KR102541009B1 - Aspergillus candidus strain and composition for controlling plant diseases comprising the same - Google Patents
Aspergillus candidus strain and composition for controlling plant diseases comprising the same Download PDFInfo
- Publication number
- KR102541009B1 KR102541009B1 KR1020210002089A KR20210002089A KR102541009B1 KR 102541009 B1 KR102541009 B1 KR 102541009B1 KR 1020210002089 A KR1020210002089 A KR 1020210002089A KR 20210002089 A KR20210002089 A KR 20210002089A KR 102541009 B1 KR102541009 B1 KR 102541009B1
- Authority
- KR
- South Korea
- Prior art keywords
- aspergillus
- composition
- culture filtrate
- plant
- culture
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/34—Aspergillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/66—Aspergillus
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP (SFC20200425-M11) 균주를 제공한다.
본 발명의 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물을 포함하는 식물병 방제용 조성물은 천연물로서 인체에 무해하고 자연계에서 생분해되어 환경오염을 유발하지 않으면서 식물병을 방제하는데 효과가 있어 환경친화적인 생물농약으로 개발될 수 있고 고부가가치의 유기농산물 생산에 있어 유용하게 사용될 수 있다.The present invention is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) strain is provided.
Aspergillus candida of the present invention ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate, or a composition for controlling plant diseases containing a fraction of the culture filtrate is a natural product, harmless to the human body and biodegradable in nature, so it is effective in controlling plant diseases without causing environmental pollution It can be developed as an environmentally friendly biological pesticide and can be usefully used in the production of high value-added organic products.
Description
본 발명은 아스퍼질러스 캔디더스(Aspergillus candidus) 균주 및 이를 포함하는 식물병 방제용 조성물에 관한 것으로, 상세하게는 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP 균주, 상기 균주의 배양여액, 상기 배양여액의 분획물을 포함하는 식물병 방제용 조성물을 제공한다.The present invention is Aspergillus candida ( Aspergillus candidus strain and a composition for controlling plant diseases containing the same, and in detail, Aspergillus candidus strain KACC83032BP, a culture filtrate of the strain, and a composition for controlling plant diseases comprising fractions of the culture filtrate provides
식물병원균은 농작물에 다양한 병을 일으켜, 작물의 수량과 감소시키고 상품성을 훼손한다, 전 지구적인 기후변화로 매년 새로운 병해충이 출현하여 작물에 해를 준다. 만약 여기에 적절히 대처하지 못하여 대발생하게 되면, 1846년 아일랜드 대기근과 같은 심각한 사회문제가 발생할 수 있다. 식물병을 방제하기 위한 주요 수단으로서 화학 농약을 사용해 왔으나, 지나친 화학 농약의 사용은 생태계 교란, 환경오염, 인축독성, 약제저항성 문제 등을 가져왔다. 따라서 화학 농약의 사용을 줄이거나 이를 대체하기 위한 새로운 친환경 식물병 방제수단의 개발이 요구된다. 이러한 관점에서, 식물 추출물이나 미생물, 또는 미생물의 이차대사산물 등의 천연소재가 새로운 식물병 방제제 개발에 적극적으로 이용되고 있다. Plant pathogens cause various diseases in crops, reduce the yield of crops and impair marketability. Due to global climate change, new pests and pests appear every year and harm crops. If this is not adequately dealt with, serious social problems such as the Great Irish Famine of 1846 may occur. Chemical pesticides have been used as a major means for controlling plant diseases, but excessive use of chemical pesticides has resulted in ecosystem disturbance, environmental pollution, human toxicity, and drug resistance problems. Therefore, it is required to develop new eco-friendly plant disease control means to reduce or replace the use of chemical pesticides. From this point of view, natural materials such as plant extracts, microorganisms, or secondary metabolites of microorganisms are actively used to develop new plant disease control agents.
페니실리움(Penicillium) 속 곰팡이에서 페니실린(penicillin)을 발견한 이래 미생물을 새로운 항생물질의 보고로서 신약개발에 적극적으로 이용했고, 다양한 항균활성 물질들이 미생물에서 분리되었다. 자낭균 페니실리움 그리세오풀범(Penicillium griseofulvum)에서 처음 분리된 그리세오풀빈(griseofulvin)은 양파잿빛곰팡이병균(Botrytis allii)의 정상적인 포자발아를 저해하는 활성으로 식물병 방제제로 주목받았었고, 항생물질 크리니펠린(crinipellins)을 생산하는 담자균 크리니펠리스 라이조마티콜라(Crinipellis rhizomaticola)의 배양액이 벼 도열병과 고추 탄저병 방제에 효과를 나타내는 등의 미생물을 이용한 식물병 방제 가능성을 시사하는 다양한 연구가 보고되어왔다. 특히, 다양한 목재부후 담자균이 생산하는 스트로비루린(strobilurins) 또는 오데만신(oudemansins)은 글로벌 살균제 시장에서 가장 많이 판매중인 QoI 살균제의 리드화합물이다. 이처럼 미생물은 새로운 작물보호제를 개발하는데 적극적으로 이용될 수 있다.Since the discovery of penicillin from a fungus of the genus Penicillium, microorganisms have been actively used for new drug development as a treasure trove of new antibiotics, and various antibacterial active substances have been isolated from microorganisms. Griseofulvin, first isolated from the ascomycete Penicillium griseofulvum , has attracted attention as a plant disease control agent for its activity of inhibiting the normal spore germination of Botrytis allii , and as an antibiotic. Various studies suggesting the possibility of controlling plant diseases using microorganisms have been reported, such as showing that the culture medium of the basidiomycete Crinipellis rhizomaticola, which produces crinipellins, is effective in controlling rice blast and pepper anthracnose. come. In particular, strobilurins or oudemansins, which are produced by various wood-decaying basidiomycetes, are the lead compounds of QoI fungicides sold the most in the global fungicide market. As such, microorganisms can be actively used to develop new crop protection agents.
본 발명자들은 환경친화적인 식물병 방제 수단으로서 아스퍼질러스 캔디더스(Aspergillus candidus) 균주를 이용하고자 하였다.The present inventors tried to use Aspergillus candidus strains as an environmentally friendly means for controlling plant diseases.
본 발명의 하나의 목적은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP 균주를 제공하는 것이다.One object of the present invention is Aspergillus candida ( Aspergillus candidus ) KACC83032BP strain is provided.
본 발명의 다른 하나의 목적은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP 균주 또는 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물을 포함하는 식물병 방제용 조성물을 제공한다. Another object of the present invention is Aspergillus candidus ( Aspergillus candidus ) KACC83032BP strain or its culture solution, its culture filtrate or provides a composition for controlling plant diseases comprising a fraction of the culture filtrate.
본 발명의 다른 하나의 목적은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP를 배지에 배양하는 단계를 포함하는 식물병 방제용 조성물의 제조방법을 제공하는 것이다.Another object of the present invention is to provide a method for producing a composition for controlling plant diseases, comprising the step of culturing Aspergillus candidus KACC83032BP in a medium.
본 발명의 또 다른 하나의 목적은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물을 포함하는 식물병 방제용 조성물을 식물, 이의 종자 또는 이의 서식지에 처리하는 단계를 포함하는 식물병 방제 방법을 제공하는 것이다.Another object of the present invention is Aspergillus candidus ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate, or a plant disease control composition comprising a fraction of the culture filtrate treatment to plants, their seeds or their habitat It is to provide a plant disease control method comprising the step of doing.
본 발명자는 친환경 식물병 방제제를 개발하기 위하여 다양한 균주의 다양한 식물병에 대한 방제효과를 조사하던 중 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP(SFC20200425-M11), 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물이 다양한 식물병에 방제효과가 우수하다는 것을 발견하였다.The present inventors were investigating the control effects of various plant diseases of various strains in order to develop an eco-friendly plant disease control agent. Aspergillus candidus KACC83032BP (SFC20200425-M11), its culture medium, its culture filtrate or It was found that the fractions of the culture filtrate had excellent control effects against various plant diseases.
본 출원에서 사용한 용어는 단지 특정한 실시예를 설명하기 위해 사용된 것으로서 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 출원에서, “포함하다” 또는 “가지다” 등의 용어는 명에서 상에 기재된 특징, 단계, 구조 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 단계, 구조 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.Terms used in this application are only used to describe specific embodiments and are not intended to limit the present invention. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this application, terms such as “comprise” or “having” are intended to designate that the features, steps, structures, or combinations thereof described above exist in the name, but one or more other features, steps, structures, or these It should be understood that it does not preclude the possibility of existence or addition of combinations.
다르게 정의하지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in the present application, they should not be interpreted in an ideal or excessively formal meaning. don't
아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACC83032BPKACC83032BP 균주, 상기 균주의 배양액, 상기 균주의 strain, culture of the strain, of the strain 배양여액culture filtrate 또는 상기 or above 배양여액의culture filtrate 분획물fraction 및 and 이들을 포함하는including these 식물병 방제용 조성물 및 이의 제조방법 Composition for controlling plant diseases and method for producing the same
본 발명은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP 균주를 제공한다.The present invention is Aspergillus candida ( Aspergillus candidus ) KACC83032BP strain is provided.
