time.

따라서, 저비용으로 단시간 내에 효율적으로 바이러스를 검출하는 새로운 방법의 개발이 필요한 실정이다.Therefore, there is a need to develop a new method to efficiently detect viruses at low cost and within a short period of time.

본 발명자들은 단일 분자 수준에서 RNA를 조기에 검출할 수 있는 방법을 개발하고자 노력하였다. 그 결과, 검출 대상 RNA가 혼성화된 표지 dsDNA를 제조하였으며, 이를 일 측에 경사면을 갖는 채널을 포함하는 마이크로채널을 이용하여 시각화 하는 경우, 단시간 내에 단일 DNA 분자 수준에서 RNA를 검출할 수 있음을 규명하여, 본 발명을 완성하게 되었다.The present inventors tried to develop a method for early detection of RNA at the single molecule level. As a result, labeled dsDNA hybridized with the detection target RNA was produced, and when visualized using a microchannel containing a channel with an inclined surface on one side, it was found that RNA could be detected at the level of a single DNA molecule within a short period of time. Thus, the present invention was completed.

따라서, 본 발명의 목적은 표지 (marker) DNA를 포함하는 RNA 검출용 조성물의 제조방법을 제공하는 것이다.Therefore, the purpose of the present invention is to provide a method for producing a composition for detecting RNA containing marker DNA.

본 발명의 다른 목적은 표지 DNA를 포함하는 RNA 검출용 조성물의 제조방법에 의해 제조된 바이러스 검출용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for detecting viruses prepared by a method for producing a composition for detecting RNA containing labeled DNA.

본 발명의 또 다른 목적은 표지 DNA를 포함하는 RNA 검출용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for detecting RNA containing labeled DNA.

본 발명의 또 다른 목적은 표지 DNA를 포함하는 RNA 검출용 조성물을 마이크로채널 (microchannel)에 주입하는 단계를 포함하는 RNA 검출방법을 제공하는 것이다.Another object of the present invention is to provide a method for detecting RNA, which includes the step of injecting a composition for detecting RNA containing labeled DNA into a microchannel.

본 발명자들은 단일 분자 수준에서 RNA를 조기에 검출하기 위해, 검출 대상 RNA가 혼성화된 표지 dsDNA를 제조하였으며, 이를 한쪽에 경사면을 갖는 채널을 포함하는 마이크로채널을 이용하여 시각화 하는 경우, 단시간 내에 단일 DNA 분자 수준에서 RNA를 검출할 수 있음을 확인하였다.In order to detect RNA early at the single molecule level, the present inventors prepared labeled dsDNA to which the RNA to be detected was hybridized, and when this was visualized using a microchannel containing a channel with an inclined surface on one side, a single DNA DNA was produced within a short period of time. It was confirmed that RNA could be detected at the molecular level.

본 발명은 표지 (marker) DNA를 포함하는 RNA 검출용 조성물의 제조방법, 이에 의해 제조된 RNA 검출용 조성물, 이를 포함하는 RNA 검출용 키트 및 이를 이용한 RNA 검출방법에 관한 것이다.The present invention relates to a method for producing a composition for detecting RNA containing marker DNA, a composition for detecting RNA prepared thereby, a kit for detecting RNA containing the same, and a method for detecting RNA using the same.

이하, 본 발명을 더욱 자세히 설명하고자 한다.Hereinafter, the present invention will be described in more detail.

본 발명의 일 양태는 하기의 단계를 포함하는 표지 (marker) DNA를 포함하는 RNA 검출용 조성물의 제조방법에 관한 것이다:One aspect of the present invention relates to a method for producing a composition for detecting RNA containing marker DNA comprising the following steps:

검출 대상 RNA 서열이 혼성화된 환형 단일가닥 DNA (ssDNA)를 제조하는 탐침 (probe) DNA 제조 단계;A probe DNA preparation step of preparing circular single-stranded DNA (ssDNA) hybridized with the RNA sequence to be detected;

검출 대상 RNA 서열에 상보적인 프라이머를 이용하여 환형 단일가닥 DNA로부터 환형 이중가닥 DNA (dsDNA)를 제조하는 환형 dsDNA 제조 단계; 및A circular dsDNA preparation step of preparing circular double-stranded DNA (dsDNA) from circular single-stranded DNA using a primer complementary to the RNA sequence to be detected; and

환형 이중가닥 DNA를 절단하여 선형 이중가닥 DNA를 제조하는 표지 DNA 제조 단계.A labeled DNA preparation step in which circular double-stranded DNA is cut to produce linear double-stranded DNA.

본 발명에 있어서 검출 대상 RNA는 바이러스 RNA, 세포 내 발현되는 miRNA, 다양한 암 특이적인 mRNA들을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다. In the present invention, RNA to be detected may include, but is not limited to, viral RNA, intracellularly expressed RNA, and various cancer-specific mRNAs.

본 발명에 있어서 바이러스는 RNA 바이러스인 것일 수 있으며, 예를 들어, 인간 면역 결핍 바이러스 (HIV), 인플루엔자 A 바이러스일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the virus may be an RNA virus, for example, human immunodeficiency virus (HIV) or influenza A virus, but is not limited thereto.

본 발명에 있어서 상보적인 프라이머는 핵산인 것일 수 있으며, 예를 들어, RNA인 것일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the complementary primer may be a nucleic acid, for example, RNA, but is not limited thereto.

본 발명에 있어서 상보적인 프라이머는 RNA 바이러스 유전체로부터 유래된 것일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the complementary primer may be derived from an RNA virus genome, but is not limited thereto.

본 발명에 있어서 탐침 DNA 제조 단계는 하기의 단계를 포함하는 것일 수 있다:In the present invention, the probe DNA preparation step may include the following steps:

검출 대상 RNA 서열을 파지미드 (phagemid)에 삽입하여 재조합 파지미드를 제조하는 재조합 파지미드 제조 단계;A recombinant phagemid production step of inserting the RNA sequence to be detected into a phagemid to produce a recombinant phagemid;

재조합 파지미드를 보조파지 (helper phage)와 함께 대장균 내에 도입하여 배양하는 배양 단계; 및A culture step of introducing and culturing the recombinant phagemid together with helper phage into E. coli; and

배양 결과물로부터 환형 단일가닥 DNA를 추출하는 추출 단계.Extraction step to extract circular single-stranded DNA from the culture result.

본 발명에 있어서 탐침 DNA 제조 단계는 추출 단계에서 존재하는 대장균 유전체, 보조파지 유전체 및 기타 DNA를 제거하기 위하여 환형 단일가닥 DNA를 정제하는 정제 단계를 추가로 포함하는 것일 수 있다.In the present invention, the probe DNA preparation step may further include a purification step of purifying the circular single-stranded DNA to remove the E. coli genome, auxiliary phage genome, and other DNA present in the extraction step.

본 발명에서 "탐침 DNA"는 단일 분자 시각화를 위한 표지 (marker) DNA를 제조하기 위하여 시각화 대상 유전자 서열이 혼성화될 DNA를 말하는 것으로서, 올리고뉴클레오티드, cDNA 또는 본 발명에 따른 환형 단일가닥 DNA(ssDNA)를 포함할 수 있다.In the present invention, "probe DNA" refers to DNA to which the gene sequence to be visualized will be hybridized to produce marker DNA for single molecule visualization, such as oligonucleotide, cDNA, or circular single-stranded DNA (ssDNA) according to the present invention. may include.

본 발명에서 "시각화 대상 유전자"는 검출하고자 하는 대상 바이러스 또는 발현을 여부를 판별하고자 하는 대상 세포에서 추출한 DNA 또는 RNA를 말하는 것으로, 상기 시각화 대상 유전자의 상당 부분은 탐침 DNA와 상보적인 서열을 갖고 있어 이들의 결합에 의해 역전사 반응을 통한 표지(marker) DNA로의 혼성화가 가능하다.In the present invention, the "gene to be visualized" refers to DNA or RNA extracted from the target virus to be detected or the target cell whose expression is to be determined. A significant portion of the gene to be visualized has a sequence complementary to the probe DNA. Their combination allows hybridization to marker DNA through reverse transcription reaction.

본 발명에서 "파지미드"는 f1 복제 기점 (origin of replication)을 갖는 플라스미드를 의미하며, 파지미드의 DNA는 단일가닥 환형 상태로 바이러스 입자에 들어가며 위치-지정 돌연변이(site-directed mutagenesis)를 통해 특정 제한효소 사이트 더하고 이를 활용 외부 유전자를 도입할 수 있다.In the present invention, "phagemid" refers to a plasmid with an f1 origin of replication, and the DNA of the phagemid enters the virus particle in a single-stranded circular state and is specific through site-directed mutagenesis. You can add restriction enzyme sites and use them to introduce external genes.

