KR102541009B1 - Aspergillus candidus strain and composition for controlling plant diseases comprising the same - Google Patents

Abstract

The present invention is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) strain is provided.
Aspergillus candida of the present invention ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate, or a composition for controlling plant diseases containing a fraction of the culture filtrate is a natural product, harmless to the human body and biodegradable in nature, so it is effective in controlling plant diseases without causing environmental pollution It can be developed as an environmentally friendly biological pesticide and can be usefully used in the production of high value-added organic products.

Description

Aspergillus candidus strain and composition for controlling plant diseases comprising the same {Aspergillus candidus strain and composition for controlling plant diseases comprising the same}

The present invention is Aspergillus candida ( Aspergillus candidus strain and a composition for controlling plant diseases containing the same, and in detail, Aspergillus candidus strain KACC83032BP, a culture filtrate of the strain, and a composition for controlling plant diseases comprising fractions of the culture filtrate provides

Plant pathogens cause various diseases in crops, reduce the yield of crops and impair marketability. Due to global climate change, new pests and pests appear every year and harm crops. If this is not adequately dealt with, serious social problems such as the Great Irish Famine of 1846 may occur. Chemical pesticides have been used as a major means for controlling plant diseases, but excessive use of chemical pesticides has resulted in ecosystem disturbance, environmental pollution, human toxicity, and drug resistance problems. Therefore, it is required to develop new eco-friendly plant disease control means to reduce or replace the use of chemical pesticides. From this point of view, natural materials such as plant extracts, microorganisms, or secondary metabolites of microorganisms are actively used to develop new plant disease control agents.

Since the discovery of penicillin from a fungus of the genus Penicillium, microorganisms have been actively used for new drug development as a treasure trove of new antibiotics, and various antibacterial active substances have been isolated from microorganisms. Griseofulvin, first isolated from the ascomycete Penicillium griseofulvum , has attracted attention as a plant disease control agent for its activity of inhibiting the normal spore germination of Botrytis allii , and as an antibiotic. Various studies suggesting the possibility of controlling plant diseases using microorganisms have been reported, such as showing that the culture medium of the basidiomycete Crinipellis rhizomaticola, which produces crinipellins, is effective in controlling rice blast and pepper anthracnose. come. In particular, strobilurins or oudemansins, which are produced by various wood-decaying basidiomycetes, are the lead compounds of QoI fungicides sold the most in the global fungicide market. As such, microorganisms can be actively used to develop new crop protection agents.

The present inventors tried to use Aspergillus candidus strains as an environmentally friendly means for controlling plant diseases.

One object of the present invention is Aspergillus candida ( Aspergillus candidus ) KACC83032BP strain is provided.

Another object of the present invention is Aspergillus candidus ( Aspergillus candidus ) KACC83032BP strain or its culture solution, its culture filtrate or provides a composition for controlling plant diseases comprising a fraction of the culture filtrate.

Another object of the present invention is to provide a method for producing a composition for controlling plant diseases, comprising the step of culturing Aspergillus candidus KACC83032BP in a medium.

Another object of the present invention is Aspergillus candidus ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate, or a plant disease control composition comprising a fraction of the culture filtrate treatment to plants, their seeds or their habitat It is to provide a plant disease control method comprising the step of doing.

The present inventors were investigating the control effects of various plant diseases of various strains in order to develop an eco-friendly plant disease control agent. Aspergillus candidus KACC83032BP (SFC20200425-M11), its culture medium, its culture filtrate or It was found that the fractions of the culture filtrate had excellent control effects against various plant diseases.

Terms used in this application are only used to describe specific embodiments and are not intended to limit the present invention. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this application, terms such as “comprise” or “having” are intended to designate that the features, steps, structures, or combinations thereof described above exist in the name, but one or more other features, steps, structures, or these It should be understood that it does not preclude the possibility of existence or addition of combinations.

Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in the present application, they should not be interpreted in an ideal or excessively formal meaning. don't

Aspergillus candidas ( Aspergillus candidus ) KACC83032BP strain, culture of the strain, of the strain culture filtrate or above culture filtrate fraction and including these Composition for controlling plant diseases and method for producing the same

The present invention is Aspergillus candida ( Aspergillus candidus ) KACC83032BP strain is provided.

