KR102564765B1 - Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient - Google Patents
Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient Download PDFInfo
- Publication number
- KR102564765B1 KR102564765B1 KR1020220137838A KR20220137838A KR102564765B1 KR 102564765 B1 KR102564765 B1 KR 102564765B1 KR 1020220137838 A KR1020220137838 A KR 1020220137838A KR 20220137838 A KR20220137838 A KR 20220137838A KR 102564765 B1 KR102564765 B1 KR 102564765B1
- Authority
- KR
- South Korea
- Prior art keywords
- exosomes
- derived
- skin
- plant
- derived exosomes
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9789—Magnoliopsida [dicotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/005—Preparations for sensitive skin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Dermatology (AREA)
- Botany (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
본 발명은 라벤다(Lavandula angustifolia) 유래 엑소좀, 어성초(Houttuynia cordata) 유래 엑소좀, 티트리(Melaleuca alternifolia) 유래 엑소좀 및 이들의 혼합 엑소좀으로 이루어진 군으로부터 선택되는 식물 유래 엑소좀을 유효성분으로 포함하는 항염 및 피부 진정용 화장료 조성물에 관한 것이다. 본 발명으로부터 제공되는 식물 유래 엑소좀은 피부 세포에서 COX-2 유전자 및 iNOS 유전자의 발현을 감소시켜 염증 반응을 완화시킬 뿐만 아니라, 자외선 자극으로부터 피부세포 보호 효과가 우수하기 때문에, 항염 및 피부 진정용 화장료 조성물로 활용 가능하다. The present invention uses plant-derived exosomes selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata -derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof as an active ingredient. It relates to a cosmetic composition for anti-inflammatory and skin soothing comprising. The plant-derived exosome provided from the present invention not only relieves the inflammatory response by reducing the expression of the COX-2 gene and the iNOS gene in skin cells, but also has excellent skin cell protection effects from ultraviolet rays, so it is anti-inflammatory and skin soothing It can be used as a cosmetic composition.
Description
본 발명은 식물 유래 엑소좀을 유효성분으로 포함하는 항염 및 피부 진정용 화장료 조성물에 관한 것이다.The present invention relates to a cosmetic composition for anti-inflammatory and skin soothing comprising plant-derived exosomes as an active ingredient.
피부는 외부 환경과 직접 접촉하는 신체의 가장 외부 조직으로 성인 몸무게의 약 7%를 차지하며 표피층, 진피층 및 피하조직으로 구성된다. 인체의 내부와 외부 환경 사이의 장벽 역할을 수행하는 피부는 기본 신진대사를 통해 몸의 항상성 유지를 위해 자외선 차단, 세균과 독소 등 위험 요소의 침입 방지, 땀의 분비로 체온 조절, 수분 조절 등 다양한 생리적 기능을 담당한다. 이런 피부의 손상은 결국 피부 속 활성 산소의 증가로 인한 피부 속 콜라겐 합성의 감소, 콜라겐 분해의 증가로 인해 피부 노화 촉진 및 피부 장벽 기능 저하로 피부 자극이 증가하는 문제가 발생한다.Skin is the outermost tissue of the body that directly contacts the external environment and accounts for about 7% of an adult's body weight, and is composed of an epidermal layer, a dermal layer, and a subcutaneous tissue. The skin, which serves as a barrier between the internal and external environment of the human body, has various functions such as blocking ultraviolet rays, preventing the invasion of dangerous factors such as bacteria and toxins, regulating body temperature through secretion of sweat, and regulating moisture to maintain body homeostasis through basic metabolism. responsible for physiological functions. Such damage to the skin eventually causes a problem of increased skin irritation due to accelerated skin aging and decreased skin barrier function due to a decrease in collagen synthesis in the skin due to an increase in active oxygen in the skin and an increase in collagen decomposition.
피부에 미치는 외부 자극의 주원인은 자외선이지만 그와 더불어 매연, 미세먼지, 황사, 중금속, 병원성 미생물 등 다양하며, 이들은 피부의 산화적 스트레스를 유도하여 활성산소(Reactive oxygen species, ROS)를 생성함으로써 항산화 시스템을 파괴하여 피부 세포 손상 및 세포 사멸에 이르게 된다. 피부 속 활성 산소가 증가하게 되고 이로 인해 피부 속 콜라겐 합성 감소 및 콜라겐 분해 증가로 인해 피부 노화가 촉진되다. 또한 인간의 몸을 외부 환경으로부터 보호하는 피부 장벽 기능 저하되어 피부 자극이 증가하는 문제가 증가하고 있다.The main cause of external stimulation to the skin is ultraviolet rays, but there are also various other factors such as soot, fine dust, yellow dust, heavy metals, and pathogenic microorganisms. It destroys the system, leading to skin cell damage and cell death. Active oxygen in the skin increases, which accelerates skin aging due to a decrease in collagen synthesis and an increase in collagen degradation in the skin. In addition, the skin barrier function that protects the human body from the external environment is reduced, resulting in increased skin irritation.
한편, 라벤다(Lavandula angustifolia)는 꿀풀과의 지중해 연안에 많이 서식하는 다년생 상록 소관목으로 잎은 선형이고 회녹색을 띠며, 흰 털로 덮여 있다. 라벤더 특유의 향긋하고 은은한 향, 특히 꽃을 증류해서 얻는 라벤더유(油)는 향수 및 화장품의 원료로 많이 사용된다. 라벤더의 효능 중 대표적인 것은 마음을 편안하게 해 주고 신경을 안정시켜주는 신경안정 효과이다. 또한 오래전부터 천연 진통제라 할 만큼 통증을 완화하는데 효과가 좋았고, 혈액의 흐름을 원활하게 하고, 혈관의 전반적인 건강 증진 및 고혈압과 같은 혈관계 질환들을 예방하고 개선하는데 효과적이다. 피부에 있어서 세포 재생효과가 있어 피부 트러블 완화, 상처 회복 및 아토피나 피부염 등과 같은 염증으로 인한 피부 질환들의 증상을 개선등 효능은 의약품으로도 사용이 되어져 왔는데, 1985년 에이프로젠제약회사는 라벤다 크림을 광범위 피부 질환 치료제인 전문의약품으로 출시하였다.On the other hand, Lavender ( Lavandula angustifolia ) is a perennial evergreen shrub that lives in the Mediterranean coast of the Lamiaceae family, and its leaves are linear, gray-green, and covered with white hairs. Lavender's unique fragrant and subtle scent, especially lavender oil obtained by distilling flowers, is often used as a raw material for perfumes and cosmetics. One of the representative effects of lavender is the calming effect of calming the mind and stabilizing the nerves. In addition, it has long been effective in relieving pain enough to be called a natural pain reliever, smoothing blood flow, improving overall health of blood vessels, and preventing and improving vascular diseases such as high blood pressure. It has a cell regeneration effect on the skin, so it has been used as a medicine for its efficacy, such as relieving skin troubles, recovering wounds, and improving the symptoms of skin diseases caused by inflammation such as atopy or dermatitis. It was launched as a prescription drug that treats a wide range of skin diseases.
어성초(Houttuynia cordata)는 쌍떡잎식물로 삼백초과에 속하는 다년생초본으로 메밀의 잎과 비슷하게 생겼다고 해서 약모밀이라고 불리운다. 잎을 포함한 뿌리 등 전초의 약 0.005%에 해당하는 정유 성분이 들어 있는데, 이런 정유 성분에 의해 비린내가 난다고 하여 어성초(魚腥草)라고 불리운다. 어성초의 정유 성분에는 데카노일 아세트알데히드(Decanoyl acetaldehyde), 미르센(Myrcene), 라우릭 알데히드(Lauric aldehyde), 캐프릭 알데히드(Capric aldehyde) 등이 주성분으로 체내 유해한 각종 염증과 노폐물을 제거 및 미세먼지로 인해 체내에 쌓인 유해 물질과 중금속 배출에 뛰어난 효과가 알려져 있다. 어성초에 다량 들어있는 퀘르세틴(Quercetin) 성분은 두피의 모세혈관을 확장시켜 항균 및 소염 작용을 통해 여드름, 각종 피부 트러블을 개선하는데 좋은 효과가 있다. Houttuynia cordata is a dicotyledonous perennial herb belonging to the family of 300 and is called medicinal buckwheat because it looks similar to buckwheat leaves. It contains essential oil components that account for about 0.005% of the whole plant, including the leaves and roots. Eoseongcho's essential oil components include Decanoyl acetaldehyde, Myrcene, Lauric aldehyde, Capric aldehyde, etc. It is known to have an excellent effect on excreting harmful substances and heavy metals accumulated in the body. Quercetin, which is contained in large amounts in Eoseongcho, expands the capillaries of the scalp and has an antibacterial and anti-inflammatory effect, which is effective in improving acne and various skin troubles.