본 발명에서, 상기 균주는 SFC20200425-M11라 명명하기도 한다.In the present invention, the strain is also named SFC20200425-M11.
또한, 상기 균주는 하기와 같은 서열번호 1의 calmodulin (CaM) 유전자 서열을 가질 수 있다.In addition, the strain may have a calmodulin (CaM) gene sequence of SEQ ID NO: 1 as follows.
GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTCCATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC(서열번호 1).GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGC TGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTC CATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC (SEQ ID NO: 1).
본 발명에 있어서, 상기 균주는 도루묵(Arctoscopus japonicus)의 알(egg)로부터 분리된 것일 수 있고, 구체적으로 강원도 양양군 강현면 정암리 정암해변에서 채취한 도루묵알로부터 분리된 것일 수 있다.In the present invention, the strain is sandfish ( Arctoscopus japonicus ), and specifically, it may be separated from sandfish eggs collected from Jeongam Beach, Jeongam-ri, Ganghyeon-myeon, Yangyang-gun, Gangwon-do.
본 발명에 있어서, 상기 균주는 식물병 방제 활성 및 살균 활성을 가질 수 있다.In the present invention, the strain may have plant disease control activity and bactericidal activity.
본 발명의 일 측면에 있어서, 본 발명은 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물을 포함하는 식물병 방제용 조성물을 제공한다.In one aspect of the present invention, the present invention provides a composition for controlling plant diseases comprising Aspergillus candidus KACC83032BP, a culture thereof, a culture filtrate thereof, or a fraction of the culture filtrate.
본 명세서 중에서 “방제”라고 하는 것은 병이나 해충의 예방, 기피뿐만 아니라 제거, 사멸을 포함하는 의미로 이용하는 것으로 한다. 하지만 식물병 방제는 예방적 처리에 의한 방제효과가 주요 방제 기작이므로 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물의 식물병에 대한 방제효과 조사는 예방적 처리로 실험하였다.In this specification, "control" is intended to be used in the sense of including removal and death as well as prevention and avoidance of diseases and pests. However, since the control effect by preventive treatment is the main control mechanism for plant disease control, Aspergillus candidus KACC83032BP, its culture medium, its culture filtrate, or the control effect of the fractions of the culture filtrate on plant diseases is investigated. Experiments were conducted with the enemy treatment.
상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP 균주는 상술한 바와 같은 특징을 가질 수 있다.The Aspergillus candida ( Aspergillus candidus ) KACC83032BP strain may have the above-described characteristics.
본 발명에 있어서, 상기 식물병은 식물병원성 곰팡이로부터 유발되는 것일 수 있다.In the present invention, the plant disease may be caused by a plant pathogenic fungus.
구체적으로, 상기 식물병원성 곰팡이는 보트라이티스 시네리아( Botrytis cinerea; 잿빛곰팡이병균), 콜레토트리쿰 코코데스(Colletotrichum coccodes; 고추 탄저병균), 마그나포르테 오라이제(Magnaporthe oryzae; 벼 도열병균), 푸시니아 트리티시나(Puccinia triticina; 밀 붉은녹병균), 블루메리아 그라미니스 에프. 에스피. 호르데이 (Blumeria graminis f. sp. Hordei ; 보리 흰가루병균), 파이토프토라 인페스탄스(Phytophthora infestans; 감자/토마토 역병균)일 수 있으나 본 발명의 범위가 여기에 한정되는 것은 아니다. Specifically, the plant pathogenic fungi are Botrytis cinerea ( Botrytis cinerea ; Gray mold disease), Colletotrichum coco des ( Colletotrichum coccodes ; Pepper anthracnose), Magnaporthe oryse ( Magnaporthe oryzae ; Rice blast fungus), Puccinia triticina (Wheat red rust fungus), Bloomeria graminis F. esp. Hordei ( Blumeria graminis f. sp. Hordei ; Barley powdery mildew), Phytophthora infestans ( Phytophthora infestans ; potato / tomato bacillus), but the scope of the present invention is not limited thereto.
본 발명에 있어서, 상기 식물병은 벼 도열병(원인균: Magnaporthe oryzae), 토마토 잿빛곰팡이병(원인균: Botrytis cinerea), 토마토 역병(원인균: Phytophthora infestans), 밀 붉은녹병(원인균: Puccinia triticina), 보리 흰가루병(원인균: Blumeria graminis f. sp. hordei), 고추 탄저병(원인균: Colletotrichum coccodes)일 수 있으나, 이에 한정되지 않는다.In the present invention, the plant disease is rice blast (causative fungus: Magnaporthe oryzae ), tomato gray mold (causative fungus: Botrytis) cinerea ), tomato blight (causative fungus: Phytophthora infestans ), wheat red rust (causative fungus: Puccinia) triticina ), barley powdery mildew (causative fungus: Blumeria graminis f. sp. hordei ), pepper anthracnose (causative bacteria: Colletotrichum coccodes ), but is not limited thereto.
본 발명에 있어서, 상기 분획물은 물, C1 내지 C4의 저급 알코올(예를 들어, 메탄올, 에탄올, 프로판올, 이소프로판올, 부탄올 등), 헥산, 클로로포름, 메틸렌클로라이드, 에틸아세테이트, 아세톤, 아세토나이트릴, 이들의 조합 등의 유기용매를 사용하여 분획될 수 있으며, 바람직하게는 물, 메탄올, 에탄올, 프로판올, 이소프로판올, 부탄올, 또는 에틸아세테이트를 사용하여 분획물을 제조할 수 있으나, 본 발명에서 분획물을 제조하기 위해 사용되는 유기 용매의 범위가 이에 한정되는 것은 아니다.In the present invention, the fraction is water, C 1 to C 4 lower alcohol (eg, methanol, ethanol, propanol, isopropanol, butanol, etc.), hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile , It can be fractionated using an organic solvent such as a combination thereof, preferably water, methanol, ethanol, propanol, isopropanol, butanol, or ethyl acetate can be used to prepare fractions, but in the present invention, fractions are prepared The range of organic solvents used to do this is not limited thereto.
본 발명에 있어서, 상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물은 식물병 방제용 조성물에 100 내지 3000 μg/ml 농도로 포함될 수 있다. 상기 농도는 식물병이 발생된 식물, 이의 종자 또는 이의 서식지에 처리할 때의 조성물에 포함된 농도를 나타내며, 상기 농도가 100 μg/ml 미만일 경우, 상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물의 농도가 너무 낮아 식물병의 방제효과가 떨어지는 문제가 있고, 상기 농도가 3000 μg/ml 초과일 경우, 필요 이상으로 상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물의 농도가 너무 높아 비경제적이며 환경에 대한 부정적 영향이 발생할 수 있다. 하지만, 식물병 방제용 조성물의 사용량이 상기 농도 범위에 제한되는 것은 아니며, 식물병원균 또는 식물병원성 세균의 종류, 발생 정도, 환경 등을 고려하여 적절하게 조절될 수 있다.In the present invention, the Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate, or fractions of the culture filtrate may be included in the composition for controlling plant diseases at a concentration of 100 to 3000 μg/ml. The concentration refers to the concentration included in the composition when the plant, its seed or its habitat is treated with a plant disease, and when the concentration is less than 100 μg / ml, the Aspergillus candidus KACC83032BP, There is a problem in that the concentration of the culture solution, the culture filtrate or the fraction of the culture filtrate is too low to control plant diseases, and when the concentration exceeds 3000 μg / ml, the Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate, or its fractions of the culture filtrate is too high in concentration, which is uneconomical and may have a negative impact on the environment. However, the amount of the composition for controlling plant diseases is not limited to the above concentration range, and may be appropriately adjusted in consideration of the type, degree of occurrence, environment, etc. of plant pathogens or plant pathogenic bacteria.
본 발명의 조성물은 불활성 담체가 추가로 포함된 혼합물일 수 있고, 상기 혼합물이 유제, 유액, 유동화제, 습윤성 분말, 과립화 습윤성 분말, 분말제, 과립제 등으로 제형화 될 수 있도록 혼합물에 계면활성제 및 필요한 기타 보조제를 첨가함으로써 제조된다. 상기 언급된 식물병 방제용 조성물은 그 자체로서 또는 다른 불활성 성분을 첨가하여 본 발명은 종자 처리제로도 사용될 수 있다.The composition of the present invention may be a mixture additionally containing an inert carrier, and a surfactant is added to the mixture so that the mixture can be formulated into an emulsion, emulsion, glidant, wettable powder, granulated wettable powder, powder, granule, etc. and other necessary auxiliaries. The above-mentioned composition for controlling plant diseases can also be used as a seed treatment agent in the present invention by itself or by adding other inactive ingredients.