In the present invention, the strain is also named SFC20200425-M11.

In addition, the strain may have a calmodulin (CaM) gene sequence of SEQ ID NO: 1 as follows.

GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGC TGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTC CATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC (SEQ ID NO: 1).

In the present invention, the strain is sandfish ( Arctoscopus japonicus ), and specifically, it may be separated from sandfish eggs collected from Jeongam Beach, Jeongam-ri, Ganghyeon-myeon, Yangyang-gun, Gangwon-do.

In the present invention, the strain may have plant disease control activity and bactericidal activity.

In one aspect of the present invention, the present invention provides a composition for controlling plant diseases comprising Aspergillus candidus KACC83032BP, a culture thereof, a culture filtrate thereof, or a fraction of the culture filtrate.

In this specification, "control" is intended to be used in the sense of including removal and death as well as prevention and avoidance of diseases and pests. However, since the control effect by preventive treatment is the main control mechanism for plant disease control, Aspergillus candidus KACC83032BP, its culture medium, its culture filtrate, or the control effect of the fractions of the culture filtrate on plant diseases is investigated. Experiments were conducted with the enemy treatment.

The Aspergillus candida ( Aspergillus candidus ) KACC83032BP strain may have the above-described characteristics.

In the present invention, the plant disease may be caused by a plant pathogenic fungus.

Specifically, the plant pathogenic fungi are Botrytis cinerea ( Botrytis cinerea ; Gray mold disease), Colletotrichum coco des ( Colletotrichum coccodes ; Pepper anthracnose), Magnaporthe oryse ( Magnaporthe oryzae ; Rice blast fungus), Puccinia triticina (Wheat red rust fungus), Bloomeria graminis F. esp. Hordei ( Blumeria graminis f. sp. Hordei ; Barley powdery mildew), Phytophthora infestans ( Phytophthora infestans ; potato / tomato bacillus), but the scope of the present invention is not limited thereto.

In the present invention, the plant disease is rice blast (causative fungus: Magnaporthe oryzae ), tomato gray mold (causative fungus: Botrytis) cinerea ), tomato blight (causative fungus: Phytophthora infestans ), wheat red rust (causative fungus: Puccinia) triticina ), barley powdery mildew (causative fungus: Blumeria graminis f. sp. hordei ), pepper anthracnose (causative bacteria: Colletotrichum coccodes ), but is not limited thereto.

In the present invention, the fraction is water, C ₁ to C ₄ lower alcohol (eg, methanol, ethanol, propanol, isopropanol, butanol, etc.), hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile , It can be fractionated using an organic solvent such as a combination thereof, preferably water, methanol, ethanol, propanol, isopropanol, butanol, or ethyl acetate can be used to prepare fractions, but in the present invention, fractions are prepared The range of organic solvents used to do this is not limited thereto.

In the present invention, the Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate, or fractions of the culture filtrate may be included in the composition for controlling plant diseases at a concentration of 100 to 3000 μg/ml. The concentration refers to the concentration included in the composition when the plant, its seed or its habitat is treated with a plant disease, and when the concentration is less than 100 μg / ml, the Aspergillus candidus KACC83032BP, There is a problem in that the concentration of the culture solution, the culture filtrate or the fraction of the culture filtrate is too low to control plant diseases, and when the concentration exceeds 3000 μg / ml, the Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate, or its fractions of the culture filtrate is too high in concentration, which is uneconomical and may have a negative impact on the environment. However, the amount of the composition for controlling plant diseases is not limited to the above concentration range, and may be appropriately adjusted in consideration of the type, degree of occurrence, environment, etc. of plant pathogens or plant pathogenic bacteria.

The composition of the present invention may be a mixture additionally containing an inert carrier, and a surfactant is added to the mixture so that the mixture can be formulated into an emulsion, emulsion, glidant, wettable powder, granulated wettable powder, powder, granule, etc. and other necessary auxiliaries. The above-mentioned composition for controlling plant diseases can also be used as a seed treatment agent in the present invention by itself or by adding other inactive ingredients.