티트리(Melaleuca alternifolia, Tea Tree)는 쌍떡잎식물의 도금양과의 허브의 한 종류이다. 티트리는 오래 전부터 약용 식물로 사용되어 왔다. 티트리의 유효성분으로서 4-터피네올(4-Terpineol), 파이넨(pinene), α- 와 γ-터피넨(α- and γ-terpinene) 등 대표적인 티트리 오일의 주성분이 박테리아, 바이러스 또는 곰팡이 균에 의한 염증 완화등 항균성 항진균 효과가 있으며 피부 정화의 효능도 알려져 있다. 또한 피부 트러블, 무좀, 포진, 벌레 물린데 등의 염증 완화 효과가 높아 의약품으로도 사용되어진다.Tea tree ( Melaleuca alternifolia , Tea Tree) is a kind of herb of the myrtle family of the dicotyledonous plant. Tea tree has long been used as a medicinal plant. As active ingredients of tea tree, the main components of typical tea tree oil, such as 4-Terpineol, pinene, α- and γ-terpinene, are resistant to bacteria, viruses or It has antibacterial and antifungal effects, such as relieving inflammation caused by fungi, and is also known to have skin cleansing effects. In addition, it is used as a medicine because it is highly effective in relieving inflammation such as skin troubles, athlete's foot, herpes, and insect bites.
엑소좀(Exosome)은 세포가 분비하는 세포간 신호전달 기능을 갖는 나노 소립자(Nanovesicles)의 물질로 세포막의 구조와 동일한 인지질이중막(Phospholipid bilayer) 구조로 이루어진 수십 내지 수백 나노미터의 소립자를 칭하지만, 식물의 경우 그 기원에 따라 다양한 크기의 엑소좀을 지닌다. 모든 동물, 식물 및 미생물 세포는 엑소좀을 분비하며 이것은 최소 단위의 세포로 기원 세포 유래 단백질(Protein), 핵산( DNA, messenger RNA 또는 micro RNA 등), 지질(Lipids), 대사산물(metabolite) 등을 포함한다. 엑소좀은 피부 재생을 촉진하고 피부 염증을 완화하는 효과가 있으며, 콜라겐, 히알루론산 등 피부에 유익한 물질의 생산을 촉진한다. 특히, 피부톤 개선, 피부 보습 증가 및 콜라겐 합성 증대에 따른 탄력감 및 잔주름 개선, 피부 염증 완화에 의한 여드름 피부 및 아토피 피부염 개선에 있어 입증되어져 왔다.Exosome is a substance of nanovesicles secreted by cells that has intercellular signal transmission function. , plants have exosomes of various sizes depending on their origin. All animal, plant and microbial cells secrete exosomes, which are the smallest unit of cells and contain proteins, nucleic acids (DNA, messenger RNA or micro RNA, etc.), lipids, metabolites, etc. includes Exosomes promote skin regeneration, relieve skin inflammation, and promote the production of substances beneficial to the skin, such as collagen and hyaluronic acid. In particular, it has been proven to improve skin tone, improve skin elasticity and fine wrinkles due to increased skin moisturization and increased collagen synthesis, and improve acne skin and atopic dermatitis by relieving skin inflammation.
이러한 특장점에도 불구하고 엑소좀에 대한 연구와 응용된 제품들이 아직까지는 미비한 상태이다. 그 이유 중 한가지로 엑소좀을 수득할 수 있는 방법이 아직까지 제한적이고 그 방법도 전체 엑소좀 중에 극히 소량만으로 추출할 수 있는 효율성이 떨어지는 것으로 연구와 제품 상용화에 있어 그 방법을 개선하는 것이 필수적인 상황이다.Despite these characteristics, research on exosomes and applied products are still incomplete. One of the reasons for this is that the method for obtaining exosomes is still limited, and that method is inefficient as it can extract only a small amount from all exosomes, so it is essential to improve the method for research and product commercialization. am.
엑소좀을 이용하는 항염 및 피부 진정용 화장료 조성물 기술로는, 국내의 경우 대한민국 등록특허공보 제10-2192317호「천연 추출물 유래 엑소좀을 유효성분으로 포함하는 피부 진정용 조성물」, 대한민국 등록특허공보 제10-2159394호「바다제비집에서 유래된 엑소좀을 유효성분으로 포함하는 피부 상태 개선용 조성물」, 대한민국 등록특허공보 제10-2170387호「줄기세포 유래 엑소좀의 동결건조제제 및 이를 유효성분으로 포함하는 여드름의 예방, 억제, 완화, 개선 또는 치료용 조성물」 등이 개시되어 있다.As an anti-inflammatory and skin soothing cosmetic composition technology using exosomes, in Korea, Korean Patent Registration No. 10-2192317 "Composition for skin soothing containing exosomes derived from natural extracts as an active ingredient", Korean Registered Patent Publication No. No. 10-2159394 「Composition for improving skin conditions containing exosomes derived from bird's nest as an active ingredient」, Korean Patent Registration No. 10-2170387 「Lyophilized preparation of stem cell-derived exosomes and containing it as an active ingredient A composition for preventing, suppressing, alleviating, improving, or treating acne,” and the like are disclosed.
그러나, 아직까지 라벤다(Lavandula angustifolia) 유래 엑소좀, 어성초(Houttuynia cordata) 유래 엑소좀, 티트리(Melaleuca alternifolia) 유래 엑소좀 및 이들의 혼합 엑소좀으로 이루어진 군으로부터 선택되는 식물 유래 엑소좀을 이용하여 항염 및 피부 진정 효과를 동시에 부여할 수 있는 화장료 조성물에 대한 연구는 존재하지 않은 실정이다.However, using plant-derived exosomes selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Eoseongcho ( Houttuynia cordata )-derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof There is no research on a cosmetic composition capable of simultaneously imparting anti-inflammatory and skin soothing effects.
이에, 본 발명자들은 라벤다(Lavandula angustifolia) 유래 엑소좀, 어성초(Houttuynia cordata) 유래 엑소좀, 티트리(Melaleuca alternifolia) 유래 엑소좀 및 이들의 혼합 엑소좀으로 이루어진 군으로부터 선택되는 식물 유래 엑소좀이 피부 세포에서 COX-2 유전자 및 iNOS 유전자의 발현을 감소시켜 염증 반응을 완화시킬 뿐만 아니라 자외선 자극으로부터 피부세포 보호 효과가 우수하기 때문에, 항염 및 피부 진정 효과를 동시에 부여할 수 있다는 사실을 발견하고 본 발명을 완성하게 되었다.Accordingly, the present inventors found that plant-derived exosomes selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata -derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes are suitable for skin It was found that not only does it reduce the expression of the COX-2 gene and iNOS gene in cells to alleviate the inflammatory response, but it also has an excellent effect of protecting skin cells from UV stimulation, so it can impart anti-inflammatory and skin soothing effects at the same time, and the present invention has completed
본 발명의 목적은 식물 유래 엑소좀의 항염 및 피부 진정용 화장료 조성물을 제공하는 데 있다.An object of the present invention is to provide a cosmetic composition for anti-inflammatory and skin soothing of plant-derived exosomes.
본 발명의 다른 목적은 상기 조성물을 포함하는 화장품을 제공하는 데 있다.Another object of the present invention is to provide a cosmetic comprising the composition.
상기와 같은 목적을 달성하기 위하여, 본 발명은 라벤다(Lavandula angustifolia) 유래 엑소좀, 어성초(Houttuynia cordata) 유래 엑소좀, 티트리(Melaleuca alternifolia) 유래 엑소좀 및 이들의 혼합 엑소좀으로 이루어진 군으로부터 선택되는 식물 유래 엑소좀을 유효성분으로 포함하는 항염 및 피부 진정용 화장료 조성물을 제공한다.In order to achieve the above object, the present invention is selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata ( Houttuynia cordata )-derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof It provides an anti-inflammatory and skin soothing cosmetic composition comprising plant-derived exosomes as an active ingredient.