본 발명에 있어서, 제형에서 사용될 수 있는 액체 담체의 예는 물; 알콜, 예로 메탄올 및 에탄올; 케톤, 예로 아세톤 및 메틸 에틸 케톤; 방향족 탄화수소, 예로 벤젠, 톨루엔, 자일렌, 에틸벤젠 및 메틸나프탈렌; 지방족 탄화수소, 예로 헥산, 시클로헥산, 케로신 및 라이트 오일; 에스테르, 예로 에틸 아세테이트 및 부틸 아세테이트; 니트릴, 예로 아세토니트릴 및 이소부티르니트릴; 에테르, 예로 디이소프로필에테르 및 디옥산; 산 아미드, 예로 N,N-디메틸 포름아미드 및 N,N-디메틸아세트아미드; 할로겐화 탄화수소, 예로 디클로로메탄, 트리클로로에탄 및 사염화탄소; 디메틸 술폭시드; 및 식물성 오일, 예로 대두유 및 면실유가 포함될 수 있다.In the present invention, examples of the liquid carrier that can be used in the formulation include water; alcohols such as methanol and ethanol; ketones such as acetone and methyl ethyl ketone; aromatic hydrocarbons such as benzene, toluene, xylene, ethylbenzene and methylnaphthalene; aliphatic hydrocarbons such as hexane, cyclohexane, kerosene and light oil; esters such as ethyl acetate and butyl acetate; nitriles such as acetonitrile and isobutyrnitrile; ethers such as diisopropylether and dioxane; acid amides such as N,N-dimethyl formamide and N,N-dimethylacetamide; halogenated hydrocarbons such as dichloromethane, trichloroethane and carbon tetrachloride; dimethyl sulfoxide; and vegetable oils such as soybean oil and cottonseed oil.
또한, 제형에서 사용될 수 있는 고체 담체의 예는 미세 분말 또는 과립 예컨대 광물 예컨대 카올린 점토, 애터펄자이트 점토, 벤토나이트, 몬트모릴로나이트, 애시드 화이트 점토, 피로필라이트, 탈크, 규조토 및 탈사이트; 천연 유기 물질 예컨대 옥수수 잎대 분말 및 월넛 껍질 분말; 합성 유기 물질 예컨대 우레아; 염 예컨대 탄산 칼슘 및 황산 암모늄; 합성 무기 물질 예컨대 합성 수화 산화 규소를 포함하며; 액체 담체로서, 방향족 탄화수소 예컨대 자일렌, 알킬벤젠 및 메틸나프탈렌; 알코올 예컨대 2-프로판올, 에틸렌글리콜, 프로필렌 글리콜 및 에틸렌 글리콜 모노에틸 에테르; 케톤 예컨대 아세톤, 시클로헥사논 및 이소포론; 식물성 오일 예컨대 대두유 및 면실유; 석유 지방족 탄화수소, 에스테르, 디메틸술폭시드, 아세토니트릴 및 물을 포함한다.Further, examples of solid carriers that can be used in the formulation include fine powders or granules such as minerals such as kaolin clay, attapulgite clay, bentonite, montmorillonite, acid white clay, pyrophyllite, talc, diatomaceous earth and talcite; natural organic substances such as corn stalk meal and walnut husk meal; synthetic organic substances such as urea; salts such as calcium carbonate and ammonium sulfate; synthetic inorganic materials such as synthetic hydrated silicon oxide; As liquid carriers, aromatic hydrocarbons such as xylenes, alkylbenzenes and methylnaphthalenes; alcohols such as 2-propanol, ethylene glycol, propylene glycol and ethylene glycol monoethyl ether; ketones such as acetone, cyclohexanone and isophorone; vegetable oils such as soybean oil and cottonseed oil; petroleum aliphatic hydrocarbons, esters, dimethylsulfoxide, acetonitrile and water.
또한, 계면활성제의 예는 음이온성 계면활성제 예컨대 알킬 술페이트 에스테르 염, 알킬아릴 술포네이트 염, 디알킬술포숙시네이트 염, 폴리옥시에틸렌 알킬아릴 에테르 포스페이트 에스테르 염, 리그노술포네이트 염 및 나프탈렌 술포네이트 포름알데히드 중축합물; 및 비이온성 계면활성제 예컨대 폴리옥시에틸렌 알킬 아릴 에테르, 폴리옥시에틸렌 알킬폴리옥시프로필렌 블럭 공중합체 및 소르비탄 지방산 에스테르 및 양이온성 계면활성제 예컨대 알킬트리메틸암모늄 염을 포함한다.Further, examples of surfactants include anionic surfactants such as alkyl sulfate ester salts, alkylaryl sulfonate salts, dialkylsulfosuccinate salts, polyoxyethylene alkylaryl ether phosphate ester salts, lignosulfonate salts, and naphthalene sulfonates. nate formaldehyde polycondensate; and nonionic surfactants such as polyoxyethylene alkyl aryl ethers, polyoxyethylene alkylpolyoxypropylene block copolymers and sorbitan fatty acid esters, and cationic surfactants such as alkyltrimethylammonium salts.
다른 제형 보조제의 예는 수용성 중합체 예컨대 폴리비닐 알코올 및 폴리비닐피롤리돈, 다당류 예컨대 아라비아 고무, 알긴산 및 이의 염, CMC(카르복시메틸-셀룰로오스), 잔탄 고무, 무기 물질 예컨대 알루미늄 마그네슘 실리케이트 및 알루미나 졸(alumina sol), 보존제, 착색제 및 안정화제 예컨대 PAP(산 포스페이트 이소프로필) 및 BHT(부틸하이드록리톨루엔)를 포함한다.Examples of other formulation auxiliaries are water-soluble polymers such as polyvinyl alcohol and polyvinylpyrrolidone, polysaccharides such as gum arabic, alginic acid and its salts, CMC (carboxymethyl-cellulose), xanthan gum, inorganic materials such as aluminum magnesium silicate and alumina sol ( alumina sol), preservatives, colorants and stabilizers such as PAP (acid phosphate isopropyl) and BHT (butylhydroxyltoluene).
본 발명의 일 실시예에서, 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물이 식물 병원균에 대한 방제 효과가 있음을 실시예를 통해 확인하였으며, 이로부터 식물병 방제 효과가 있음을 알 수 있다.In one embodiment of the present invention, Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate, or its fractions of the culture filtrate was confirmed through Examples that it has a control effect on plant pathogens, and it can be seen from this that it has a plant disease control effect.
또한, 배양액은 균주를 배양하여 얻은 것일 수 있고, 상기 배양여액은 균주를 배양한 배양액을 물리적으로 여과한 것일 수 있다.In addition, the culture solution may be obtained by culturing the strain, and the culture filtrate may be obtained by physically filtering the culture solution in which the strain is cultured.
본 발명의 일 측면에 있어서, 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP를 배지에서 배양하는 단계;를 포함하는 식물병 방제용 조성물의 제조방법을 제공한다.In one aspect of the present invention, Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium; it provides a method for producing a composition for controlling plant diseases, including.
또한, 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP를 배지에 접종한 후 7일 동안 25℃에서 진탕배양하는 단계;를 더 포함할 수 있다.In addition, Aspergillus candida ( Aspergillus candidus ) KACC83032BP inoculated into the medium and then incubated with shaking at 25° C. for 7 days.
상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP의 배양 방법을 포함하는 식물병 방제용 조성물의 제조방법은 당 업계에 공지된 임의의 방법을 이용할 수 있으며, 특정 방법에 특별히 제한되는 것은 아니다.The Aspergillus candida ( Aspergillus candidus ) The method for preparing a composition for controlling plant diseases, including a method of culturing KACC83032BP, may use any method known in the art, and is not particularly limited to a specific method.
상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물은 하기의 단계들을 포함하는 제조방법에 의해 제조될 수 있으나, 이에 한정되지 않는다:The Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate, or a fraction of the culture filtrate may be prepared by a manufacturing method comprising the following steps, but is not limited thereto:
예를 들어, 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032B 균주, 이의 배양액 및 이의 배양여액을 제조하는 단계는 다음 단계를 포함할 수 있다:For example, Aspergillus candida ( Aspergillus candidus ) KACC83032B strain, the step of preparing its culture medium and its culture filtrate may include the following steps:
1) 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP를 배지에서 배양하는 단계;1) Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium;
2) 단계 1의 배지에서 형성된 균총을 이용하여 균사 디스크를 제조하는 단계;2) preparing hyphal discs using the flora formed in the medium of step 1;
3) 단계 2의 균사 디스크를 배지에 접종하여 진탕배양시켜 균주 배양액을 제조하는 단계; 및3) preparing a strain culture solution by inoculating the mycelial disk of step 2 into a culture medium and culturing with shaking; and
4) 단계 3에서 제조된 배양액을 여과하여 배양여액을 제조하는 단계.4) Filtering the culture solution prepared in step 3 to prepare a culture filtrate.