In the present invention, examples of the liquid carrier that can be used in the formulation include water; alcohols such as methanol and ethanol; ketones such as acetone and methyl ethyl ketone; aromatic hydrocarbons such as benzene, toluene, xylene, ethylbenzene and methylnaphthalene; aliphatic hydrocarbons such as hexane, cyclohexane, kerosene and light oil; esters such as ethyl acetate and butyl acetate; nitriles such as acetonitrile and isobutyrnitrile; ethers such as diisopropylether and dioxane; acid amides such as N,N-dimethyl formamide and N,N-dimethylacetamide; halogenated hydrocarbons such as dichloromethane, trichloroethane and carbon tetrachloride; dimethyl sulfoxide; and vegetable oils such as soybean oil and cottonseed oil.

Further, examples of solid carriers that can be used in the formulation include fine powders or granules such as minerals such as kaolin clay, attapulgite clay, bentonite, montmorillonite, acid white clay, pyrophyllite, talc, diatomaceous earth and talcite; natural organic substances such as corn stalk meal and walnut husk meal; synthetic organic substances such as urea; salts such as calcium carbonate and ammonium sulfate; synthetic inorganic materials such as synthetic hydrated silicon oxide; As liquid carriers, aromatic hydrocarbons such as xylenes, alkylbenzenes and methylnaphthalenes; alcohols such as 2-propanol, ethylene glycol, propylene glycol and ethylene glycol monoethyl ether; ketones such as acetone, cyclohexanone and isophorone; vegetable oils such as soybean oil and cottonseed oil; petroleum aliphatic hydrocarbons, esters, dimethylsulfoxide, acetonitrile and water.

Further, examples of surfactants include anionic surfactants such as alkyl sulfate ester salts, alkylaryl sulfonate salts, dialkylsulfosuccinate salts, polyoxyethylene alkylaryl ether phosphate ester salts, lignosulfonate salts, and naphthalene sulfonates. nate formaldehyde polycondensate; and nonionic surfactants such as polyoxyethylene alkyl aryl ethers, polyoxyethylene alkylpolyoxypropylene block copolymers and sorbitan fatty acid esters, and cationic surfactants such as alkyltrimethylammonium salts.

Examples of other formulation auxiliaries are water-soluble polymers such as polyvinyl alcohol and polyvinylpyrrolidone, polysaccharides such as gum arabic, alginic acid and its salts, CMC (carboxymethyl-cellulose), xanthan gum, inorganic materials such as aluminum magnesium silicate and alumina sol ( alumina sol), preservatives, colorants and stabilizers such as PAP (acid phosphate isopropyl) and BHT (butylhydroxyltoluene).

In one embodiment of the present invention, Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate, or its fractions of the culture filtrate was confirmed through Examples that it has a control effect on plant pathogens, and it can be seen from this that it has a plant disease control effect.

In addition, the culture solution may be obtained by culturing the strain, and the culture filtrate may be obtained by physically filtering the culture solution in which the strain is cultured.

In one aspect of the present invention, Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium; it provides a method for producing a composition for controlling plant diseases, including.

In addition, Aspergillus candida ( Aspergillus candidus ) KACC83032BP inoculated into the medium and then incubated with shaking at 25° C. for 7 days.

The Aspergillus candida ( Aspergillus candidus ) The method for preparing a composition for controlling plant diseases, including a method of culturing KACC83032BP, may use any method known in the art, and is not particularly limited to a specific method.

The Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate, or a fraction of the culture filtrate may be prepared by a manufacturing method comprising the following steps, but is not limited thereto:

For example, Aspergillus candida ( Aspergillus candidus ) KACC83032B strain, the step of preparing its culture medium and its culture filtrate may include the following steps:

1) Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium;

2) preparing hyphal discs using the flora formed in the medium of step 1;

3) preparing a strain culture solution by inoculating the mycelial disk of step 2 into a culture medium and culturing with shaking; and

4) Filtering the culture solution prepared in step 3 to prepare a culture filtrate.

