KR102564765B1 - Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient - Google Patents

Abstract

The present invention uses plant-derived exosomes selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata -derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof as an active ingredient. It relates to a cosmetic composition for anti-inflammatory and skin soothing comprising. The plant-derived exosome provided from the present invention not only relieves the inflammatory response by reducing the expression of the COX-2 gene and the iNOS gene in skin cells, but also has excellent skin cell protection effects from ultraviolet rays, so it is anti-inflammatory and skin soothing It can be used as a cosmetic composition.

Description

Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient}

The present invention relates to a cosmetic composition for anti-inflammatory and skin soothing comprising plant-derived exosomes as an active ingredient.

Skin is the outermost tissue of the body that directly contacts the external environment and accounts for about 7% of an adult's body weight, and is composed of an epidermal layer, a dermal layer, and a subcutaneous tissue. The skin, which serves as a barrier between the internal and external environment of the human body, has various functions such as blocking ultraviolet rays, preventing the invasion of dangerous factors such as bacteria and toxins, regulating body temperature through secretion of sweat, and regulating moisture to maintain body homeostasis through basic metabolism. responsible for physiological functions. Such damage to the skin eventually causes a problem of increased skin irritation due to accelerated skin aging and decreased skin barrier function due to a decrease in collagen synthesis in the skin due to an increase in active oxygen in the skin and an increase in collagen decomposition.

The main cause of external stimulation to the skin is ultraviolet rays, but there are also various other factors such as soot, fine dust, yellow dust, heavy metals, and pathogenic microorganisms. It destroys the system, leading to skin cell damage and cell death. Active oxygen in the skin increases, which accelerates skin aging due to a decrease in collagen synthesis and an increase in collagen degradation in the skin. In addition, the skin barrier function that protects the human body from the external environment is reduced, resulting in increased skin irritation.

On the other hand, Lavender ( Lavandula angustifolia ) is a perennial evergreen shrub that lives in the Mediterranean coast of the Lamiaceae family, and its leaves are linear, gray-green, and covered with white hairs. Lavender's unique fragrant and subtle scent, especially lavender oil obtained by distilling flowers, is often used as a raw material for perfumes and cosmetics. One of the representative effects of lavender is the calming effect of calming the mind and stabilizing the nerves. In addition, it has long been effective in relieving pain enough to be called a natural pain reliever, smoothing blood flow, improving overall health of blood vessels, and preventing and improving vascular diseases such as high blood pressure. It has a cell regeneration effect on the skin, so it has been used as a medicine for its efficacy, such as relieving skin troubles, recovering wounds, and improving the symptoms of skin diseases caused by inflammation such as atopy or dermatitis. It was launched as a prescription drug that treats a wide range of skin diseases.

Houttuynia cordata is a dicotyledonous perennial herb belonging to the family of 300 and is called medicinal buckwheat because it looks similar to buckwheat leaves. It contains essential oil components that account for about 0.005% of the whole plant, including the leaves and roots. Eoseongcho's essential oil components include Decanoyl acetaldehyde, Myrcene, Lauric aldehyde, Capric aldehyde, etc. It is known to have an excellent effect on excreting harmful substances and heavy metals accumulated in the body. Quercetin, which is contained in large amounts in Eoseongcho, expands the capillaries of the scalp and has an antibacterial and anti-inflammatory effect, which is effective in improving acne and various skin troubles.

Tea tree ( Melaleuca alternifolia , Tea Tree) is a kind of herb of the myrtle family of the dicotyledonous plant. Tea tree has long been used as a medicinal plant. As active ingredients of tea tree, the main components of typical tea tree oil, such as 4-Terpineol, pinene, α- and γ-terpinene, are resistant to bacteria, viruses or It has antibacterial and antifungal effects, such as relieving inflammation caused by fungi, and is also known to have skin cleansing effects. In addition, it is used as a medicine because it is highly effective in relieving inflammation such as skin troubles, athlete's foot, herpes, and insect bites.