예를 들어, 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032B 균주의 배양여액의 분획물을 제조하는 단계는 다음 단계를 포함할 수 있다:For example, Aspergillus candida ( Aspergillus candidus ) The step of preparing the fraction of the culture filtrate of the KACC83032B strain may include the following steps:
1) 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP를 배지에서 배양하는 단계;1) Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium;
2) 단계 1의 배지에서 형성된 균총을 이용하여 균사 디스크를 제조하는 단계;2) preparing hyphal discs using the flora formed in the medium of step 1;
3) 단계 2의 균사 디스크를 배지에 접종하여 진탕배양시켜 균주 배양액을 제조하는 단계; 3) preparing a strain culture solution by inoculating the mycelial disk of step 2 into a culture medium and culturing with shaking;
4) 단계 3에서 제조된 배양액을 여과하여 배양여액을 제조하는 단계; 및4) preparing a culture filtrate by filtering the culture solution prepared in step 3; and
5) 상기 배양여액과 유기용매를 혼합한 후 층분리하여 분획물을 제조하는 단계.5) preparing fractions by mixing the culture filtrate and the organic solvent and separating the layers.
본 발명에 있어서, 상기 단계 1 및 단계 3에서 배지는 PDA(Potato dextrose agar) 배지, MEB(Malt extract broth) 배지, PDB(Potato dextrose broth) 배지, CDB(Czapek dox broth) 배지 또는 SDB(Sabouraud dextrose broth) 배지일 수 있으며, 바람직하게는 PDA(Potato dextrose agar) 배지 또는 PDB(Potato dextrose broth) 배지일 수 있으나, 본 발명의 범위가 여기에 한정되는 것은 아니다.In the present invention, the medium in step 1 and step 3 is PDA (Potato dextrose agar) medium, MEB (Malt extract broth) medium, PDB (Potato dextrose broth) medium, CDB (Czapek dox broth) medium or SDB (Sabouraud dextrose medium) broth) medium, preferably PDA (Potato dextrose agar) medium or PDB (Potato dextrose broth) medium, but the scope of the present invention is not limited thereto.
더욱 바람직하게는 PDA 배지(감자전분 4 g, 포도당 20 g, 한천 15 g, 증류수 1L) 및 증류수 대신에 인공해수(NaCl 28.32 g, KCl 0.77 g, MgCl2·6H2O 5.48 g, MgSO4·7H2O 7.39 g, CaCl2 1.11 g, NaHCO3 0.2 g, 증류수 1 L)를 첨가한 PDA(감자전분 4 g, 포도당 20 g, 한천 15 g, 인공해수 1 L) 배지일 수 있으며; PDB 배지(감자전분 4 g, 포도당 20 g, 증류수 1 L) 및 증류수 대신에 인공해수를 첨가한 PDB(감자전분 4 g, 포도당 20 g, 한천 15 g, 인공해수 1 L) 배지일 수 있다.More preferably, PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1L) and artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl 2 6H 2 O 5.48 g, MgSO 4 7H 2 O 7.39 g, CaCl 2 1.11 g NaHCO 3 0.2 g, distilled water 1 L) may be a PDA (potato starch 4 g, glucose 20 g, agar 15 g, artificial seawater 1 L) medium; It may be a PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and a PDB medium (potato starch 4 g, glucose 20 g, agar 15 g, artificial sea water 1 L) to which artificial seawater is added instead of distilled water.
상기 유기 용매는 물, C1 내지 C4의 저급 알코올(예를 들어, 메탄올, 에탄올, 프로판올, 이소프로판올, 부탄올 등), 헥산, 클로로포름, 메틸렌클로라이드, 에틸아세테이트, 아세톤, 아세토나이트릴, 이들의 조합 등일 수 있으며, 바람직하게는 물, 메탄올, 에탄올, 프로판올, 이소프로판올, 부탄올, 헥산, 또는 에틸아세테이트일 수 있다.The organic solvent is water, C 1 to C 4 lower alcohol (eg, methanol, ethanol, propanol, isopropanol, butanol, etc.), hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile, combinations thereof and the like, preferably water, methanol, ethanol, propanol, isopropanol, butanol, hexane, or ethyl acetate.
아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACC83032BPKACC83032BP 균주, 상기 균주의 배양액, 상기 균주의 strain, culture of the strain, of the strain 배양여액culture filtrate 또는 상기 or above 배양여액의culture filtrate 분획물을fraction 포함하는 including 식물병plant disease 방제용 조성물을 사용한 식물병 방제 방법 Plant disease control method using composition for control
본 발명의 다른 일 측면에 있어서, 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP 균주, 상기 균주의 배양액, 상기 균주의 배양여액 또는 상기 배양여액의 분획물을 포함하는 식물병 방제용 조성물을 식물, 이의 종자 또는 이의 서식지에 처리하는 단계;를 포함하는 식물병 방제 방법을 제공한다.In another aspect of the present invention, a composition for controlling plant diseases comprising Aspergillus candidus KACC83032BP strain, a culture solution of the strain, a culture filtrate of the strain, or a fraction of the culture filtrate is prepared by plant and seed thereof Or treating its habitat; It provides a plant disease control method comprising a.
상기 처리는 조성물을 식물체에 직접 살포하거나, 식물체가 자라고 있는 토양에 살포하거나 식물체의 배양용 매개체에 살포하는 간접 살포일 수 있다.The treatment may be indirect spraying by spraying the composition directly on the plant, spraying on the soil where the plant is growing, or spraying on the culture medium of the plant.
본 발명의 방제 방법은 식물의 줄기 및 잎의 처리, 식물이 성장하는 장소(예를 들어 토양)의 처리, 종자 멸균/종자 코팅과 같은 종자의 처리 및 뿌리의 처리를 포함한다.The control method of the present invention includes treatment of the stem and leaves of the plant, treatment of the place where the plant grows (eg soil), treatment of the seed such as seed sterilization/seed coating, and treatment of the root.
본 발명의 방제 방법으로의 줄기 및 잎의 처리로서, 특히, 예를 들어 줄기 및 잎에 분무하는 것과 같은 식물 표면 상의 적용이 포함될 수 있다. 본 발명의 방제 방법으로의 토양의 처리로서, 예를 들어 토양 상 분무, 토양과의 혼합, 액체 처리제의 토양 내로의 살포(액체 처리제의 관개, 토양 내로의 주입, 액체 처리제의 적하) 가 포함될 수 있으며, 처리되는 장소의 예는 재식혈(planting hole), 고랑, 재식혈 주변, 심을골(planting furrow) 주변, 성장 부위의 전체 표면, 토양과 식물 사이 부분, 뿌리 사이 부위, 식물체의 줄기 밑 부위, 주 고랑, 성장 토양, 못자리. 모 재배용 상자, 모 재배용 트레이, 모판을 포함한다. 처리는 살포 전, 살포 시, 살포 직후, 모의 재배 기간 동안, 재배 정착 전, 재배 정착시 및 재배 정착 후 성장 시기에 수행될 수 있다. 상기 언급한 토양 처리에서, 유효 성분이 식물이 동시에 적용될 수 있거나, 유효 성분을 함유하는 페이스트 비료와 같은 고체 비료가 토양에 적용될 수 있다. 유효 성분은 관개 액체 내에서 혼합될 수 있으며, 예를 들어 관개 시설(관개 튜브, 관개 파이프, 스프링클러 등) 에 주입되고, 고랑 사이 범람하는 액체 내에 혼합되거나, 수경 배지(water culture medium)에 혼합될 수 있다. 대안적으로는, 관개 액체 및 유효 성분은 사전에 혼합될 수 있고, 예를 들어 상기 언급된 관개 방법 및 살포 및 범람과 같은 다른 방법을 포함하는 적절한 관개 방법에 의한 처리에 사용될 수 있다.Treatment of stems and leaves with the control method of the present invention may include, in particular, application on plant surfaces, such as for example by spraying stems and leaves. As the treatment of the soil in the control method of the present invention, for example, spraying on the soil, mixing with the soil, spraying the liquid treatment agent into the soil (irrigation of the liquid treatment agent, injection into the soil, dripping of the liquid treatment agent) may be included. Examples of places to be treated are planting holes, furrows, around planting holes, around planting furrows, the entire surface of the growth area, the part between the soil and the plant, the part between the roots, and the part under the stem of the plant. , main furrow, growing soil, seed bed. It includes boxes for growing seedlings, trays for growing seedlings, and seedlings. The treatment may be performed before application, at the time of application, immediately after application, during the simulated cultivation period, before cultivation establishment, during cultivation establishment, and during the growth period after cultivation establishment. In the above-mentioned soil treatment, the active ingredient may be simultaneously applied to the plants, or a solid fertilizer such as a paste fertilizer containing the active ingredient may be applied to the soil. The active ingredient can be mixed in an irrigation liquid, for example injected into an irrigation facility (irrigation tube, irrigation pipe, sprinkler, etc.), mixed into a furrow overflow liquid, or mixed into a water culture medium. can Alternatively, the irrigation liquid and the active ingredient may be pre-mixed and used for treatment by suitable irrigation methods including, for example, the irrigation methods mentioned above and other methods such as sprinkling and flooding.