For example, Aspergillus candida ( Aspergillus candidus ) The step of preparing the fraction of the culture filtrate of the KACC83032B strain may include the following steps:

1) Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium;

2) preparing hyphal discs using the flora formed in the medium of step 1;

3) preparing a strain culture solution by inoculating the mycelial disk of step 2 into a culture medium and culturing with shaking;

4) preparing a culture filtrate by filtering the culture solution prepared in step 3; and

5) preparing fractions by mixing the culture filtrate and the organic solvent and separating the layers.

In the present invention, the medium in step 1 and step 3 is PDA (Potato dextrose agar) medium, MEB (Malt extract broth) medium, PDB (Potato dextrose broth) medium, CDB (Czapek dox broth) medium or SDB (Sabouraud dextrose medium) broth) medium, preferably PDA (Potato dextrose agar) medium or PDB (Potato dextrose broth) medium, but the scope of the present invention is not limited thereto.

More preferably, PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1L) and artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl ₂ 6H ₂ O 5.48 g, MgSO ₄ 7H ₂ O 7.39 g, CaCl ₂ 1.11 g NaHCO ₃ 0.2 g, distilled water 1 L) may be a PDA (potato starch 4 g, glucose 20 g, agar 15 g, artificial seawater 1 L) medium; It may be a PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and a PDB medium (potato starch 4 g, glucose 20 g, agar 15 g, artificial sea water 1 L) to which artificial seawater is added instead of distilled water.

The organic solvent is water, C ₁ to C ₄ lower alcohol (eg, methanol, ethanol, propanol, isopropanol, butanol, etc.), hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile, combinations thereof and the like, preferably water, methanol, ethanol, propanol, isopropanol, butanol, hexane, or ethyl acetate.

Aspergillus candidas ( Aspergillus candidus ) KACC83032BP strain, culture of the strain, of the strain culture filtrate or above culture filtrate fraction including plant disease Plant disease control method using composition for control

In another aspect of the present invention, a composition for controlling plant diseases comprising Aspergillus candidus KACC83032BP strain, a culture solution of the strain, a culture filtrate of the strain, or a fraction of the culture filtrate is prepared by plant and seed thereof Or treating its habitat; It provides a plant disease control method comprising a.

The treatment may be indirect spraying by spraying the composition directly on the plant, spraying on the soil where the plant is growing, or spraying on the culture medium of the plant.

The control method of the present invention includes treatment of the stem and leaves of the plant, treatment of the place where the plant grows (eg soil), treatment of the seed such as seed sterilization/seed coating, and treatment of the root.

Treatment of stems and leaves with the control method of the present invention may include, in particular, application on plant surfaces, such as for example by spraying stems and leaves. As the treatment of the soil in the control method of the present invention, for example, spraying on the soil, mixing with the soil, spraying the liquid treatment agent into the soil (irrigation of the liquid treatment agent, injection into the soil, dripping of the liquid treatment agent) may be included. Examples of places to be treated are planting holes, furrows, around planting holes, around planting furrows, the entire surface of the growth area, the part between the soil and the plant, the part between the roots, and the part under the stem of the plant. , main furrow, growing soil, seed bed. It includes boxes for growing seedlings, trays for growing seedlings, and seedlings. The treatment may be performed before application, at the time of application, immediately after application, during the simulated cultivation period, before cultivation establishment, during cultivation establishment, and during the growth period after cultivation establishment. In the above-mentioned soil treatment, the active ingredient may be simultaneously applied to the plants, or a solid fertilizer such as a paste fertilizer containing the active ingredient may be applied to the soil. The active ingredient can be mixed in an irrigation liquid, for example injected into an irrigation facility (irrigation tube, irrigation pipe, sprinkler, etc.), mixed into a furrow overflow liquid, or mixed into a water culture medium. can Alternatively, the irrigation liquid and the active ingredient may be pre-mixed and used for treatment by suitable irrigation methods including, for example, the irrigation methods mentioned above and other methods such as sprinkling and flooding.

The volatilization treatment method in the control method of the present invention is, for example, spraying the soil for culturing plants with the composition for controlling plant diseases of the present invention and a medium such as a hydroponic medium for culturing plants, seedlings, etc. to volatilize the sprayed composition. It is a method to protect plants from pests and diseases through the plant, and in addition, the plant can be exposed to the volatilized gaseous composition by passing the composition around the plant.

Seed treatment as a control method of the present invention is, for example, a method of treating seeds to be protected from diseases and pests with the composition for controlling plant diseases of the present invention, a specific example of which is atomization of the suspension of the composition for controlling plant diseases of the present invention. a spray treatment method of spraying on the seed surface; a spraying treatment method in which wettable powder, emulsion, glidant, etc. of the composition for controlling plant diseases of the present invention is applied on the surface of seeds by itself or with the addition of a small amount of water; an impregnation treatment method in which seeds are impregnated in a solution of the composition for controlling plant diseases of the present invention for a specific period of time; It includes a film coating treatment method and a pellet coating treatment method.

When plants or soil for plant growth are treated with the strain according to the present invention, the culture solution of the strain, the culture filtrate of the strain, or the fraction of the culture filtrate, the amount of treatment is the type of plant to be treated, the type of pest to be controlled and the frequency of occurrence, It may change depending on the formulation type, treatment period, climatic conditions, and the like.

Emulsions, wettable powders, glidants and the like are usually diluted with water and then applied for treatment. In this case, the concentration of the active ingredient is usually in the range of 0.0001 to 3% by weight, preferably 0.0005 to 1% by weight. Powders, granules and the like are usually used for treatment without dilution.

The control method of the present invention can be used in cultivated or uncultivated land such as rice fields.

Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture solution, its culture filtrate or its fractions are harmless to the human body as a natural product and are biodegradable in the natural world, so they are effective in controlling plant diseases without causing environmental pollution, so they can be developed as environmentally friendly biological pesticides. and can be usefully used in the production of high value-added organic produce.

1 is an image showing the flora of Aspergillus candidus KACC83032BP (SFC20200425-M11) strain according to Example 1.
2 is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) shows a phylogenetic tree based on the results of sequencing of the calmodulin gene of the strain.

Hereinafter, examples will be described in detail.

However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

< Example 1> Aspergillus candidas ( Aspergillus candidus ) KACC83032BP Isolation and identification of (SFC20200425-M11) strain

(One) SFC20200425 -Isolation of the M11 strain

The surface of sandfish ( Arctoscopus japonicus ) eggs collected from Jeongam Beach, Jeongam-ri, Ganghyeon-myeon, Yangyang-gun, Gangwon-do was mixed with artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl ₂ 6H ₂ O 5.48 g, MgSO ₄ 7H ₂ O 7.39 g, CaCl ₂ 1.11 g , NaHCO ₃ 0.2 g, distilled water 1 L) to remove impurities, cut it into about 5 mm length, and add artificial seawater to the PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, artificial sea water 1 L) ), and incubated at 25 ° C for 1 to 2 weeks. Aspergillus candida ( Aspergillus candida), which forms white hyphae with round colonies by pure culture of the formed flora. candidus ) KACC83032BP (SFC20200425-M11) strain was isolated (FIG. 1).

Thereafter, the isolated SFC20200425-M11 strain was immersed in a sterilized 20% glycerol aqueous solution and stored at a temperature of -80°C.

(2) SFC20200425 -Identification of strain M11

For taxonomic identification of the SFC20200425-M11 strain isolated in Example 1, molecular phylogenetic analysis was performed based on the calmodulin gene sequence.

Specifically, the SFC20200425-M11 strain was inoculated into PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and cultured with shaking at 25 ° C. for one week at 150 rpm. Genomic DNA was extracted from the cells obtained by culturing using AccuPrep DNA extraction kit (Bioneer, Daejeon, Korea), and PCR was performed using the extracted DNA as a template.

PCR (polymerase chain reaction) was performed using forward primer CF1D (5′-CAGGTCTCCGAGTACAAG-3′: SEQ ID NO: 2), reverse primer CF4 (5′-CAGGTCTCCGAGTACAAG TTTYTGCATCATRAGYTGGAC-3′: SEQ ID NO: 3) and Ex Taq polymerase (Takara, Otsu, Japan) was used at 94°C for 5 minutes once, 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds 34 times, and 72°C for 7 minutes once. After electrophoresis of the obtained PCR product and purification using an Expin PCR purification kit (GeneAll, Seoul, Korea), a sequencing analysis service (Macrogen, Daejeon, Korea) was requested for sequencing.

Based on the sequenced nucleotide sequence result (SEQ ID NO: 1 below), comparison and analysis were performed with the ITS nucleotide sequences of other strains registered in the NCBI BLASTn database. After aligning the base sequences with the MAFFT program, a neighbor-joining tree was created using the MEGA program with the Kimura 2-parameter model and 1,000 bootstrap method.

[SEQ ID NO: 1]

GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGC TGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTC CATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC

As a result of creating a phylogenetic tree using the above sequence number, the SFC20200425-M11 strain of the present invention is Aspergillus candida ( Aspergillus candidus ) showed high homology (more than 99.4%) with the NRRL 303 strain (FIG. 2).

Based on these analysis results, the SFC20200425-M11 strain was named Aspergillus candidus SFC20200425-M11 strain, and deposited with the National Institute of Agricultural Sciences Microorganism Bank on July 31, 2020 under accession number KACC 83032BP.

< Example 2> Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate plant disease Control effect evaluation

Step 1: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate manufacturing

Aspergillus candida isolated in Example 1 ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain (hereinafter referred to as SFC20200425-M11) was cultured in a sterilized PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1 L), and then formed on the medium Mycelial discs (8 mm in diameter) were prepared by piercing the colonies with a cork borer. Inoculate the mycelial disk into a sterilized PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and incubate with shaking (150 rpm) for 1 week at 25 ° C. Filter the strain culture medium with filter paper (or gauze) to obtain the culture filtrate. manufactured.

Step 2: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate of the composition comprising plant disease Investigation of control activity

Aspergillus candida of the present invention ( Aspergillus candidus ) Rice blast of the composition containing the SFC20200425-M11 strain culture filtrate (pathogen: Magnaporthe oryzae ), tomato gray mold (pathogen: Botrytis ) cinerea ), tomato blight (pathogen: Phytophthora infestans ), wheat red rust (pathogen: Puccinia triticina ), barley powdery mildew (pathogen: Blumeria graminis f. sp. hordei ), and pepper anthracnose (pathogen: Colletotrichum coccodes ) were evaluated in greenhouse conditions.

Specifically, after preparing a composition containing the culture filtrate by adding Tween 20 as a spreading agent to the culture filtrate obtained in step 1 to a concentration of 0.025% (w / v), the composition was prepared for rice, tomato, Wheat, barley and pepper seedlings were sprayed and air-dried for 24 hours, and each pathogen was inoculated. At this time, 4 pots were used for each plant bottle, and each plant was filled with about 80% of potting soil or horticultural potting soil in a plastic pot with a diameter of 4.5 cm, and then the seeds were sown and kept in a greenhouse at 25 ± 5 ° C for 1 week to 80%. Cultivated for 4 weeks was used.

Tomato gray mold, tomato blight, and pepper anthracnose were investigated 3 days after inoculation, wheat red rust and barley powdery mildew 7 days after inoculation, and the lesion area (%) was investigated. Control value (%) was calculated according to the formula.

The untreated group was treated only with Tween 20 at a concentration of 0.025% (w/v) without the culture filtrate.

<expression>

Control value (%) = [1 - (lesion area ratio of treated group / lesion area ratio of untreated group)] × 100

culture filtrate Prevention (%) TGM TLB WLR BPM PAN Aspergillus candidus ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate 82 36 20 25 91

(TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)

As shown in Table 1, the culture filtrate of the SFC20200425-M11 strain of the present invention showed a control effect on tomato gray mold, tomato blight, wheat red rust, barley powdery mildew and pepper anthracnose, in particular, tomato gray mold and pepper anthracnose showed excellent control effects of 82% and 91%, respectively.