본 발명에서 "f1 복제 기점"은 f1 파지(f1 phage)에서 유래된 복제 개시점을 의미한다.In the present invention, “f1 origin of replication” refers to the origin of replication derived from f1 phage.

본 발명에서 "보조파지"는 단독으로 감염성이나 자기 증식능을 가지지 않고 불완전 파지 (결손이 있는 파지)의 증식을 도와주는 파지를 의미하며, 같은 종 2개의 파지 중 1개는 정상 파지이지만 다른 1개는 파지의 기능 일부를 결실하고 있는 경우에 양자가 동일 세포 내에 혼합 감염하면 후자는 전자의 산물을 이용하여 생육할 수 있다. In the present invention, "auxiliary phage" refers to a phage that does not have infectious or self-proliferating ability but helps the proliferation of incomplete phages (phage with defects). Among two phages of the same species, one is a normal phage, but the other one is a normal phage. In the case where part of the phage function is deleted, if both phages are mixed and infected in the same cell, the latter can grow using the product of the former.

한편, 재조합 파지미드가 보조파지와 동시에 존재하는 경우 상기 보조파지는 재조합 파지미드를 단일가닥 DNA 형태로 우선적으로 증폭시키기 때문에, 대장균으로부터 추출되는 자손 파지는 유전체로 파지미드를 가질 수 있다. 따라서, 배양 결과물 내 이러한 파지로부터 유전체를 추출하여 환형 단일가닥 DNA (탐침 DNA)를 얻을 수 있다.Meanwhile, when the recombinant phagemid is present simultaneously with the auxiliary phage, the auxiliary phage preferentially amplifies the recombinant phagemid in the form of single-stranded DNA, so the progeny phage extracted from E. coli may have the phagemid as its genome. Therefore, circular single-stranded DNA (probe DNA) can be obtained by extracting the genome from these phages in the culture result.

본 발명에 있어서 환형 표지 이중가닥 DNA 제조 단계의 프라이머는 검출 대상 RNA의 절편화, 예를 들어, 대상 바이러스 유전체 및/또는 세포 유래 RNA의 절편화를 통해 생성되는 것일 수 있다.In the present invention, the primers in the circularly labeled double-stranded DNA production step may be generated through fragmentation of the RNA to be detected, for example, fragmentation of the target viral genome and/or cell-derived RNA.

본 발명에 있어서 탐침 DNA는 프라이머(들)와 상보적인 서열을 포함하도록 설계되었다. In the present invention, the probe DNA is designed to contain a sequence complementary to the primer(s).

본 발명에 있어서 상기 프라이머를 이용하여 역전사효소를 사용한 반응을 통해 환형 단일가닥 DNA로부터 환형 이중가닥 DNA로의 혼성화가 가능하다.In the present invention, hybridization from circular single-stranded DNA to circular double-stranded DNA is possible through a reaction using reverse transcriptase using the above primers.

따라서, 본 발명은 검출 대상 RNA의 제한이 없으며, 예를 들어, 바이러스의 유전체상 어떤 부분도 검출 대상으로 할 수 있으며, 마찬가지로 세포 유래 miRNA 및 mRNA 검출을 위한 서열 역시 해당 RNA 서열의 전체 또는 일부 어떤 부분으로 결정할 수 있으므로, 제작 가능한 탐침 DNA의 경우 역시 무한하다. Therefore, the present invention is not limited to the RNA to be detected, and for example, any part of the genome of the virus can be targeted for detection, and similarly, sequences for detecting cell-derived miRNA and mRNA may also be used for all or part of the corresponding RNA sequence. Since it can be determined in parts, the number of probe DNAs that can be produced is also infinite.

본 발명에 있어서 환형 표지 dsDNA는 G/AATTC 서열을 가질 수 있으므로, 제한효소 EcoRI를 이용하여 환형 dsDNA를 절단하여 선형 이중가닥 표지 DNA를 제조할 수 있다.In the present invention, since the circularly labeled dsDNA may have a G/AATTC sequence, linear double-stranded labeled DNA can be prepared by cutting the circular dsDNA using the restriction enzyme EcoRI.

본 발명의 다른 일 양태는 표지(marker) DNA를 포함하는 RNA 검출용 조성물에 관한 것이다.Another aspect of the present invention relates to a composition for detecting RNA containing marker DNA.

본 발명에 있어서 표지 DNA를 포함하는 RNA 검출용 조성물은 상기 제조방법에 의해 제조된 것일 수 있다.In the present invention, the composition for detecting RNA containing labeled DNA may be prepared by the above production method.

본 발명에 있어서 표지 DNA를 포함하는 RNA 검출용 조성물은 필요에 따라 프라이머 (primer), dNTPs 및 rNTPs, 표지 시약 (labeling agent), 역전사 효소, DNA 중합효소, 완충용액, 화학형광물질(chemifluorescent) 및/또는 화학발광물질 (chemiiluminescent) 등이 포함될 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the composition for detecting RNA containing labeled DNA includes primers, dNTPs and rNTPs, labeling agent, reverse transcriptase, DNA polymerase, buffer solution, chemifluorescent, and /or chemiluminescent substances, etc. may be included, but are not limited thereto.

본 발명의 또 다른 일 양태는 상기 RNA 검출용 조성물을 포함하는 바이러스 검출용 키트에 관한 것이다.Another aspect of the present invention relates to a virus detection kit comprising the RNA detection composition.

본 발명에 있어서 키트는 바이러스 RNA, 세포 내 발현되는 miRNA, 다양한 암 특이적인 mRNA들을 검출할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the kit can detect viral RNA, intracellularly expressed miRNA, and various cancer-specific mRNAs, but is not limited to this.

본 발명에 있어서 키트는 바이러스를 신뢰성 있게 검출할 수 있도록, 특정 바이러스 종에 특이적인 유전자를 타겟으로 설계된 탐침 DNA를 포함할 수 있다.In the present invention, the kit may include probe DNA designed to target a gene specific to a specific virus species so that the virus can be detected reliably.

본 발명에 있어서 바이러스는 RNA 바이러스인 것일 수 있으며, 예를 들어, 인간 면역 결핍 바이러스 (HIV), 인플루엔자 A 바이러스일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the virus may be an RNA virus, for example, human immunodeficiency virus (HIV) or influenza A virus, but is not limited thereto.

본 발명에 있어서 키트는 단일 분자 수준에서 분석을 수행하기 위해 필요한 필수 요소를 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the kit may include essential elements necessary to perform analysis at the single molecule level, but is not limited thereto.

본 발명의 키트는 별도로 PCR 분석 등을 수행할 필요 없이 시료로부터 바로 현미경 등을 통해 검출 대상 RNA의 검출이 가능하다.The kit of the present invention allows detection of target RNA directly from the sample using a microscope, etc., without the need for separate PCR analysis.

본 발명의 또 다른 일 양태는 상기 RNA 검출용 조성물을 이용한 RNA 검출방법에 관한 것이다.Another aspect of the present invention relates to a method for detecting RNA using the composition for detecting RNA.

본 발명에 있어서 RNA 검출방법은 표지 DNA를 포함하는 RNA 검출용 조성물을 시료에 접촉시키는 접촉 단계를 포함하는 것일 수 있다.In the present invention, the RNA detection method may include a contact step of contacting a sample with a composition for detecting RNA containing labeled DNA.

본 발명에 있어서 RNA는 바이러스 RNA, 세포 내 발현되는 miRNA, 다양한 암 특이적인 mRNA들을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다. In the present invention, RNA may include, but is not limited to, viral RNA, intracellularly expressed miRNA, and various cancer-specific mRNAs.

본 발명에 있어서 바이러스는 RNA 바이러스인 것일 수 있으며, 예를 들어, 인간 면역 결핍 바이러스 (HIV), 인플루엔자 A 바이러스일 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the virus may be an RNA virus, for example, human immunodeficiency virus (HIV) or influenza A virus, but is not limited thereto.

본 발명에 있어서 RNA 검출방법은 상기 RNA 검출용 조성물을 마이크로채널 (microchannel)에 주입하는 단계를 포함하는 것일 수 있다.In the present invention, the RNA detection method may include the step of injecting the RNA detection composition into a microchannel.

본 발명에 있어서 마이크로채널은 하나 이상의 채널로 이루어진 시료 부착부; 상기 시료 부착부의 일 측에 연결된 입구부; 시료를 주입하기 위하여 상기 입구부에 연결된 주입부; 및 상기 시료 부착부의 다른 일 측에 연결된 출구부;를 구비하고, 상기 채널은 입구부 측의 상부 연결점으로부터 하부 연결점을 향하여 경사면을 갖고, 상기 채널 내의 하부 표면은 양전하를 띠고, 상기 하나 이상의 채널은 출구부에서 서로 연통되어 시료를 회수하는 것을 특징으로 할 수 있다.In the present invention, the microchannel includes a sample attachment portion consisting of one or more channels; an inlet connected to one side of the sample attachment part; an injection unit connected to the inlet to inject a sample; and an outlet connected to the other side of the sample attachment portion, wherein the channel has an inclined surface from an upper connection point on the inlet side toward a lower connection point, the lower surface within the channel is positively charged, and the one or more channels It may be characterized in that the sample is recovered by communicating with each other at the outlet.