본 발명의 방제 방법으로 휘발 처리법은, 예를 들어 본 발명의 식물병 방제용 조성물로 식물을 배양하는 토양 및 식물의 배양을 위한 수경 배지, 모판 등의 매개물에 살포 처리하여 살포된 조성물의 휘발을 통해 식물체를 병충해로부터 보호되도록 하는 방법이며, 이외에도 상기 조성물을 식물체 주변에 거치시켜 휘발된 기체상태의 조성물에 식물체를 노출시킬 수 있다. The volatilization treatment method in the control method of the present invention is, for example, spraying the soil for culturing plants with the composition for controlling plant diseases of the present invention and a medium such as a hydroponic medium for culturing plants, seedlings, etc. to volatilize the sprayed composition. It is a method to protect plants from pests and diseases through the plant, and in addition, the plant can be exposed to the volatilized gaseous composition by passing the composition around the plant.
본 발명의 방제 방법으로의 종자 처리법은, 예를 들어 본 발명의 식물병 방제용 조성물로 병충해로부터 보호되도록 종자를 처리하는 방법이며, 이의 특정 예는 본 발명의 식물병 방제용 조성물의 현탁액을 미립화하고 종자 표면 상에 분무하는 분무 처리법; 본 발명의 식물병 방제용 조성물의 습윤성 분말, 유액, 유동화제 등을 그 자체로 또는 소량의 물을 첨가하여 종자 표면 상에 적용하는 살포 처리법; 종자를 특정 기간 동안 본 발명의 식물병 방제용 조성물의 용액 내에 함침시키는 함침 처리법; 필름 코팅 처리법 및 펠렛 코팅 처리법을 포함한다.Seed treatment as a control method of the present invention is, for example, a method of treating seeds to be protected from diseases and pests with the composition for controlling plant diseases of the present invention, a specific example of which is atomization of the suspension of the composition for controlling plant diseases of the present invention. a spray treatment method of spraying on the seed surface; a spraying treatment method in which wettable powder, emulsion, glidant, etc. of the composition for controlling plant diseases of the present invention is applied on the surface of seeds by itself or with the addition of a small amount of water; an impregnation treatment method in which seeds are impregnated in a solution of the composition for controlling plant diseases of the present invention for a specific period of time; It includes a film coating treatment method and a pellet coating treatment method.
식물, 또는 식물 성장용 토양이 본 발명에 의한 균주, 균주의 배양액, 균주의 배양여액 또는 상기 배양여액의 분획물로 처리되는 경우, 처리량은 처리할 식물의 종류, 방제할 해충의 종류 및 발생 빈도, 제형 형태, 처리 기간, 기후 조건 등에 따라 변화할 수 있다.When plants or soil for plant growth are treated with the strain according to the present invention, the culture solution of the strain, the culture filtrate of the strain, or the fraction of the culture filtrate, the amount of treatment is the type of plant to be treated, the type of pest to be controlled and the frequency of occurrence, It may change depending on the formulation type, treatment period, climatic conditions, and the like.
유액, 습윤성 분말, 유동화제 등은 통상 물로 희석된 후 처리를 위해 살포된다. 이러한 경우, 유효 성분의 농도는 통상 0.0001 내지 3 중량%, 바람직하게는 0.0005 내지 1 중량%의 범위이다. 분말제, 과립제 등은 통상 희석 없이 처리에 사용된다.Emulsions, wettable powders, glidants and the like are usually diluted with water and then applied for treatment. In this case, the concentration of the active ingredient is usually in the range of 0.0001 to 3% by weight, preferably 0.0005 to 1% by weight. Powders, granules and the like are usually used for treatment without dilution.
본 발명의 방제 방법은 논과 같은 경작지 또는 비경작지에서 사용될 수 있다.The control method of the present invention can be used in cultivated or uncultivated land such as rice fields.
아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물은 천연물로서 인체에 무해하고 자연계에서 생분해되어 환경오염을 유발하지 않으면서 식물병을 방제하는데 효과가 있어 환경친화적인 생물농약으로 개발될 수 있고 고부가가치의 유기농산물 생산에 있어 유용하게 사용될 수 있다.Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate or its fractions are harmless to the human body as a natural product and are biodegradable in the natural world, so they are effective in controlling plant diseases without causing environmental pollution, so they can be developed as environmentally friendly biological pesticides. and can be usefully used in the production of high value-added organic produce.
도 1은 실시예 1에 따른 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP(SFC20200425-M11) 균주의 균총을 나타낸 이미지이다.
도 2는 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP (SFC20200425-M11) 균주의 calmodulin 유전자의 염기서열 분석 결과를 기반으로 작성된 계통수를 나타낸 것이다.1 is an image showing the flora of Aspergillus candidus KACC83032BP (SFC20200425-M11) strain according to Example 1.
2 is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) shows a phylogenetic tree based on the results of sequencing of the calmodulin gene of the strain.
이하, 실시예에 의해 상세히 설명한다.Hereinafter, examples will be described in detail.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.
<< 실시예Example 1> 1> 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACC83032BPKACC83032BP (SFC20200425-M11) 균주의 분리 및 동정 Isolation and identification of (SFC20200425-M11) strain
(1) (One) SFC20200425SFC20200425 -M11 균주의 분리-Isolation of the M11 strain
강원도 양양군 강현면 정암리 정암해변에서 채취한 도루묵(Arctoscopus japonicus) 알 표면을 인공해수(NaCl 28.32 g, KCl 0.77 g, MgCl2·6H2O 5.48 g, MgSO4·7H2O 7.39 g, CaCl2 1.11 g, NaHCO3 0.2 g, 증류수 1 L)로 세척하여 불순물을 제거하고, 이를 약 5 mm 길이로 잘라서 인공해수를 첨가한 PDA 배지(감자전분 4 g, 포도당 20 g, 한천 15 g, 인공해수 1 L)에 올려놓고, 25℃에서 1 내지 2주 동안 배양하였다. 형성된 균총을 순수 배양하여 원형의 콜로니 형태를 보이며 흰색의 균사를 형성하는 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP (SFC20200425-M11) 균주를 분리하였다(도 1). The surface of sandfish ( Arctoscopus japonicus ) eggs collected from Jeongam Beach, Jeongam-ri, Ganghyeon-myeon, Yangyang-gun, Gangwon-do was mixed with artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl 2 6H 2 O 5.48 g, MgSO 4 7H 2 O 7.39 g, CaCl 2 1.11 g , NaHCO 3 0.2 g, distilled water 1 L) to remove impurities, cut it into about 5 mm length, and add artificial seawater to the PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, artificial sea water 1 L) ), and incubated at 25 ° C for 1 to 2 weeks. Aspergillus candida ( Aspergillus candida), which forms white hyphae with round colonies by pure culture of the formed flora. candidus ) KACC83032BP (SFC20200425-M11) strain was isolated (FIG. 1).
이 후, 상기 분리된 SFC20200425-M11 균주는 멸균한 20% 글리세롤(glycerol) 수용액에 침지하여 -80℃의 온도에서 보관하였다.Thereafter, the isolated SFC20200425-M11 strain was immersed in a sterilized 20% glycerol aqueous solution and stored at a temperature of -80°C.
(2) (2) SFC20200425SFC20200425 -M11 균주의 동정-Identification of strain M11
실시예 1에서 분리한 SFC20200425-M11 균주의 분류학적 동정을 위해 calmodulin 유전자 염기서열을 바탕으로 분자계통학적 분석을 실시하였다. For taxonomic identification of the SFC20200425-M11 strain isolated in Example 1, molecular phylogenetic analysis was performed based on the calmodulin gene sequence.
구체적으로, 상기 SFC20200425-M11 균주를 PDB 배지(감자전분 4 g, 포도당 20 g, 증류수 1 L)에 접종하여 25℃에서 일주일간 150rpm으로 진탕배양하였다. AccuPrep DNA 추출 키트(Bioneer, Daejeon, Korea)를 이용하여 배양하여 얻은 균체로부터 유전체 DNA를 추출하고, 추출된 DNA를 주형으로 하여 PCR을 수행하였다.Specifically, the SFC20200425-M11 strain was inoculated into PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and cultured with shaking at 25 ° C. for one week at 150 rpm. Genomic DNA was extracted from the cells obtained by culturing using AccuPrep DNA extraction kit (Bioneer, Daejeon, Korea), and PCR was performed using the extracted DNA as a template.