< Example 3> Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate fraction including plant disease composition for controlling plant disease Control effect evaluation

Step 1: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate fractional manufacturing

Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) In order to prepare a fraction of the culture filtrate, the same method as in step 1 of Example 1 was performed to Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate was prepared, and solvent fractionation of the culture filtrate of the strain was performed.

Specifically, the culture filtrate of the SFC20200425-M11 strain was put into a separatory funnel, mixed with an equal amount of ethyl acetate, shaken, allowed to stand, and when the layers were separated, an organic solvent layer and an aqueous solution layer were obtained. The same amount of butanol was mixed with the aqueous layer, shaken, allowed to stand, and the organic solvent layer was separated and concentrated under reduced pressure to obtain an ethyl acetate fraction, a butanol fraction, and a water fraction.

Step 2: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate fraction including plant disease Preparation of composition for control

Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) For the plant disease control effect evaluation experiment of the plant disease control composition containing the fractions of the culture filtrate, each fraction obtained in step 1 was prepared at a concentration of 1,000 μg / ml, and the fractions For dissolution, the content of methanol was added to 5%, and Tween 20 as a spreading agent was added to a concentration of 0.025% (w / v) to prepare a composition containing the fraction of the culture filtrate.

Step 3: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate fraction including plant disease composition for controlling plant disease Confirmation of control activity

Rice blast of the composition prepared in step 2 (pathogen: Magnaporthe oryzae ), tomato gray mold (pathogen: Botrytis ) cinerea ), tomato blight (pathogen: Phytophthora infestans ), wheat red rust (pathogen: Puccinia triticina ), barley powdery mildew (pathogen: Blumeria graminis f. sp. hordei ) and pepper anthracnose (pathogen: Colletotrichum coccodes ) were evaluated for plant disease control effects in greenhouse conditions in the same manner as in step 2 of Example 2, and the results are shown in Table 2.

fraction density
(μg/ml) Prevention (%) RCB TGM TLB WLR BPM PAN Ethyl acetate fraction 1,000 56 100 94 73 8 91 butanol fraction 1,000 0 21 0 20 0 0 water fraction 1,000 0 7 0 13 8 61

(RCB, rice blast; TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)

As shown in Table 2, when plants were treated with the ethyl acetate fraction at a concentration of 1,000 μg/ml, control effects were shown against 6 plant diseases, especially against tomato gray mold, tomato late blight, and pepper anthracnose. Excellent control effects of 100%, 94%, and 91% were shown, respectively, and 73% and 56% respectively against wheat rust and rice blast.

On the other hand, the butanol fraction and the water fraction were found to have a control effect only on some plant diseases, showing no significant control effect.

Although the above has been described with reference to preferred embodiments of the present invention, those skilled in the art can variously modify and change the present invention without departing from the spirit and scope of the present invention described in the claims below. You will understand that you can.

National Institute of Agricultural Science Microorganism Bank KACC83032BP 20200731

<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY Seoul National University R&DB Foundation <120> Aspergillus candidus strain and composition for controlling plant diseases comprising the same <130> KRICT18P <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 561 <212> DNA <213> artificial sequence <220> <223> calmodulin (CaM) <400> 1 gtctccgagt acaaggaggc cttctccctc ttcgtaagtc ctccgttcgg ggtgtcctgc 60 accggaagat ggaacggcgc tgatcgcagg tcgtttttgc tcgtgtaaca ggataaggat 120 ggcgatggtt agtactccgt ctggacgatg cgaccggcgt ggatcgattc tgatgatcac 180 gtttctttgc gaacttctta tctgacgtac ggcaggacaa atcaccacca aggagctggg 240 caccgtcatg cggtcgctgg gccagaaccc ctccgagtcg gaactccagg acatgatcaa 300 cgaggttgac gcggacaaca acggcaccat cgatttccct gaattcctca ccatgatggc 360 tcgtaagatg aaggacaccg actcggagga ggagatccgg gaagcgttca aggtctttga 420 tcgcgacaac aacggcttca tctccgccgc ggagctgcgc cacgtcatga cctccatcgg 480 cgagaagctg accgacgacg aggttgacga gatgatccgc gaggccgacc aggacggcga 540 cggccgcatc gactgtactt c 561 <210> 2 <211> 18 <212> DNA <213> artificial sequence <220> <223> CF1D Forward <400> 2 caggtctccg agtacaag 18 <210> 3 <211> 39 <212> DNA <213> artificial sequence <220> <223> CF4 Reverse <400> 3 caggtctccg agtacaagtt tytgcatcat ragytggac 39