이하, 첨부된 도면을 참조하여 본 발명의 실시예에 따른 마이크로채널에 대하여 구체적으로 설명한다.Hereinafter, a microchannel according to an embodiment of the present invention will be described in detail with reference to the attached drawings.

도 5는 본 발명의 실시예에 따른 시료 부착부가 1개 포함된 마이크로채널을 도식화한 평면도이다.Figure 5 is a schematic plan view of a microchannel including one sample attachment portion according to an embodiment of the present invention.

상기 도면을 참조하면, 본 발명의 일 실시예에 따른 마이크로채널 (1)은, 시료 부착부 (10), 입구부 (20), 주입부 (30) 및 출구부 (40)를 포함하여 구성될 수 있다.Referring to the drawing, the microchannel 1 according to an embodiment of the present invention will be comprised of a sample attachment part 10, an inlet part 20, an injection part 30, and an outlet part 40. You can.

본 발명에 있어서 시료 부착부 (10)는 적어도 1개 이상의 채널 (11)로 이루어지도록 구성될 수 있다. In the present invention, the sample attachment portion 10 may be configured to include at least one channel 11.

본 발명에 있어서 채널이 적어도 2개 이상의 채널로 이루어지는 경우, 각각의 채널은 병렬로 연결되도록 구성된 것일 수 있다.In the present invention, when the channel consists of at least two channels, each channel may be configured to be connected in parallel.

본 발명에 있어서 채널 (11)는 시료가 통과하기 위한 통로로, 입구부 (20)측의 상부 연결점 (12)으로부터 하부 연결점 (13)을 향하여 경사면을 가지도록 구성될 수 있다.In the present invention, the channel 11 is a passage for the sample to pass through, and may be configured to have an inclined surface from the upper connection point 12 on the inlet 20 side toward the lower connection point 13.

본 발명에 있어서 상부 연결점의 높이는 1 내지 50 um, 1 내지 40 um, 1 내지 30 um, 10 내지 50 um, 10 내지 40 um, 10 내지 30 um, 20 내지 50 um, 20 내지 40 um, 20 내지 30 um, 25 내지 50 um, 25 내지 40 um, 25 내지 30 um, 예를 들어, 27 um일 수 있다. 상기 범위에서 사용되는 경우 분자들이 시료부착부에 더 고르게 분포되는 효과가 있다.In the present invention, the height of the upper connection point is 1 to 50 um, 1 to 40 um, 1 to 30 um, 10 to 50 um, 10 to 40 um, 10 to 30 um, 20 to 50 um, 20 to 40 um, 20 to 20 um. It may be 30 um, 25 to 50 um, 25 to 40 um, 25 to 30 um, for example, 27 um. When used in the above range, there is an effect that the molecules are distributed more evenly on the sample attachment area.

본 발명에 있어서 채널 내의 하부 표면은 양전하를 띠도록 구성될 수 있다. 채널 내의 하부 표면이 양전하를 띰으로써, 음전하를 띠는 DNA 및/또는 RNA가 채널의 하부 표면에 부착되어 검출될 수 있다.In the present invention, the lower surface within the channel may be configured to have a positive charge. Because the lower surface within the channel is positively charged, negatively charged DNA and/or RNA can attach to the lower surface of the channel and be detected.

본 발명에 있어서 채널의 재질은 당업계에서 채널을 제조하기 위하여 이용되는 어떠한 재질도 포함할 수 있다.In the present invention, the material of the channel may include any material used to manufacture channels in the art.

본 발명에 있어서 입구부 (20)는 시료를 채널 내로 주입하기 위한 주입부가 포함되는 구성으로, 상기 시료 부착부 (10)의 일 측에 연결되도록 구성될 수 있다.In the present invention, the inlet portion 20 includes an injection portion for injecting a sample into the channel, and may be configured to be connected to one side of the sample attachment portion 10.

본 발명에 있어서 주입부 (30)는 시료를 주입하기 위한 구성으로, 입구부(20)에 연결되도록 구성될 수 있다.In the present invention, the injection unit 30 is configured to inject a sample and may be configured to be connected to the inlet unit 20.

본 발명에 있어서 출구부 (40)는 시료를 회수하기 위한 배출구로, 상기 시료 부착부의 다른 일 측에 연결되도록 구성될 수 있다. 특히, 시료 부착부가 2개 이상의 채널로 이루어진 구성에서, 각각의 채널에 연결된 각각의 출구부들은 서로 연통되어 시료를 회수할 수 있다.In the present invention, the outlet portion 40 is an outlet for recovering a sample, and may be configured to be connected to the other side of the sample attachment portion. In particular, in a configuration where the sample attachment portion consists of two or more channels, the respective outlet portions connected to each channel communicate with each other to recover the sample.

본 발명에 있어서 시료는 당업계에서 단일 분자 분석이 필요한 시료라면 어떠한 시료도 포함할 수 있다. 구체적으로는, 상기 시료는 상기 표지 DNA를 포함할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the sample may include any sample that requires single molecule analysis in the art. Specifically, the sample may include the labeled DNA, but is not limited thereto.

본 발명에 있어서 표지 DNA는 상기 마이크로채널의 채널 내 양전하를 띠는 하부 표면에 부착될 수 있으므로, 현미경을 사용하여 부착된 표지 DNA를 촬영하여 RNA를 검출할 수 있다.In the present invention, labeled DNA can be attached to the positively charged lower surface of the microchannel, so RNA can be detected by photographing the attached labeled DNA using a microscope.

본 발명의 RNA 검출방법에 있어서 RNA 검출용 조성물과 관련된 중복되는 내용은 본 명세서의 복잡성을 고려하여 생략한다.In the RNA detection method of the present invention, overlapping content related to the composition for RNA detection is omitted in consideration of the complexity of the present specification.

본 발명은 단일 DNA 분자 시각화 방법을 이용한 바이러스 및 세포 RNA 검출방법에 관한 것이다. 본 발명의 방법은 검출 대상 바이러스 또는 세포 RNA 단편이 혼성화된 표지 dsDNA를 시각화함으로써, 단시간 내에 단일 DNA 분자 수준에서 바이러스 및 세포 RNA의 검출이 가능한 장점이 있다.The present invention relates to a method for detecting viral and cellular RNA using a single DNA molecule visualization method. The method of the present invention has the advantage of enabling detection of viral and cellular RNA at the level of a single DNA molecule within a short period of time by visualizing labeled dsDNA hybridized with the viral or cellular RNA fragment to be detected.

도 1은 본 발명의 일 실시예에 따라 합성된 환형 단일가닥 DNA (ssDNA) 탐침을 생산하고 정제한 (high purity로 표시) 결과이다.
도 2는 본 발명의 일 실시예에 따라 합성된 선형 이중가닥(dsDNA) 표지의 합성여부를 확인한 결과이다.
도 3은 본 발명의 일 실시예에 따라 M13mp18 ssDNA를 사용하여 합성된 dsDNA 를 확인한 결과이다.
도 4는 본 발명의 일 실시예에 따라 M13mp18 ssDNA를 사용하여 합성한 dsDNA와 원형 ssDNA의 형태를 비교하고 합성된 dsDNA를 선형화한 결과이다.
도 5는 본 발명의 일 실시예에 따른 채널이 1개 포함된 마이크로채널을 도식화한 평면도이다.
도 6은 본 발명의 일 실시예에 따른 마이크로채널의 모식도이다.
도 7은 본 발명의 일 실시예에 따른 채널의 입구 부분의 경사에 대한 주사 전자 현미경 (scanning electron microscope, SEM) 사진이다.
도 8은 본 발명의 일 실시예에 따라 경사 (기울기)가 없는 입구 부분을 포함하는 채널 (비교예)과 경사가 있는 입구 부분을 포함하는 채널 (실시예)을 비교한 그림이다 (Scale bar = 40 μm).
도 9는 본 발명의 일 실시예에 따라 합성된 dsDNA의 양을 시각화 대상 농도에 따라 나타낸 그림이다.
도 10은 본 발명의 일 실시예에 따른 마이크로채널을 이용하여 측정한 dsDNA 분자 개수를 시각화 대상 DNA 농도에 대하여 나타낸 그래프이다.Figure 1 shows the results (expressed as high purity) of producing and purifying a circular single-stranded DNA (ssDNA) probe synthesized according to an embodiment of the present invention.
Figure 2 shows the results of confirming whether a linear double-stranded (dsDNA) label synthesized according to an embodiment of the present invention was synthesized.
Figure 3 shows the results of confirming dsDNA synthesized using M13mp18 ssDNA according to an embodiment of the present invention.
Figure 4 shows the results of comparing the shapes of dsDNA synthesized using M13mp18 ssDNA and circular ssDNA according to an embodiment of the present invention and linearizing the synthesized dsDNA.
Figure 5 is a plan view schematically illustrating a microchannel including one channel according to an embodiment of the present invention.
Figure 6 is a schematic diagram of a microchannel according to an embodiment of the present invention.
Figure 7 is a scanning electron microscope (SEM) photograph of the inclination of the entrance portion of a channel according to an embodiment of the present invention.
Figure 8 is a diagram comparing a channel including an inlet portion without a slope (comparative example) and a channel including an inlet portion with a slope (example) according to an embodiment of the present invention (Scale bar = 40 μm).
Figure 9 is a diagram showing the amount of dsDNA synthesized according to an embodiment of the present invention according to the concentration to be visualized.
Figure 10 is a graph showing the number of dsDNA molecules measured using a microchannel according to an embodiment of the present invention versus the DNA concentration to be visualized.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