Exosome is a substance of nanovesicles secreted by cells that has intercellular signal transmission function. , plants have exosomes of various sizes depending on their origin. All animal, plant and microbial cells secrete exosomes, which are the smallest unit of cells and contain proteins, nucleic acids (DNA, messenger RNA or micro RNA, etc.), lipids, metabolites, etc. includes Exosomes promote skin regeneration, relieve skin inflammation, and promote the production of substances beneficial to the skin, such as collagen and hyaluronic acid. In particular, it has been proven to improve skin tone, improve skin elasticity and fine wrinkles due to increased skin moisturization and increased collagen synthesis, and improve acne skin and atopic dermatitis by relieving skin inflammation.

Despite these characteristics, research on exosomes and applied products are still incomplete. One of the reasons for this is that the method for obtaining exosomes is still limited, and that method is inefficient as it can extract only a small amount from all exosomes, so it is essential to improve the method for research and product commercialization. am.

As an anti-inflammatory and skin soothing cosmetic composition technology using exosomes, in Korea, Korean Patent Registration No. 10-2192317 "Composition for skin soothing containing exosomes derived from natural extracts as an active ingredient", Korean Registered Patent Publication No. No. 10-2159394 「Composition for improving skin conditions containing exosomes derived from bird's nest as an active ingredient」, Korean Patent Registration No. 10-2170387 「Lyophilized preparation of stem cell-derived exosomes and containing it as an active ingredient A composition for preventing, suppressing, alleviating, improving, or treating acne,” and the like are disclosed.

However, using plant-derived exosomes selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Eoseongcho ( Houttuynia cordata )-derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof There is no research on a cosmetic composition capable of simultaneously imparting anti-inflammatory and skin soothing effects.

Accordingly, the present inventors found that plant-derived exosomes selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata -derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes are suitable for skin It was found that not only does it reduce the expression of the COX-2 gene and iNOS gene in cells to alleviate the inflammatory response, but it also has an excellent effect of protecting skin cells from UV stimulation, so it can impart anti-inflammatory and skin soothing effects at the same time, and the present invention has completed

Republic of Korea Patent Registration No. 10-2192317 Republic of Korea Patent Registration No. 10-2159394 Republic of Korea Patent Registration No. 10-2170387

An object of the present invention is to provide a cosmetic composition for anti-inflammatory and skin soothing of plant-derived exosomes.

Another object of the present invention is to provide a cosmetic comprising the composition.

In order to achieve the above object, the present invention is selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata ( Houttuynia cordata )-derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof It provides an anti-inflammatory and skin soothing cosmetic composition comprising plant-derived exosomes as an active ingredient.

In the present invention, the lavender-derived exosomes are characterized in that they are lavender leaf cell-derived exosomes.

In the present invention, the exosomes derived from Hoseongcho are characterized in that they are exosomes derived from leaves of Hoseongcho.

In the present invention, the exosomes derived from tea tree are characterized in that they are exosomes derived from tea tree leaves.

In the present invention, the mixed exosomes are characterized in that lavender-derived exosomes, Eoseongcho-derived exosomes, and tea tree-derived exosomes are mixed in a weight ratio of 1:0.5 to 2:0.5 to 2.

In the present invention, the exosome is characterized in that the average particle size is 50 ~ 250 nm of extracellular vesicles (extracellular vesicles).

In the present invention, the exosome is characterized in that it comprises a particle number of 1x10 ⁷ ~ 1x10 ⁹ particles/mL.

In the present invention, the exosome is characterized in that it contains a protein concentration of 100 ~ 300ug / mL.

In the present invention, the plant-derived exosome is characterized in that it is included in 0.1 to 30% by weight based on the total weight of the composition.

In addition, the present invention provides a cosmetic comprising the composition.

The plant-derived exosome provided from the present invention not only relieves the inflammatory response by reducing the expression of the COX-2 gene and the iNOS gene in skin cells, but also has excellent skin cell protection effects from ultraviolet rays, so it is anti-inflammatory and skin soothing It can be used as a cosmetic composition.