Claims (15)

delete Aspergillus candidus KACC83032BP (SFC20200425-M11), its culture solution, its culture filtrate or rice blast containing fractions of the culture filtrate, tomato gray mold, potato / tomato blight, wheat red rust, barley powdery mildew And any one plant disease control composition selected from the group consisting of red pepper anthracnose. According to claim 2,
The plant disease is a composition for controlling plant diseases that is caused by plant pathogenic fungi. According to claim 3,
The phytopathogenic fungus is Botrytis cinerea ( Botrytis cinerea ; Gray Mold Bacteria), Colletotrichum Cocodes ( Colletotrichum coccodes ; Pepper anthracnose), Magnaporthe oryse ( Magnaporthe oryzae ; Rice blast fungus), Puccinia triticina (Wheat red rust fungus), Bloomeria graminis F. esp. Hordei ( Blumeria graminis f. sp. hordei ; A composition for controlling plant diseases that is selected from the group consisting of barley powdery mildew) and Phytophthora infestans (potato / tomato blight). delete According to claim 2,
The fraction is fractionated using an organic solvent selected from the group consisting of water, C ₁ to C ₄ lower alcohol, hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile and combinations thereof, plant A composition for controlling diseases. According to claim 2,
The Aspergillus candida ( Aspergillus candidus ) KACC83032BP, a culture thereof, a culture filtrate thereof, or a fraction of the culture filtrate has a bactericidal activity. According to claim 2,
The Aspergillus candida ( Aspergillus candidus ) KACC83032BP, its culture medium, its culture filtrate or fractions of the culture filtrate is contained in the composition for controlling plant diseases at a concentration of 100 to 3000 μg / ml, the composition for controlling plant diseases. Aspergillus candidus ( Aspergillus candidus ) Cultivating KACC83032BP (SFC20200425-M11) in a medium; rice blast, tomato gray mold, potato / tomato blight, wheat red rust, barley powdery mildew and pepper anthracnose, including Method for producing a composition for controlling any one plant disease selected from the group. According to claim 9,
Aspergillus candida ( Aspergillus candidus ) KACC83032BP inoculated into the medium and then incubated with shaking at 25° C. for 7 days. Aspergillus candidus KACC83032BP (SFC20200425-M11), its culture solution, its culture filtrate or rice blast containing fractions of the culture filtrate, tomato gray mold, potato / tomato blight, wheat red rust, barley powdery mildew And treating plants, their seeds or their habitat with any one plant disease control composition selected from the group consisting of pepper anthracnose; rice blast, tomato gray mold, potato / tomato blight, wheat red rust, A method for controlling any one plant disease selected from the group consisting of barley powdery mildew and pepper anthracnose. The method of claim 11, wherein the control method is carried out by a volatilization treatment method or a seed treatment method. The control method according to claim 11, wherein the control method is to treat the plant disease control composition on the surface of stems and leaves of plants, sterilize seeds and coat or treat the habitat in which plants grow. The method of claim 11, wherein the habitat is a planting hole, a furrow, around a planting hole, around a planting furrow, the entire surface of a growing part, a part between soil and a plant, a part between roots, and a stem of a plant A control method selected from the group consisting of parts, main furrows, growing soil, seedlings, seedling boxes, seedling trays or seedlings. The control method according to claim 11, wherein the treatment is performed during the simulated cultivation period of the composition, before cultivation settlement, during cultivation settlement and after cultivation settlement.

Images