시험물질 및 시약Test substances and reagents

λ phage DNA(48.5 kbp), M13mp18 단일가닥 (single-stranded) DNA (7.2 kb), 및 효소들은 New England Biolabs (Ipswich, MA)에서 구매하였다. DNA 프라이머는 Cosmogenetech (Seoul, Korea)에서 구매하였고, Top 폴리머라제는 Bioneer (Daejeon, Korea)에서 구매하였다. 50% 메탄올 내 N-trimethoxymethyl silyl propyl-N,N,N-trimethylammonium chloride는 Gelest (Morrisville, PA)에서 구매하였으며, 다른 시약은 Sigma-Aldrich (St. Louis, MO)에서 구매하였다. 감광성 수지인 SU-8 2015 및 SU-8 2005는 MicroChem 제품을 구입하였다. Polydimethyl-siloxane (Sylgard 184, PDMS)의 경우 K1 Solution (Seoul, Korea)에서 구입하였다.λ phage DNA (48.5 kbp), M13mp18 single-stranded DNA (7.2 kb), and enzymes were purchased from New England Biolabs (Ipswich, MA). DNA primers were purchased from Cosmogenetech (Seoul, Korea), and top polymerase was purchased from Bioneer (Daejeon, Korea). N-trimethoxymethyl silyl propyl-N,N,N-trimethylammonium chloride in 50% methanol was purchased from Gelest (Morrisville, PA), and other reagents were purchased from Sigma-Aldrich (St. Louis, MO). Photosensitive resins SU-8 2015 and SU-8 2005 were purchased from MicroChem. Polydimethyl-siloxane (Sylgard 184, PDMS) was purchased from K1 Solution (Seoul, Korea).

형광 현미경 이미지Fluorescence microscopy image

역방향 광학 현미경 (Olympus IX70, Japan)으로 측정하였다. 100 X 대물렌즈 (Olympus UPlanSApo oil immersion objective) 및 LED (SOLA SM Ⅱlight engine, Lumencor, Beaverton, OR)를 사용하였고, 여기 (excitation) 및 방출(emission) 빛은 형광필터세트 (Semrock, Rochester, NY)로 통과하였다. 형광 이미지는 Prime sCMOS 카메라 (Photometrics, Tucson, AZ)를 사용하여 얻었고, Micro-manager 소프트웨어를 이용하여 16-bit TIFF 형식으로 저장하였다. 이미지 프로세싱을 위하여, ImageJ 프로그램을 사용하였다.Measurements were made using an inverted optical microscope (Olympus IX70, Japan). A 100 passed. Fluorescence images were acquired using a Prime sCMOS camera (Photometrics, Tucson, AZ) and saved in 16-bit TIFF format using Micro-manager software. For image processing, the ImageJ program was used.

제조예 1. 탐침 (probe) DNA의 제조Preparation Example 1. Preparation of probe DNA

HIV-1 유전체의 일부와 상보적인 염기 서열을 포함한 탐침 DNA 제조를 위해 파지미드를 백본 (backbone)으로 이용하였다. HIV-1 유전체를 포함하는 플라스미드 DNA의 일부를 제한 (restriction)하고, 파지미드에 f1 복제 기점의 방향을 고려하여 결찰 (ligation)하였다. 그 결과 pBluescript II SK+ (Addgene, Watertown, MA) 파지미드에 HIV-1 유전체 전체 5kb 중 2.3kb가 포함된 5.3kb의 DNA가 제작되었다. 그 다음, 제작된 HIV-1 유전체 일부를 포함하는 이중 가닥의 파지미드를 환형 단일가닥 형태로 전환하였다. 구체적으로, 형질전환을 통해 해당 파지미드를 XL1 Blue MRF'(Agilent Technologies, Santa Clara, CA) 대장균 내에 도입 후, 테트라사이클린 (tetracycline, 5μg/mL)과 암피실린 (ampicillin, 60μg/mL)이 포함된 LB 플레이트에 도포하였다. 테트라사이클린 처리는 보조파지에 의해 감염될 수 있는 F-pilli를 발현하는 대장균만 선별하기 위함이고, 암피실린 저항성 유전자를 포함하는 파지미드가 정상적으로 도입된 대장균을 선별하기 위에 암피실린이 사용되었다. 15시간 정도 후 생성된 대장균 콜로니 2개를 위와 동일한 농도의 테트라사이클린 및 암피실린을 포함하는 2xYT 30mL에 넣고 37℃에서 2시간 30분 동안 쉐어커 (shaker)에서 배양한 후, 보조파지 (2.05 x 108 PFU)를 넣어주었다. 보조파지에 의해 대장균이 감염되도록 1시간 30분의 배양 이후에 카나마이신 (kanamycin, 30μg/mL)을 처리하여 감염되지 않은 대장균은 제거하고 밤새 배양을 통해 대장균 내에서 만들어지는 파지 (progeny phage) 양을 증가시켰다. 보조파지의 도움을 받아 파지미드는 환형 단일가닥 형태로 증폭되고 보조파지로부터 만들어지는 단백질에 싸여 파지 입자 형태로 미디아 상에 방출된다. 해당 대장균 배양액을 상온에서 20분동안 원심분리 (10,000g)하여 대장균과 배지를 분리한 후, 배지에 존재하는 파지들을 농축시키기 위해 25% PEG과 2.5M NaCl이 혼합된 용액을 6mL (0.2 volume) 넣고, 4℃ 냉장고에 2시간 이상 인큐베이션시켰다. 그 다음, 4℃에서 20분동안 원심분리 (12,000g)하여 상층액은 버리고 침전된 파지만 수득하였다. DNA clean & concentrator 키트 (Zymo research, Irvine, US)를 이용해 파지로부터 환형 단일가닥 DNA를 추출하였다. 추출한 DNA는 겔 전기 영동을 통해 확인되며, 순도를 높이기 위해 단일 가닥의 파지미드 DNA band를 잘라 Zymoclean Gel RNA Recovery 키트 (Zymo research)를 이용해 정제하여, 그 결과를 도 1에 나타내었다. 도 1에서 확인할 수 있듯이, 높은 순도의 환형 단일가닥 DNA(ssDNA)를 얻을 수 있었다.A phagemid was used as a backbone to prepare probe DNA containing a base sequence complementary to a portion of the HIV-1 genome. A portion of the plasmid DNA containing the HIV-1 genome was restricted and ligated to the phagemid, taking into account the direction of the f1 replication origin. As a result, 5.3 kb of DNA containing 2.3 kb of the total 5 kb of the HIV-1 genome was produced in pBluescript II SK+ (Addgene, Watertown, MA) phagemid. Next, the double-stranded phagemid containing part of the constructed HIV-1 genome was converted into a circular single-stranded form. Specifically, the phagemid was introduced into XL1 Blue MRF' (Agilent Technologies, Santa Clara, CA) E. coli through transformation, and then added to E. coli containing tetracycline (5μg/mL) and ampicillin (60μg/mL). It was applied to the LB plate. Tetracycline treatment was intended to select only E. coli expressing F-pilli that can be infected by auxiliary phages, and ampicillin was used to select E. coli into which a phagemid containing an ampicillin resistance gene was normally introduced. After about 15 hours, two E. coli colonies were placed in 30mL of 2xYT containing the same concentrations of tetracycline and ampicillin as above, cultured on a shaker at 37°C for 2 hours and 30 minutes, and then incubated with auxiliary phage (2.05 x 10). 8 PFU) was added. After 1 hour and 30 minutes of incubation to infect E. coli with auxiliary phages, uninfected E. coli were removed by treatment with kanamycin (30 μg/mL), and the amount of progeny phages produced within E. coli was measured through overnight incubation. increased. With the help of the auxiliary phage, the phagemid is amplified into a circular single-stranded form, wrapped in a protein made from the auxiliary phage, and released onto the media in the form of phage particles. The E. coli culture was centrifuged (10,000 g) for 20 minutes at room temperature to separate the E. coli and the medium, and then 6 mL (0.2 volume) of a mixed solution of 25% PEG and 2.5 M NaCl was added to concentrate the phages present in the medium. and incubated in a refrigerator at 4°C for more than 2 hours. Next, centrifugation (12,000g) was performed at 4°C for 20 minutes, the supernatant was discarded, and only the precipitated phages were obtained. Circular single-stranded DNA was extracted from the phage using a DNA clean & concentrator kit (Zymo research, Irvine, US). The extracted DNA was confirmed through gel electrophoresis, and to increase purity, the single-stranded phagemid DNA band was cut and purified using the Zymoclean Gel RNA Recovery kit (Zymo research), and the results are shown in Figure 1. As can be seen in Figure 1, high purity circular single-stranded DNA (ssDNA) was obtained.