1 shows the measurement of exosome size and concentration of lavender leaf cell-derived exosomes using NTA equipment (ZetaView, Particle Metrix, German).
2 is a measurement of the size and concentration of exosomes derived from Eoseongcho using NTA equipment (ZetaView, Particle Metrix, German).
Figure 3 is a measurement of the size and concentration of tea tree-derived exosomes using NTA equipment (ZetaView, Particle Metrix, German).
4 is a graph showing the protein content of exosomes derived from lavender leaf cells, exosomes derived from Houttuynia cordata, and exosomes derived from tea tree.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclatures used herein are those well known and commonly used in the art.

Throughout the present specification, when a certain component is said to "include", it means that it may further include other components without excluding other components unless otherwise stated.

According to one embodiment of the present invention, the present invention is selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata ( Houttuynia cordata )-derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof It relates to an anti-inflammatory and skin soothing cosmetic composition comprising plant-derived exosomes as an active ingredient.

According to one embodiment of the present invention, the lavender-derived exosomes are exosomes derived from lavender leaf cells, and more specifically, exosomes derived from a culture medium obtained by filtering the cells obtained through liquid culture of lavender leaf cells and the cultured cells with filter paper. characterized by

In addition, the exosomes derived from Eoseongcho are exosomes derived from leaves of Eoseongcho, and more specifically, may be exosomes obtained through the juice of the leaves of Eoseongcho.

In addition, the tea tree-derived exosomes may be tea tree leaf-derived exosomes, and more specifically, may be exosomes obtained by extracting juice from tea tree leaves.

According to one embodiment of the present invention, the mixed exosome is preferably a mixture of lavender-derived exosomes, Houttuynia cordata-derived exosomes, and tea tree-derived exosomes in a weight ratio of 1:0.5 to 2:0.5 to 2, among which A mixture of lavender-derived exosomes, Houttuynia cordata-derived exosomes, and tea tree-derived exosomes in a weight ratio of 1:1:1 is preferable in terms of not only greatly improving the yield of exosomes, but also having the best anti-inflammatory and skin soothing effects.

According to one embodiment of the present invention, the exosomes may be extracellular vesicles having an average particle size of 50 to 250 nm, and anti-inflammatory and skin soothing effects are enhanced when the exosomes contain the above range It is preferable in terms of being possible.

In addition, the exosome may include a particle number of 1x10 ⁷ to 1x10 ⁹ particles/mL, and when the exosome contains the above range, anti-inflammatory and skin soothing effects may be enhanced.

In addition, the exosome may contain 100 ~ 300ug/mL of protein, and when the exosome contains the above range, anti-inflammatory and skin soothing effects may be enhanced.

According to one embodiment of the present invention, the plant-derived exosomes may be included in an amount of 0.1 to 30% by weight, more preferably 1 to 20% by weight, based on the total weight of the composition. If the plant-derived exosome is less than 0.1% by weight relative to the total weight of the composition, the anti-inflammatory and skin soothing effect cannot be sufficiently obtained, so the function as a composition is poor, and if it exceeds 30% by weight, it is sufficient even if it does not contain more Not only is it uneconomical because it can show efficacy, but it is also undesirable because it is difficult to use as a cosmetic because the stability and spreadability of the formulation are lowered.

As described above, plant-derived exosomes reduce the expression of the COX-2 gene and the iNOS gene in skin cells to alleviate the inflammatory response, and because they have excellent skin cell protection effects from UV stimulation, they are suitable for anti-inflammatory and skin soothing purposes. It can be used as a cosmetic composition.

According to one embodiment of the present invention, the present invention relates to a cosmetic comprising the composition.

The cosmetics can be applied for anti-inflammatory and skin soothing purposes.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it is to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. It will be self-explanatory.