본 발명에 있어서, 상기 라벤다 유래 엑소좀은 라벤다 잎세포 유래 엑소좀인 것을 특징으로 한다.In the present invention, the lavender-derived exosomes are characterized in that they are lavender leaf cell-derived exosomes.
본 발명에 있어서, 상기 어성초 유래 엑소좀은 어성초 잎 유래 엑소좀인 것을 특징으로 한다.In the present invention, the exosomes derived from Hoseongcho are characterized in that they are exosomes derived from leaves of Hoseongcho.
본 발명에 있어서, 상기 티트리 유래 엑소좀은 티트리 잎 유래 엑소좀인 것을 특징으로 한다.In the present invention, the exosomes derived from tea tree are characterized in that they are exosomes derived from tea tree leaves.
본 발명에 있어서, 상기 혼합 엑소좀은 라벤다 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀이 1:0.5~2:0.5~2의 중량비로 혼합된 것을 특징으로 한다.In the present invention, the mixed exosomes are characterized in that lavender-derived exosomes, Eoseongcho-derived exosomes, and tea tree-derived exosomes are mixed in a weight ratio of 1:0.5 to 2:0.5 to 2.
본 발명에 있어서, 상기 엑소좀은 평균 입자 크기가 50 ~ 250 nm인 세포외소포체(extracellular vesicles)인 것을 특징으로 한다.In the present invention, the exosome is characterized in that the average particle size is 50 ~ 250 nm of extracellular vesicles (extracellular vesicles).
본 발명에 있어서, 상기 엑소좀은 1x107 ~ 1x109 particles/mL의 입자수를 포함하는 것을 특징으로 한다.In the present invention, the exosome is characterized in that it comprises a particle number of 1x10 7 ~ 1x10 9 particles/mL.
본 발명에 있어서, 상기 엑소좀은 100 ~ 300ug/mL의 단백질 농도를 포함하는 것을 특징으로 한다.In the present invention, the exosome is characterized in that it contains a protein concentration of 100 ~ 300ug / mL.
본 발명에 있어서, 상기 식물 유래 엑소좀은 조성물 총 중량에 대하여 0.1 내지 30 중량% 포함되는 것을 특징으로 한다.In the present invention, the plant-derived exosome is characterized in that it is included in 0.1 to 30% by weight based on the total weight of the composition.
또한, 본 발명은 상기 조성물을 포함하는 화장품을 제공한다.In addition, the present invention provides a cosmetic comprising the composition.
본 발명으로부터 제공되는 식물 유래 엑소좀은 피부 세포에서 COX-2 유전자 및 iNOS 유전자의 발현을 감소시켜 염증 반응을 완화시킬 뿐만 아니라, 자외선 자극으로부터 피부세포 보호 효과가 우수하기 때문에, 항염 및 피부 진정용 화장료 조성물로 활용 가능하다.The plant-derived exosome provided from the present invention not only relieves the inflammatory response by reducing the expression of the COX-2 gene and the iNOS gene in skin cells, but also has excellent skin cell protection effects from ultraviolet rays, so it is anti-inflammatory and skin soothing It can be used as a cosmetic composition.
도 1은 라벤더 잎세포 유래 엑소좀을 NTA 장비(ZetaView, Particle Metrix, German)를 이용하여 엑소좀의 크기 및 농도를 측정한 것이다.
도 2는 어성초 유래 엑소좀을 NTA 장비(ZetaView, Particle Metrix, German)를 이용하여 엑소좀의 크기 및 농도를 측정한 것이다.
도 3은 티트리 유래 엑소좀을 NTA 장비(ZetaView, Particle Metrix, German)를 이용하여 엑소좀의 크기 및 농도를 측정한 것이다.
도 4는 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀의 단백질 함량을 나타낸 그래프이다.
1 shows the measurement of exosome size and concentration of lavender leaf cell-derived exosomes using NTA equipment (ZetaView, Particle Metrix, German).
2 is a measurement of the size and concentration of exosomes derived from Eoseongcho using NTA equipment (ZetaView, Particle Metrix, German).
Figure 3 is a measurement of the size and concentration of tea tree-derived exosomes using NTA equipment (ZetaView, Particle Metrix, German).
4 is a graph showing the protein content of exosomes derived from lavender leaf cells, exosomes derived from Houttuynia cordata, and exosomes derived from tea tree.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 가진다. 일반적으로, 본 명세서에서 사용된 명명법 은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclatures used herein are those well known and commonly used in the art.
본원 명세서 전체에서, 어떤 부분이 어떤 구성 요소를 "포함" 한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성 요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다.Throughout the present specification, when a certain component is said to "include", it means that it may further include other components without excluding other components unless otherwise stated.
본 발명의 일 구현예에 따르면, 본 발명은 라벤다(Lavandula angustifolia) 유래 엑소좀, 어성초(Houttuynia cordata) 유래 엑소좀, 티트리(Melaleuca alternifolia) 유래 엑소좀 및 이들의 혼합 엑소좀으로 이루어진 군으로부터 선택되는 식물 유래 엑소좀을 유효성분으로 포함하는 항염 및 피부 진정용 화장료 조성물에 관한 것이다.According to one embodiment of the present invention, the present invention is selected from the group consisting of lavender ( Lavandula angustifolia )-derived exosomes, Houttuynia cordata ( Houttuynia cordata )-derived exosomes, tea tree ( Melaleuca alternifolia )-derived exosomes, and mixed exosomes thereof It relates to an anti-inflammatory and skin soothing cosmetic composition comprising plant-derived exosomes as an active ingredient.
본 발명의 일 구현예에 따르면, 상기 라벤다 유래 엑소좀은 라벤다 잎세포 유래 엑소좀이며, 더욱 상세하게는 라벤다 잎세포 액체 배양을 통해 얻어진 세포와 배양된 세포를 여과지에 걸러낸 배양액 유래 엑소좀인 것을 특징으로 한다.According to one embodiment of the present invention, the lavender-derived exosomes are exosomes derived from lavender leaf cells, and more specifically, exosomes derived from a culture medium obtained by filtering the cells obtained through liquid culture of lavender leaf cells and the cultured cells with filter paper. characterized by
또한, 상기 어성초 유래 엑소좀은 어성초 잎 유래 엑소좀이며, 더욱 상세하게는 생어성초 잎의 착즙액을 통해 수득된 엑소좀인 것일 수 있다.In addition, the exosomes derived from Eoseongcho are exosomes derived from leaves of Eoseongcho, and more specifically, may be exosomes obtained through the juice of the leaves of Eoseongcho.
또한, 상기 티트리 유래 엑소좀은 티트리 잎 유래 엑소좀이며, 더욱 상세하게는 티트리 잎의 착즙액을 통해 수득된 엑소좀인 것일 수 있다.In addition, the tea tree-derived exosomes may be tea tree leaf-derived exosomes, and more specifically, may be exosomes obtained by extracting juice from tea tree leaves.
본 발명의 일 구현예에 따르면, 상기 혼합 엑소좀은 라벤다 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀이 1:0.5~2:0.5~2의 중량비로 혼합된 것이 바람직하고, 그 중에서도 라벤다 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀이 1:1:1 중량비로 혼합된 것이 엑소좀 수득률이 크게 향상될 뿐만 아니라, 항염 및 피부 진정 효과가 가장 우수하다는 측면에서 바람직하다.According to one embodiment of the present invention, the mixed exosome is preferably a mixture of lavender-derived exosomes, Houttuynia cordata-derived exosomes, and tea tree-derived exosomes in a weight ratio of 1:0.5 to 2:0.5 to 2, among which A mixture of lavender-derived exosomes, Houttuynia cordata-derived exosomes, and tea tree-derived exosomes in a weight ratio of 1:1:1 is preferable in terms of not only greatly improving the yield of exosomes, but also having the best anti-inflammatory and skin soothing effects.
본 발명의 일 구현예에 따르면, 상기 엑소좀은 평균 입자 크기가 50 ~ 250 nm인 세포외소포체(extracellular vesicles)인 것일 수 있으며, 엑소좀이 상기 범위를 포함할 경우 항염 및 피부 진정 효과가 증진될 수 있다는 측면에서 바람직하다.According to one embodiment of the present invention, the exosomes may be extracellular vesicles having an average particle size of 50 to 250 nm, and anti-inflammatory and skin soothing effects are enhanced when the exosomes contain the above range It is preferable in terms of being possible.