제조예 2. 표지 (marker) DNA의 제조Preparation Example 2. Preparation of marker DNA

상기 제조예 1의 방법과 동일하게 만들어진 6 kb 크기의 HIV-1 탐침 DNA (HIV-1 유전체 중 3 kb의 상보가닥을 포함함)를 이용하여 선형의 이중가닥 DNA를 제조하였다.Linear double-stranded DNA was prepared using a 6 kb HIV-1 probe DNA (containing a 3 kb complementary strand of the HIV-1 genome) prepared in the same manner as in Preparation Example 1 above.

먼저, 탐침 DNA에 붙어 프라이머로서 작용하는 HIV-1 RNA를 준비하였다. HIV-1에서 Quick-RNA Viral 키트 (Zymo)를 이용해 RNA를 추출하였고, 전체 35 uL 중 2 uL가 AmbionTM RNaseIII (Thermo Fisher Scientific) 0.5 uL에 의해 처리되었다. 단일 가닥을 자르기 위해 NaCl 농도를 효소와 함께 제공되는 기존 10X RNaseIII Reaction 버퍼 보다 10배 낮춘 버퍼를 만들어, 전체 부피 5 uL에 0.5 uL 넣어주었다. 이렇게 RNaseIII에 의해 조각난 바이러스 유래 RNA 용액 5uL는 탐침 DNA 125ng, M-MuLV Reverse transcriptase 0.3uL, 10x reaction buffer 2uL, 10x DTT 2uL, dNTP (10mM) 1uL, RNase Inhibitor, Murine (NEB) 0.2uL 와 함께 전체 20uL 용액으로 만들어, 42℃ 에서 1시간 동안 역전사 반응을 수행하였다. 합성되어 만들어진 DNA는 환형 이중가닥 형태이므로 단일 분자 이미징을 위해 특정 위치 한 곳만 자르는 제한 효소 EcoRI (NEB) 0.5 uL를 처리하여 선형으로 만들었다. 도 2에서 확인할 수 있듯이, 현미경으로 관찰할 수 있는 선형 이중가닥 DNA(dsDNA)가 합성되었음을 확인하였다.First, HIV-1 RNA, which attaches to the probe DNA and acts as a primer, was prepared. RNA was extracted from HIV-1 using the Quick-RNA Viral kit (Zymo), and 2 uL of the total 35 uL was treated with 0.5 uL of Ambion TM RNaseIII (Thermo Fisher Scientific). In order to cut single strands, we made a buffer with a NaCl concentration 10 times lower than the existing 10X RNaseIII Reaction buffer provided with the enzyme, and added 0.5 uL to the total volume of 5 uL. In this way, 5uL of the virus-derived RNA solution fragmented by RNaseIII is mixed with 125ng of probe DNA, 0.3uL of M-MuLV Reverse transcriptase, 2uL of 10x reaction buffer, 2uL of 10x DTT, 1uL of dNTP (10mM), and 0.2uL of RNase Inhibitor, Murine (NEB). It was made into a 20uL solution, and the reverse transcription reaction was performed at 42°C for 1 hour. Since the synthesized DNA was in a circular double-stranded form, it was made linear by treating it with 0.5 uL of the restriction enzyme EcoRI (NEB), which cuts only at one specific location for single molecule imaging. As can be seen in Figure 2, it was confirmed that linear double-stranded DNA (dsDNA) that could be observed under a microscope was synthesized.

같은 방식으로 환형 M13mp18 ssDNA에 기반하여 선형 dsDNA를 합성하고, 하기 실험에서 단일 분자 검출 시스템 성능 분석에 적용하였다.In the same way, linear dsDNA was synthesized based on circular M13mp18 ssDNA, and was applied to analyze the performance of the single molecule detection system in the following experiment.

실험예 1. M13mp18 모델을 이용한 성능 확인Experimental Example 1. Performance confirmation using the M13mp18 model

1-1. 선형 이중가닥 DNA (Double-stranded DNA, dsDNA)의 생성1-1. Generation of linear double-stranded DNA (dsDNA)

표 1의 M13mp18 표적 올리고머 4 fmol 용액과 이를 2배씩 희석한 2 fmol, 1 fmol 및 0.5 fmol의 올리고머 용액을 준비하였다. 그 다음, 상기 각각의 올리고머 (4 fmol, 2 fmol, 1 fmol 및 0.5 fmol) 용액 1 uL에 원형의 M13mp18 ssDNA (5 amoL) 1uL, 10x Top 폴리머라제 버퍼 2uL, 10uM dNTPs 1.5uL, Top 폴리머라제(Bioneer) 0.5uL 및 증류수 14 uL를 넣고, 95℃에서 6분, 60℃에서 6분, 72℃에서 15분 동안 이중가닥 DNA 생성 효소 반응을 진행하였다. 반응이 끝난 각각의 용액 15uL에 3.1 NEB 버퍼 2uL, PstⅠ 0.5uL 및 증류수 2.5uL를 넣고, 37℃에서 15분 동안 제한효소 반응, 80℃에서 20분 동안 제한효소 불활성화 반응을 수행하여 선형의 dsDNA를 제조하였다.A 4 fmol solution of the M13mp18 target oligomer in Table 1 and 2-fold diluted oligomer solutions of 2 fmol, 1 fmol, and 0.5 fmol were prepared. Next, 1 uL of each oligomer (4 fmol, 2 fmol, 1 fmol, and 0.5 fmol) solution was added with 1 uL of circular M13mp18 ssDNA (5 amoL), 2 uL of 10x Top polymerase buffer, 1.5 uL of 10 uM dNTPs, and Top polymerase ( Bioneer) 0.5 uL and distilled water 14 uL were added, and double-stranded DNA production enzyme reaction was performed for 6 minutes at 95°C, 6 minutes at 60°C, and 15 minutes at 72°C. To each 15uL of the reaction solution, add 2uL of 3.1 NEB buffer, 0.5uL of PstⅠ, and 2.5uL of distilled water, and perform restriction enzyme reaction at 37℃ for 15 minutes and restriction enzyme inactivation reaction at 80℃ for 20 minutes to produce linear dsDNA. was manufactured.

서열번호sequence number 명명denomination 서열목록 (5' -> 3')Sequence Listing (5' -> 3') 비고note 1One M13mp18 targeting oligomerM13mp18 targeting oligomer GGAAACCGAGGAAACGCAATAATAACGGAATACCCGGAAACCGAGGAAACGCAATAATAACGGAATACCC

1-2. dsDNA의 생성여부 확인1-2. Check whether dsDNA is generated

원형의 M13mp18 ssDNA (5 amol) 15uL와 상기 제조한 M13mp18 dsDNA (5 amol)에 각각 3.1 NEB 버퍼 2uL, PstⅠ 0.5uL 및 증류수 2.5uL를 넣고, 37℃에서 15분, 80℃에서 20분 동안 제한효소 반응과 제한효소 불활성화 반응을 수행하여 single-cut 선형 dsDNA가 생성되는지 확인하였다. 또한, 원형의 M13mp18 ssDNA (5 amol) 15 uL와 상기 제조한 M13mp18 dsDNA (5 amol)에 각각 3.1 NEB 버퍼 2 uL, PstⅠ 0.5uL, BglII 0.5 uL 및 증류수 2 uL를 넣고, 37℃에서 15분, 80℃에서 20분 동안 반응시켜 double-cut 선형 dsDNA가 생성되는지 확인하였다. 제조한 DNA를 모두 0.7 % 아가로오즈젤에서 30분 전기 영동하여, 그 결과를 도 3에 나타내었다. Add 2uL of 3.1 NEB buffer, 0.5uL of PstⅠ, and 2.5uL of distilled water to 15uL of circular M13mp18 ssDNA (5 amol) and M13mp18 dsDNA (5 amol) prepared above, and incubate with restriction enzymes at 37°C for 15 minutes and 80°C for 20 minutes. Reaction and restriction enzyme inactivation reaction were performed to confirm whether single-cut linear dsDNA was generated. In addition, 2 uL of 3.1 NEB buffer, 0.5 uL of PstⅠ, 0.5 uL of BglII, and 2 uL of distilled water were added to 15 uL of circular M13mp18 ssDNA (5 amol) and M13mp18 dsDNA (5 amol) prepared above, and incubated at 37°C for 15 minutes. The reaction was performed at 80°C for 20 minutes to confirm whether double-cut linear dsDNA was produced. All of the prepared DNA was subjected to electrophoresis on a 0.7% agarose gel for 30 minutes, and the results are shown in Figure 3.