<Example 1> Preparation of exosomes derived from lavender leaf cells

(1) Disinfection of lavender seeds and induction of leaf cells

Lavender seeds (Chilternseeds, UK) were immersed in 70% ethanol for 60 seconds, disinfected with a disinfectant solution (50% bleach + 0.1% Tween-20) for 20 minutes, and then washed three or more times with sterile water. Seeds were planted on basic MS medium for germination. After germination, the true leaves of the 8-week-old plant were cut with a sharp knife, measuring 2*4 mm in length and width, and 1.5 mg/L NAA (1-Naphthaleneacetic acid) and 1.0 mg/L 6-BA (6-Benzylaminopurine) were added. , 0.5 mg/L 2,4-D (2,4-Dichlorophenoxyacetic acid), 3% sucrose, and 0.4% gelrite in the basic MS medium containing 25 ℃, 70% humidity in the dark culture conditions, the cell mass Callus was induced. The state of callus cell induction was frequently observed under a microscope. Excellent cell lines were selected through subculture 3 to 4 times at intervals of 4 weeks in a solid medium, and the selected excellent cell lines were placed in a 10 L bioreactor (Bioreactor) at a temperature of 23 ± 2 ° C. ), callus culture was performed by liquid suspension culture for 3 to 4 weeks with an air supply of 0.2 vvm, and a culture medium was prepared accordingly.

(2) Preparation of exosomes derived from lavender leaf cells

For the production of lavender leaf cell-derived exosomes, lavender leaf cells cultured in a bioreactor of liquid suspension culture were taken at a weight ratio of 10% leaf cell culture medium and 90% (w/w) culture medium of cell culture, and cultured cells using a homogenizer was pulverized at a speed of 50-100 rpm together with the culture medium. The pulverized solution was filtered through a 400 um mesh, and then centrifuged at 1,500 to 2,000 xg for 20 to 30 minutes using a centrifuge, and only the supernatant was taken to separate and remove cell residues. After the supernatant extract was centrifuged at 100,000 to 150,000 xg for 2 hours using an ultra-high speed centrifuge, the exosomes were settled in the pellet layer and then redispersed to separate the exosomes. The exosomes derived from lavender leaf cells obtained above were dissolved in DNase/RNase free water, and then filtered through a 0.22 μm filter to remove bacteria. The finally obtained lavender leaf cell-derived exosomes were checked for size and concentration using NTA equipment (ZetaView, Particle Metrix, German).

As a result, as can be seen in FIG. 1, it was confirmed that the exosomes derived from lavender leaf cells were extracellular vesicles having an average particle size of 228.1 nm, and the number of particles was 1.0x10 ¹⁰ particles/mL.

<Example 2> Preparation of Eoseongcho-derived exosomes

(1) Juice of Eoseongcho leaves

After washing raw fish (Jecheon herbal medicine, Yeongcheon, Gyeongsangbuk-do) cleanly and removing water, 10 to 20 times the weight of purified water was added to the washed fish fish leaves in a general grinder, and grinding was performed at a speed of 30 to 50 rpm. The leaf grinding liquid was removed from the suspended matter through a 400 um mesh. The recovered Eoseongcho leaf pulverized liquid was used as a sample for exosome analysis.

(2) Manufacture of Eoseongcho-derived exosomes

For the preparation of Eoseongcho-derived exosomes, 10 to 20 times the weight of purified water was first added to the ground liquid of Eoseongcho leaves. After centrifugation at 3,000 to 4,000 xg for 20 minutes using a centrifuge, only the supernatant was taken to separate and remove cell residues. The above step was performed once more to remove impurities. After the supernatant extract was centrifuged at 100,000 to 150,000 xg for 2 hours using an ultra-high-speed centrifuge, the exosomes were settled in a pellet layer and redispersed in sterile water to separate the exosomes. Eoseongcho-derived exosomes obtained above were filtered through a 0.22 μm filter to perform disinfection. The size and concentration of the finally obtained Eoseongcho-derived exosomes were confirmed using NTA equipment (ZetaView, Particle Metrix, German).

As a result, as can be seen in Figure 2, it was confirmed that the exosomes derived from Eoseongcho were extracellular vesicles having an average particle size of 181.4 nm, and the number of particles was 1.2x10 ⁹ particles / mL.

<Example 3> Preparation of exosomes derived from tea tree

(1) Juice of tea tree leaves

Tea tree leaves (Yedam Flower, Goyang, Gyeonggi-do) were washed and dried, and then 10 to 20 times the weight of purified water was added to the washed tea tree leaves in a general grinder and pulverized at a speed of 30 to 50 rpm. The suspended matter was removed from the powdered tea tree leaf solution through a 400 um mesh. The collected tea tree leaf powder was used as a sample for exosome analysis.

(2) Production of tea tree-derived exosomes

To prepare tea tree-derived exosomes, 10 to 20 times the weight of purified water was first added to the tea tree leaf pulverized liquid. After centrifugation at 3,000 to 4,000 xg for 20 minutes using a centrifuge, only the supernatant was taken to separate and remove cell residues. The above step was performed once more to remove impurities. After the supernatant extract was centrifuged at 100,000 to 150,000 xg for 2 hours using an ultra-high-speed centrifuge, the exosomes were settled in a pellet layer and redispersed in sterile water to separate the exosomes. The tea tree-derived exosomes obtained above were filtered through a 0.22 μm filter to remove bacteria. The size and concentration of the finally obtained tea tree-derived exosomes were confirmed using NTA equipment (ZetaView, Particle Metrix, German).

As a result, as can be seen in FIG. 3, it was confirmed that the tea tree-derived exosomes were extracellular vesicles having an average particle size of 132.5 nm, and the number of particles was 1.6x10 ¹⁰ particles/mL.

<Experimental Example 1> Analysis of the yield increase effect of exosomes

Quantitative analysis (particle size, particle number) of plant-derived exosomes obtained in Examples 1 to 3 was measured using a nano tracking analyzer (Nano Tracking Analyzer; NTA, ZetaView TWIN, Particle Metrix, German), and this device Analysis was performed using ZetaView software, an analysis program of .

The plant-derived exosomes obtained in Examples 1 to 3 were measured for protein concentration through Bicinchoninic Acid (BCA) assay, which is generally used for quantitative and molecular biological evaluation. 20 μl of plant-derived exosome samples obtained in Examples 1 to 3 and 180 μl of BCA sample were mixed in a 96-well plate, and then reacted at 37° C. for 1 hour while blocking light with foil. Then, absorbance was measured at a wavelength of 562 nm using a Microplate reader (BioTek). For the protein concentration through the measured absorbance, obtain a standard curve of absorbance using bovine serum albumin (BSA), a standard protein material provided with the reagent, and then use this standard curve to determine the concentration of the sample protein. Concentrations were analyzed. The concentration of sample protein using each exosome was measured after setting the number of particles to one billion (1.0x10 ⁹ particles/mL).

As a result, as can be seen in FIG. 4, the exosomes derived from lavender leaf cells had a protein concentration of 219.3ug/mL, the exosomes derived from Eoseongcho had a protein concentration of 193.1ug/mL, and the exosomes derived from tea tree had a protein concentration of 219.3ug/mL. It was confirmed that it was 170.6ug/mL.

<Experimental Example 2> Evaluation of cell activity through skin cell culture

HaCaT cells (Human epidermal keratinocyte, keratinocyte) and Detroit 551 cells (Human skin fibroblast, fibroblast) were mixed in DMEM containing 10% FBS (Fetal Bovine Serum) and 1% penicillin/streptomycin (GIBCO, 10,000 U/mL), respectively. (Dubelcco's Modified Eagle's Medium) medium was used and cultured for 24 hours in an incubator under conditions of 37°C and 5% CO ₂ . The cultured cells were dispensed in a 96 well plate at a concentration of 0.5 X 10 ⁴ cells per well, cultured in an incubator at 37°C and 5% CO ₂ , and adhered to the plate. After 24 hours, the cells were treated with the control group to which purified water was added and the plant-derived exosomes obtained in Examples 1 to 3, which are test materials, and further cultured for 24 hours. Each well was treated with 10% WST-1 reagent. . At this time. The processing concentration of each exosome is determined by billions (1.0x10 ⁹ particles/mL) based on 100% concentration, and each exosome is 10% (1.0x10 ⁸ particles/mL) and 5% (5.0x10 ⁷ particles/mL). ), treated at a concentration of 1% (1.0x10 ⁷ particles/mL). After reacting in an incubator for 2 hours, the absorbance value was measured at 450 nm using a Microplate reader (BioTeck), and cell viability (%) was measured according to the following formula.