또한, 상기 엑소좀은 1x107 ~ 1x109 particles/mL의 입자수를 포함하는 것일 수 있으며, 엑소좀이 상기 범위를 포함할 경우 항염 및 피부 진정 효과가 증진될 수 있다는 측면에서 바람직하다.In addition, the exosome may include a particle number of 1x10 7 to 1x10 9 particles/mL, and when the exosome contains the above range, anti-inflammatory and skin soothing effects may be enhanced.
또한, 상기 엑소좀은 100 ~ 300ug/mL의 단백질을 포함하는 것일 수 있으며, 엑소좀이 상기 범위를 포함할 경우 항염 및 피부 진정 효과가 증진될 수 있다는 측면에서 바람직하다.In addition, the exosome may contain 100 ~ 300ug/mL of protein, and when the exosome contains the above range, anti-inflammatory and skin soothing effects may be enhanced.
본 발명의 일 구현예에 따르면, 상기 식물 유래 엑소좀은 조성물 총 중량에 대하여 0.1 내지 30 중량% 포함될 수 있고, 더욱 바람직하게는 1 내지 20 중량% 포함될 수 있다. 상기 식물 유래 엑소좀이 조성물의 총 중량에 대하여 0.1 중량% 미만일 경우에는 항염 및 피부 진정 효과를 충분히 얻을 수 없기 때문에 조성물로서의 기능이 떨어지고, 30 중량%를 초과하는 경우에는 그 이상을 함유하지 않아도 충분한 효능을 나타낼 수 있기 때문에 비경제적일 뿐만 아니라, 제형의 안정성 및 발림성 등이 저하되어 화장품으로 사용에 어려움이 있기 때문에 바람직하지 않다.According to one embodiment of the present invention, the plant-derived exosomes may be included in an amount of 0.1 to 30% by weight, more preferably 1 to 20% by weight, based on the total weight of the composition. If the plant-derived exosome is less than 0.1% by weight relative to the total weight of the composition, the anti-inflammatory and skin soothing effect cannot be sufficiently obtained, so the function as a composition is poor, and if it exceeds 30% by weight, it is sufficient even if it does not contain more Not only is it uneconomical because it can show efficacy, but it is also undesirable because it is difficult to use as a cosmetic because the stability and spreadability of the formulation are lowered.
전술된 바와 같이, 식물 유래 엑소좀은 피부 세포에서 COX-2 유전자 및 iNOS 유전자의 발현을 감소시켜 염증 반응을 완화시킬 뿐만 아니라, 자외선 자극으로부터 피부세포 보호 효과가 우수하기 때문에, 항염 및 피부 진정용 화장료 조성물로 사용될 수 있다.As described above, plant-derived exosomes reduce the expression of the COX-2 gene and the iNOS gene in skin cells to alleviate the inflammatory response, and because they have excellent skin cell protection effects from UV stimulation, they are suitable for anti-inflammatory and skin soothing purposes. It can be used as a cosmetic composition.
본 발명의 일 구현예에 따르면, 본 발명은 상기 조성물을 포함하는 화장품에 관한 것이다.According to one embodiment of the present invention, the present invention relates to a cosmetic comprising the composition.
상기 화장품은 항염 및 피부 진정용으로 적용이 가능하다.The cosmetics can be applied for anti-inflammatory and skin soothing purposes.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it is to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. It will be self-explanatory.
<실시예 1> 라벤다 잎세포 유래 엑소좀 제조<Example 1> Preparation of exosomes derived from lavender leaf cells
(1) 라벤다 종자 소독 및 잎세포 유도(1) Disinfection of lavender seeds and induction of leaf cells
라벤다 종자(Chilternseeds, UK)를 70% 에탄올 60초 침지한 후, 소독액(50% 락스 + 0.1% Tween-20)으로 20분 소독한 후, 멸균수로 3회 이상 세척하였다. 종자 발아를 위해 기본 MS배지 위에 치상하였다. 발아 후, 8주 정도 된 식물체의 본엽을 날카로운 칼로 가로*세로 2*4 mm 크기의 절편체를 만들어 1.5 mg/L NAA(1-Naphthaleneacetic acid), 1.0 mg/L 6-BA(6-Benzylaminopurine), 0.5 mg/L 2,4-D(2,4-Dichlorophenoxyacetic acid), 3% Sucrose 및 0.4% gelrite가 포함된 기본 MS배지에서 25 ℃, 습도 70%의 생장상 조건으로 암배양하여 세포 덩어리인 캘러스를 유도하였다. 캘러스 세포 유도 상태를 수시로 현미경으로 관찰하였다. 고체배지 상태에서 4주 간격으로 3 ~ 4회 계대배양을 통해 우량 세포주를 선발하였고, 선발된 우량 세포주는 적정 호르몬이 포함된 MS 액체배지에서 온도 조건 23±2 ℃ 조건에서 10 L 생물반응기(Bioreactor)에 공기공급량 0.2 vvm로 3 ~ 4주간 액체 현탁 배양하여 캘러스 배양을 실시하였고, 그에 따른 배양액을 제조하였다.Lavender seeds (Chilternseeds, UK) were immersed in 70% ethanol for 60 seconds, disinfected with a disinfectant solution (50% bleach + 0.1% Tween-20) for 20 minutes, and then washed three or more times with sterile water. Seeds were planted on basic MS medium for germination. After germination, the true leaves of the 8-week-old plant were cut with a sharp knife, measuring 2*4 mm in length and width, and 1.5 mg/L NAA (1-Naphthaleneacetic acid) and 1.0 mg/L 6-BA (6-Benzylaminopurine) were added. , 0.5 mg/L 2,4-D (2,4-Dichlorophenoxyacetic acid), 3% sucrose, and 0.4% gelrite in the basic MS medium containing 25 ℃, 70% humidity in the dark culture conditions, the cell mass Callus was induced. The state of callus cell induction was frequently observed under a microscope. Excellent cell lines were selected through subculture 3 to 4 times at intervals of 4 weeks in a solid medium, and the selected excellent cell lines were placed in a 10 L bioreactor (Bioreactor) at a temperature of 23 ± 2 ° C. ), callus culture was performed by liquid suspension culture for 3 to 4 weeks with an air supply of 0.2 vvm, and a culture medium was prepared accordingly.
(2) 라벤다 잎세포 유래 엑소좀 제조(2) Preparation of exosomes derived from lavender leaf cells
라벤다 잎세포 유래 엑소좀 제조를 위해 액체 현탁 배양의 생물반응기에서 배양된 라벤다 잎세포를 잎세포 배양체 10% 및 세포 배양을 한 배양액 90%(w/w) 중량비로 취하여 homogenizer를 이용하여 배양된 세포를 배양액과 함께 50~100 rpm 속도로 분쇄하였다. 분쇄액은 400 um mesh로 거른 다음, 원심분리기를 이용하여 1,500 ~ 2,000 xg로 20 ~ 30분 동안 원심분리 후, 상등액만을 취하여 세포의 잔여물을 분리 및 제거하였다. 상등 추출액을 초고속 원심분리기를 이용하여 100,000 ~ 150,000 xg로 2시간 동안 원심분리 후, 펠렛층에 엑소좀을 가라앉힌 후 재분산하는 단계를 거쳐 엑소좀을 분리하였다. 상기에서 얻어진 라벤다 잎세포 유래 엑소좀을 DNase/RNase free water로 녹인 다음, 0.22 ㎛ 필터로 여과하여 제균 작업을 실시하였다. 최종적으로 수득된 라벤다 잎세포 유래 엑소좀을 NTA 장비(ZetaView, Particle Metrix, German)를 이용하여 크기와 농도를 확인하였다.For the production of lavender leaf cell-derived exosomes, lavender leaf cells cultured in a bioreactor of liquid suspension culture were taken at a weight ratio of 10% leaf cell culture medium and 90% (w/w) culture medium of cell culture, and cultured cells using a homogenizer was pulverized at a speed of 50-100 rpm together with the culture medium. The pulverized solution was filtered through a 400 um mesh, and then centrifuged at 1,500 to 2,000 xg for 20 to 30 minutes using a centrifuge, and only the supernatant was taken to separate and remove cell residues. After the supernatant extract was centrifuged at 100,000 to 150,000 xg for 2 hours using an ultra-high speed centrifuge, the exosomes were settled in the pellet layer and then redispersed to separate the exosomes. The exosomes derived from lavender leaf cells obtained above were dissolved in DNase/RNase free water, and then filtered through a 0.22 μm filter to remove bacteria. The finally obtained lavender leaf cell-derived exosomes were checked for size and concentration using NTA equipment (ZetaView, Particle Metrix, German).