도 3에서 확인할 수 있듯이, 폴리머라제 반응 후 (dsDNA double cut)에만 예상된 크기의 조각이 나온 것으로부터 M13mp18 dsDNA로 생성을 확인하였다.As can be seen in Figure 3, the production of M13mp18 dsDNA was confirmed because a fragment of the expected size was produced only after the polymerase reaction (dsDNA double cut).

1-3. ssDNA 탐침 및 합성된 dsDNA 표지의 형태 확인1-3. Confirmation of conformation of ssDNA probe and synthesized dsDNA label

M13mp18 ssDNA와 상기에서 제조한 선형 M13mp18 dsDNA를 20배 희석하고, 50 nM YOYO-1 (0.5 % BME) 와 1:1 로 섞고, 양전하 표면 위에 도포 후 현미경으로 관찰하여, 그 결과를 도 4에 나타내었다. M13mp18 ssDNA and linear M13mp18 dsDNA prepared above were diluted 20 times, mixed 1:1 with 50 nM YOYO-1 (0.5% BME), applied on a positively charged surface, and observed under a microscope. The results are shown in Figure 4. It was.

도 4에서 확인할 수 있듯이, ssDNA일 때는 점의 형태인 DNA가 dsDNA로의 변화 및 제한효소에 의한 선형화 후에는 선의 형태로 관찰되었다. As can be seen in Figure 4, the DNA, which was in the form of dots when it was ssDNA, was observed in the form of a line after being changed to dsDNA and linearized with restriction enzymes.

상기 내용을 종합해보면, 본 발명의 탐침 DNA를 이용하는 경우 장시간의 유전자 증폭 없이도 단일 분자 수준의 이미징 만으로 다양한 바이러스 및 세포 RNA를 검출할 수 있을 것으로 기대된다.Considering the above, it is expected that when using the probe DNA of the present invention, various viral and cellular RNAs can be detected through single molecule level imaging without long-term gene amplification.

제조예 3. 마이크로채널 (Microchannel)의 제조Preparation Example 3. Preparation of microchannel (Microchannel)

3-1. 기울기 (경사)가 있는 채널 입구의 제조3-1. Manufacturing of channel inlets with inclination (slope)

실리콘 웨이퍼 (silicon wafer) 상에 음성 감광액 (Negative photoresist)인 SU-8 2015를 얹고, 스핀 코터 (spin coater)에서 1,500 rpm, 90초 회전하였다. 잘 코팅된 웨이퍼를 핫플레이트 (hot plate) 위에서 95℃, 5분간 소프트 베이크 (soft bake)하였다. 그리고 마스크 얼라이너 (mask aligner)에 첫번째 패턴을 고정하였다. 마스크 및 웨이퍼의 위치를 잘 맞추고 40초간 UV (350-450 nm)에 노출시켰다. 노출이 끝난 후 핫플레이트에서 95℃, 6분간 익스포져 베이크 (exposure bake)를 하고, SU-8 디벨로퍼 (developer)에 7분간 담갔다. 아이소프로필 알코올로 깨끗하게 세척하고 증류수로 세척하여 첫번째 패턴을 새겼다. 두번째 패턴을 새기기 위하여, 공기 압축기로 물기를 제거하고 물기를 제거한 실리콘 웨이퍼 상에 또 다른 음성 감광액인 SU-8 2005를 얹었다. 스핀 코터에서 4000rpm, 30초 회전하였다. 잘 코팅된 웨이퍼를 핫플레이트 위에서 95℃, 3분간 소프트 베이크한 후, 마스크 얼라이너에 두번째 패턴을 고정하였다. 마스크 및 웨이퍼의 위치를 잘 맞추고 30초간 UV (350-450 nm)를 노출시켰다. 노출이 끝난 후 핫플레이트에서 95℃, 3분간 익스포져 베이크를 하고, SU-8 디벨로퍼에 7분간 담갔다. 아이소프로필 알코올로 깨끗하게 세척하고 증류수로로 세척하였다. 공기 압축기로 물기를 제거하고 핫플레이트 위에서 150℃, 1시간 동안 올려놓고 하드 베이크 (hard bake)하여 마이크로채널의 입구 부분의 경사를 제조하였다. 상기 입구 부분의 경사에 대한 주사 전자 현미경 (SEM) 사진은 도 7에 나타내었다.SU-8 2015, a negative photoresist, was placed on a silicon wafer and rotated at 1,500 rpm for 90 seconds in a spin coater. The well-coated wafer was soft baked on a hot plate at 95°C for 5 minutes. Then, the first pattern was fixed to the mask aligner. The mask and wafer were positioned properly and exposed to UV (350-450 nm) for 40 seconds. After exposure was completed, exposure bake was performed on a hot plate at 95°C for 6 minutes, and then immersed in SU-8 developer for 7 minutes. I cleaned it thoroughly with isopropyl alcohol, washed it with distilled water, and engraved the first pattern. To engrave the second pattern, water was removed using an air compressor and another negative photoresist, SU-8 2005, was placed on the dried silicon wafer. It was rotated in a spin coater at 4000 rpm for 30 seconds. The well-coated wafer was soft-baked on a hot plate at 95°C for 3 minutes, and then the second pattern was fixed on the mask aligner. The mask and wafer were positioned properly and exposed to UV (350-450 nm) for 30 seconds. After exposure, it was exposed baked on a hot plate at 95°C for 3 minutes and soaked in SU-8 developer for 7 minutes. It was thoroughly washed with isopropyl alcohol and then with distilled water. Water was removed with an air compressor, placed on a hot plate at 150°C for 1 hour, and hard baked to prepare a slope at the entrance of the microchannel. A scanning electron microscope (SEM) photograph of the inclination of the inlet portion is shown in Figure 7.

3-2. 채널(Channel)의 제조3-2. Manufacturing of Channels

SYLGARD®184 실리콘 엘라스토머 베이스 30g 및 SYLGARD®184 실리콘 엘라스토머 경화제 3g을 넣어 섞고, 상기에서 제조한 2종류의 패턴을 오버래이(overlay)한 웨이퍼 상에 부은 후, 65℃ 오븐에 밤새 넣어두어 채널을 제조하였다. 제조된 채널은 공기 플라즈마 생성기 (Femto Science Cute Basic, Korea)에서 100W, 30초 동안 처리하여 표면이 친수성 (hydrophilic)화되도록 하였다. 친수성화 된 채널은 물에 보관하였고, 사용 전에 대기 건조하여 물기를 제거해주었다. 물기가 제거된 채널에 2mm 구멍을 뚫어서 시료 주입부로 사용하였다.Add 30g of SYLGARD®184 silicone elastomer base and 3g of SYLGARD®184 silicone elastomer curing agent, mix, pour on the wafer on which the two types of patterns prepared above are overlaid, and place in an oven at 65°C overnight to prepare a channel. did. The manufactured channel was treated in an air plasma generator (Femto Science Cute Basic, Korea) at 100 W for 30 seconds to make the surface hydrophilic. The hydrophilic channel was stored in water and air-dried to remove moisture before use. A 2 mm hole was drilled in the drained channel and used as a sample injection port.