Cell viability (%) = [(absorbance of test substance)/(absorbance of control group)] X 100

division Treatment concentration (%) HaCaT
Cell viability (%) Detroit 551
Cell viability (%) control group - 100 100 Exosomes derived from lavender leaf cells One 105 106 5 112 118 10 128 130 Eoseongcho-derived exosome One 102 106 5 109 110 10 118 116 Tea tree-derived exosomes One 105 102 5 110 108 10 118 119

As a result, as can be seen in Table 1 above, the exosomes derived from lavender leaf cells, exosomes derived from Houttuynia cordata, and exosomes derived from tea tree were keratinocytes, HaCaT cells (Human epidermal keratinocytes), and fibroblasts, at 1-10% treatment concentration. In Detroit 551 cells (Human skin fibroblast), it was confirmed that not only did not show intracellular toxicity, but also cell viability (%) increased in a concentration dependent manner. Therefore, it was confirmed that the exosomes derived from lavender leaf cells, the exosomes derived from Houttuynia cordata, and the exosomes derived from tea tree are safe substances that increase cell survival in a concentration-dependent manner with low possibility of skin irritation because they do not stimulate cells.

<Experimental Example 3> Test to confirm skin cell protection effect from UV stimulation

In order to examine whether the plant-derived exosomes obtained in Examples 1 to 3 have an effect of protecting skin cells from UV stimulation, changes in cell viability were examined. To this end, HaCaT cells were seeded in a 96-well plate and cultured for 24 hours under cell culture conditions. Thereafter, UVB was irradiated, and the cells were treated with the control and the composition as the test substance to which purified water was added, and further cultured for 24 hours. As a light source used for UV irradiation, an Ultraviolet crosslinker (Ultra-Violet Products, Cat No. CL-1000) emitting ultraviolet rays with a wavelength of 302 nm was used. Subsequently, cell viability was measured using MTT assay to confirm whether skin cell damage was protected by UV induction.

division UVB Treatment concentration (%) Cell viability (%) Control (UVB-) - - 100.0 Control (UVB+) + - 30.2 Exosomes derived from lavender leaf cells One 65.3 5 78.2 10 85.5 Eoseongcho-derived exosome One 60.5 5 75.2 10 83.2 Tea tree-derived exosomes One 58.1 5 63.5 10 71.5 Mixed exosomes (1:1:1) One 65.7 5 79.9 10 88.4

As a result, as can be seen in Table 2, the mixed exosomes of lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes and lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes are When compared with the control group (UVB+) irradiated with ultraviolet light, the cell viability increased in a concentration-dependent manner, confirming the cell protection effect by ultraviolet irradiation.

Therefore, it was confirmed that the exosomes derived from lavender leaf cells, the exosomes derived from Houttuynia cordata, the exosomes derived from tea tree, and the plant mixed exosomes protect cells from UV rays and increase the survival rate.

<Experimental Example 4> Inflammation inhibitory effect confirmation test

In order to investigate whether the plant-derived exosomes obtained in Examples 1 to 3 have skin inflammation inhibition and soothing effects, changes in the expression of COX-2 (Cyclooxygenase-2) and iNOS (Inducible nitric oxide synthase) involved in the inflammatory response were examined. investigated. Unlike COX-1 and COX-3, which are constantly expressed in tissues, COX-2 is an inducible enzyme induced by growth factors, inflammatory factors, oxidative stress, trauma, oncogenes, or cytokines. Similarly, iNOS, like COX-2, is not normally present in cells, but is expressed by inflammatory and cancer-inducing factors such as interleukin-1 (IL-1), tumor necrosis factor-α (TNF-α), and lipopolysaccharide (LPS). When this is induced, a large amount of nitric oxide (NO) is produced for a long time, and the generated NO exhibits harmful effects to the body such as pathological vasodilation, cytotoxicity, and tissue damage.

In order to confirm the anti-inflammatory effect of exosomes, HaCaT cells were seeded in a 96-well plate and cultured for 24 hours under cell culture conditions. Thereafter, an inflammatory response was induced through UVB irradiation, and the exosomes derived from lavender leaf cells obtained in Examples 1 to 3, the control and the test substance to which purified water was added, exosomes derived from eoseongcho, and exosomes derived from tea tree and derived from lavender leaf cells Exosomes, exosomes derived from Eoseongcho, and exosomes derived from tea tree were mixed in a weight ratio of 1:1:1 to the cells and further cultured for 4 hours. Real-time PCR was performed to confirm COX-2 and iNOS at the genetic level, and a mixture containing Cyber Green (SYBR Green supermis, Applied Biosystems, USA) was used for RNA isolation and cDNA synthesis. The primers used in the experiment were ORIGENE's COX2 (PTGS2) Human qPCR Primer pair (Cat. HP200900) and iNOS (NOS2) Human qPCR Primer pair (Cat. HP200591), and the COX-2 and iNOS mRNA expression levels of each sample was quantified with GADPH (Cat. HP205798). The nucleotide sequence of each primer is shown in Table 3 below, and the gene expression rates of COX-2 and iNOS according to plant-derived exosomes are shown in Table 4.

gene Accession No. Forward primer Reverse Primer COX-2 NM_000963 SEQ ID NO: 1:
CGGTGAAACTCTGGCTAGACAG SEQ ID NO: 2:
GCAAACCGTAGATGCTCAGGGA iNOS NM_000625 SEQ ID NO: 3:
GCTCTACACCTCCAATGTGACC SEQ ID NO: 4:
CTGCCGAGATTTGAGGCCTCATG GADPH NM_002046 SEQ ID NO: 5:
GTCTCCTCTGACTTCAACAGCG SEQ ID NO: 6:
ACCACCCTGTTGCTGTAGCCAA

division UVB Treatment concentration (%) COX-2 gene expression rate iNOS gene expression rate Control (UVB-) - - 0.11 0.12 Control (UVB+) + - 1.00 1.00 Exosomes derived from lavender leaf cells One 0.82 0.90 5 0.75 0.81 10 0.69 0.69 Eoseongcho-derived exosome One 0.91 0.90 5 0.81 0.83 10 0.71 0.69 Tea tree-derived exosomes One 0.84 0.89 5 0.76 0.79 10 0.71 0.70 Mixed exosomes (1:1:1) One 0.78 0.81 5 0.68 0.71 10 0.54 0.58

As a result, as can be seen in Table 4, the mixed exosomes of lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes and lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes are Compared to the control group irradiated with ultraviolet light in skin cells, the expression of COX-2 and iNOS was reduced in a concentration-dependent manner to confirm the effect of relieving the inflammatory response, which can be expected to have a skin soothing effect due to relieving inflammation.

Therefore, it was confirmed that the exosomes derived from lavender leaf cells, the exosomes derived from Houttuynia cordata, the exosomes derived from tea tree, and the plant mixed exosomes had anti-inflammatory and skin soothing effects.

Having described specific parts of the present invention in detail above, it will be clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the invention will be defined by the appended claims and their equivalents.

Claims (10)

Lavender ( Lavandula angustifolia ) Leaf cell-derived exosomes, Eoseongcho ( Houttuynia cordata ) leaf-derived exosomes and tea tree ( Melaleuca alternifolia ) leaf-derived exosomes are mixed in a weight ratio of 1: 1: 1 Plant-derived exosomes A cosmetic composition for skin protection against ultraviolet rays comprising as an active ingredient.
delete delete delete delete According to claim 1, wherein the exosome is an average particle size of 50 ~ 250 nm of extracellular vesicles (extracellular vesicles) characterized in that the plant-derived exosomes as an active ingredient a cosmetic composition for skin protection against ultraviolet rays.
According to claim 1, wherein the exosomes 1x10 ⁷ ~ 1x10 ⁹ Particle number of particles / mL characterized in that it comprises a plant-derived exosomes as an active ingredient a cosmetic composition for skin protection against ultraviolet rays.
According to claim 1, wherein the exosomes are 100 ~ 300ug / mL of protein comprising a plant-derived exosomes as an active ingredient characterized in that the cosmetic composition for skin protection against ultraviolet rays.
According to claim 1, wherein the plant-derived exosome is 0.1 to 30% by weight relative to the total weight of the composition A cosmetic composition for skin protection against ultraviolet rays containing a plant-derived exosome as an active ingredient.
A cosmetic comprising the composition of any one of claims 1, 6, 7, 8 and 9.