그 결과, 도 1에서 확인할 수 있듯이, 라벤다 잎세포 유래 엑소좀은 엑소좀의 평균 입자 크기가 228.1 nm인 세포외소포체인 것을 확인할 수 있었고, 입자수는 1.0x1010 particles/mL 인 것을 확인하였다.As a result, as can be seen in FIG. 1, it was confirmed that the exosomes derived from lavender leaf cells were extracellular vesicles having an average particle size of 228.1 nm, and the number of particles was 1.0x10 10 particles/mL.
<실시예 2> 어성초 유래 엑소좀 제조<Example 2> Preparation of Eoseongcho-derived exosomes
(1) 어성초 잎의 착즙(1) Juice of Eoseongcho leaves
생어성초(제천한방약초, 경북 영천)를 깨끗이 씻어 물기를 제거한 다음, 일반 분쇄기에 세척된 어성초잎에 10~20배 중량의 정제수를 넣어 30 ~ 50 rpm의 속도로 분쇄를 수행하였으며, 수득된 어성초 잎 분쇄액은 400 um mesh를 통해 부유물을 제거하였다. 회수된 어성초 잎 분쇄액은 엑소좀 분석을 위한 시료로 사용하였다.After washing raw fish (Jecheon herbal medicine, Yeongcheon, Gyeongsangbuk-do) cleanly and removing water, 10 to 20 times the weight of purified water was added to the washed fish fish leaves in a general grinder, and grinding was performed at a speed of 30 to 50 rpm. The leaf grinding liquid was removed from the suspended matter through a 400 um mesh. The recovered Eoseongcho leaf pulverized liquid was used as a sample for exosome analysis.
(2) 어성초 유래 엑소좀 제조(2) Manufacture of Eoseongcho-derived exosomes
어성초 유래 엑소좀 제조를 위해 먼저 어성초 잎 분쇄액에 10~20배 중량의 정제수를 첨가하였다. 원심분리기를 이용하여 3,000 ~ 4,000 xg로 20분 동안 원심분리 후, 상등액만을 취하여 세포의 잔여물을 분리 및 제거하였다. 상기 단계를 한번 더 수행하여 불순물 제거하였다. 상등 추출액을 초고속 원심분리기를 이용하여 100,000 ~ 150,000 xg로 2시간 동안 원심분리 후, 엑소좀을 펠렛층에 가라앉힌 후, 멸균수로 재분산하는 단계를 거쳐 엑소좀을 분리하였다. 상기에서 얻어진 어성초 유래 엑소좀을 0.22 ㎛ 필터로 여과하여 제균 작업을 실시하였다. 최종적으로 수득된 어성초 유래 엑소좀을 NTA 장비(ZetaView, Particle Metrix, German)를 이용하여 크기와 농도를 확인하였다.For the preparation of Eoseongcho-derived exosomes, 10 to 20 times the weight of purified water was first added to the ground liquid of Eoseongcho leaves. After centrifugation at 3,000 to 4,000 xg for 20 minutes using a centrifuge, only the supernatant was taken to separate and remove cell residues. The above step was performed once more to remove impurities. After the supernatant extract was centrifuged at 100,000 to 150,000 xg for 2 hours using an ultra-high-speed centrifuge, the exosomes were settled in a pellet layer and redispersed in sterile water to separate the exosomes. Eoseongcho-derived exosomes obtained above were filtered through a 0.22 μm filter to perform disinfection. The size and concentration of the finally obtained Eoseongcho-derived exosomes were confirmed using NTA equipment (ZetaView, Particle Metrix, German).
그 결과, 도 2에서 확인할 수 있듯이, 어성초 유래 엑소좀은 엑소좀의 평균 입자 크기가 181.4 nm인 세포외소포체인 것을 확인할 수 있었고, 입자수는 1.2x109 particles/mL 인 것을 확인하였다.As a result, as can be seen in Figure 2, it was confirmed that the exosomes derived from Eoseongcho were extracellular vesicles having an average particle size of 181.4 nm, and the number of particles was 1.2x10 9 particles / mL.
<실시예 3> 티트리 유래 엑소좀 제조<Example 3> Preparation of exosomes derived from tea tree
(1) 티트리 잎의 착즙(1) Juice of tea tree leaves
티트리 잎(예담플라워, 경기도 고양)을 깨끗이 씻어 물기를 제거한 다음, 일반 분쇄기에 세척된 티트리 잎에 10~20배 중량의 정제수를 넣어 30 ~ 50 rpm의 속도로 분쇄를 수행하였으며, 수득된 티트리 잎 분쇄액은 400 um mesh를 통해 부유물을 제거하였다. 회수된 티트리 잎 분쇄액은 엑소좀 분석을 위한 시료로 사용하였다.Tea tree leaves (Yedam Flower, Goyang, Gyeonggi-do) were washed and dried, and then 10 to 20 times the weight of purified water was added to the washed tea tree leaves in a general grinder and pulverized at a speed of 30 to 50 rpm. The suspended matter was removed from the powdered tea tree leaf solution through a 400 um mesh. The collected tea tree leaf powder was used as a sample for exosome analysis.
(2) 티트리 유래 엑소좀 제조(2) Production of tea tree-derived exosomes
티트리 유래 엑소좀 제조를 위해 먼저 티트리 잎 분쇄액에 10~20배 중량의 정제수를 첨가하였다. 원심분리기를 이용하여 3,000 ~ 4,000 xg로 20분 동안 원심분리 후, 상등액만을 취하여 세포의 잔여물을 분리 및 제거하였다. 상기 단계를 한번 더 수행하여 불순물 제거하였다. 상등 추출액을 초고속 원심분리기를 이용하여 100,000 ~ 150,000 xg로 2시간 동안 원심분리 후, 엑소좀을 펠렛층에 가라앉힌 후, 멸균수로 재분산하는 단계를 거쳐 엑소좀을 분리하였다. 상기에서 얻어진 티트리 유래 엑소좀을 0.22 ㎛ 필터로 여과하여 제균 작업을 실시하였다. 최종적으로 수득된 티트리 유래 엑소좀을 NTA 장비(ZetaView, Particle Metrix, German)를 이용하여 크기와 농도를 확인하였다.To prepare tea tree-derived exosomes, 10 to 20 times the weight of purified water was first added to the tea tree leaf pulverized liquid. After centrifugation at 3,000 to 4,000 xg for 20 minutes using a centrifuge, only the supernatant was taken to separate and remove cell residues. The above step was performed once more to remove impurities. After the supernatant extract was centrifuged at 100,000 to 150,000 xg for 2 hours using an ultra-high-speed centrifuge, the exosomes were settled in a pellet layer and redispersed in sterile water to separate the exosomes. The tea tree-derived exosomes obtained above were filtered through a 0.22 μm filter to remove bacteria. The size and concentration of the finally obtained tea tree-derived exosomes were confirmed using NTA equipment (ZetaView, Particle Metrix, German).
그 결과, 도 3에서 확인할 수 있듯이, 티트리 유래 엑소좀은 엑소좀의 평균 입자 크기가 132.5 nm인 세포외소포체인 것을 확인할 수 있었고, 입자수는 1.6x1010 particles/mL 인 것을 확인하였다.As a result, as can be seen in FIG. 3, it was confirmed that the tea tree-derived exosomes were extracellular vesicles having an average particle size of 132.5 nm, and the number of particles was 1.6x10 10 particles/mL.
<실험예 1> 엑소좀의 수율 증대 효과 분석<Experimental Example 1> Analysis of the yield increase effect of exosomes
실시예 1~3에서 수득된 식물 유래 엑소좀의 정량(입자 크기, 입자 수) 분석은 나노 입자 추적 분석기(Nano Tracking Analyzer; NTA, ZetaView TWIN, Particle Metrix, German)를 이용하여 측정하였으며, 본 기기의 분석 프로그램인 ZetaView software를 이용하여 분석을 수행하였다.Quantitative analysis (particle size, particle number) of plant-derived exosomes obtained in Examples 1 to 3 was measured using a nano tracking analyzer (Nano Tracking Analyzer; NTA, ZetaView TWIN, Particle Metrix, German), and this device Analysis was performed using ZetaView software, an analysis program of .