3-3. 양전하 표면의 제조3-3. Fabrication of positively charged surfaces

22 x 22 mm 커버글라스를 테플론 랙 (Teflon rack)에 끼우고 테플론 테이프로 고정하였다. 글라스가 들어있는 테플론 랙을 비커에 넣고, 후드 안에서 3시간 동안 피라냐 용액 (H2SO4:H2O2=7:3)으로 반응시켰다. 반응이 끝난 피라냐 용액은 버리고 증류수로 pH 7이 될 때까지 세척한 후, 소니케이터 (sonicator)에서 30분 동안 세척하였다. 폴리프로필렌 보틀 (bottle)에 증류수 250mL 및 N-Trimethoxysilylpropyl-N,N,N-trimethylammonium chloride (SIT8415.0, Gelest) 350uL를 넣은 후, 세척한 커버글라스를 끼운 테플론 랙을 넣고 진탕 배양기(shaking incubator)에서 반응 (65℃, 100rpm, 12시간 이상)시켰다. 반응이 끝난 표면을 99% 에탄올로 3회 세척하고 에탄올에 보관하였다.A 22 x 22 mm cover glass was placed in a Teflon rack and fixed with Teflon tape. A Teflon rack containing glass was placed in a beaker and reacted with piranha solution (H 2 SO 4 :H 2 O 2 =7:3) for 3 hours in a hood. After the reaction was completed, the piranha solution was discarded, washed with distilled water until pH reached 7, and then washed in a sonicator for 30 minutes. Put 250mL of distilled water and 350uL of N-Trimethoxysilylpropyl-N,N,N-trimethylammonium chloride (SIT8415.0, Gelest) in a polypropylene bottle, then place a Teflon rack with a washed cover glass and place in a shaking incubator. The reaction was carried out (65°C, 100rpm, over 12 hours). After the reaction was completed, the surface was washed three times with 99% ethanol and stored in ethanol.

비교예. 경사 없는 채널 입구를 포함하는 마이크로채널의 제조Comparative example. Fabrication of microchannels with slope-free channel entrances

상기 제조예 3-1 단계를 제외하고, 상기 제조예 3과 동일한 방법을 이용하여, 기울기 (경사)가 없는 채널 입구를 포함하는 마이크로채널을 제조하였다.A microchannel including a channel inlet without a slope was manufactured using the same method as Preparation Example 3, except for the step of Preparation Example 3-1.

실험예 2. 마이크로채널의 입구 각도에 따른 시료 검출 효과 비교Experimental Example 2. Comparison of sample detection effects according to the inlet angle of the microchannel

λ DNA (NEB)를 10 pg/ul로 희석한 후, 50 nM YOYO-1 (5 % BME)과 1:1로 섞어 2 ul를 상기 마이크로채널 주입부에 흘려주었다. 상기 현미경으로 관찰하여, 그 결과를 도 8에 나타내었다. λ DNA (NEB) was diluted to 10 pg/ul, mixed 1:1 with 50 nM YOYO-1 (5% BME), and 2 ul was flowed into the microchannel injection port. Observed using the microscope, the results are shown in Figure 8.

도 8에서 확인할 수 있듯이, 비교예 (위쪽)는 입구 부분에 DNA가 뭉쳐서 구별하기가 어려웠으나, 실시예 (아래쪽)는 입구 부분에 DNA가 뭉치지 않고 넓게 퍼져있기 때문에 단일 DNA 분자를 구분/측정하기 수월함을 확인하였다.As can be seen in Figure 8, in the comparative example (top), the DNA was clumped at the entrance, making it difficult to distinguish, but in the example (bottom), the DNA was spread widely rather than clumped at the entrance, making it difficult to distinguish/measure single DNA molecules. It was confirmed to be easy.

실험예 3. 시각화 대상 유전자의 농도에 따른 정량성 확인Experimental Example 3. Confirmation of quantification according to concentration of visualization target gene

시각화 대상 DNA의 용액 농도를 78 fmol/uL부터 2배씩 희석하여 각각 39 fmol/uL, 19.5 fmol/uL, 9.75 fmol/uL 및 4.875 fmol/uL의 DNA 용액을 제조하였다 (M13mp18 ssDNA 농도는 78 fmol/uL로 고정). 그 다음, 50 nM YOYO-1 (5 % BME)과 1:1 로 섞어 2 ul 를 상기 마이크로채널 주입부에 흘려주었다. 상기 현미경으로 관찰하였다. 현미경으로 좁은 채널을 모두 측정하고 Image J에서 분석하였다. Image J에서 연동하는 JAVA Plugins 중 'Mol Length'를 이용하여 DNA 길이 정보를 얻고 분석하여, 그 결과를 도 9에 나타내었다.The solution concentration of the DNA to be visualized was diluted two-fold starting from 78 fmol/uL to prepare DNA solutions of 39 fmol/uL, 19.5 fmol/uL, 9.75 fmol/uL, and 4.875 fmol/uL, respectively (M13mp18 ssDNA concentration was 78 fmol/uL). fixed at uL). Next, it was mixed 1:1 with 50 nM YOYO-1 (5% BME) and 2 ul was flowed into the microchannel injection port. Observed using the above microscope. All narrow channels were measured under a microscope and analyzed in Image J. DNA length information was obtained and analyzed using 'Mol Length' among the JAVA plugins linked to Image J, and the results are shown in Figure 9.

도 9에서 확인할 수 있듯이, 시각화 대상 DNA의 농도가 증가함에 따라 반응 전에는 나타나지 않던 밴드가 나타나고 점점 진해지는 것을 알 수 있었다. 이러한 결과는, 시각화 대상 DNA의 농도에 따라 생성되는 dsDNA의 양이 증가하는 것을 의미한다.As can be seen in Figure 9, as the concentration of the DNA to be visualized increased, a band that did not appear before the reaction appeared and became increasingly darker. These results mean that the amount of dsDNA produced increases depending on the concentration of the DNA to be visualized.

다음으로, λ DNA 용액을 16 fg/uL, 8 fg/uL, 4 fg/uL, 2 fg/uL, 1 fg/uL, 0.5 fg/uL 농도로 희석하였다. 그 다음, 50 nM YOYO-1 (5 % BME) 와 1:1 로 섞어 2 ul 를 상기 마이크로채널 주입부에 흘려주었다. 상기 현미경으로 관찰하였다. 현미경으로 좁은 채널을 모두 측정하고 Image J에서 분석하였다. Image J에서 연동하는 JAVA Plugins 중 'Mol Length'를 이용하여 DNA 길이 정보를 얻고 분석하여, 그 결과를 도 10에 나타내었다.Next, the λ DNA solution was diluted to concentrations of 16 fg/uL, 8 fg/uL, 4 fg/uL, 2 fg/uL, 1 fg/uL, and 0.5 fg/uL. Next, it was mixed 1:1 with 50 nM YOYO-1 (5% BME) and 2 ul was flowed into the microchannel injection port. Observed using the above microscope. All narrow channels were measured under a microscope and analyzed in Image J. DNA length information was obtained and analyzed using 'Mol Length' among the JAVA plugins linked to Image J, and the results are shown in Figure 10.

도 10에서 확인할 수 있듯이, 0.5 fmol/uL 농도에서도 시각화 대상 유전자를 검출할 수 있음을 알 수 있었다.As can be seen in Figure 10, it was found that the gene to be visualized could be detected even at a concentration of 0.5 fmol/uL.

1: 마이크로채널 10: 시료 부착부
11: 채널 12: 상부 연결점
13: 하부 연결점 20: 입구부
30: 주입부 40: 출구부1: Microchannel 10: Sample attachment portion
11: Channel 12: Upper connection point
13: lower connection point 20: inlet
30: injection part 40: outlet part

<110> SOGANG UNIVERSITY RESEARCH FOUNDATION Sookmyung Women's university industry-academic cooperation foundation <120> Single stranded DNA probe based RNA detection method <130> PN190030 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> M13mp18 targeting oligomer <400> 1 ggaaaccgag gaaacgcaat aataacggaa taccc 35 <110> SOGANG UNIVERSITY RESEARCH FOUNDATION Sookmyung Women's university industry-academic cooperation foundation <120> Single stranded DNA probe based RNA detection method <130> PN190030 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> M13mp18 targeting oligomer <400> 1 ggaaaccgag gaaacgcaat aataacggaa taccc 35

Claims (11)