PCR(polymerase chain reaction)은 정방향 프라이머 CF1D(5′- CAGGTCTCCGAGTACAAG-3′ : 서열번호 2), 역방향 프라이머 CF4(5′-CAGGTCTCCGAGTACAAG TTTYTGCATCATRAGYTGGAC-3′ : 서열번호 3)와 Ex Taq polymerase(Takara, Otsu, Japan)를 이용하여 94℃ 5분 1회, 94℃ 30초, 58℃ 30초, 72℃ 30초에서 34회, 72℃에서 7분간 1회 조건에서 진행되었다. 수득한 PCR 생성물(product)을 전기영동하고 Expin PCR purification kit(GeneAll, Seoul, Korea)를 사용하여 정제한 후, 염기서열 분석을 위해 시퀀싱 분석 서비스(Macrogen, Daejeon, Korea)를 의뢰하였다. PCR (polymerase chain reaction) was performed using forward primer CF1D (5′-CAGGTCTCCGAGTACAAG-3′: SEQ ID NO: 2), reverse primer CF4 (5′-CAGGTCTCCGAGTACAAG TTTYTGCATCATRAGYTGGAC-3′: SEQ ID NO: 3) and Ex Taq polymerase (Takara, Otsu, Japan) was used at 94°C for 5 minutes once, 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds 34 times, and 72°C for 7 minutes once. After electrophoresis of the obtained PCR product and purification using an Expin PCR purification kit (GeneAll, Seoul, Korea), a sequencing analysis service (Macrogen, Daejeon, Korea) was requested for sequencing.
시퀀싱된 염기서열 결과(하기 서열번호 1)를 바탕으로 NCBI BLASTn 데이터베이스에 등록된 다른 균주들의 ITS 염기서열과 비교 분석하였다. MAFFT 프로그램으로 염기서열을 정렬한 후 Kimura 2-parameter model과 1,000회의 부트스트랩(bootstrap) 법으로 MEGA 프로그램을 사용하여 계통수(neighbor-joining tree)를 작성하였다. Based on the sequenced nucleotide sequence result (SEQ ID NO: 1 below), comparison and analysis were performed with the ITS nucleotide sequences of other strains registered in the NCBI BLASTn database. After aligning the base sequences with the MAFFT program, a neighbor-joining tree was created using the MEGA program with the Kimura 2-parameter model and 1,000 bootstrap method.
[서열번호 1][SEQ ID NO: 1]
GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTCCATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTCGTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGC TGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTC CATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC
상기 서열번호를 이용하여 계통도를 작성한 결과, 본 발명의 SFC20200425-M11 균주는 아스퍼질러스 캔디더스(Aspergillus candidus) NRRL 303 균주와 높은 상동성(99.4% 이상)을 나타냈다(도 2). As a result of creating a phylogenetic tree using the above sequence number, the SFC20200425-M11 strain of the present invention is Aspergillus candida ( Aspergillus candidus ) showed high homology (more than 99.4%) with the NRRL 303 strain (FIG. 2).
이러한 분석결과를 바탕으로 SFC20200425-M11 균주를 아스퍼질러스 캔디더스(Aspergillus candidus) SFC20200425-M11 균주로 명명하고, 2020년 7월 31일에 국립농업과학원 미생물은행에 수탁번호 KACC 83032BP로 기탁하였다.Based on these analysis results, the SFC20200425-M11 strain was named Aspergillus candidus SFC20200425-M11 strain, and deposited with the National Institute of Agricultural Sciences Microorganism Bank on July 31, 2020 under accession number KACC 83032BP.
<< 실시예Example 2> 2> 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) 균주 (SFC20200425-M11) strain 배양여액의culture filtrate 식물병plant disease 방제효과 평가 Control effect evaluation
단계 1: Step 1: 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) 균주 (SFC20200425-M11) strain 배양여액의culture filtrate 제조 manufacturing
실시예 1에서 분리한 아스퍼질러스 캔디더스(Aspergillus candidus) KACC 83032BP (SFC20200425-M11) 균주(이하, SFC20200425-M11라 함)를 멸균한 PDA 배지(감자전분 4 g, 포도당 20 g, 한천 15 g, 증류수 1 L)에서 배양한 다음, 배지에 형성된 균총을 코르크 보러로 천공하여 균사 디스크(직경 8 mm)를 제조하였다. 균사 디스크를 멸균한 PDB 배지(감자전분 4 g, 포도당 20 g, 증류수 1 L)에 접종하고 25℃에서 1주일 동안 진탕배양(150rpm)한 후에 균주배양액을 여과지(또는 거즈)로 걸러서 배양여액을 제조하였다.Aspergillus candida isolated in Example 1 ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain (hereinafter referred to as SFC20200425-M11) was cultured in a sterilized PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1 L), and then formed on the medium Mycelial discs (8 mm in diameter) were prepared by piercing the colonies with a cork borer. Inoculate the mycelial disk into a sterilized PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and incubate with shaking (150 rpm) for 1 week at 25 ° C. Filter the strain culture medium with filter paper (or gauze) to obtain the culture filtrate. manufactured.
단계 2: Step 2: 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) 균주 (SFC20200425-M11) strain 배양여액을culture filtrate 포함하는 조성물의 of the composition comprising 식물병plant disease 방제활성 조사 Investigation of control activity
본 발명의 아스퍼질러스 캔디더스(Aspergillus candidus) SFC20200425-M11 균주 배양여액을 포함하는 조성물의 벼 도열병(병원균: Magnaporthe oryzae), 토마토 잿빛곰팡이병(병원균: Botrytis cinerea), 토마토 역병(병원균: Phytophthora infestans), 밀 붉은녹병(병원균: Puccinia triticina), 보리 흰가루병(병원균: Blumeria graminis f. sp. hordei), 고추 탄저병(병원균: Colletotrichum coccodes)에 대한 식물병 방제 효과를 온실 조건에서 평가하였다.Aspergillus candida of the present invention ( Aspergillus candidus ) Rice blast of the composition containing the SFC20200425-M11 strain culture filtrate (pathogen: Magnaporthe oryzae ), tomato gray mold (pathogen: Botrytis ) cinerea ), tomato blight (pathogen: Phytophthora infestans ), wheat red rust (pathogen: Puccinia triticina ), barley powdery mildew (pathogen: Blumeria graminis f. sp. hordei ), and pepper anthracnose (pathogen: Colletotrichum coccodes ) were evaluated in greenhouse conditions.
구체적으로, 단계 1에서 얻어진 배양여액에 전착제로서 트윈 20(Tween 20)을 0.025%(w/v) 농도가 되도록 첨가하여 상기 배양여액을 포함하는 조성물을 제조한 후, 상기 조성물을 벼, 토마토, 밀, 보리 및 고추 유묘에 분무처리하고 24시간 동안 풍건한 다음 각각의 병원균을 접종하였다. 이때, 각 식물병 당 4개의 포트를 이용하였고, 각 식물은 지름 4.5 ㎝의 플라스틱 포트에 수도용 상토 또는 원예용 상토를 80% 정도 채운 다음, 종자를 파종하여 25±5℃의 온실에서 1주 내지 4주 동안 재배한 것을 이용하였다. Specifically, after preparing a composition containing the culture filtrate by adding Tween 20 as a spreading agent to the culture filtrate obtained in step 1 to a concentration of 0.025% (w / v), the composition was prepared for rice, tomato, Wheat, barley and pepper seedlings were sprayed and air-dried for 24 hours, and each pathogen was inoculated. At this time, 4 pots were used for each plant bottle, and each plant was filled with about 80% of potting soil or horticultural potting soil in a plastic pot with a diameter of 4.5 cm, and then the seeds were sown and kept in a greenhouse at 25 ± 5 ° C for 1 week to 80%. Cultivated for 4 weeks was used.
토마토 잿빛곰팡이병, 토마토 역병, 고추 탄저병은 접종 3일 후에, 밀 붉은녹병과 보리 흰가루병은 접종 7일 후에 병반면적율(%)을 조사하였으며, 측정한 각 식물병의 병반면적율을 사용하여 다음과 같은 식에 따라 방제가(%)를 계산하였다.Tomato gray mold, tomato blight, and pepper anthracnose were investigated 3 days after inoculation, wheat red rust and barley powdery mildew 7 days after inoculation, and the lesion area (%) was investigated. Control value (%) was calculated according to the formula.
무처리구는 배양여액이 포함되지 않은 0.025%(w/v) 농도의 트윈 20만을 처리하였다.The untreated group was treated only with Tween 20 at a concentration of 0.025% (w/v) without the culture filtrate.
<식><expression>
방제가(%) = [1 - (처리구의 병반면적율 / 무처리구의 병반면적율)] ×100Control value (%) = [1 - (lesion area ratio of treated group / lesion area ratio of untreated group)] × 100
(TGM, 토마토 잿빛곰팡이병; TLB, 토마토 역병; WLR, 밀 붉은녹병; BPM, 보리 흰가루병; PAN, 고추 탄저병)(TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)
표 1에서 나타난 바와 같이, 본 발명의 SFC20200425-M11 균주의 배양여액은 토마토 잿빛곰팡이병, 토마토 역병, 밀 붉은녹병, 보리 흰가루병 및 고추 탄저병에 방제효과를 보였으며, 특히, 토마토 잿빛곰팡이병과 고추 탄저병에 대하여 각각 82%와 91%의 우수한 방제효과를 나타냈다.As shown in Table 1, the culture filtrate of the SFC20200425-M11 strain of the present invention showed a control effect on tomato gray mold, tomato blight, wheat red rust, barley powdery mildew and pepper anthracnose, in particular, tomato gray mold and pepper anthracnose showed excellent control effects of 82% and 91%, respectively.
<< 실시예Example 3> 3> 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) 균주 (SFC20200425-M11) strain 배양여액의culture filtrate 분획물을fraction 포함하는 including 식물병plant disease 방제용 조성물의 composition for controlling 식물병plant disease 방제효과 평가 Control effect evaluation
단계 1: Step 1: 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) (SFC20200425-M11) 배양여액의culture filtrate 분획물의fractional 제조 manufacturing
아스퍼질러스 캔디더스(Aspergillus candidus) KACC 83032BP (SFC20200425-M11) 배양여액의 분획물을 제조하기 위하여, 상기 실시예 1의 단계 1과 동일한 방법을 수행하여 아스퍼질러스 캔디더스(Aspergillus candidus) KACC 83032BP (SFC20200425-M11) 배양여액을 제조하였으며, 균주의 배양여액의 용매 분획을 수행하였다. Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) In order to prepare a fraction of the culture filtrate, the same method as in step 1 of Example 1 was performed to Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate was prepared, and solvent fractionation of the culture filtrate of the strain was performed.
구체적으로, 분액 여두(separatory funnel)에 상기 SFC20200425-M11 균주의 배양여액을 넣고 동량의 에틸아세테이트와 혼합하여 진탕시킨 다음 정치하고 층 분리가 일어나면 유기용매층 및 수용액층을 얻었다. 수용액층에 다시 동량의 부탄올을 혼합하여 진탕시킨 다음 정치하고 유기용매층을 분리하고 각각을 감압농축하여 에틸아세테이트 분획물, 부탄올 분획물, 물 분획물을 획득하였다.Specifically, the culture filtrate of the SFC20200425-M11 strain was put into a separatory funnel, mixed with an equal amount of ethyl acetate, shaken, allowed to stand, and when the layers were separated, an organic solvent layer and an aqueous solution layer were obtained. The same amount of butanol was mixed with the aqueous layer, shaken, allowed to stand, and the organic solvent layer was separated and concentrated under reduced pressure to obtain an ethyl acetate fraction, a butanol fraction, and a water fraction.
단계 2: Step 2: 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) (SFC20200425-M11) 배양여액의culture filtrate 분획물을fraction 포함하는 including 식물병plant disease 방제용 조성물의 준비 Preparation of composition for control
아스퍼질러스 캔디더스(Aspergillus candidus) KACC 83032BP (SFC20200425-M11) 배양여액의 분획물을 포함하는 식물병 방제용 조성물의 식물병 방제효과 평가 실험을 위하여, 단계 1에서 얻어진 각 분획물을 1,000 μg/ml의 농도로 준비하고, 분획물의 용해를 위해서 메탄올의 함량을 5%로 첨가하고, 전착제로서 트윈 20(Tween 20)을 0.025%(w/v) 농도가 되도록 첨가하여 상기 배양여액의 분획물을 포함하는 조성물을 제조하였다.Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) For the plant disease control effect evaluation experiment of the plant disease control composition containing the fractions of the culture filtrate, each fraction obtained in step 1 was prepared at a concentration of 1,000 μg / ml, and the fractions For dissolution, the content of methanol was added to 5%, and Tween 20 as a spreading agent was added to a concentration of 0.025% (w / v) to prepare a composition containing the fraction of the culture filtrate.
단계 3: Step 3: 아스퍼질러스Aspergillus 캔디더스candidas (( AspergillusAspergillus candiduscandidus ) ) KACCKACC 83032BP83032BP (SFC20200425-M11) (SFC20200425-M11) 배양여액의culture filtrate 분획물을fraction 포함하는 including 식물병plant disease 방제용 조성물의 composition for controlling 식물병plant disease 방제활성 확인 Confirmation of control activity
상기 단계 2에서 제조된 조성물의 벼 도열병(병원균: Magnaporthe oryzae), 토마토 잿빛곰팡이병(병원균: Botrytis cinerea), 토마토 역병(병원균: Phytophthora infestans), 밀 붉은녹병(병원균: Puccinia triticina), 보리 흰가루병(병원균: Blumeria graminis f. sp. hordei), 고추 탄저병(병원균: Colletotrichum coccodes)에 대한 식물병 방제 효과를 온실 조건에서 실시예 2의 단계 2와 동일한 방법으로 식물병에 대한 방제효과를 평가하였으며, 그 결과는 표 2와 같다.Rice blast of the composition prepared in step 2 (pathogen: Magnaporthe oryzae ), tomato gray mold (pathogen: Botrytis ) cinerea ), tomato blight (pathogen: Phytophthora infestans ), wheat red rust (pathogen: Puccinia triticina ), barley powdery mildew (pathogen: Blumeria graminis f. sp. hordei ) and pepper anthracnose (pathogen: Colletotrichum coccodes ) were evaluated for plant disease control effects in greenhouse conditions in the same manner as in step 2 of Example 2, and the results are shown in Table 2.
(μg/ml)density
(μg/ml)
(RCB, 벼 도열병; TGM, 토마토 잿빛곰팡이병; TLB, 토마토 역병; WLR, 밀 붉은녹병; BPM, 보리 흰가루병; PAN, 고추 탄저병)(RCB, rice blast; TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)
표 2에서 나타난 바와 같이, 에틸아세테이트 분획물을 1,000 μg/ml 농도로 식물에 처리했을 때, 6종의 식물병에 대해 방제효과가 나타났으며 특히, 토마토 잿빛곰팡이병, 토마토 역병, 고추 탄저병에 대하여 각각 100%, 94%, 91%의 매우 우수한 방제효과를 나타냈으며, 밀 붉은녹병 및 벼 도열병에 대해서도 각각 73% 및 56%의 방제효과를 나타냈다. As shown in Table 2, when plants were treated with the ethyl acetate fraction at a concentration of 1,000 μg/ml, control effects were shown against 6 plant diseases, especially against tomato gray mold, tomato late blight, and pepper anthracnose. Excellent control effects of 100%, 94%, and 91% were shown, respectively, and 73% and 56% respectively against wheat rust and rice blast.
반면, 부탄올 분획물과 물 분획물에서는 일부 식물병에 대해서만 방제 효과가있는 것으로 나타나 유의미한 방제 효과를 보이지 않았다. On the other hand, the butanol fraction and the water fraction were found to have a control effect only on some plant diseases, showing no significant control effect.
상기에서는 본 발명의 바람직한 실시예를 참조하여 설명하였지만, 해당 기술 분야의 숙련된 당업자는 하기의 특허 청구 범위에 기재된 본 발명의 사상 및 영역으로부터 벗어나지 않는 범위 내에서 본 발명을 다양하게 수정 및 변경시킬 수 있음을 이해할 수 있을 것이다.Although the above has been described with reference to preferred embodiments of the present invention, those skilled in the art can variously modify and change the present invention without departing from the spirit and scope of the present invention described in the claims below. You will understand that you can.
<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY Seoul National University R&DB Foundation <120> Aspergillus candidus strain and composition for controlling plant diseases comprising the same <130> KRICT18P <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 561 <212> DNA <213> Artificial Sequence <220> <223> calmodulin (CaM) <400> 1 gtctccgagt acaaggaggc cttctccctc ttcgtaagtc ctccgttcgg ggtgtcctgc 60 accggaagat ggaacggcgc tgatcgcagg tcgtttttgc tcgtgtaaca ggataaggat 120 ggcgatggtt agtactccgt ctggacgatg cgaccggcgt ggatcgattc tgatgatcac 180 gtttctttgc gaacttctta tctgacgtac ggcaggacaa atcaccacca aggagctggg 240 caccgtcatg cggtcgctgg gccagaaccc ctccgagtcg gaactccagg acatgatcaa 300 cgaggttgac gcggacaaca acggcaccat cgatttccct gaattcctca ccatgatggc 360 tcgtaagatg aaggacaccg actcggagga ggagatccgg gaagcgttca aggtctttga 420 tcgcgacaac aacggcttca tctccgccgc ggagctgcgc cacgtcatga cctccatcgg 480 cgagaagctg accgacgacg aggttgacga gatgatccgc gaggccgacc aggacggcga 540 cggccgcatc gactgtactt c 561 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CF1D Forward <400> 2 caggtctccg agtacaag 18 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CF4 Reverse <400> 3 caggtctccg agtacaagtt tytgcatcat ragytggac 39 <110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY Seoul National University R&DB Foundation <120> Aspergillus candidus strain and composition for controlling plant diseases comprising the same <130> KRICT18P <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 561 <212> DNA <213> artificial sequence <220> <223> calmodulin (CaM) <400> 1 gtctccgagt acaaggaggc cttctccctc ttcgtaagtc ctccgttcgg ggtgtcctgc 60 accggaagat ggaacggcgc tgatcgcagg tcgtttttgc tcgtgtaaca ggataaggat 120 ggcgatggtt agtactccgt ctggacgatg cgaccggcgt ggatcgattc tgatgatcac 180 gtttctttgc gaacttctta tctgacgtac ggcaggacaa atcaccacca aggagctggg 240 caccgtcatg cggtcgctgg gccagaaccc ctccgagtcg gaactccagg acatgatcaa 300 cgaggttgac gcggacaaca acggcaccat cgatttccct gaattcctca ccatgatggc 360 tcgtaagatg aaggacaccg actcggagga ggagatccgg gaagcgttca aggtctttga 420 tcgcgacaac aacggcttca tctccgccgc ggagctgcgc cacgtcatga cctccatcgg 480 cgagaagctg accgacgacg aggttgacga gatgatccgc gaggccgacc aggacggcga 540 cggccgcatc gactgtactt c 561 <210> 2 <211> 18 <212> DNA <213> artificial sequence <220> <223> CF1D Forward <400> 2 caggtctccg agtacaag 18 <210> 3 <211> 39 <212> DNA <213> artificial sequence <220> <223> CF4 Reverse <400> 3 caggtctccg agtacaagtt tytgcatcat ragytggac 39
Claims (15)
상기 식물병은 식물병원성 곰팡이로부터 유발되는 것인 식물병 방제용 조성물.According to claim 2,
The plant disease is a composition for controlling plant diseases that is caused by plant pathogenic fungi.
상기 식물병원성 곰팡이는 보트라이티스 시네리아( Botrytis cinerea; 잿빛곰팡이병균), 콜레토트리쿰 코코데스(Colletotrichum coccodes; 고추 탄저병균), 마그나포르테 오라이제(Magnaporthe oryzae; 벼 도열병균), 푸시니아 트리티시나(Puccinia triticina; 밀 붉은녹병균), 블루메리아 그라미니스 에프. 에스피. 호르데이 (Blumeria graminis f. sp. hordei ; 보리 흰가루병균) 및 파이토프토라 인페스탄스(Phytophthora infestans; 감자/토마토 역병균)으로 이루어지는 군으로부터 선택되는 것인 식물병 방제용 조성물.According to claim 3,
The phytopathogenic fungus is Botrytis cinerea ( Botrytis cinerea ; Gray Mold Bacteria), Colletotrichum Cocodes ( Colletotrichum coccodes ; Pepper anthracnose), Magnaporthe oryse ( Magnaporthe oryzae ; Rice blast fungus), Puccinia triticina (Wheat red rust fungus), Bloomeria graminis F. esp. Hordei ( Blumeria graminis f. sp. hordei ; A composition for controlling plant diseases that is selected from the group consisting of barley powdery mildew) and Phytophthora infestans (potato / tomato blight).
상기 분획물은 물, C1 내지 C4의 저급 알코올, 헥산, 클로로포름, 메틸렌클로라이드, 에틸아세테이트, 아세톤, 아세토나이트릴 및 이들의 조합으로 이루어지는 군으로부터 선택되는 유기용매를 사용하여 분획된 것인, 식물병 방제용 조성물.According to claim 2,
The fraction is fractionated using an organic solvent selected from the group consisting of water, C 1 to C 4 lower alcohol, hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile and combinations thereof, plant A composition for controlling diseases.
상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물은 살균 활성을 갖는 것인 식물병 방제용 조성물.According to claim 2,
The Aspergillus candida ( Aspergillus candidus ) KACC83032BP, a culture thereof, a culture filtrate thereof, or a fraction of the culture filtrate has a bactericidal activity.
상기 아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP, 이의 배양액, 이의 배양여액 또는 상기 배양여액의 분획물은 식물병 방제용 조성물에 100 내지 3000 μg/ml 농도로 포함되는 것인, 식물병 방제용 조성물.According to claim 2,
The Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate or fractions of the culture filtrate is contained in the composition for controlling plant diseases at a concentration of 100 to 3000 μg / ml, the composition for controlling plant diseases.
아스퍼질러스 캔디더스(Aspergillus candidus) KACC83032BP를 배지에 접종한 후 7일 동안 25℃에서 진탕배양하는 단계;를 더 포함하는 것인, 제조방법.According to claim 9,
Aspergillus candida ( Aspergillus candidus ) KACC83032BP inoculated into the medium and then incubated with shaking at 25° C. for 7 days.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210002089A KR102541009B1 (en) | 2021-01-07 | 2021-01-07 | Aspergillus candidus strain and composition for controlling plant diseases comprising the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210002089A KR102541009B1 (en) | 2021-01-07 | 2021-01-07 | Aspergillus candidus strain and composition for controlling plant diseases comprising the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20220099786A KR20220099786A (en) | 2022-07-14 |
KR102541009B1 true KR102541009B1 (en) | 2023-06-12 |
Family
ID=82406913
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020210002089A KR102541009B1 (en) | 2021-01-07 | 2021-01-07 | Aspergillus candidus strain and composition for controlling plant diseases comprising the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102541009B1 (en) |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2248940A1 (en) * | 1996-04-22 | 1997-10-30 | Shionogi & Co., Ltd. | Novel terphenyl compounds and the pharmaceutical composition containing the same |
KR101708325B1 (en) * | 2015-04-06 | 2017-02-20 | 전남대학교산학협력단 | Aspergillus niger F22 strain having nematocidal activity against plant parasitic nematode and uses thereof |
KR101876939B1 (en) * | 2015-11-10 | 2018-07-11 | 전남대학교산학협력단 | Composition for controlling plant disease comprising Aspergillus persii strain producing penicillic acid as effective component and uses thereof |
KR102375336B1 (en) * | 2019-06-27 | 2022-03-17 | 한국화학연구원 | Composition for controlling plant diseases using Brevibacillus brevis HK544 |
-
2021
- 2021-01-07 KR KR1020210002089A patent/KR102541009B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
Kor. J. Appl. Microbiol. Biotechnol,제24권,5호,574-578면(1996) 1부.* |
Also Published As
Publication number | Publication date |
---|---|
KR20220099786A (en) | 2022-07-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102375337B1 (en) | Composition for controlling plant diseases using Brevibacillus brevis HK544 | |
KR101667541B1 (en) | New microorganism Bacillus methylotrophicus GH1-13 and Microbial agent and biopesticide containing the same | |
KR20090035162A (en) | Compositions of increasing microbial populations on surfaces and their uses | |
KR101287141B1 (en) | Streptomyces griseus BIG105 for controlling plant diseases and uses thereof | |
KR20140071145A (en) | Novel Paenibacillus polymyxa AB-15 strain and use the same | |
AU2017410234B2 (en) | Microbial insecticide for control of mulberry thrips | |
KR100757298B1 (en) | Antagonistic microorganisms having activity against plant pathogens and plant diseases controlling agent comprising the same | |
KR101626801B1 (en) | Beauveria bassiana having insect pathogenicityand agent for prevention of rice vermin using the same | |
KR101524651B1 (en) | Composition for plant disease control containing Streptomyces griseus S4-7' or its culture fluid as an active ingredient | |
KR20180116172A (en) | Burkholderia ambifaria CJ4 strain Possessing antifungal activity against Root Rot Pathogen of ginseng and Use Thereof | |
KR100294023B1 (en) | Bacteria for disease prevention of crops, microorganisms containing them and uses thereof | |
KR101891296B1 (en) | Composition for controlling plant diseases including Chitinophaga sp. HK235 strain and its culture broth, its fraction as an active ingredient | |
KR102131411B1 (en) | Composition and method for controlling plant diseases using vulculic acid isolated from Paraboremia adianticola SFC20150402-M24 strain | |
KR102541009B1 (en) | Aspergillus candidus strain and composition for controlling plant diseases comprising the same | |
KR102522009B1 (en) | Composition for controlling plant diseases comprising a compound having fungicidal activity derived from Aspergillus candidus strain | |
Abada et al. | Bacterial bioagents and compost as two tools for management of eggplant Fusarium wilt | |
KR102633074B1 (en) | Composition for controlling plant diseases using Aspergillus montenegroi SFC20200425-M27 strain and method for manufacturing the same | |
KR100314323B1 (en) | Bacillus sp. GB-017 KFCC-11070 | |
KR102167148B1 (en) | Composition and method for controlling plant diseases using Paraboeremia adianticola | |
KR102598551B1 (en) | Composition for controlling plant diseases comprising compound derived from Aspergillus montenegroi SFC20200425-M27 strain and method for preparing the same | |
KR20240066505A (en) | Streptomyces platensis strain and composition for controlling plant diseases comprising the same | |
KR20240113656A (en) | Composition for controlling plant diseases using Streptomyces olivoreticuli KRA21-80 and use thereof | |
KR20180105458A (en) | Trichoderma citrinoviride PG87 strain isolated from mountain-cultivated ginseng roots having antimicrobial activity against ginseng plant pathogen and uses thereof | |
KR102002538B1 (en) | Composition for controlling plant diseases including Crinipellis rhizomaticola IUM00035 strain, culture medium thereof, fraction of thereof or a compound isolated therefrom as an active ingredient and method of controlling plant diseases using the same | |
KR100757300B1 (en) | Chromobacterium sp. strain C-61 having activity against plant pathogens and plant diseases controlling agent comprising the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right |