실시예 1~3에서 수득된 식물 유래 엑소좀은 정량적 및 분자 생물학적 평가를 위해 일반적으로 사용되고 있는 BCA(Bicinchoninic Acid) assay 법을 통해 단백질 농도를 측정하였다. 상기 실시예 1~3에서 수득된 식물 유래 엑소좀 시료 20 ㎕와 BCA 시료 180 ㎕을 96-well plate에서 혼합한 후, 호일로 빛을 차단한 상태에서 37℃에서 1시간 반응시켰다. 이후, Microplate reader 장비(BioTek)를 이용하여 562 nm의 파장에서 흡광도를 측정하였다. 측정된 흡광도를 통한 단백질의 농도는 시약과 함께 제공된 표준 단백질 물질인 소혈청알부민단백질 BSA(Bovine serum albumin)를 이용한 흡광도의 표준 곡선(Standard curve)을 구한 후, 이 표준 곡선을 이용하여 시료 단백질의 농도를 분석하였다. 각 엑소좀을 이용한 시료 단백질의 농도는 입자수를 십억개(1.0x109 particles/mL)로 맞춘 다음 측정하였다.The plant-derived exosomes obtained in Examples 1 to 3 were measured for protein concentration through Bicinchoninic Acid (BCA) assay, which is generally used for quantitative and molecular biological evaluation. 20 μl of plant-derived exosome samples obtained in Examples 1 to 3 and 180 μl of BCA sample were mixed in a 96-well plate, and then reacted at 37° C. for 1 hour while blocking light with foil. Then, absorbance was measured at a wavelength of 562 nm using a Microplate reader (BioTek). For the protein concentration through the measured absorbance, obtain a standard curve of absorbance using bovine serum albumin (BSA), a standard protein material provided with the reagent, and then use this standard curve to determine the concentration of the sample protein. Concentrations were analyzed. The concentration of sample protein using each exosome was measured after setting the number of particles to one billion (1.0x10 9 particles/mL).
그 결과, 도 4에서 확인할 수 있듯이, 라벤다 잎세포 유래 엑소좀은 단백질의 농도가 219.3ug/mL, 어성초 유래 엑소좀은 단백질의 농도가 193.1ug/mL 및 티트리 유래 엑소좀은 단백질의 농도가 170.6ug/mL 인 것을 확인하였다.As a result, as can be seen in FIG. 4, the exosomes derived from lavender leaf cells had a protein concentration of 219.3ug/mL, the exosomes derived from Eoseongcho had a protein concentration of 193.1ug/mL, and the exosomes derived from tea tree had a protein concentration of 219.3ug/mL. It was confirmed that it was 170.6ug/mL.
<실험예 2> 피부 세포 배양을 통한 세포 활성도 평가 <Experimental Example 2> Evaluation of cell activity through skin cell culture
HaCaT 세포(Human epidermal keratinocyte, 각질형성세포), Detroit 551 세포(Human skin fibroblast, 섬유아세포)를 각각 10% FBS(Fetal Bovine Serum), 1% penicillin/streptomycin(GIBCO, 10,000U/mL) 함유된 DMEM(Dubelcco's Modified Eagle's Medium) 배지를 이용하여 37℃, 5% CO2의 조건인 항온기에서 24시간 배양하였다. 이렇게 배양된 세포를 96 well plate에 한 well 당 0.5 X 104개의 농도로 분주하고, 37℃, 5% CO2 조건인 항온기에서 배양하여 plate에 부착시켰다. 24시간 뒤, 정제수를 첨가한 대조군과 시험물질인 실시예 1~3에서 수득된 식물 유래 엑소좀을 세포에 처리하고, 24시간 동안 추가 배양하였고, 10% WST-1 시약을 각 well에 처리하였다. 이때. 각 엑소좀의 처리 농도는 십억개(1.0x109 particles/mL)를 100% 농도 기준으로 정하고, 각각의 엑소좀을 10%(1.0x108 particles/mL), 5%(5.0x107 particles/mL), 1%(1.0x107 particles/mL) 농도로 처리하였다. 2시간 동안 배양기에서 반응시킨 후, Microplate reader기(BioTeck)를 이용하여 450nm에서 흡광 값을 측정한 후, 하기 수식에 따라 세포 생존율(%)을 측정하였다.HaCaT cells (Human epidermal keratinocyte, keratinocyte) and Detroit 551 cells (Human skin fibroblast, fibroblast) were mixed in DMEM containing 10% FBS (Fetal Bovine Serum) and 1% penicillin/streptomycin (GIBCO, 10,000 U/mL), respectively. (Dubelcco's Modified Eagle's Medium) medium was used and cultured for 24 hours in an incubator under conditions of 37°C and 5% CO 2 . The cultured cells were dispensed in a 96 well plate at a concentration of 0.5 X 10 4 cells per well, cultured in an incubator at 37°C and 5% CO 2 , and adhered to the plate. After 24 hours, the cells were treated with the control group to which purified water was added and the plant-derived exosomes obtained in Examples 1 to 3, which are test materials, and further cultured for 24 hours. Each well was treated with 10% WST-1 reagent. . At this time. The processing concentration of each exosome is determined by billions (1.0x10 9 particles/mL) based on 100% concentration, and each exosome is 10% (1.0x10 8 particles/mL) and 5% (5.0x10 7 particles/mL). ), treated at a concentration of 1% (1.0x10 7 particles/mL). After reacting in an incubator for 2 hours, the absorbance value was measured at 450 nm using a Microplate reader (BioTeck), and cell viability (%) was measured according to the following formula.
세포생존율(%)=[(시험물질의 흡광도)/(대조군의 흡광도)] X 100Cell viability (%) = [(absorbance of test substance)/(absorbance of control group)] X 100
세포 생존율(%)HaCaT
Cell viability (%)
세포 생존율(%)Detroit 551
Cell viability (%)
그 결과, 상기 표 1에서 확인할 수 있듯이 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀은 1~10% 처리 농도에서 각질형성세포인 HaCaT 세포(Human epidermal keratinocyte), 섬유아세포인 Detroit 551 세포(Human skin fibroblast)에서 세포 내 독성을 보이지 않을 뿐만 아니라 세포생존율(%)이 농도 의존적으로 증가함을 확인하였다. 따라서, 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀은 세포에 대한 자극이 없어 피부 자극 유발 가능성이 낮으며 농도 의존적으로 세포 생존을 증가시키는 안전한 물질임을 확인하였다.As a result, as can be seen in Table 1 above, the exosomes derived from lavender leaf cells, exosomes derived from Houttuynia cordata, and exosomes derived from tea tree were keratinocytes, HaCaT cells (Human epidermal keratinocytes), and fibroblasts, at 1-10% treatment concentration. In Detroit 551 cells (Human skin fibroblast), it was confirmed that not only did not show intracellular toxicity, but also cell viability (%) increased in a concentration dependent manner. Therefore, it was confirmed that the exosomes derived from lavender leaf cells, the exosomes derived from Houttuynia cordata, and the exosomes derived from tea tree are safe substances that increase cell survival in a concentration-dependent manner with low possibility of skin irritation because they do not stimulate cells.
<실험예 3> <Experimental Example 3> 자외선 자극으로부터 피부세포 보호 효과 확인 시험 Test to confirm skin cell protection effect from UV stimulation
실시예 1~3에서 수득된 식물 유래 엑소좀이 자외선 자극으로부터 피부세포 보호 효과를 갖는지 살펴보기 위해, 세포생존율의 변화를 알아보았다. 이를 위하여 HaCaT 세포를 96-well plate에 분주한 후, 세포 배양 조건에서 24시간 배양하였다. 이후 UVB를 조사하고, 정제수를 첨가한 대조군과 시험물질인 조성물을 세포에 처리하여 24시간 동안 추가 배양하였다. UV 조사에 사용된 광원으로는 302 nm 파장의 자외선을 방출하는 Ultraviolet crosslinker(Ultra-Violet Products 社, Cat No. CL-1000)을 사용하였다. 이어 자외선 유도에 의한 피부세포의 손상을 보호하는지 확인하고자 MTT assay를 이용하여 세포 생존율을 측정하였다.In order to examine whether the plant-derived exosomes obtained in Examples 1 to 3 have an effect of protecting skin cells from UV stimulation, changes in cell viability were examined. To this end, HaCaT cells were seeded in a 96-well plate and cultured for 24 hours under cell culture conditions. Thereafter, UVB was irradiated, and the cells were treated with the control and the composition as the test substance to which purified water was added, and further cultured for 24 hours. As a light source used for UV irradiation, an Ultraviolet crosslinker (Ultra-Violet Products, Cat No. CL-1000) emitting ultraviolet rays with a wavelength of 302 nm was used. Subsequently, cell viability was measured using MTT assay to confirm whether skin cell damage was protected by UV induction.
그 결과, 상기 표 2에서 확인할 수 있듯이 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀과 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀의 혼합 엑소좀은 자외선이 조사된 대조군(UVB+)과 비교하였을 때, 농도 의존적으로 세포생존율이 증가하여 자외선 조사에 의한 세포 보호 효과를 확인하였다.As a result, as can be seen in Table 2, the mixed exosomes of lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes and lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes are When compared with the control group (UVB+) irradiated with ultraviolet light, the cell viability increased in a concentration-dependent manner, confirming the cell protection effect by ultraviolet irradiation.
따라서, 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀 및 이의 식물 혼합 엑소좀은 자외선으로부터 세포를 보호하여 생존율을 증가 시킴을 확인하였다.Therefore, it was confirmed that the exosomes derived from lavender leaf cells, the exosomes derived from Houttuynia cordata, the exosomes derived from tea tree, and the plant mixed exosomes protect cells from UV rays and increase the survival rate.
<실험예 4> 염증 억제 효과 확인 시험<Experimental Example 4> Inflammation inhibitory effect confirmation test
실시예 1~3에서 수득된 식물 유래 엑소좀이 피부 염증 억제 및 진정 효능이 있는지 알아보고자, 염증 반응에 관여하는 COX-2(Cyclooxygenase-2), iNOS(Inducible nitric oxide synthase)의 발현양 변화를 조사하였다. COX-2는 조직내에서 일정하게 발현되는 COX-1, COX-3와 달리 성장인자, 염증유발인자, 산화적 스트레스, 외상, 암유전자 또는 사이토카인 등에 의해 유도되는 효소(inducible enzyme)이다. 마찬가지로 iNOS도 COX-2처럼 평소에는 세포 내에 존재하지 않으나 interleukin-1(IL-1), tumor necrosis factor-α(TNF-α), lipopolysaccharide(LPS) 등과 같은 염증유발인자 및 암발생 인자에 의해 발현이 유도되면 장시간 동안 다량의 nitric oxide(NO)를 생성하며, 생성된 NO는 병리적인 혈관확장, 세포독성, 조직손상 등과 같은 생체에 유해한 작용을 나타낸다.In order to investigate whether the plant-derived exosomes obtained in Examples 1 to 3 have skin inflammation inhibition and soothing effects, changes in the expression of COX-2 (Cyclooxygenase-2) and iNOS (Inducible nitric oxide synthase) involved in the inflammatory response were examined. investigated. Unlike COX-1 and COX-3, which are constantly expressed in tissues, COX-2 is an inducible enzyme induced by growth factors, inflammatory factors, oxidative stress, trauma, oncogenes, or cytokines. Similarly, iNOS, like COX-2, is not normally present in cells, but is expressed by inflammatory and cancer-inducing factors such as interleukin-1 (IL-1), tumor necrosis factor-α (TNF-α), and lipopolysaccharide (LPS). When this is induced, a large amount of nitric oxide (NO) is produced for a long time, and the generated NO exhibits harmful effects to the body such as pathological vasodilation, cytotoxicity, and tissue damage.
엑소좀의 염증 억제 효과를 확인하기 위하여 HaCaT 세포를 96-well plate에 분주한 후, 세포 배양 조건에서 24시간 배양하였다. 이후 UVB 조사를 통해 염증 반응을 유도하고, 정제수를 첨가한 대조군과 시험 물질인 실시예 1~3에서 수득된 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀과 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀을 1:1:1 중량비로 혼합한 혼합 엑소좀을 세포에 처리하여 4시간 동안 추가 배양하였다. COX-2, iNOS의 유전자 수준에서 확인하기 위해 Real-time PCR 법을 수행하였으며, RNA isolation과 cDNA 합성을 위해 사이버그린(SYBR Green supermis, Applied Biosystems, 미국)을 첨가한 혼합물을 이용하였다. 실험에 사용한 primer는 ORIGENE 社의 COX2(PTGS2) Human qPCR Primer pair(Cat. HP200900), iNOS(NOS2) Human qPCR Primer pair(Cat. HP200591)을 사용하였으며, 각 시료의 COX-2, iNOS mRNA 발현량은 GADPH(Cat. HP205798)로 정량하였다. 각 프라이머의 염기서열은 하기 표 3에 나타내었으며, 식물 유래 엑소좀에 따른 COX-2, iNOS의 유전자 발현율은 표 4에 나타내었다.In order to confirm the anti-inflammatory effect of exosomes, HaCaT cells were seeded in a 96-well plate and cultured for 24 hours under cell culture conditions. Thereafter, an inflammatory response was induced through UVB irradiation, and the exosomes derived from lavender leaf cells obtained in Examples 1 to 3, the control and the test substance to which purified water was added, exosomes derived from eoseongcho, and exosomes derived from tea tree and derived from lavender leaf cells Exosomes, exosomes derived from Eoseongcho, and exosomes derived from tea tree were mixed in a weight ratio of 1:1:1 to the cells and further cultured for 4 hours. Real-time PCR was performed to confirm COX-2 and iNOS at the genetic level, and a mixture containing Cyber Green (SYBR Green supermis, Applied Biosystems, USA) was used for RNA isolation and cDNA synthesis. The primers used in the experiment were ORIGENE's COX2 (PTGS2) Human qPCR Primer pair (Cat. HP200900) and iNOS (NOS2) Human qPCR Primer pair (Cat. HP200591), and the COX-2 and iNOS mRNA expression levels of each sample was quantified with GADPH (Cat. HP205798). The nucleotide sequence of each primer is shown in Table 3 below, and the gene expression rates of COX-2 and iNOS according to plant-derived exosomes are shown in Table 4.
CGGTGAAACTCTGGCTAGACAGSEQ ID NO: 1:
CGGTGAAACTCTGGCTAGACAG
GCAAACCGTAGATGCTCAGGGASEQ ID NO: 2:
GCAAACCGTAGATGCTCAGGGA
GCTCTACACCTCCAATGTGACCSEQ ID NO: 3:
GCTCTACACCTCCAATGTGACC
CTGCCGAGATTTGAGCCTCATGSEQ ID NO: 4:
CTGCCGAGATTTGAGGCCTCATG
GTCTCCTCTGACTTCAACAGCGSEQ ID NO: 5:
GTCTCCTCTGACTTCAACAGCG
ACCACCCTGTTGCTGTAGCCAASEQ ID NO: 6:
ACCACCCTGTTGCTGTAGCCAA
그 결과, 상기 표 4에서 확인할 수 있듯이 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀과 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀의 혼합 엑소좀은 피부 세포에서 자외선에서 조사된 대조군과 비교하여 COX-2와 iNOS의 발현을 농도 의존적으로 감소시켜 염증 반응의 완화 효과를 확인하였고, 이는 염증 완화에 따른 피부 진정 효과를 기대할 수 있다.As a result, as can be seen in Table 4, the mixed exosomes of lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes and lavender leaf cell-derived exosomes, Houttuynia cordata-derived exosomes and tea tree-derived exosomes are Compared to the control group irradiated with ultraviolet light in skin cells, the expression of COX-2 and iNOS was reduced in a concentration-dependent manner to confirm the effect of relieving the inflammatory response, which can be expected to have a skin soothing effect due to relieving inflammation.
따라서, 라벤다 잎세포 유래 엑소좀, 어성초 유래 엑소좀 및 티트리 유래 엑소좀 및 이의 식물 혼합 엑소좀은 항염 및 피부 진정 효능이 있음을 확인하였다.Therefore, it was confirmed that the exosomes derived from lavender leaf cells, the exosomes derived from Houttuynia cordata, the exosomes derived from tea tree, and the plant mixed exosomes had anti-inflammatory and skin soothing effects.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.Having described specific parts of the present invention in detail above, it will be clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the invention will be defined by the appended claims and their equivalents.