다음의 단계를 포함하는 단일 DNA 분자 수준에서의 RNA 검출 방법:
검출 대상 RNA를 준비하는 단계;
상기 검출 대상 바이러스 또는 세포로부터 추출한 RNA를 절편화하여 프라이머를 수득하는 RNA 절편화 단계;
검출 대상 RNA 서열을 파지미드에 삽입하여 재조합 파지미드를 제조하는 재조합 파지미드 제조 단계;
재조합 파지미드를 보조파지와 함께 대장균 내에 도입하여 배양하는 배양 단계;
배양 결과물로부터 환형 단일가닥 DNA를 추출하는 단계;
상기 추출된 환형 단일가닥 DNA로부터 불필요한 유전체 및 기타 DNA를 제거하여 탐침 환형 단일가닥 DNA를 수득하는 정제 단계;
상기 탐침 환형 단일가닥 DNA와 상기 절편화 단계를 통해 생성된 RNA 프라이머를 이용하여 역전사 반응을 통해 검출대상 RNA가 혼성화된 환형 표지 이중가닥 DNA를 제조하는 단계;
상기 환형 표지 이중가닥 DNA의 용이한 단일 분자 이미징을 위해 제한효소를 이용, 절단하여 검출대상 RNA가 혼성화된 선형 표지 이중가닥 DNA를 제조하는 단계;
상기 선형 표지 이중가닥 DNA를 입구부 측의 상부 연결점으로부터 하부 연결점을 향하여 경사면을 갖는 마이크로채널에 주입하는 단계; 및
상기 선형 표지 이중가닥 DNA가 상기 마이크로채널내 양전하를 띠는 하부 표면에 부착을 관찰 및 시각화 하여 바이러스 및 세포 RNA를 검출하는 단계.RNA detection method at the single DNA molecule level comprising the following steps:
Preparing RNA to be detected;
An RNA fragmentation step of fragmenting RNA extracted from the virus or cell to be detected to obtain primers;
A recombinant phagemid production step of inserting the RNA sequence to be detected into the phagemid to produce a recombinant phagemid;
A culture step of introducing and culturing the recombinant phagemid together with auxiliary phages into E. coli;
Extracting circular single-stranded DNA from the culture result;
A purification step of removing unnecessary genome and other DNA from the extracted circular single-stranded DNA to obtain probe circular single-stranded DNA;
Preparing a circular labeled double-stranded DNA hybridized with the detection target RNA through a reverse transcription reaction using the probe circular single-stranded DNA and the RNA primer generated through the fragmentation step;
For easy single-molecule imaging of the circularly labeled double-stranded DNA, cutting the circularly labeled double-stranded DNA using restriction enzymes to prepare linearly labeled double-stranded DNA hybridized to the RNA to be detected;
Injecting the linearly labeled double-stranded DNA into a microchannel having an inclined surface from the upper connection point on the inlet side toward the lower connection point; and
Detecting viral and cellular RNA by observing and visualizing the attachment of the linearly labeled double-stranded DNA to the positively charged lower surface of the microchannel. 제1항에 있어서, 상기 마이크로채널은,
적어도 1개 이상의 채널로 이루어진 시료 부착부;
시료 부착부의 일 측에 연결된 입구부;
상기 선형 표지 이중가닥 DNA를 주입하기 위하여 상기 입구부에 연결된 주입부; 및
상기 시료 부착부의 다른 일 측에 연결된 출구부를 구비하고,
상기 채널은 입구부 측의 상부 연결점으로부터 하부 연결점을 향하여 경사면을 갖고,
상기 채널 내의 하부 표면은 양전하를 띠고,
상기 하나 이상의 채널은 출구부에서 서로 연통되어 상기 선형 표지 이중가닥 DNA를 회수하는 것을 특징으로 하는, 방법.The method of claim 1, wherein the microchannel is:
A sample attachment portion consisting of at least one channel;
An inlet connected to one side of the sample attachment portion;
an injection section connected to the inlet section to inject the linearly labeled double-stranded DNA; and
Provided with an outlet connected to the other side of the sample attachment portion,
The channel has an inclined surface from the upper connection point on the inlet side toward the lower connection point,
The lower surface within the channel is positively charged,
The method, characterized in that the one or more channels communicate with each other at the outlet to recover the linearly labeled double-stranded DNA. 제2항에 있어서, 상기 마이크로채널의 상부 연결점의 높이는 1 내지 50 um인, 방법.The method of claim 2, wherein the height of the upper connection point of the microchannel is 1 to 50 um. 제1항에 있어서, 상기 검출 대상 RNA는 바이러스 유래 또는 세포 유래인것인, 선형 표지 이중가닥 DNA를 포함하는 RNA 검출 방법.The method for detecting RNA comprising linearly labeled double-stranded DNA according to claim 1, wherein the RNA to be detected is derived from a virus or a cell. 제4항에 있어서, 상기 바이러스는 RNA 바이러스인 것인, 선형 표지 이중가닥 DNA를 포함하는 RNA 검출 방법.The method of claim 4, wherein the virus is an RNA virus. 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete
KR1020200002259A 2020-01-07 2020-01-07 Single stranded DNA probe based RNA detection method KR102595580B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020200002259A KR102595580B1 (en) 2020-01-07 2020-01-07 Single stranded DNA probe based RNA detection method
PCT/KR2021/000103 WO2021141369A1 (en) 2020-01-07 2021-01-06 Single-stranded dna probe-based rna detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200002259A KR102595580B1 (en) 2020-01-07 2020-01-07 Single stranded DNA probe based RNA detection method

Publications (2)

Publication Number Publication Date
KR20210089302A KR20210089302A (en) 2021-07-16
KR102595580B1 true KR102595580B1 (en) 2023-10-31

Family

ID=76788486

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200002259A KR102595580B1 (en) 2020-01-07 2020-01-07 Single stranded DNA probe based RNA detection method

Country Status (2)

Country Link
KR (1) KR102595580B1 (en)
WO (1) WO2021141369A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115233188A (en) * 2022-07-22 2022-10-25 南京理工大学 Piece-level Ni-Al 2 O 3 Preparation method of porous energy material

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018183065A (en) 2017-04-24 2018-11-22 国立大学法人広島大学 RNA detection method
JP2019201581A (en) 2018-05-23 2019-11-28 東ソー株式会社 RNA detection method

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003035709A (en) * 2001-07-19 2003-02-07 Fuji Photo Film Co Ltd Detection method for rna using dye
KR100468317B1 (en) * 2002-07-27 2005-01-27 주식회사 웰진 DNA chip using a probe DNA with single stranded large circular molecules
JP2012080871A (en) * 2009-12-14 2012-04-26 National Agriculture & Food Research Organization Method for directly detecting rna

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018183065A (en) 2017-04-24 2018-11-22 国立大学法人広島大学 RNA detection method
JP2019201581A (en) 2018-05-23 2019-11-28 東ソー株式会社 RNA detection method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF BIOCHEMISTRY AND MOLECULAR BIOLOGY, VOL. 37, NO. 4, JULY 2004, PP. 439_444
PLOS ONE, OCTOBER 2014, VOL. 9, ISSUE 10, E108401. [DOI:10.1371/JOURNAL.PONE.0108401]

Also Published As

Publication number Publication date
KR20210089302A (en) 2021-07-16
WO2021141369A1 (en) 2021-07-15

Similar Documents

Publication Publication Date Title
JP6875998B2 (en) Spatial mapping of molecular profiles of biological tissue samples
CN106521032B (en) A kind of nucleic acid amplification technologies and its application in carapuru virus detection
Tang et al. Rapid Detection of Tembusu Virus by Reverse‐Transcription, Loop‐mediated Isothermal Amplification (RT‐LAMP)
US20090226888A1 (en) Diagnostic Primers And Method For Detecting Avian Influenza Virus Subtype H5 And H5N1
KR20180052317A (en) Primer set for detection of MERS-coronavirus and uses thereof
KR101149422B1 (en) Primers and its application in multiplex PCR to identify Rinderpest, Peste-des-petits-ruminants virus, Bluetongue virus and Rift Valley fever
CN113025748A (en) Primer composition and kit for rapidly detecting 69-70del mutation of novel coronavirus
CN113046475A (en) Primer composition and kit for rapidly detecting mutant type novel coronavirus
KR102595580B1 (en) Single stranded DNA probe based RNA detection method
CN106947834B (en) Multiplex PCR method for detecting six duck susceptibility viruses
Jung et al. Differentiation between porcine epidemic diarrhea virus and transmissible gastroenteritis virus in formalin-fixed paraffin-embedded tissues by multiplex RT-nested PCR and comparison with in situ hybridization
KR102018079B1 (en) Primer set for detection of MERS-coronavirus and uses thereof
CN113046476A (en) Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus
WO2006132601A1 (en) Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1
JP5997764B2 (en) Torque tenovirus diagnosis
CN112941240B (en) Primer pair, kit and method for detecting goose astrovirus and goose goblet virus
CN1922330A (en) Rnai agents for anti-sars coronavirus therapy
JP5835683B2 (en) Rapid simultaneous detection of bovine group A rotavirus and bovine coronavirus
CN113151585A (en) Primer composition and kit for rapidly detecting mutation of novel coronavirus D614G
CN115968408A (en) Detection of low abundance nucleic acids
JP2010516231A (en) Human erythrovirus
JP3752102B2 (en) Method for detecting small spherical viruses
Truong et al. Development of ultra-rapid PCR system for genotyping of Sacbrood virus
KR101566402B1 (en) Diagnostic Multiplex Kit for White Spot Syndrome Virus Using Microarray Chip
CN114592091B (en) Kit for detecting rhabdovirus of micropterus salmoides and detection method thereof

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant