KR102543076B1 - Composition comprising DNA components for suppressing specific gene expression, controlling epigenetic mutation, and improving skin condition - Google Patents

Abstract

The present specification relates to a composition for improving skin condition containing a nucleobase, a plant extract, and acetylhexapeptide-1, and a manufacturing method thereof, wherein the composition has effects of alleviating wrinkles, strengthening skin elasticity, whitening skin, reducing skin blemishes, strengthening the skin barrier, and / or alleviating acne.

Description

Composition comprising DNA components for suppressing specific gene expression, controlling epigenetic mutation, and improving skin condition

The present specification relates to a composition for improving skin conditions containing a nucleobase and a method for preparing the same, and specifically, may further include a plant extract and acetyl hexapeptide-1, improving wrinkles, enhancing skin elasticity, skin whitening, skin It has the effect of reducing melasma production, strengthening the skin barrier, and/or improving acne.

The skin is an important organ that protects the human body from the external environment and is in charge of various physiological functions such as a barrier function that prevents internal moisture and useful components from leaking out, thermoregulation, and excretion.

As the above functions are gradually weakened with age, skin aging progresses, resulting in wrinkles and weakening of skin elasticity. Exposure to ultraviolet rays, stress, disease conditions, environmental factors, wounds, aging, oxidative stress, etc. can cause spots on the skin, weaken the skin barrier, and cause acne. In addition, as the preference for white skin increases, the demand for cosmetics with a whitening effect is increasing.

A nucleobase is a biological compound that contains nitrogen as a constituent of nucleosides. Nucleosides are constituents of nucleotides, and nucleotides act as units constituting nucleic acids, and their ability to stack on top of each other is a substance that forms long chain structures such as ribonucleic acid (RNA) and deoxyribonucleic acid (DNA), which can be applied to the skin. Corresponds to friendly substances.

In addition, skin loses elasticity, keratinization, wrinkles, and pigmentation due to external environmental stimuli such as changes in temperature and humidity, ultraviolet rays, and pollutants, and many factors directly affect these skin phenomena. Research has been ongoing, and recently, methods for controlling the expression of skin problem factors by controlling epigenetic-related mechanisms have been actively studied.

Epigenetics (epigenetics) is a field that studies the phenomenon in which specific genes are expressed differently between generations, even though DNA sequences that transmit genetic information between generations do not change. These epigenetic changes are caused by changes in environmental factors or are caused in the process of aging. Major mechanisms involved in epigenetics that have been identified so far include DNA methylation, histone modification, and chromatin remodeling. It is known that epigenetic mutations caused by these major factors affect various biological phenomena such as diseases such as cancer and aging.

Since the skin is a very sensitive tissue, chemical and physical reactions may occur depending on the substances (eg cosmetics) in contact with it, which may cause side effects (eg acne, melasma, etc.) that are different from the original purpose, and adverse effects such as inflammatory diseases. Therefore, it is important to find materials that do not cause side effects or adverse effects on the skin.

Under this background, the present inventors confirmed the effects of wrinkle improvement, skin elasticity enhancement, skin whitening, skin blemishes reduction, skin barrier strengthening and acne improvement effects when containing a nucleobase and/or further containing a plant extract, It was confirmed that it can be usefully used as a composition for improving skin conditions.

The present specification provides a composition for improving skin conditions, including a nucleobase.

One example provides a composition for improving skin conditions, including Adenine (A), Thymine (T), Guanine (G) and Cytosine (C).

Another example is

(a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)

(b) 1 species selected from the group consisting of Sambakcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetylhexapeptide-1, Squidweed extract, Butracetri extract, and Red chinensis extract ideal

It provides a method for producing a composition for improving skin condition, comprising the step of mixing.

One example of the present specification provides a composition for improving skin condition, including Adenine (A), Thymine (T), Guanine (G) and Cytosine (C).

The composition is 1 species selected from the group consisting of Triticale extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetyl Hexapeptide-1, Spermula extract, Butracetri extract, and Red chinensis extract It may further include the above, but is not limited thereto.

The composition may have at least one effect selected from the group consisting of antioxidant, anti-aging and anti-inflammatory, but is not limited thereto.

Another example is

(a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)

(b) 1 species selected from the group consisting of Sambakcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetylhexapeptide-1, Squidweed extract, Butracetri extract, and Red chinensis extract ideal

It provides a method for producing a composition for improving skin condition, comprising the step of mixing.

Hereinafter, the present invention will be described in detail.

As used herein, “improvement of skin condition” includes all types of reduction or improvement of symptoms such as wrinkles, melasma, acne, etc., delay or alleviation of progression of skin-related diseases, improvement, relief or stabilization of conditions or symptoms of skin-related diseases, and the like. can be used in the sense of

As used herein, "nucleobase" may be Adenine (A), Thymine (T), Guanine (G), Cytosine (C) and/or Uracil (U), but hereby It is not limited. The amine groups of A, T, G, and C can play the same role as (-) charges (good bonding due to unshared electron pairs), which can increase the DNA binding affinity and increase the biotransmission rate of active ingredients. It is not.

Nucleobases included in the compositions provided herein include Adenine (A), Thymine (T)/Uracil (U), Guanine (G), and/or Cytosine (C) It means, it is in the form of a single compound that is not a component constituting a nucleic acid sequence linked by nucleosides, nucleotides, and phosphodiester bonds, without binding pentose sugars and phosphate groups. In the composition provided herein, the nucleobases may be in the form of a mixture that is not chemically bonded to each other.

The composition for improving skin conditions provided herein contains adenine (A), thymine (T), guanine (G) and cytosine (C).

1 to 15, 1 to 10, 1 to 9, 1 to 7, 1 to 6, 1 to 5, 1 to 3, 1 to 2, 3 to 15, 3 to 10, 3 to 6 adenine based on 1 part by weight of cytosine 9, 3 to 7, 3 to 6, 3 to 5, 4 to 15, 4 to 10, 4 to 9, 4 to 7, 4 to 6, 4 to 5, 5 to 15, 5 to 10, 5 to 9, 5 to 7, 5 to 6, 8 to 15, 8 to 10, 8 to 9, 9 to 15, or 9 to 10 parts by weight, such as 1, 5 or 9 parts by weight,

1 to 15, 1 to 10, 1 to 9, 1 to 7, 1 to 6, 1 to 5, 1 to 3, 1 to 2, 3 to 15, 3 to 10, 3 to thymine based on 1 part by weight of cytosine 9, 3 to 7, 3 to 6, 3 to 5, 4 to 15, 4 to 10, 4 to 9, 4 to 7, 4 to 6, 4 to 5, 5 to 15, 5 to 10, 5 to 9, 5 to 7, 5 to 6, 8 to 15, 8 to 10, 8 to 9, 9 to 15, or 9 to 10 parts by weight, such as 1, 5 or 9 parts by weight,

1 to 15, 1 to 10, 1 to 5, 1 to 2, 3 to 15, 3 to 10, 3 to 5, 5 to 15, 5 to 10, or 10 to 15 parts by weight of guanine based on 1 part by weight of cytosine , For example, it may include 1 part by weight, but is not limited thereto. The composition for improving skin condition provided in the present specification includes adenine (A) and thymine (T) in equal weight (eg, adenine and thymine in a weight ratio of about 1:1), and/or guanine (G) and cytosine (C) in equal weight (eg, guanine and cytosine in a weight ratio of about 1:1). At this time, the content of each of adenine and thymine or the total content of adenine and thymine in the composition is about 1 to about 15 times, about 2 to about 15 times, or about 3 times the content of each of guanine and cytosine or the total content thereof. to about 15 times.

DTC (direct-to-consumer) gene analysis service allows for skin improvement by controlling gene mutations in the user's skin characteristics such as wrinkles, skin elasticity, pigmentation, melasma/freckles, acne, skin sensitivity, etc. do. The genes are AKAP1, CDK10, BNC2, FANCA, MC1R, IRF4, CDK5RAP1 (ASIP), ANKRD11, CPNE7, OCA2, FST, TGFB2, LOC107985745 (SELL), C11orf49 (DDB2), AGER, DEF8, SLC45A2, TMEM232, RTEL1, It may be at least one selected from the group consisting of IL18R1, PBX2, C6ORF10, GLB1, ZNF365, NTN4, GRM5, ASIP, ELN, HLA-B, IL13, IL12B and LCE3D, but is not limited thereto.

The composition for improving skin conditions provided herein may improve wrinkles, skin elasticity, pigmentation, melasma/freckles, acne, skin sensitivity, etc. by controlling the genetic mutation, but is not limited thereto. Regulating the genetic mutation may mean increasing or decreasing the mutation, but is not limited thereto.

The total content (concentration) of the adenine (A), thymine (T), guanine (G) and cytosine (C) in the composition for improving skin condition provided herein is 0.1 to 1000 μg/ml, 1 to 1000 μg/ml ml, 3 to 1000 μg/ml, 5 to 1000 μg/ml, 10 to 1000 μg/ml, 15 to 1000 μg/ml, 20 to 1000 μg/ml, 30 to 1000 μg/ml, 40 to 1000 μg/ml , 50 to 1000 μg/ml, 70 to 1000 μg/ml, 90 to 1000 μg/ml, 100 to 1000 μg/ml, 130 to 1000 μg/ml, 160 to 1000 μg/ml, 190 to 1000 μg/ml, 200-1000 μg/ml, 0.1-500 μg/ml, 1-500 μg/ml, 3-500 μg/ml, 5-500 μg/ml, 10-500 μg/ml, 15-500 μg/ml, 20 to 500 μg/ml, 30 to 500 μg/ml, 40 to 500 μg/ml, 50 to 500 μg/ml, 70 to 500 μg/ml, 90 to 500 μg/ml, 100 to 500 μg/ml, 130 to 500 μg/ml 500 μg/ml, 160 to 500 μg/ml, 190 to 500 μg/ml, 200 to 500 μg/ml, 0.1 to 300 μg/ml, 1 to 300 μg/ml, 3 to 300 μg/ml, 5 to 300 μg/ml, 10 to 300 μg/ml, 15 to 300 μg/ml, 20 to 300 μg/ml, 30 to 300 μg/ml, 40 to 300 μg/ml, 50 to 300 μg/ml, 70 to 300 μg /ml, 90-300 μg/ml, 100-300 μg/ml, 130-300 μg/ml, 160-300 μg/ml, 190-300 μg/ml, 200-300 μg/ml, 0.1-250 μg/ml ml, 1 to 250 μg/ml, 3 to 250 μg/ml, 5 to 250 μg/ml, 10 to 250 μg/ml, 15 to 250 μg/ml, 20 to 250 μg/ml, 30 to 250 μg/ml , 40 to 250 μg/ml, 50 to 250 μg/ml, 70 to 250 μg/ml, 90 to 250 μg/ml, 100 to 250 μg/ml, 130 to 250 μg/ml, 160 to 250 μg/ml, 190-250 μg/ml, 200-250 μg/ml, 0.1-210 μg/ml, 1-210 μg/ml, 3-210 μg/ml, 5-210 μg/ml, 10-210 μg/ml, 15 to 210 μg/ml, 20 to 210 μg/ml, 30 to 210 μg/ml, 40 to 210 μg/ml, 50 to 210 μg/ml, 70 to 210 μg/ml, 90 to 210 μg/ml, 100 to 210 μg/ml 210 μg/ml, 130-210 μg/ml, 160-210 μg/ml, 190-210 μg/ml, 200-210 μg/ml, 0.1-200 μg/ml, 1-200 μg/ml, 3-200 μg/ml, 5 to 200 μg/ml, 10 to 200 μg/ml, 15 to 200 μg/ml, 20 to 200 μg/ml, 30 to 200 μg/ml, 40 to 200 μg/ml, 50 to 200 μg /ml, 70-200 μg/ml, 90-200 μg/ml, 100-200 μg/ml, 130-200 μg/ml, 160-200 μg/ml, 190-200 μg/ml, 0.1-150 μg/ml ml, 1 to 150 μg/ml, 3 to 150 μg/ml, 5 to 150 μg/ml, 10 to 150 μg/ml, 15 to 150 μg/ml, 20 to 150 μg/ml, 30 to 150 μg/ml , 40 to 150 μg/ml, 50 to 150 μg/ml, 70 to 150 μg/ml, 90 to 150 μg/ml, 100 to 150 μg/ml, 130 to 150 μg/ml, 0.1 to 110 μg/ml, 1 to 110 μg/ml, 3 to 110 μg/ml, 5 to 110 μg/ml, 10 to 110 μg/ml, 15 to 110 μg/ml, 20 to 110 μg/ml, 30 to 110 μg/ml, 40 to 110 μg/ml, 50 to 110 μg/ml, 70 to 110 μg/ml, 90 to 110 μg/ml, 100 to 110 μg/ml, 0.1 to 100 μg/ml, 1 to 100 μg/ml, 3 to 100 μg/ml 100 μg/ml, 5 to 100 μg/ml, 10 to 100 μg/ml, 15 to 100 μg/ml, 20 to 100 μg/ml, 30 to 100 μg/ml, 40 to 100 μg/ml, 50 to 100 μg/ml, 70-100 μg/ml, 90-100 μg/ml, 0.1-60 μg/ml, 1-60 μg/ml, 3-60 μg/ml, 5-60 μg/ml, 10-60 μg /ml, 15 to 60 μg/ml, 20 to 60 μg/ml, 30 to 60 μg/ml, 40 to 60 μg/ml, 50 to 60 μg/ml, 0.1 to 50 μg/ml, 1 to 50 μg/ml ml, 3 to 50 μg/ml, 5 to 50 μg/ml, 10 to 50 μg/ml, 15 to 50 μg/ml, 20 to 50 μg/ml, 30 to 50 μg/ml, 40 to 50 μg/ml , 0.1 to 45 μg/ml, 1 to 45 μg/ml, 3 to 45 μg/ml, 5 to 45 μg/ml, 10 to 45 μg/ml, 15 to 45 μg/ml, 20 to 45 μg/ml, 30-45 μg/ml, 40-45 μg/ml, 0.1-40 μg/ml, 1-40 μg/ml, 3-40 μg/ml, 5-40 μg/ml, 10-40 μg/ml, 15 to 40 μg/ml, 20 to 40 μg/ml, 30 to 40 μg/ml, 0.1 to 30 μg/ml, 1 to 30 μg/ml, 3 to 30 μg/ml, 5 to 30 μg/ml, 10 to 30 μg/ml 30 μg/ml, 15 to 30 μg/ml, 20 to 30 μg/ml, 0.1 to 25 μg/ml, 1 to 25 μg/ml, 3 to 25 μg/ml, 5 to 25 μg/ml, 10 to 25 μg/ml, 15 to 25 μg/ml, 20 to 25 μg/ml, 0.1 to 20 μg/ml, 1 to 20 μg/ml, 3 to 20 μg/ml, 5 to 20 μg/ml, 10 to 20 μg /ml, 15-20 μg/ml, 0.1-15 μg/ml, 1-15 μg/ml, 3-15 μg/ml, 5-15 μg/ml, 10-15 μg/ml, 0.1-10 μg/ml ml, 1 to 10 μg/ml, 3 to 10 μg/ml, 5 to 10 μg/ml, 0.1 to 5 μg/ml, 1 to 5 μg/ml, 3 to 5 μg/ml, 0.1 to 3 μg/ml , 1 to 3 μg/ml, or 0.1 to 1 μg/ml, such as 1, 3, 10, 20, 40, 50, 100, or 200 μg/ml, but is not limited thereto.

As used herein, "extract" refers to an extract obtained by extraction of a plant, a filtrate of the extract, a diluted or concentrated solution of the extract, a dried product obtained by drying the extract, a crude product or a purified product of the extract, or a product thereof. It includes extracts of all formulations that can be formed using extracts themselves and extracts, such as mixtures.

Plants provided herein (e.g., triticale, marjoram, haberea rhodopensis, ginseng galpi, langshot, staphylococcus, butracetri and / or parsnips) are whole shoots or parts (e.g., fruits, roots) of plants , Leaves, flowers, and / or stems, etc.), and plant extracts provided herein (e.g., triticale extract, marjoram extract, Haberea rhodopensis extract, ginseng extract, langshot extract, spp. The extract, butracetri extract and / or chinensis extract) may be an extract obtained by extracting a whole plant or part (eg, fruit, root, leaf, flower, and / or stem, etc.) of a plant with an extraction solvent, and the above Whole shoots or parts of plants (eg, fruits, roots, leaves, flowers, and/or stems, etc.) may be used for extraction as crude drugs or in a dried and/or heated state, but are not limited thereto.

The extraction solvent that can be used in the preparation of the plant extract may be water, straight or branched chain alcohol having 1 (C ₁ ) to 4 (C ₄ ) carbon atoms, and/or mixtures thereof. For example, it may be water, straight-chain or branched-chain alcohol having 1 to 4 carbon atoms (eg, methanol (methyl alcohol), ethanol (ethyl alcohol), propyl alcohol, etc.), or a mixture thereof, but is not limited thereto.

The extraction method for preparing the extract may use a conventional extraction method, for example, extraction using a high-pressure sterilizer, extraction using an evaporator, extraction using an extraction solvent, supercritical fluid extraction, ultrasonic extraction, hot water extraction, A method such as shaking extraction may be used, but is not limited thereto.

The plant extract may be used as a raw material as it is, or may be used as a raw material after undergoing a post-treatment step such as centrifugation or filtration. In order to reduce the quantitative loss in order to utilize the effective substances of the plant, the entire plant extract may be used, or only the supernatant of the plant extract may be used. In addition, after the extraction process, the residue may be removed and used, but is not limited thereto.

"Saururus chinensis" in this specification is a perennial herb from Jeju Island and parts of Jirisan, and the growth environment grows in a well-ventilated, high-humidity, semi-shady place in a humid valley. It is used for ornamental purposes, and leaves including flowers and stems and roots are used as medicine.

"Origanum Majorana" in this specification is one of the first spices used for mummification in ancient Egypt. It is native to the eastern Mediterranean coast. If you boil it and drink it, it will benefit your body by discharging toxins from the body. The leaves facilitate the action of the digestive system and are effective in promoting digestion and enhancing gastrointestinal function.

"Haberlea Rhodopensis" in the present specification is a plant that has lived since the Ice Age and is now one of the valuable resurrection plants inhabiting the high mountains of Bulgaria.

"Acanthopanax Senticosus (Eleuthero)" in the present specification is a plant belonging to the Aralia family and is named in the form of "thorn + galpi". It lives in the deep mountains of the Korean Peninsula, Japan and China, and together with Eleutherococcus Senticosus and Acanthopanax Koreanum, the roots and bark are used as herbal medicines.

"Lansium Domesticum" in the present specification is a fruit tree of the family Mulberry, the fruits are densely clustered next to old branches or branches, and the flesh tastes like grapefruit and has a sweet and slightly sour taste.

"Ageratum Conyzoides" in the present specification is an annual plant. In Korea, it was first confirmed in Jeju Island and also found in Seoul. It is similar to stapes, but it is distinguished because it is a large perennial plant, its leaves are about 3 times as large, and its umbrella hairs are thin and numerous.

"Butracetri (Eperua Falcata)" of the present specification is a flowering plant of the Fabaceae family, which can grow on pure sandy beaches and has excellent resistance to decay and is effective against shingles.

"Vitex Trifolia" in this specification is an evergreen shrub from the sandy beaches of the central and southern parts of Korea, and its growth environment grows in sunny places with many sandy beaches or pebbles, and is used for ornamental purposes. Fruits are used for medicinal purposes. .

The composition for improving skin condition provided in the present specification

(1) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and

(2) 1 species selected from the group consisting of Sambakcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetylhexapeptide-1, Squidweed extract, Butracetri extract, and Red chinensis extract ideal

1:10 to 100 ((1):(2)), 1:10 to 90, 1:10 to 85, 1:10 to 82.5, 1:10 to 80, 1:10 to 60, 1:10 to 57.5 , 1:10 to 55, 1:10 to 50, 1:10 to 40, 1:10 to 37.5, 1:10 to 35, 1:20 to 100, 1:20 to 90, 1:20 to 85, 1 :20 to 82.5, 1:20 to 80, 1:20 to 60, 1:20 to 57.5, 1:20 to 55, 1:20 to 50, 1:20 to 40, 1:20 to 37.5, 1:20 to 35, 1:30 to 100, 1:30 to 90, 1:30 to 85, 1:30 to 82.5, 1:30 to 80, 1:30 to 60, 1:30 to 57.5, 1:30 to 55 , 1:30 to 50, 1:30 to 40, 1:30 to 37.5, 1:30 to 35, 1:35 to 100, 1:35 to 90, 1:35 to 85, 1:35 to 82.5, 1 :35 to 80, 1:35 to 60, 1:35 to 57.5, 1:35 to 55, 1:35 to 50, 1:35 to 40, 1:35 to 37.5, 1:37.5 to 100, 1:37.5 to 90, 1:37.5 to 85, 1:37.5 to 82.5, 1:37.5 to 80, 1:37.5 to 60, 1:37.5 to 57.5, 1:37.5 to 55, 1:37.5 to 50, 1:37.5 to 40 , 1:50 to 100, 1:50 to 90, 1:50 to 85, 1:50 to 82.5, 1:50 to 80, 1:50 to 60, 1:50 to 57.5, 1:50 to 55, 1 :55 to 100, 1:55 to 90, 1:55 to 85, 1:55 to 82.5, 1:55 to 80, 1:55 to 60, 1:55 to 57.5, 1:57.5 to 100, 1:57.5 to 90, 1:57.5 to 85, 1:57.5 to 82.5, 1:57.5 to 80, 1:57.5 to 60, 1:60 to 100, 1:60 to 90, 1:60 to 85, 1:60 to 82.5 , 1:60 to 80, 1:80 to 100, 1:80 to 90, 1:80 to 85, 1:80 to 82.5, 1:82.5 to 100, 1:82.5 to 90, or 1:82.5 to 85, For example, it may be included in a weight ratio of 1:35, 1:37.5, 1:57.5 or 1:82.5, but is not limited thereto.

The composition for improving skin condition provided in the present specification

(1) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and

(2) 1 species selected from the group consisting of Sambakcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetylhexapeptide-1, Squidweed extract, Butracetri extract, and Red chinensis extract ideal

1 to 100 (w/v)%, 1 to 50 (w/v)%, 1 to 30 (w/v)%, 1 to 20 (w/v)%, 1 to 15 (w/v)%, 1 to 10 (w/v)%, 5 to 100 (w/v)%, 5 to 50 (w/v)%, 5 to 30 (w/v)%, 5 to 20 (w/v)%, 5 to 15 (w/v)%, 5 to 10 (w/v)%, 8 to 100 (w/v)%, 8 to 50 (w/v)%, 8 to 30 (w/v)%, 8 to 20 (w/v)%, 8 to 15 (w/v)%, 8 to 10 (w/v)%, 10 to 100 (w/v)%, 10 to 50 (w/v)%, 10 to 30 (w / v)%, 10 to 20 (w / v)%, or 10 to 15 (w / v)%, for example, may be included at a concentration of 10 (w / v)%, but is limited thereto it is not going to be

The composition for improving skin condition provided in the present specification contains triticale extract and marjoram extract in an amount of 1 to 20:1 (triple quince extract: marjoram extract), 1 to 15:1, 1 to 10:1, 1 to 8:1, 1 to 8:1 7:1, 5 to 20:1, 5 to 15:1, 5 to 10:1, 5 to 8:1, 5 to 7:1, 7 to 20:1, 7 to 15:1, 7 to 10: It may be included in a weight ratio of 1, or 7 to 8:1, for example, 7:1, but is not limited thereto.

The composition for improving skin condition provided in the present specification contains Haberea rhodopensis extract and Marjoram extract at a ratio of 1 to 10: 1 (Haberea rhodopensis extract: Marjoram extract), 1 to 5: 1, 1 to 3: 1, 1 to 2:1, 1.5 to 10:1, 1.5 to 5:1, 1.5 to 3:1, 1.5 to 2:1, 2 to 10:1, 2 to 5:1, or 2 to 3:1, such as , It may be included in a weight ratio of 2: 1, but is not limited thereto.

The composition for improving skin condition provided in the present specification is a mixture of a prickly pear extract and a langshot extract in a ratio of 1 to 10:1 (prickly pear extract: langshot extract), 1 to 5:1, 1 to 3:1, 1 to 2:1, Or 1 to 1.5: 1, for example, may include a weight ratio of 1.5: 1, but is not limited thereto.

The composition for improving skin condition provided in the present specification contains acetylhexapeptide-1 and Langshot extract in the ratio of 1:1 to 20 (acetylhexapeptide-1: Langshot extract), 1:1 to 15, 1:1 to 14, 1: 1 to 13, 1:5 to 20, 1:5 to 15, 1:5 to 14, 1:5 to 13, 1:10 to 20, 1:10 to 15, 1:10 to 14, 1:10 to 13, 1:12 to 20, 1:12 to 15, 1:12 to 14, 1:12 to 13, 1:13 to 20, 1:13 to 15, or 1:13 to 14, such as 1:13 It may be included in a weight ratio of, but is not limited thereto.

The composition for improving skin condition provided in the present specification is composed of 1 to 10: 1 (Supracetri extract: Butracetri extract), 1 to 5: 1, 1 to 3: 1, 1 to 3: 1, It may be included in a weight ratio of 2 to 10:1, 2 to 5:1, 2 to 3:1, 5 to 10:2, 5 to 8:2, or 5 to 6:2, such as 5:2, It is not limited thereto.

The composition for improving skin condition provided in the present specification is composed of chinensis extract and butracetri extract in the ratio of 1 to 10: 1 (wild chinensis extract: butracetri extract), 1 to 5: 1, 1 to 3: 1, It may be included in a weight ratio of 2 to 10:1, 2 to 5:1, 2 to 3:1, 5 to 10:2, 5 to 8:2, or 5 to 6:2, such as 5:2, It is not limited thereto.

The composition for improving skin conditions provided herein may further include a preservative and moisturizer, and may include 1,2-hexanediol, glycerin, butylene glycol, It may further include at least one selected from the group consisting of maltodextrin and hyaluronic acid, but is not limited thereto.

In the present specification, "skin condition improvement" may be at least one selected from the group consisting of wrinkle improvement, skin elasticity enhancement, skin whitening, skin blemishes reduction, skin barrier enhancement, and acne improvement, but is not limited thereto.

The composition for improving skin conditions provided herein may have one or more effects selected from the group consisting of wrinkle improvement, skin elasticity enhancement, skin whitening, skin blemishes reduction, skin barrier enhancement, and acne improvement, but are now limited. no.

In the present specification, "wrinkle" refers to fine lines caused by skin deterioration.

In this specification, "elasticity" means a force that bounces like a spring or holds tight.

As used herein, "whitening" or "skin whitening" refers to any activity that prevents, improves, alleviates, and/or treats pigmentation in the skin, such as preventing and improving freckles, melasma, age spots, and blemishes. , alleviation, and/or treatment, but is not limited thereto.

In the present specification, "melasma" refers to a disease in which brown spots of irregular shapes and various sizes occur in exposed areas, particularly on the face.

As used herein, "acne" refers to a chronic inflammatory disease that occurs in the sebaceous glands attached to hair follicles that produce hair.

As used herein, "treatment" means alleviation or improvement of symptoms (eg, wrinkles, melasma, and/or acne, etc.), delay or alleviation of disease progression (eg, wrinkles, melasma, and/or acne, etc.), disease state or symptom It can be used in the meaning of including all improvement, reduction or stabilization of, partial or complete recovery or elimination, and other beneficial treatment results. “Amelioration” means alleviation or improvement of (eg, wrinkles, melasma, and/or acne, etc.), delay or alleviation of the progression of a disease (eg, wrinkles, melasma, and/or acne, etc.), amelioration, alleviation, or stabilization of a disease state or symptom. etc. can be used in the meaning including all. “Prevention” is used to include all mechanisms and/or effects that act on a subject not having a specific disease to prevent the development of the specific disease or to delay the onset of the disease.

The composition for improving skin condition provided herein increases collagen type I protein expression, decreases AGER protein expression, increases elastin protein expression, decreases melanin synthesis, decreases TRP-1 protein expression, decreases PAR-2 protein expression, and increases filaggrin protein expression , At least one effect selected from the group consisting of increasing Involucrin expression and inhibiting inflammatory cytokine expression may be present, but is not limited thereto.

Another example is

(a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)

(b) 1 species selected from the group consisting of Sambakcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetylhexapeptide-1, Squidweed extract, Butracetri extract, and Red chinensis extract ideal

It provides a method for producing a composition for improving skin condition, comprising the step of mixing.

Method for producing the composition for improving skin condition

Mixing Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and/or

A mixture of two or more selected from the group consisting of Sambaekcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetyl Hexapeptide-1, Sturgeon japonica extract, Butracetri extract, and Red chinensis extract It may further include the step of doing, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (a) is prepared by mixing Adenine (A), Thymine (T), Guanine (G) and Cytosine (C). and (b) is composed of three baekcho extracts, marjoram extracts, haberea rhodopensis extracts, ginseng extracts, langshot extracts, acetyl hexapeptide-1, rhododendron japonica extracts, butracetri extracts, and japonica extracts. It may be prepared by mixing two or more selected from the group, but is not limited thereto.

(a) adenine (A), thymine (T), guanine (G) and cytosine (Cytosine; C)

(b) 1 species selected from the group consisting of Sambakcho extract, Marjoram extract, Haberea rhodopensis extract, Gasiogalpi extract, Langshot extract, Acetylhexapeptide-1, Squidweed extract, Butracetri extract, and Red chinensis extract ideal

1:10 to 100 ((a):(b)), 1:10 to 90, 1:10 to 85, 1:10 to 82.5, 1:10 to 80, 1:10 to 60, 1:10 to 57.5 , 1:10 to 55, 1:10 to 50, 1:10 to 40, 1:10 to 37.5, 1:10 to 35, 1:20 to 100, 1:20 to 90, 1:20 to 85, 1 :20 to 82.5, 1:20 to 80, 1:20 to 60, 1:20 to 57.5, 1:20 to 55, 1:20 to 50, 1:20 to 40, 1:20 to 37.5, 1:20 to 35, 1:30 to 100, 1:30 to 90, 1:30 to 85, 1:30 to 82.5, 1:30 to 80, 1:30 to 60, 1:30 to 57.5, 1:30 to 55 , 1:30 to 50, 1:30 to 40, 1:30 to 37.5, 1:30 to 35, 1:35 to 100, 1:35 to 90, 1:35 to 85, 1:35 to 82.5, 1 :35 to 80, 1:35 to 60, 1:35 to 57.5, 1:35 to 55, 1:35 to 50, 1:35 to 40, 1:35 to 37.5, 1:37.5 to 100, 1:37.5 to 90, 1:37.5 to 85, 1:37.5 to 82.5, 1:37.5 to 80, 1:37.5 to 60, 1:37.5 to 57.5, 1:37.5 to 55, 1:37.5 to 50, 1:37.5 to 40 , 1:50 to 100, 1:50 to 90, 1:50 to 85, 1:50 to 82.5, 1:50 to 80, 1:50 to 60, 1:50 to 57.5, 1:50 to 55, 1 :55 to 100, 1:55 to 90, 1:55 to 85, 1:55 to 82.5, 1:55 to 80, 1:55 to 60, 1:55 to 57.5, 1:57.5 to 100, 1:57.5 to 90, 1:57.5 to 85, 1:57.5 to 82.5, 1:57.5 to 80, 1:57.5 to 60, 1:60 to 100, 1:60 to 90, 1:60 to 85, 1:60 to 82.5 , 1:60 to 80, 1:80 to 100, 1:80 to 90, 1:80 to 85, 1:80 to 82.5, 1:82.5 to 100, 1:82.5 to 90, or 1:82.5 to 85, For example, it may be mixed at a weight ratio ((a):(b)) of 1:35, 1:37.5, 1:57.5 or 1:82.5, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (a) is a mixture of adenine (A), thymine (T), guanine (G) and cytosine (C) in a ratio of 1 to 15:1 to 15:1:1 (A:T :G:C), 1 to 12:1 to 12:1:1, 1 to 10:1 to 10:1:1, 1 to 9:1 to 9:1:1, 1 to 7:1 to 7: 1:1, 1 to 6:1 to 6:1:1, 1 to 5:1 to 5:1:1, 3 to 15:3 to 15:1:1, 3 to 12:3 to 12:1: 1, 3 to 10:3 to 10:1:1, 3 to 9:3 to 9:1:1, 3 to 7:3 to 7:1:1, 3 to 6:3 to 6:1:1, 3 to 5:3 to 5:1:1, 4 to 15:4 to 15:1:1, 4 to 12:4 to 12:1:1, 4 to 10:4 to 10:1:1, 4 to 9:4 to 9:1:1, 4 to 7:4 to 7:1:1, 4 to 6:4 to 6:1:1, 4 to 5:4 to 5:1:1, 5 to 15: 5 to 15:1:1, 5 to 12:5 to 12:1:1, 5 to 10:5 to 10:1:1, 5 to 9:5 to 9:1:1, 5 to 7:5 to 7:1:1, 5 to 6:5 to 6:1:1, 7 to 15:7 to 15:1:1, 7 to 12:7 to 12:1:1, 7 to 10:7 to 10: 1:1, 7 to 9:7 to 9:1:1, 8 to 15:8 to 15:1:1, 8 to 12:8 to 12:1:1, 8 to 10:8 to 10:1: 1, 8 to 9:8 to 9:1:1, 9 to 15:9 to 15:1:1, 9 to 12:9 to 12:1:1, or 9 to 10:9 to 10:1:1 , For example, 1:1:1:1 (A:T:G:C), 5:5:1:1 or 9:9:1:1, but may be included in a weight ratio, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (b) is 1 to 20: 1 (Swallowtail extract: Marjoram extract), 1 to 15: 1, 1 to 10: 1, 1 to 8: 1, 1 to 7:1, 5 to 20:1, 5 to 15:1, 5 to 10:1, 5 to 8:1, 5 to 7:1, 7 to 20:1, 7 to 15:1, It may be included in a weight ratio of 7 to 10:1, or 7 to 8:1, for example, 7:1, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (b) is obtained by mixing the Haberea rhodopensis extract and the Marjoram extract at a ratio of 1 to 10: 1 (Haberea rhodopensis extract: Marjoram extract), 1 to 5: 1, 1 to 10: 1. 3:1, 1 to 2:1, 1.5 to 10:1, 1.5 to 5:1, 1.5 to 3:1, 1.5 to 2:1, 2 to 10:1, 2 to 5:1, or 2 to 3 : 1, for example, may include a weight ratio of 2: 1, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (b) is a mixture of ginseng ginseng extract and langshot extract at a ratio of 1 to 10:1 (strife ginseng extract: langshot extract), 1 to 5:1, 1 to 3:1, 1 to 10:1 It may be included in a weight ratio of 2:1, or 1 to 1.5:1, for example, 1.5:1, but is not limited thereto.

In the method for preparing the composition for improving skin conditions, (b) is 1:1 to 20 (acetylhexapeptide-1: Langshot extract), 1:1 to 15, 1:1 to 1:1 to acetylhexapeptide-1 and Langshot extract. 14, 1:1 to 13, 1:5 to 20, 1:5 to 15, 1:5 to 14, 1:5 to 13, 1:10 to 20, 1:10 to 15, 1:10 to 14, 1:10 to 13, 1:12 to 20, 1:12 to 15, 1:12 to 14, 1:12 to 13, 1:13 to 20, 1:13 to 15, or 1:13 to 14, such as , It may be included in a weight ratio of 1:13, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (b) is the ratio of 1 to 10: 1 (Spiderilla japonica extract: Butracetri extract), 1 to 5: 1, 1 to 5: 1, 1 to 10: 1 3:1, 2 to 10:1, 2 to 5:1, 2 to 3:1, 5 to 10:2, 5 to 8:2, or 5 to 6:2, such as in a weight ratio of 5:2 It can be done, but is not limited thereto.

In the method for preparing the composition for improving skin condition, (b) is composed of 1 to 10: 1 (Squid japonica extract: Butracetri extract), 1 to 5: 1, 1 to 1 to 5: 1, 1 to 10: 1 3:1, 2 to 10:1, 2 to 5:1, 2 to 3:1, 5 to 10:2, 5 to 8:2, or 5 to 6:2, such as in a weight ratio of 5:2 It can be done, but is not limited thereto.

In the present specification, the composition may be a pharmaceutical composition, cosmetic composition, skin external application composition, health functional food, or quasi-drug composition, which is a solution, ointment, external ointment, cream, essence, foam, lotion, nutrient lotion, softening water, softening lotion , pack, emulsion, makeup base, soap, cleanser, bath additive, sunscreen, body lotion, body cream, gel cream, massage cream, sun oil, suspension, emulsion, paste, gel (gel), lotion, powder, soap, It may have a formulation selected from the group consisting of surfactant-containing cleansing, oil, foundation, powder foundation, emulsion foundation, wax foundation, patch, lipstick, spray, and spray.

In the present specification, "cosmetics" or "cosmetic composition" may be in any formulation form conventionally prepared in the art, and for example, solutions, ointments, external ointments, creams, essences, foams, lotions, nutrient lotions, softening water, Softening lotion, pack, emulsion, makeup base, soap, cleanser, bath additive, sunscreen, body lotion, body cream, gel cream, massage cream, sun oil, suspension, emulsion, paste, gel (gel), lotion, powder, It may be formulated into soap, surfactant-containing cleansing, oil, foundation, powder foundation, emulsion foundation, wax foundation, patch, lipstick, mist and spray, but is not limited thereto. Specifically, it may be prepared in the form of softening lotion, nutrient lotion, nutrient cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.

The cosmetic or cosmetic composition may be used alone or in combination with other cosmetic compositions. In addition, the cosmetic composition of the present invention can be used according to the usual method of use, but the number of times of use can be varied according to the user's skin condition or taste.

The cosmetic or cosmetic composition may be used for humans, primates such as monkeys, rodents such as mice, rats, and rabbits, other mammals including dogs, cats, cows, pigs, sheep, horses, goats, chickens, ducks, geese, etc. It may be applied to a target selected from vertebrates such as reptiles, amphibians, and fish, including birds, snakes, lizards, turtles, and crocodiles.

A composition according to the present disclosure may be a pharmaceutical composition. The pharmaceutical composition for whitening according to the present specification may be used alone or in combination with other pharmaceutically active compounds. The pharmaceutical composition may be a formulation for oral administration or parenteral administration known in the art.

If the composition is for oral administration (e.g., a pharmaceutical composition (oral) or food composition), the composition may be formulated into powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. there is.

The pharmaceutical composition is suitable for humans, primates such as monkeys, rodents such as mice, rats and rabbits, other mammals including dogs, cats, cows, pigs, sheep, horses, goats, chickens, ducks and geese. It can be administered to a target selected from vertebrates such as birds, snakes, lizards, turtles, reptiles including crocodiles, amphibians, and fish, including the like, by various routes.

The method of administration of the pharmaceutical composition may be any method commonly used, for example, oral administration, intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, topical administration at the lesion site, or parenteral administration such as intraperitoneal injection. It can be administered by route. All modes of administration can be envisaged, eg oral, or parenteral administration (intraperitoneal, rectal, intravenous, intramuscular or subcutaneous injection, or transdermal administration). At this time, the parenteral route is preferably transdermal administration, and among them, topical application may be the most preferable. A preferred dosage of the pharmaceutical composition for whitening according to the present invention varies depending on the condition and weight of the patient, the severity of the disease, the type of drug, the route and period of administration, but can be appropriately selected by those skilled in the art. However, for desirable effects, the pharmaceutical composition for whitening according to the present invention may be administered in an amount of 0.1 to 100 mg/kg once or several times a day, but is not limited thereto.

The pharmaceutical composition may be administered in a pharmaceutically effective amount. The dosage of the pharmaceutical composition is variously prescribed by factors such as formulation method, administration method, patient's age, weight, sex, disease condition, food, administration time, administration interval, administration route, excretion rate, and reaction sensitivity. It can be. The dosage may vary depending on the patient's age, weight, sex, dosage form, health condition, and degree of disease, and may be divided into once or several times a day at regular time intervals according to the judgment of a doctor or pharmacist.

For example, the dose of the pharmaceutical composition once or daily is 0.001 to 10000 mg / kg, specifically, 0.01 to 10000 mg based on the weight of the solid content of the active ingredient (eg, nucleobase, plant extract, acetyl hexapeptide-1, etc.) /kg, 0.01 to 5000mg/kg, 0.01 to 3000mg/kg, 0.01 to 2500mg/kg, 0.01 to 2000mg/kg, 0.01 to 1800mg/kg, 0.1 to 10000mg/kg, 0.1 to 5000mg/kg kg, 0.1 to 3000 mg/kg, 0.1 to 2500 mg/kg, 0.1 to 2000 mg/kg, 0.1 to 1800 mg/kg, 1 to 10000 mg/kg, 1 to 5000 mg/kg, 1 to 3000 mg/kg , 1 to 2500 mg/kg, 1 to 2000 mg/kg, 1 to 1800 mg/kg, 10 to 10000 mg/kg, 10 to 5000 mg/kg, 10 to 3000 mg/kg, 10 to 2500 mg/kg, 10 to 2000 mg/kg, 10 to 1800 mg/kg, 100 to 10000 mg/kg, 100 to 5000 mg/kg, 100 to 3000 mg/kg, 100 to 2500 mg/kg, 100 to 2000 mg/kg, or It may range from 100 to 1800 mg/kg, but is not limited thereto. The one-time or daily dose may be formulated as a single formulation in unit dose form, formulated in appropriate portions, or prepared by placing it in a multi-dose container. The above dosage is an example of an average case, and the dosage may be higher or lower depending on individual differences.

The pharmaceutical composition may be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, or parenteral formulations in the form of sterile injectable solutions according to conventional methods, respectively. there is.

In addition to the active ingredients described above, the pharmaceutical composition is generally selected from the group consisting of pharmaceutically and / or physiologically acceptable carriers, excipients, diluents, etc., selected in consideration of the method of administration and standard pharmaceutical practice. It may be administered in combination with one or more selected adjuvants. For example, the pharmaceutically and/or physiologically acceptable carrier may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, It may contain at least one selected from the group consisting of cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. However, it is not limited thereto, and may be any carrier commonly used in the pharmaceutical field.

The pharmaceutically and / or physiologically acceptable diluent and / or excipient is selected from the group consisting of all fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, etc. commonly used in the proper formulation of pharmaceutical compositions It may be one or more.

For example, in the case of solid preparations for oral administration such as tablets, pills, powders, granules, or capsules, the excipient is at least one material for formulating such solid preparations, such as starch, calcium carbonate , sucrose, lactose, and may be one or more selected from the group consisting of gelatin. In addition, lubricants such as magnesium styrate, talc, and the like may also be used. In addition, in the case of formulation of liquid preparations for oral administration such as suspensions, internal solutions, emulsions, syrups, etc., at least one selected from the group consisting of commonly used simple diluents such as water, liquid paraffin, etc. may be used. , Various excipients commonly used, for example, wetting agents, sweeteners, aromatics, and / or preservatives may be included, but are not limited thereto.

For example, the pharmaceutical composition may be in the form of a tablet containing starch or lactose, or in the form of a capsule containing suitable excipients, or in the form of an elixir or suspension containing a flavoring or coloring chemical, orally, orally. It can be administered intra- or sublingually. Such liquid formulations may be prepared by suspending agents (e.g. methylcellulose, semi-synthetic glycerides such as Witepsol, or mixtures of Apricot kernel oil and PEG-6 esters or PEG-8 and caprylic/capric acid). It may be formulated with pharmaceutically acceptable excipients such as mixtures of glycerides, but not limited thereto.

The present invention is a composition for improving skin condition containing a nucleobase, and specifically, the improvement of skin condition is at least one selected from the group consisting of wrinkle improvement, skin elasticity enhancement, skin whitening, skin blemishes reduction, skin barrier strengthening, and acne improvement. It works.

1 is a graph confirming the antioxidant activity of nucleobases. 9:9:1:1, 5:5:1:1 and 1:1:1:1 refer to the weight ratios of A, T, G, and C (A:T:G:C).
Figure 2 is a graph showing the results of confirming the elastin inhibitory activity of the nucleobase by measuring the absorbance.
3 is a graph showing the results of confirming the elastin inhibition rate of nucleobases.
4 is a graph confirming the NO production inhibitory effect of nucleobases. NDGA means positive control nordihydroguaiaretic acid.
5 is a graph confirming the cytotoxicity of nucleobases. NDGA means positive control nordihydroguaiaretic acid.
6 is a photograph showing the results of morphological observation of Collagen Type I to which DNA-AGER was added to RST through an immunofluorescence staining process. D0 control is RST where DNA-AGER is not treated and culture is not performed, D5 control is RST where DNA-AGER is not treated and culture is performed for 5 days, D5 DNA-AGER 10% is DNA-AGER is added and 5 Means the RST after culturing for one day.
7 is a graph showing comparison results of Collagen Type I positive staining areas observed by adding DNA-AGER to RST. D0 control is RST where DNA-AGER is not treated and culture is not performed, D5 control is RST where DNA-AGER is not treated and culture is performed for 5 days, D5 DNA-AGER 10% is DNA-AGER is added and 5 Means the RST after culturing for one day.
8 is a photograph showing the results of morphological observation of elastin to which DNA-ELN was added to RST through an immunofluorescence staining process. D0 control is RST where DNA-ELN is not treated and culture is not performed, D5 control is RST where DNA-ELN is not treated and culture is performed for 5 days, D5 DNA-ELN 10% is DNA-ELN is added and 5 Means the RST after culturing for one day.
9 is a graph showing the comparison results of elastin-positive stained areas observed by adding DNA-ELN to RST. D0 control is RST where DNA-ELN is not treated and culture is not performed, D5 control is RST where DNA-ELN is not treated and culture is performed for 5 days, D5 DNA-ELN 10% is DNA-ELN is added and 5 Means the RST after culturing for one day.
10 is a photograph showing melanin synthesis results of Reconstructed skin tissue (RST) to which DNA-OCA was added. D0 control is RST where DNA-OCA is not treated and culture is not performed, D5 control is RST where DNA-OCA is not treated and culture is performed for 5 days, D5 DNA-OCA 10% is DNA-OCA is added and 5 Means the RST after culturing for one day.
11 is a graph showing the comparison results of melanin-positive stained areas observed by adding DNA-OCA to RST. D0 control is RST where DNA-OCA is not treated and culture is not performed, D5 control is RST where DNA-OCA is not treated and culture is performed for 5 days, D5 DNA-OCA 10% is DNA-OCA is added and 5 Means the RST after culturing for one day.
12 is a photograph showing melanin synthesis results of Reconstructed skin tissue (RST) to which DNA-MC1R was added. D0 control is RST where DNA-MC1R is not treated and culture is not performed, D5 control is RST where DNA-MC1R is not treated and culture is performed for 5 days, D5 DNA-MC1R 10% is DNA-MC1R is added and 5 Means the RST after culturing for one day.
13 is a graph showing the comparison results of melanin-positive stained areas observed by adding DNA-MC1R to RST. D0 control is RST where DNA-MC1R is not treated and culture is not performed, D5 control is RST where DNA-MC1R is not treated and culture is performed for 5 days, D5 DNA-MC1R 10% is DNA-MC1R is added and 5 Means the RST after culturing for one day.
14 is a photograph confirming the expression level of filaggrin through Immunofluorescence staining when DNA-IL is added to RST. D0 control is RST where DNA-IL is not treated and culture is not performed, D5 control is RST where DNA-IL is not treated and culture is performed for 5 days, D5 DNA-IL 10% is DNA-IL is added and 5 Means the RST after culturing for one day.
15 is a graph showing comparison results of filaggrin-positive staining areas observed by adding DNA-IL to RST. D0 control is RST where DNA-IL is not treated and culture is not performed, D5 control is RST where DNA-IL is not treated and culture is performed for 5 days, D5 DNA-IL 10% is DNA-IL is added and 5 Means the RST after culturing for one day.
16 is a graph confirming the expression level of inflammatory cytokines when DNA-AC was added to RAW 264.7 cells.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Preparation of samples containing nucleobases

In order to confirm the skin improvement effect (antioxidant effect, skin elasticity effect, defense effect against inflammation) of nucleobases, adenine (A), thymine (T), guanine (G) and cytosine ( Cytosine; C) (Merck Sigma-Aldrich (Germany)) was prepared by dissolving DMSO (Dimethyl sulfoxide) as a solvent to a concentration of 2mg/ml, and the weight ratio of each base was (A:T:G:C) A sample containing the base was prepared so that the ratio was 9:9:1:1 (sample 1), 5:5:1:1 (sample 2) or 1:1:1:1 (sample 3).

Example 2. Confirmation of antioxidant activity of nucleobases

In order to confirm the antioxidant effect of the nucleobase, the sample prepared in Example 1 was diluted with methanol to a concentration of 10 μg/ml, 25 μg/ml, 50 μg/ml, 100 μg/ml, or 200 μg/ml, respectively, by type and concentration. Samples were prepared, and L-ascorbic acid (Merck Sigma-Aldrich (Germany)) at a concentration of 18 μg/ml was prepared as a positive control.

180 μl of 0.3 mM DPPH (2,2-diphenyl-1-picrylhydrazyl, Sigma, USA) was mixed with 20 μl of the prepared sample, reacted at room temperature for 10 minutes, and then the absorbance was measured at a wavelength of 565 nm using a microplate reader. DPPH radical scavenging activity (DPPH radical scavenging ratio, %) was calculated by Equation 1 to confirm antioxidant activity, and the results are shown in FIGS. 1a to 1b.

[Equation 1]

As a result, sample 1 showed significant antioxidant efficacy from the 50 μg/ml concentration, and 17.3%, 32.8%, and 54.3% DPPH radical scavenging activity at 50 μg/ml, 100 μg/ml, and 200 μg/ml concentrations, respectively. It was confirmed that 10.2% DPPH radical scavenging activity was shown at a concentration of 200 μg/ml. Through this, it was confirmed that sample 1 had the best antioxidant activity.

Example 3. Confirmation of the effect on the elasticity of nucleobases

In order to confirm the effect of nucleobases on skin elasticity, an experiment was conducted to evaluate the inhibitory activity of elastase, an enzyme that decomposes elastin, an elastic fiber of the skin. Compounds with elastase inhibitory activity maintain the mechanical properties of skin tissue. It corrects elasticity and skin color and prevents skin sagging. Therefore, by measuring the elastase inhibitory activity of the raw material, the active raw material is useful for developing cosmetics for wrinkle improvement and elastic skin.

For the evaluation of the inhibitory activity, samples 1 to 3 prepared in Example 1 were diluted with 0.1 M Tris-HCl buffer to a concentration of 100 μg/ml or 200 μg/ml, respectively, and samples were prepared for each type and concentration, and a positive control group Phosphoramidon at a concentration of 0.06 μg/ml was prepared.

After adding 0.1M Tris-HCl buffer (pH 8.2) containing 1% Triton X-100 to the cultured HDFn cells (ATCC (USA)), collect them in a conical tube with a cell scraper and react at 4℃ for 15 minutes, followed by ultrasonic waves. The enzyme was prepared by extracting the enzyme with a grinder, centrifuging at 13,000 rpm for 15 minutes, and adding 30 (v/v)% of glycerol to the supernatant.

A substrate was prepared by dissolving N-Succinyl-tri-L alanine-4-nitroanilide (SAAAP, C ₁₉ H ₂₅ N ₅ O ₈ , 451.44) in 0.1 M Tris-HCl buffer (pH 8.2) to 20 mM, and the following table The prepared samples (Samples 1 to 3 and positive control), enzyme, substrate and buffer were mixed at a ratio of 1.

Material control group 1-1 Control group 1-2 Experimental group 1-1 Experimental group 1-2 buffer 0 50 0 50 sample 10 10 10 10 enzyme 50 0 50 0 temperament 40 40 40 40

(The unit of each value in Table 1 is μl, the samples included in Controls 1-1 and 1-2 are distilled water, and the buffer is 0.1 M Tris-HCl buffer (pH 8.2))

The prepared samples (Samples 1 to 3 and the positive control group) were reacted at 37 ° C. for 2 hours using a microplate reader, and the absorbance was measured at 405 nm every 5 minutes. The samples were mixed in the ratio shown in Table 1 above. After confirming the maximum reaction rate intervals of the control groups 1-1 and 1-2 and the experimental groups 1-1 and 1-2, the reaction rates between 80 and 100 minutes were compared to evaluate the elastase activity, expressed as a percentage of the experimental group compared to the control group. The inhibition rate (%) for each type and concentration of each sample was confirmed through Equation 2 below, and the results are shown in FIGS. 2 and 3.

[Equation 2]

(In Equation 2, A: Experimental group 1-1, B: Experimental group 1-2, C: Control group 1-1, D: Control group 1-2, and the significance is determined by the biological statistical criteria (two sample t-test) Significance level (α): 1%))

As a result, sample 1 significantly inhibited the activity of elastase by 16.5% and 32.7% at concentrations of 100 μg/ml and 200 μg/ml, respectively, and sample 2 significantly inhibited the activity of elastase by 3.3% and 8.2% at concentrations of 100 μg/ml and 200 μg/ml, respectively. An insignificant elastase activity inhibitory effect was shown, and sample 3 did not affect the elastase activity up to a concentration of 200 μg/ml. Through this, it was confirmed that sample 1 showed the highest elastase activity inhibition and was the most excellent in maintaining skin elasticity.

Example 4. Confirmation of the anti-inflammatory effect of nucleobases

To confirm the effect of the nucleobase on the inflammatory response, it is a biogenic molecule with high reactivity among various inflammatory factors produced by the inflammatory response, which is a defense mechanism against external invading substances. It is produced by iNOS when stimulated with lipopolysaccharide (LPS). By confirming the expression of nitric oxide (NO), the response to inflammation was indirectly confirmed.

In order to confirm the expression of the NO, samples 1 to 3 prepared in Example 1 were diluted with DMEM (Dulbecco Modified Eagle Medium) liquid medium to a concentration of 10 μg/ml, 20 μg/ml or 40 μg/ml, respectively, for each type and concentration. Samples were prepared, and nordihydroguaiaretic acid (NDGA) at a concentration of 1 μg/ml was prepared as a positive control.

RAW 264.7 cells were dispensed into 96 well-plates at a concentration of 1 x 10 ⁵ cells/well, and then cultured in a 37°C incubator for one day. NO production was induced by treatment with LPS at a concentration of 1 μg/ml, and the prepared samples (Samples 1 to 3 and the positive control group) were treated by type and concentration and allowed to react for 24 hours. After the reaction was completed, the supernatant was reacted with the griess reagent and the absorbance was measured at 540 nm to confirm the amount of NO production, and the results are shown in FIGS. 4a to 4c.

Thereafter, the cells were treated with MTT reagent at a concentration of 5 mg/ml and further incubated for 1 hour, the supernatant was removed and the cells were completely dissolved by treatment with 100 μl of DMSO, and then the absorbance was measured at 550 nm to confirm cytotoxicity. The results are shown in Figures 5a to 5c.

The significance of the test substance was confirmed according to the biological statistical criteria (significance level (α): 1%) through a two sample t-test.

As a result, sample 1 inhibited NO production significantly from the concentration of 10 μg/ml, and inhibited NO production by 17.4%, 49.2%, and 97.4% at concentrations of 10 μg/ml, 20 μg/ml, and 40 μg/ml, respectively. Sample 2 significantly inhibited NO production from the concentration of 20 μg/ml, suppressing NO production by 37.5% and 84.8% at 20 μg/ml and 40 μg/ml concentrations, respectively. Sample 3 significantly inhibited NO production from the 20 μg/ml concentration, suppressing 25.0% and 80.9% NO production at 20 μg/ml and 40 μg/ml concentrations, respectively. Through this, it was confirmed that Sample 1 had the highest NO production inhibition and had the best anti-inflammatory effect.

In addition, even when samples 1 to 3 were added, there was no significant change in cell viability, confirming that there was no cytotoxicity.

Example 5. Nucleobases and plant extracts (Trifolium chinensis extract and Marjoram leaf extract) complex wrinkle improvement effect confirmation

Example 5-1. Nucleobase and plant extract complex preparation and skin tissue treatment

In order to confirm the anti-wrinkle effect of the complex of nucleobases and plant extracts, especially when the plant extracts were used as triticale extract and marjoram leaf extract, the degree of collagen expression was confirmed.

In order to confirm the degree of collagen expression of the complex, after chopping the dried leaves of Sambaekcho and marjoram, put 100 g of dry weight in a flask, cool with 1 L of purified water, and use a high-pressure sterilizer (121 ° C. for 15 minutes). , 1.5 atm) and then filtered to remove the remnants to prepare an extract of Sambakcho and a leaf extract of Marjoram, and the extract and extract of Marjoram were mixed at a weight ratio of 7:1.

Sample 1 prepared in Example 1 and the mixed triticale extract and marjoram leaf extract were mixed at a weight ratio of 1:57.5 and concentrated under reduced pressure at 50 ° C. for 2 hours to obtain a 10 (w / v)% concentration of nucleobase (A , T, G, C complex) and plant extract complex (hereafter referred to as DNA-AGER) were prepared.

After that, 9 wells of Reconstructed skin tissue (RST) were prepared in assay media, and the prepared DNA-AGER was applied to 3 wells out of 6 wells on the tissue surface using a 20 μl pipette once/2 days and cultured for 5 days ( Experimental group 2-1). As a control, the remaining 3 wells were prepared with RST not treated with the DNA-AGER and cultured (Control 2-1) and RST cultured for 5 days (Control 2-2).

The experimental groups 2-1 and the control groups 2-1 and 2-2 were fixed in 10% neutral formalin solution for 24 hours. After that, it was embedded in OCT Compound (Optimal cutting temperature compound), cut to a thickness of 12 μm, attached to a gelatin-coated slide, and the slide was dried and stored.

Example 5-2. Experiment process

In order to confirm the anti-wrinkle effect of the composite by performing immunofluorescence staining, the dried and stored experimental group 2-1 and the control group 2-1 and 2-2 were put in distilled water to make them functional. Specifically, the experimental groups 2-1, the control groups 2-1 and 2-2 were put in a 0.01M citrate solution (pH 6.0), boiled for 15 minutes using a microwave, and left at room temperature for 20 minutes. After blocking using anti-goat serum, primary antibodies Collagen Type I (1:200), AGER (1:100) (santa cruz), and Claudin I (1:100) (invitrogen) were used overnight at 4°C. reacted Then, after washing with PBS solution, the secondary antibody, Goat anti-mouse IgG Alexa Fluor 488 (1:500) (abcam) was reacted at room temperature for 1 hour, washed with PBS solution, sealed with mounting medium with DAPI, and examined under a fluorescence microscope. Observed.

The ratio of the stained area (positive area) using the Image J program for the photograph taken at 200-fold magnification by observing with the fluorescence microscope is calculated through Equation 3 below. The rate of change, which means the amount of increase, was quantified and analyzed through Equation 4 below.

[Equation 3]

[Equation 4]

(In the case of the Example, in Equation 4, the test group is when DNA-AGER is treated (Experimental group 2-1), and the untreated group is when DNA-AGER is not treated (Control group 2-1 or 2-2) means)

The student t-test was used for statistical analysis, and a p-value of 0.05 or less was determined to be statistically significant.

Example 5-3. Collagen expression confirmation result

Collagen Type I accounts for 70% of the dermis and is a protein that plays an important role in preventing skin wrinkles. An increase in collagen type I means that the formation of skin wrinkles can be prevented, and the results of morphologically observing collagen type I through the immunofluorescence staining process are shown in FIG. 6 . Collagen Type I was stained with green fluorescence in the dermal layer, and blue light was staining the nuclei of cells.

In addition, the comparison results of Collagen Type I-positive stained areas through the statistical analysis of Example 5-2 are shown in Table 2 and FIG. 7 below.

army
(Group) Positive area (%) average Standard Deviation Change rate compared to control group 2-1 Change rate compared to control group 2-2 Significant probability compared to control group 2-1 Significant probability compared to control group 2-2 control group 2-1 23.36 0.97 - - - - control group 2-2 26.03 1.53 11.45 - 0.063 - Experimental group 2-1 38.73 2.84 65.85 48.81 0.00013 0.0024

(In Table 2, as the average value increases, it means that Collagen Type I increases, and if p<0.05, it means that there is a significant difference)

As a result, the change rate in the control group 2-2 was 11.45% compared to the control group 2-1, but it was not statistically significant. In addition, there was a significant change in the control group 2-2 compared to the control group 2-1, and the change rate was 65.85%. When using the experimental group 2-1, there was a significant change compared to the control group 2-1, and the change rate was 48.81%. Through this, the wrinkle improvement effect of DNA-AGER was confirmed through a test on reconstructed skin tissue, and DNA-AGER more excellently induces the expression of Collagen Type I, which affects skin wrinkle improvement in human-derived skin tissue, and AGER It was confirmed that the skin wrinkle improvement effect was excellent by showing the effect of suppressing.

Example 6. Confirmation of skin elasticity improvement effect of nucleobases and plant extracts (Haburea rhodopensis leaf extract and Marjoram leaf extract) complex

Example 6-1. Nucleobase and plant extract complex preparation and skin tissue treatment

In order to confirm the skin elasticity improvement effect of the complex of nucleobases and plant extracts, especially when using Haberea rhodopensis leaf extract and Marjoram leaf extract as plant extracts, the degree of enhancement of elastin synthesis was confirmed.

In order to confirm the degree of elastin synthesis enhancement of the composite, after cutting the dried Haberea rhodopensis leaves and marjoram leaves finely, put 100 g of dry weight in a flask, cool with 1 L of purified water, and use a high-pressure sterilizer After extraction by (121 ° C, 15 minutes, 1.5 atm), filtering was performed to remove the remnants to prepare Haberea rhodopensis leaf extract and Marjoram leaf extract. They were mixed in a weight ratio of 1.

Sample 1 prepared in Example 1 was mixed with the above-mixed Haberea rhodopensis leaf extract and Marjoram leaf extract at a weight ratio of 1:37.5, and concentrated under reduced pressure at 50 ° C. for 2 hours to obtain a concentration of 10 (w / v)% A nucleobase (a complex of A, T, G, and C) and a plant extract complex (hereafter, DNA-ELN) were prepared.

Then, 9 wells of Reconstructed skin tissue (RST) were prepared in assay media, and the prepared DNA-ELN was applied to 3 wells of the 9 wells on the tissue surface using a 20 μl pipette once/2 days and cultured for 5 days ( Experimental group 3-1). As a control group, RST (Control 3-1), which was not cultured without the DNA-ELN treatment, and RST (Control 3-2), which was cultured for 5 days, were prepared in 3 wells from the remaining 6 wells.

The experimental groups 3-1 and the control groups 3-1 and 3-2 were fixed in 10% neutral formalin solution for 24 hours. After that, it was embedded in OCT Compound (Optimal cutting temperature compound), cut to a thickness of 12 μm, attached to a gelatin-coated slide, and the slide was dried and stored.

Example 6-2. Experiment process

In order to confirm the skin elasticity improvement effect of the composite by performing immunofluorescence staining, the dried and stored experimental group 3-1 and control groups 3-1 and 3-2 were put in distilled water to make them functional. Specifically, the experimental groups 3-1, the control groups 3-1 and 3-2 were put in a 0.01M citrate solution (pH 6.0), boiled for 15 minutes using a microwave, and left at room temperature for 20 minutes. After blocking using anti-goat serum, the reaction was performed overnight at 4°C using primary antibody Elastin (1:100) (abcam). Then, after washing with PBS solution, the secondary antibody, Goat anti-mouse IgG Alexa Fluor 488 (1:500) (abcam) was reacted at room temperature for 1 hour, washed with PBS solution, sealed with mounting medium with DAPI, and examined under a fluorescence microscope. Observed.

The ratio of the stained area (positive area) using the Image J program for the photograph taken at 200-fold magnification by observing with the fluorescence microscope is calculated through Equation 3 below. The rate of change, which means the amount of increase, was quantified and analyzed through Equation 4 below.

[Equation 3]

[Equation 4]

(In the case of the Example, in Equation 4, the test group is when DNA-ELN is treated (Experimental group 3-1), and the untreated group is when DNA-ELN is not treated (Control group 3-1 or 3-2) means)

The student t-test was used for statistical analysis, and a p-value of 0.05 or less was determined to be statistically significant.

Example 6-3. Elastin (elastic fiber protein; Elastin) expression confirmation result

The result of morphologically observing elastin through the immunofluorescence staining process is shown in FIG. 8, and elastin was stained in a fibrous form with red fluorescence around fibroblasts in the dermis.

In addition, the comparison results of the elastin-positive stained area through the statistical analysis of Example 6-2 are shown in Table 3 and FIG. 9 below.

army
(Group) Positive area (%) average Standard Deviation Change rate compared to control group 3-1 Change rate compared to control group 3-2 Significant probability compared to control group 3-1 Significant probability compared to control group 3-2 control group 3-1 2.71 0.07 control group 3-2 6.04 0.1 122.88 <0.001 Experimental group 3-1 7.85 0.09 189.67 29.97 <0.001 <0.001

(In Table 3, it means that elastin increases as the average value increases, and if p<0.05, it means that there is a significant difference)

As a result, there was a significant change in the control group 3-2 compared to the control group 3-1, and the change rate was 122.88%. In addition, there was a significant change in the experimental group 3-1 compared to the control group 3-1, and the change rate was 189.67%. Through this, it was confirmed that elastin production by fibroblasts increased, and DNA-ELN enhances skin elasticity by increasing elastin among elasticity-related proteins produced by fibroblasts present in the dermis in human-derived skin cell tissues. It was confirmed that it was effective.

Example 7. Confirmation of whitening effect of nucleobases and plant extracts (Prickly pear extract and Langshat leaf extract) complex

Example 7-1. Nucleobase and plant extract complex preparation and skin tissue treatment

In order to confirm the whitening effect of the compound of nucleobase and plant extract, especially when the root extract and langshot leaf extract were used as plant extracts, the degree of inhibition of melanin synthesis was confirmed.

In order to confirm the degree of melanin synthesis inhibition of the complex, after finely chopping the dried ginseng root and langshot leaves, put 100 g of dry weight in a flask, cool with 1 L of purified water, and use a high-pressure sterilizer (121 ° C. , 15 minutes, 1.5 atm), followed by filtration to remove the remnants to prepare a Pasiogalpi root extract and a Langshat leaf extract, and the Pasiogalpi root extract and Langshat leaf extract were mixed in a weight ratio of 1.5:1.

Sample 1 prepared in Example 1 was mixed with the above-mixed Casiogalpi root extract and Langshat leaf extract at a weight ratio of 1:82.5, concentrated under reduced pressure at 50 ° C. for 2 hours, and nucleobase at 10 (w / v)% concentration (Composite of A, T, G, C) and plant extract complex (hereafter referred to as DNA-OCA) were prepared.

Then, 9 wells of Reconstructed skin tissue (RST) were prepared in assay media, α-MSH was added at a concentration of 100 nM to 3 wells of 9 wells to stimulate melanin formation, and DNA-OCA prepared above was added with a 20 μl pipette. was used to treat the tissue surface once/2 days and cultured for 5 days (experimental group 4-1). As a control group, RST (Control 4-1), in which the α-MSH and DNA-OCA were not treated, and the α-MSH was added, but the DNA-OCA was not treated, and the culture was carried out for 5 days. RST (Control 4-2) was prepared in 3 wells from the remaining 6 wells.

The experimental groups 4-1 and the control groups 4-1 and 4-2 were fixed in 10% neutral formalin solution for 24 hours. After that, it was embedded in OCT Compound (Optimal cutting temperature compound), cut to a thickness of 12 μm, attached to a gelatin-coated slide, and the slide was dried and stored.

Example 7-2. Experiment process

In order to confirm the whitening effect of the composite by performing immunohistochemistry staining, the dried and stored experimental group 4-1 and control groups 4-1 and 4-2 were put in distilled water to make them functional. Specifically, the experimental groups 4-1, the control groups 4-1 and 4-2 were put in a 0.01M citrate solution (pH 6.0), boiled for 15 minutes using a microwave, and left at room temperature for 20 minutes. Blocking was performed using anti-goat serum and reaction was performed overnight at 4°C using primary antibody TRP-1 (1:200, Invitrogen). After washing with PBS solution, biotinylated anti-rabbit IgG (vector), a secondary antibody, was reacted at room temperature for 1 hour, washed with PBS solution, and Vectastain elite ABC Reagent was reacted at room temperature for 30 minutes. Washed with PBS solution, reacted with DAB (3, 3'-diaminobenzidine) as a coloring reagent for 10 minutes, washed with distilled water, counterstained with hematoxylin, dehydrated with alcohol and xylene, sealed with Canada balsam, and observed under a microscope.

The ratio of the stained area (positive area) using the Image J program for the photograph taken under the microscope and taken at 400-fold magnification is calculated through Equation 3 below. The rate of change, which means , was quantified and analyzed through Equation 4 below.

[Equation 3]

[Equation 4]

(In the case of the Example, in Equation 4, the test group is when DNA-OCA is treated (Experimental group 4-1), and the untreated group is when DNA-OCA is not treated (Control group 4-1 or 4-2) means)

The student t-test was used for statistical analysis, and a p-value of 0.05 or less was determined to be statistically significant.

Example 7-3. Melanin synthesis confirmation result

The results of confirming melanin synthesis are shown in FIG. 10, and the results. Melanin was stained black, and in the control group 4-2 (D5 100nM α-MSH) stimulated with α-MSH, large and dark melanin was observed to be stained from the basal layer of the epidermis to all layers, and in the experimental group 4-2 that treated the sample 1 (D5 100 nM α-MSH + 10% DNA-OCA) decreased the size of melanin compared to the control group 4-2, which was stimulated with α-MSH, and a small amount of melanin stained black was observed.

In addition, the comparison results of the melanin-positive stained area by the statistical analysis of Example 7-2 are shown in Table 4 and FIG. 11 below.

army
(Group) Positive area (%) average Standard Deviation Change rate compared to control group 4-1 Change rate compared to control group 4-2 Significant probability compared to control group 4-1 Significant probability compared to control group 4-2 Control group 4-1 6.08 0.1 - - - - Control group 4-2 17.21 1.10 183.28 - 0.000006 - Experimental group 4-1 7.43 0.70 22.33 56.82 0.029 0.0002

(In Table 4, as the average value increases, it means that melanin increases, and if p<0.05, it means that there is a significant difference)

As a result, there was a significant change in the amount of melanin in the control group 4-2 compared to the control group 4-1, and the rate of change was 183.28%. Compared to the control group 4-1, there was a significant change in the experimental group 4-1, and the change rate was 22.33%, through which it was confirmed that the amount of melanin produced by α-MSH increased. In addition, the experimental group 4-1 showed a significant change compared to the control group 4-2, and the rate of change was 56.82%. Through this, it was confirmed that the melanin production was reduced using DNA-OCA.

Example 8. Nucleobase and plant extract (langshot leaf extract) confirmation of the effect of reducing melasma production

Example 8-1. Nucleobase and plant extract complex preparation and skin tissue treatment

In order to confirm the effect of the nucleobase and plant extract complex, in particular, the melanin production reduction effect of the complex when using the langshot leaf extract as the plant extract, the degree of inhibition of melanin production was confirmed.

In order to confirm the degree of melanin production inhibition of the complex, after cutting the dried langshot leaves into small pieces, put 100 g of dry weight in a flask, cool with 1 L of purified water, and use a high-pressure sterilizer (121 ° C, 15 minutes, 1.5 atm) to prepare a langshot leaf extract by filtering to remove the remnants, and acetyl hexapeptide-1 and the prepared langshot leaf extract were mixed at a weight ratio of 1:13.

Sample 1 prepared in Example 1 was mixed with the above-mixed acetylhexapeptide-1 and langshot leaf extract at a weight ratio of 1:35, concentrated under reduced pressure at 50°C for 2 hours, and nuclei at a concentration of 10 (w/v)% A base (a combination of A, T, G, and C) and a plant extract complex (hereafter referred to as DNA-MC1R) were prepared.

Then, 9 wells of Reconstructed skin tissue (RST) were prepared in assay media, α-MSH was added at a concentration of 100 nM to 3 wells of 9 wells to stimulate melanin formation, and DNA-MC1R prepared above was added with a 20 μl pipette. was used to treat the tissue surface once/2 days and cultured for 5 days (experimental group 5-1). As a control group, RST (Control 5-1), in which both α-MSH and DNA-MC1R were not treated, was cultured, and α-MSH was added, but DNA-MC1R was not treated and cultured for 5 days. RST (Control 5-2) was prepared in 3 wells from the remaining 6 wells.

Experimental group 5-1 and control groups 5-1 and 5-2 were fixed in 10% neutral formalin solution for 24 hours. After that, it was embedded in OCT Compound (Optimal cutting temperature compound), cut to a thickness of 12 μm, attached to a gelatin-coated slide, and the slide was dried and stored.

Example 8-2. Experiment process

Immunofluorescence staining was performed to confirm the effect of reducing the formation of melasma of the composite, and the dried and stored experimental group 5-1 and control groups 5-1 and 5-2 were put in distilled water to make them functional. Specifically, the experimental groups 5-1, the control groups 5-1 and 5-2 were put in a 0.01M citrate solution (pH 6.0), boiled for 15 minutes using a microwave, and left at room temperature for 20 minutes. Blocking was performed using anti-goat serum and reaction was performed overnight at 4°C using primary antibody PAR-2 (1:100, Bioss). Then, after washing with PBS solution, the secondary antibody, Goat anti-mouse IgG Alexa Fluor 488 (1:500) (abcam) was reacted at room temperature for 1 hour, washed with PBS solution, sealed with mounting medium with DAPI, and examined under a fluorescence microscope. Observed.

The ratio of the stained area (positive area) using the Image J program for the photograph taken at 200-fold magnification by observing with the fluorescence microscope is calculated through Equation 3 below. The rate of change, which means the amount of increase, was quantified and analyzed through Equation 4 below.

[Equation 3]

[Equation 4]

(In the case of the Example, in Equation 4, the test group is when DNA-MC1R is treated (Experimental group 5-1), and the untreated group is when DNA-MC1R is not treated (Control group 5-1 or 5-2) means)

The student t-test was used for statistical analysis, and a p-value of 0.05 or less was determined to be statistically significant.

Example 8-3. Melanin synthesis confirmation result

The results of confirming melanin synthesis are shown in FIG. 12, and as a result, melanin was stained black, and in the control group 5-2 (D5 100nM α-MSH) stimulated with α-MSH, large and dark melanins spread from the basal layer of the epidermis. It was observed that it was dyed throughout the layer, and it was confirmed that it was particularly accumulated in the stratum corneum. Experimental group 5-1 (D5 100nM α-MSH + 10% DNA-MC1R) treated with samples showed a decrease in melanin size and a small amount of black-stained melanin compared to the α-MSH stimulated control group. It was confirmed that the amount of melanin was also reduced.

In addition, the comparison results of the melanin-positive stained area by the statistical analysis of Example 8-2 are shown in Table 5 and FIG. 13 below.

army
(Group) Positive area (%) average Standard Deviation Change rate compared to control group 5-1 Change rate compared to control group 5-2 Significant probability compared to control group 5-1 Significant probability compared to control group 5-2 control group 5-1 6.08 0.1 - - - - control group 5-2 20.25 0.84 233.23 - 0.000009 - Experimental group 5-1 7.27 0.35 19.59 64.11 0.00046 0.000016

(In Table 5, it means that melanin increases as the average value increases, and if p<0.05, it means that there is a significant difference)

As a result, there was a significant change in the amount of melanin in the control group 5-2 compared to the control group 5-1, the change rate was 233.23%, and there was a significant change in the experimental group 5-1 compared to the control group 5-1, and the change rate was 19.59% was Through this, it was confirmed that the amount of melanin production increased by α-MSH.

In addition, when the experimental group 5-1 was used, there was a significant change compared to the control group 5-2, and the change rate was 64.11%. because of this. It was confirmed that the amount of melanin produced was reduced using DNA-MC1R.

Example 9. Nucleobases and plant extracts (Raspberry leaf extract and Butracetri bark extract) confirm skin barrier strengthening effect

Example 9-1. Nucleobase and plant extract complex preparation and skin tissue treatment

In order to confirm the skin barrier strengthening effect of the nucleobase and plant extract complex, especially when using the leaf extract and Butracetri bark extract as the plant extract, the degree of enhancement of filaggrin expression was confirmed.

In order to confirm the degree of enhancement of filaggrin expression of the complex, after finely chopping the dried locust leaves and butracetri bark, put 100 g of dry weight in a flask, cool with 1 L of purified water, and use a high-pressure sterilizer. After extracting using (121°C, 15 minutes, 1.5 atm), filtering to remove the remnants prepared a locust leaf extract and butracetri bark extract, and the prepared locust leaf extract and butracetri bark extract They were mixed in a weight ratio of 5:2.

Sample 1 prepared in Example 1 was mixed with the mixed locust leaf extract and butracetri bark extract at a weight ratio of 1:35, and concentrated under reduced pressure at 50 ° C. for 2 hours to obtain a concentration of 10 (w / v)% A nucleobase (a complex of A, T, G, and C) and a plant extract complex (hereafter DNA-IL) were prepared.

Then, 9 wells of Reconstructed skin tissue (RST) were prepared in assay media, and the prepared DNA-IL was applied to 3 wells of the 9 wells on the tissue surface using a 20 μl pipette once/2 days and cultured for 5 days ( Experimental group 6-1). As a control, RST (control group 6-1), which was not treated with the DNA-IL and cultured, and RST (control group 6-2), which was cultured for 5 days without treatment with the DNA-IL, were mixed into the remaining 6 wells. were prepared in 3 wells respectively.

The experimental group 6-1 and control groups 6-1 and 6-2 were fixed in 10% neutral formalin solution for 24 hours. After that, it was embedded in OCT Compound (Optimal cutting temperature compound), cut to a thickness of 12 μm, attached to a gelatin-coated slide, and the slide was dried and stored.

Example 9-2. Experiment process

In order to confirm the skin barrier strengthening effect of the complex by performing immunofluorescence staining, the dried and stored experimental group 6-1 and control groups 6-1 and 6-2 were put in distilled water to make them functional. Specifically, the experimental groups 6-1, the control groups 6-1 and 6-2 were put in a 0.01M citrate solution (pH 6.0), boiled for 15 minutes using a microwave, and left at room temperature for 20 minutes. Blocking using anti-goat serum and reacting overnight at 4°C using primary antibodies Filaggrin (1:100), Involucrin (1:100) (santa cruz), and Claudin I (1:100) (invitrogen) made it Then, after washing with PBS solution, the secondary antibody, Goat anti-mouse IgG Alexa Fluor 488 (1:500) (abcam) was reacted at room temperature for 1 hour, washed with PBS solution, sealed with mounting medium with DAPI, and examined under a fluorescence microscope. Observed.

The ratio of the stained area (positive area) using the Image J program for the photograph taken at 200-fold magnification by observing with the fluorescence microscope is calculated through Equation 3 below. The rate of change, which means the amount of increase, was quantified and analyzed through Equation 4 below.

[Equation 3]

[Equation 4]

(In the case of the Example, in Equation 4, the test group is when DNA-IL is treated (Experimental group 6-1), and the untreated group is when DNA-IL is not treated (Control group 6-1 or 6-2) means)

The student t-test was used for statistical analysis, and a p-value of 0.05 or less was determined to be statistically significant.

Example 9-3. Filaggrin expression confirmation result

Filaggrin is a protein that plays an important role in the formation of the stratum corneum in the epidermis, and an increase in filaggrin means that it forms a normal skin barrier to prevent evaporation of skin moisture.

The result of confirming the expression level of filaggrin through the immunofluorescence staining is shown in FIG. 14, and as a result, filaggrin was stained with green fluorescence in the stratum corneum, and blue light stains the nuclei of cells.

In addition, the comparison results of the filaggrin-positive stained area by the statistical analysis of Example 9-2 are shown in Table 6 and FIG. 15 below.

army
(Group) Positive area (%) average Standard Deviation Change rate compared to control group 6-1 Change rate compared to control group 6-2 Significant probability compared to control group 6-1 Significant probability compared to control group 6-2 Control group 6-1 10.72 0.25 Control group 6-2 12.64 0.67 17.87 0.013 Experimental group 6-1 16.60 1.09 54.83 31.36 0.009 0.006

(In Table 6, it means that melanin increases as the average value increases, and if p<0.05, it means that there is a significant difference)

As a result, there was a significant change in the control group 6-2 compared to the control group 6-1, and the change rate was 17.87%. Compared to the control group 6-1, there was a significant change in the experimental group 6-1, and the change rate was 54.83%, which means that the differentiation of the epidermal layer is in progress. In addition, when using the experimental group 6-1, there was a significant change compared to the control group 6-2, and the change rate was 31.36%, which confirmed that the skin barrier was strengthened when using DNA-IL.

Example 10. Nucleobases and plant extracts (Squidberry fruit extract and Butracetri bark extract) skin barrier strengthening effect confirmed

In order to confirm the acne inhibitory effect of the nucleobase and plant extract complexes, especially when the plant extracts were used as the plant extracts, the extract of the fruit extract and the extract of Butrace trifolium, the degree of inhibition of inflammatory cytokines was confirmed.

In order to confirm the degree of inflammatory cytokine inhibition of the complex, after finely chopping the dried quinoa fruit and butracetri bark, 100 g of dry weight was put into a flask, cooled with 1 L of purified water, and a high-pressure sterilizer was used. After extraction by use (121 ° C, 15 minutes, 1.5 atm), filtering to remove the residues, the extract of the fruit extract and Butracetri bark was prepared, and the extract of the fruit extract and Butracetri bark prepared above They were mixed in a weight ratio of 5:2.

Sample 1 prepared in Example 1 was mixed with the mixed Astragalus japonica fruit extract and Butracetri bark extract at a weight ratio of 1:35, and concentrated under reduced pressure at 50 ° C. for 2 hours to obtain a concentration of 10 (w / v)% A nucleobase (a complex of A, T, G, and C) and a plant extract complex (hereafter DNA-AC) were prepared.

RAW 264.7 cells were dispensed in a 6 well plate at a concentration of 3 x 10 ⁵ cells/well, and cultured for one day in a 37°C incubator supplied with 5% CO ₂ . After removing the medium from each well and replacing it with a new DMEM medium, 0.3 (w/v)%, 1 (w/v)% or 3 (w/v)% of DMEM (Dulbecco Modified Eagle Medium) liquid medium was added. DNA-AC and LPS (1 μg/ml) serially diluted in concentrations were treated and reacted for 4 hours in a 37° C. incubator (Experimental Group 7), and cells reacted without being treated with the DNA-AC and LPS as a control (Control Group 7). -1), cells reacted with only LPS were prepared (control group 7-2). Each cell was collected using a scraper and washed once with 1x PBS solution. Cells were lysed by adding 800 μl of Trizol, reacted at room temperature for 5 minutes, voltexed by adding 200 μl of chloroform, and then reacted at room temperature for 5 minutes. After centrifugation at 12,000 rpm, 4 ℃ for 15 minutes, and only the supernatant was transferred to a new e-tube, the same amount of isopropanol was added, mixed 2-3 times, and reacted at room temperature for 10 minutes. Centrifugation was performed at 12,000 rpm, 4°C for 15 minutes, the supernatant was removed, and 800 μl of cold 70% ethanol was added to wash the cells, followed by centrifugation at 12,000 rpm and 4°C for 15 minutes. After completely removing the supernatant and drying the pellet until it became transparent, DEPC DW (Diethyl pyrocarbonate distilled water) was added according to the amount of RNA. After PCR was performed using the isolated RNA, bands were detected by electrophoresis on a 2% agarose gel, and primer information used during the PCR is shown in Table 7 below.

Primer type Base sequence (5'->3') sequence number IL-6_For AGCCAGAGTCCTTCAGAGAGA One IL-6_Rev TAACGCACTAGGTTTGCCGAG 2 IL-1beta_For ATGGCAATGTTCCTGAACTCAACT 3 IL-1beta_Rev CAGGACAGGTATAGATTCTTTTCCTTT 4 beta-actin_For TGGAATCCTGTGGCATCCATGAAAC 5 beta-actin_Rev TAAAACGCAGCTCAGTAACAGTCCG 6

The band was quantified using Image J 1.47 software, and expression inhibition was expressed as a percentage compared to the control, and the results are shown in FIGS. 16a to 16c.

As a result, IL-6 showed a significant expression suppression effect when DNA-AC was added at a concentration of 0.3%, and it was confirmed that the expression of IL-6 was suppressed by a maximum of 34.50% at a concentration of 3%. When the concentration was 0.3, 1, and 3%, it was confirmed that the expression of IL-6 was suppressed by 15.89%, 22.60%, and 34.50%, respectively.

IL-1β showed a significant expression suppression effect when DNA-AC was added at a concentration of 1%, and it was confirmed that the expression of IL-1β was suppressed by a maximum of 27.06% at a concentration of 3%. , when the concentration was 3%, it was confirmed that the expression of IL-1β was suppressed by 22.19% and 27.06%, respectively.

Through this, through the addition of DNA-AC, it was confirmed that the expression of cytokines, which are inflammatory factors that cause acne, was inhibited, and it was confirmed that DNA-AC had an acne-inhibiting effect.

Claims (23)

A cosmetic composition for improving skin conditions, including Adenine (A), Thymine (T), Guanine (G) and Cytosine (C),
The skin condition improvement is at least one selected from the group consisting of antioxidant, skin wrinkle improvement, skin elasticity enhancement, skin barrier enhancement, anti-inflammatory and acne improvement, cosmetic composition. The method of claim 1, wherein the adenine, thymine, guanine and cytosine
1 to 15 parts by weight of adenine based on 1 part by weight of cytosine;
1 to 15 parts by weight of thymine; and
A cosmetic composition for improving skin conditions comprising 1 to 15 parts by weight of guanine. The cosmetic composition for improving skin condition according to claim 1, which has an effect of increasing Elastin protein expression. The method of claim 1, further comprising a triticale extract and a marjoram extract or a haberea rhodopensis extract and a marjoram extract,
The skin condition improvement is at least one selected from the group consisting of skin wrinkle improvement and skin elasticity enhancement, a cosmetic composition for improving skin condition. According to claim 4,
(1) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and
(2) triticale extract and marjoram extract or haberea rhodopensis extract and marjoram extract
In a weight ratio of 1:10 to 100 ((1): (2)),
The triticale extract and marjoram extract are included in a weight ratio of 1 to 20: 1 (tricinia triticale extract: marjoram extract), or
A cosmetic composition for improving skin conditions, comprising the Haberea rhodopensis extract and Marjoram extract in a weight ratio of 1 to 10: 1 (Haburea rhodopensis extract: Marjoram extract). The cosmetic composition for improving skin condition according to claim 4, which has at least one effect selected from the group consisting of increasing Collagen Type I protein expression, decreasing AGER protein expression, and increasing Elastin protein expression. The method of claim 1, further comprising a staphylococcus extract and a butracetri extract,
The skin condition improvement is a skin barrier enhancement, a cosmetic composition for improving skin conditions. According to claim 7, (1) adenine (A), thymine (Thymine; T), guanine (G) and cytosine (Cytosine; C); and
(2) turmeric extract and butracetri extract
In a weight ratio of 1:10 to 100 ((1): (2)),
A cosmetic composition for improving skin condition, comprising the locust plant extract and the butracetri extract in a weight ratio of 1 to 10: 1 (foot locust plant extract: butracetri extract). The cosmetic composition for improving skin condition according to claim 7, which has an effect of increasing Filaggrin protein expression. The method of claim 1, further comprising a rhizome extract and a butracetri extract,
The skin condition improvement is at least one selected from the group consisting of anti-inflammatory and acne improvement, a cosmetic composition for improving skin conditions. The composition according to claim 10, comprising (1) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and
(2) chinensis extract and butracetri extract
In a weight ratio of 1:10 to 100 ((1): (2)),
A cosmetic composition for improving skin condition, comprising the extract of S. chinensis and the extract of Butracetri in a weight ratio of 1 to 10: 1 (extract of S. chinensis: Butracetri extract). The cosmetic composition for improving skin conditions according to claim 10, which has an effect of inhibiting the expression of inflammatory cytokines. The method according to any one of claims 1 to 12, wherein 1,2-hexanediol, glycerin, butylene glycol, maltodextrin and hyaluronic acid A cosmetic composition for improving skin conditions, further comprising at least one selected from the group consisting of hyaluronic acid. The composition according to any one of claims 1 to 12, wherein the composition is cosmetic lotion, lotion, lotion, essence, cream, gel cream, massage cream, gel, pack, body lotion, body cream, sunscreen, oil, makeup base, Foundation, lipstick, at least one formulation selected from the group consisting of patches and sprays, a cosmetic composition for improving skin conditions. (1) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and
(2) A cosmetic composition for improving skin conditions, including an extract of ginseng ginseng and a langshot extract, or an acetylhexapeptide-1 and an extract of langshot,
The skin condition improvement is at least one selected from the group consisting of skin whitening and reduction of skin blemishes, a cosmetic composition for improving skin conditions. According to claim 15,
(1) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C); and
(2) Casiogalpi extract and langshot leaf extract or acetyl hexapeptide-1 and langshot leaf extract
In a weight ratio of 1:10 to 100 ((1): (2)),
The Casiogalpi and Langshot extracts are included in a weight ratio of 1 to 10:1 (Gasiogalpi extract: Langshot extract),
A cosmetic composition for improving skin conditions, comprising the acetyl hexapeptide-1 and Langshot extract in a weight ratio of 1:1 to 20 (acetylhexapeptide-1: Langshot extract). The cosmetic composition for improving skin condition according to claim 16, which has an effect of reducing melanin synthesis. The method according to any one of claims 15 to 17, wherein 1,2-hexanediol, glycerin, butylene glycol, maltodextrin and hyaluronic acid A cosmetic composition for improving skin conditions, further comprising at least one selected from the group consisting of hyaluronic acid. The method according to any one of claims 15 to 17, wherein the composition is cosmetic lotion, emulsion, lotion, essence, cream, gel cream, massage cream, gel, pack, body lotion, body cream, sun cream, oil, makeup base, Foundation, lipstick, at least one formulation selected from the group consisting of patches and sprays, a cosmetic composition for improving skin conditions. (a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)
(b) A method for producing a cosmetic composition for improving skin condition, comprising mixing a triticale extract and a marjoram extract or a haberea rhodopensis extract and a marjoram extract,
The improvement of the skin condition is at least one selected from the group consisting of improving skin wrinkles and enhancing skin elasticity, a method for producing a cosmetic composition. (a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)
(b) a method for producing a cosmetic composition for improving skin condition, comprising the step of mixing a locust plant extract and a butracetri extract,
The skin condition improvement is a method of manufacturing a cosmetic composition that strengthens the skin barrier. (a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)
(b) a method for producing a cosmetic composition for improving skin condition, comprising the step of mixing a genus chinensis extract and a butracetri extract,
The skin condition improvement is at least one selected from the group consisting of anti-inflammatory and acne improvement, a method for producing a cosmetic composition. (a) Adenine (A), Thymine (T), Guanine (G) and Cytosine (C)
(b) A method for producing a cosmetic composition for improving skin condition, comprising the step of mixing a prickly pear extract and a langshot leaf extract or acetyl hexapeptide-1 and a langshot leaf extract,
The skin condition improvement is at least one selected from the group consisting of skin whitening and reduction of skin blemishes, a method for producing a cosmetic composition.

Images