Claims (10)
Lavender ( Lavandula angustifolia ) Leaf cell-derived exosomes, Eoseongcho ( Houttuynia cordata ) leaf-derived exosomes and tea tree ( Melaleuca alternifolia ) leaf-derived exosomes are mixed in a weight ratio of 1: 1: 1 Plant-derived exosomes A cosmetic composition for skin protection against ultraviolet rays comprising as an active ingredient.
According to claim 1, wherein the exosome is an average particle size of 50 ~ 250 nm of extracellular vesicles (extracellular vesicles) characterized in that the plant-derived exosomes as an active ingredient a cosmetic composition for skin protection against ultraviolet rays.
According to claim 1, wherein the exosomes 1x10 7 ~ 1x10 9 Particle number of particles / mL characterized in that it comprises a plant-derived exosomes as an active ingredient a cosmetic composition for skin protection against ultraviolet rays.
According to claim 1, wherein the exosomes are 100 ~ 300ug / mL of protein comprising a plant-derived exosomes as an active ingredient characterized in that the cosmetic composition for skin protection against ultraviolet rays.
According to claim 1, wherein the plant-derived exosome is 0.1 to 30% by weight relative to the total weight of the composition A cosmetic composition for skin protection against ultraviolet rays containing a plant-derived exosome as an active ingredient.
A cosmetic comprising the composition of any one of claims 1, 6, 7, 8 and 9.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020220137838A KR102564765B1 (en) | 2022-10-25 | 2022-10-25 | Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020220137838A KR102564765B1 (en) | 2022-10-25 | 2022-10-25 | Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient |
Publications (1)
Publication Number | Publication Date |
---|---|
KR102564765B1 true KR102564765B1 (en) | 2023-08-09 |
Family
ID=87567067
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020220137838A KR102564765B1 (en) | 2022-10-25 | 2022-10-25 | Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102564765B1 (en) |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102159394B1 (en) | 2019-10-04 | 2020-09-24 | (주)에스디생명공학 | Composition for Improving Skin Conditions Comprising Exosome Derived from Swallow's Nest as Active Ingredient |
KR102170387B1 (en) | 2018-07-30 | 2020-10-27 | 주식회사 엑소코바이오 | Freeze-dried formulation of exosomes derived from stem cell and composition for preventing, suppressing, alleviating, improving or treating acne comprising the same |
KR102192317B1 (en) | 2020-04-29 | 2020-12-21 | 주식회사 메디컬오 | Composition for Skin Soothing Comprising Exosomes Derived from Natural Extracts |
KR102391636B1 (en) * | 2021-12-02 | 2022-04-28 | 주식회사 에이바이오머티리얼즈 | Cosmetic composition for improving skin and hair condition containing Scutellaria baicalensis exosome, Houttuynia cordata exosome |
KR102433271B1 (en) * | 2021-12-20 | 2022-08-18 | 주식회사 에이바이오머티리얼즈 | Cosmetics composition comprising extracellular vesicles from Tea Tree, Polygonum multiflorum |
KR20220122577A (en) * | 2020-09-22 | 2022-09-02 | 주식회사 바이오솔루션 | composition for improving skin condition comprising extracellular vesicles derived from plant, and method for producing the same |
-
2022
- 2022-10-25 KR KR1020220137838A patent/KR102564765B1/en active IP Right Grant
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102170387B1 (en) | 2018-07-30 | 2020-10-27 | 주식회사 엑소코바이오 | Freeze-dried formulation of exosomes derived from stem cell and composition for preventing, suppressing, alleviating, improving or treating acne comprising the same |
KR102159394B1 (en) | 2019-10-04 | 2020-09-24 | (주)에스디생명공학 | Composition for Improving Skin Conditions Comprising Exosome Derived from Swallow's Nest as Active Ingredient |
KR102192317B1 (en) | 2020-04-29 | 2020-12-21 | 주식회사 메디컬오 | Composition for Skin Soothing Comprising Exosomes Derived from Natural Extracts |
KR20220122577A (en) * | 2020-09-22 | 2022-09-02 | 주식회사 바이오솔루션 | composition for improving skin condition comprising extracellular vesicles derived from plant, and method for producing the same |
KR102391636B1 (en) * | 2021-12-02 | 2022-04-28 | 주식회사 에이바이오머티리얼즈 | Cosmetic composition for improving skin and hair condition containing Scutellaria baicalensis exosome, Houttuynia cordata exosome |
KR102433271B1 (en) * | 2021-12-20 | 2022-08-18 | 주식회사 에이바이오머티리얼즈 | Cosmetics composition comprising extracellular vesicles from Tea Tree, Polygonum multiflorum |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP2013151544A (en) | Parthenolide-free bioactive ingredient from feverfew (tanacetum parthenium) and process for producing the same | |
KR20150044607A (en) | Method for derivation of inducible Pluripotent stem cells and inducible Pluripotent stem cells produced using the same | |
Abdelrazeg et al. | Propolis composition and applications in medicine and health | |
KR20230164611A (en) | Cosmetic compositions for skin cell regeneration, anti inflammatory and whitening comprising exosome derived from Cannabis sativa L as an active ingredient | |
KR20200104158A (en) | Cosmetic composition comprising centella asiatica extracts cultivated by aquaponics | |
KR101930264B1 (en) | Cosmetic composition for inhibiting secretion of sebum and for improving acne symptoms containing natural complex extract | |
KR102002894B1 (en) | Cosmetic composition containing the complex natural extracts | |
Al-Bayaty et al. | Formulation and Evaluation of new biodegradable periodontal chips from Malaysian propolis in chitosan base | |
KR101394550B1 (en) | Anti-bacterial or Anti-inflammatory Composition Comprising Extracts from Flower of Rosa hybrida as Active Ingredient | |
Oyetunji et al. | Antibacterial and antioxidant activities of Dacryodes edulis methanolic leaf extract | |
KR102564765B1 (en) | Cosmetic compositions for anti-inflammatory and skin soothing comprising exosome derived from lavandula angustifolia, houttuynia cordata or melaleuca alternifolia as an active ingredient | |
Ibrahim | Evaluation of anti-bacterial activity of Capparis spinosa (Al-Kabara) and Aloe vera extracts against Isolates Bacterial Skin Wound Infections in-vitro and in-vivo | |
KR102190396B1 (en) | Treating agent for insect bite containing glechoma grandis extract | |
KR102540485B1 (en) | Cosmetic compositions for skin improvement comprising exosome derived from leontopodium alpinum, adenium obesum, centella asiatica or polygonum multiflorum as an active ingredient | |
KR20210013501A (en) | Eryobotrya japonica leaf mineral sugar aging solution having a skin protecting effect and a method for producing the same | |
KR102371272B1 (en) | Composition for improving skin trouble comprising of perilla seed oil and cyperi rhizoma extract | |
KR20200049418A (en) | Cosmetic composition for skin cooling or improving skin redness with the extract of Eucommia Ulmoides bark | |
KR102327023B1 (en) | Shampoo Composition and manufacturing mehtod thereof | |
EP2788011B1 (en) | Composition comprising a chelidonium majus extract and copaiba, and the use thereof for the treatment of cutaneous dysfunctions | |
KR20170051926A (en) | Functional food composition for preventing degenerative arthritis comprising biochanin-A derived from red clover | |
Mannani et al. | In vitro antifungal activity of Iranian propolis against Microsporum canis, M. gypseum and M. nanum | |
Sarandy et al. | Hydroalcoholic extract of Remijia ferruginea accelerates the closure of skin wounds by modulating tissue morphology and antioxidant profile: An in vitro and in vivo study | |
KR100335578B1 (en) | Composition for preventing carcinogenesis containing Viscum album extract | |
KR102642293B1 (en) | Composition for preventing or treating skin diseases comprising wikstroemia ganpi | |
Samieerad et al. | Physicochemical and antibacterial assessment of Iranian propolis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AMND | Amendment | ||
AMND | Amendment | ||
X091 | Application refused [patent] | ||
AMND | Amendment | ||
X701 | Decision to grant (after re-examination) | ||
GRNT | Written decision to grant |