KR102522009B1 - Composition for controlling plant diseases comprising a compound having fungicidal activity derived from Aspergillus candidus strain - Google Patents

Abstract

The present invention provides a composition for controlling plant diseases comprising at least one selected from compounds represented by Formulas 1 to 3, optical isomers thereof, or pharmaceutically acceptable salts thereof.
Aspergillus candida of the present invention ( Aspergillus candidus ) KACC83032BP-derived composition for controlling plant diseases is harmless to the human body as a natural product and is biodegradable in the natural world, so it is effective in controlling plant diseases without causing environmental pollution, so it can be developed as an environmentally friendly biological pesticide. It can be usefully used in the production of high value-added organic products.

Description

Composition for controlling plant diseases comprising a compound having fungicidal activity derived from Aspergillus candidus strain}

The present invention is Aspergillus candida ( Aspergillus candidus ) It relates to a composition for controlling plant diseases comprising a compound having bactericidal activity derived from strains, and specifically Aspergillus candidus ( Aspergillus candidus ) It provides a composition for controlling plant diseases comprising a compound isolated from a fraction of the strain culture filtrate.

Plant diseases are one of the biological hazards that hinder the healthy growth of plants and affect agricultural production by impairing crop yield and quality. If a plant disease occurs in a large-scale cultivation area, crop production is greatly reduced, resulting in great economic losses. Serious social problems can arise.

In modern agriculture, chemical pesticides have been used as a convenient means for controlling various plant diseases and minimizing losses by effectively managing plant diseases within an economic threshold range. However, as a result of increasing agricultural production by relying on chemical pesticides for the past few decades, drug-resistant pathogens and insect pests have emerged, and problems such as concerns over human harm from human and livestock toxicity and ecosystem disturbance due to residual toxicity have arisen. There is a need to develop new plant disease control means to reduce the use of and replace it.

Since the discovery of penicillin from a fungus of the genus Penicillium , microorganisms have been actively used for new drug development as a treasure trove of new antibiotics, and various antibacterial active substances have been isolated from microorganisms. Griseofulvin, first isolated from the ascomycete Penicillium griseofulvum , has attracted attention as a plant disease control agent for its activity of inhibiting the normal spore germination of Botrytis allii , and as an antibiotic. The basidiomycete Crinipellis ryzomaticola, which produces crinipellins , rhizomaticola ) has been reported in various studies suggesting the possibility of controlling plant diseases using microorganisms, such as showing effects on rice blast and pepper anthracnose. In particular, strobilurins or oudemansins, which are produced by various wood-decaying basidiomycetes, are the lead compounds of QoI fungicides sold the most in the global fungicide market. As such, microorganisms can be actively used to develop new crop protection agents.

The present inventors tried to use Aspergillus candidus strains as an environmentally friendly means for controlling plant diseases.

One object of the present invention is to provide a composition for controlling plant diseases comprising at least one selected from compounds represented by Formulas 1 to 3.

Another object of the present invention is to provide a plant disease control method comprising the step of treating a plant, its seed or its habitat with the composition for controlling plant disease.

In order to develop an eco-friendly plant disease control agent, the present inventors investigated the control effects of various plant diseases of various strains, and the following identified from the fractions of Aspergillus candidus KACC83032BP (SFC20200425-M11) culture filtrate It was found that the compounds represented by Formulas 1 to 3, their optical isomers or their pharmaceutically acceptable salts have excellent control effects on various plant diseases.

Terms used in this application are only used to describe specific embodiments and are not intended to limit the present invention. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this application, terms such as “comprise” or “having” are intended to designate that the features, steps, structures, or combinations thereof described above exist in the name, but one or more other features, steps, structures, or these It should be understood that it does not preclude the possibility of existence or addition of combinations.

Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in the present application, they should not be interpreted in an ideal or excessively formal meaning. don't

In the present invention, “Cx-Cy” means having x to y carbon atoms.

In the present invention, "alkyl" means a linear (or straight-chain, linear) saturated hydrocarbon group or a branched (or branched) saturated hydrocarbon group, methyl, ethyl, n-propyl, isopropyl, n-butyl , sec-butyl, isobutyl, tert-butyl, n-pentyl, n-hexyl, and the like.

Aspergillus candidas ( Aspergillus candidus ) KACC83032BP strain, from the strain originated compound, dental optical isomers or its pharmaceutically acceptable containing salt plant disease Composition for control and method for producing the same

In one aspect of the present invention, there is provided a composition for controlling plant diseases comprising at least one selected from compounds represented by Formulas 1 to 3, optical isomers thereof, or pharmaceutically acceptable salts thereof.

[Formula 1]

R ₁ to R ₄ are each independently a hydrogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;

[Formula 2]

In Formula 2,

R ₅ is a hydrogen atom, a halogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ,

R ₆ and R ₇ are each independently a hydrogen atom, -OH, -OC ₁ -C ₆ alkyl, C ₁ -C ₆ alkyl, -C ₁ -C ₆ alkyl-OH or C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl;

n is an integer from 1 to 4;

[Formula 3]

In Formula 3,

또는 -O-C₁-C₆ 알킬이고,X is each independently

or -OC ₁ -C ₆ alkyl;

R ₈ to R ₁₀ are each independently a hydrogen atom, -OH, -OC ₁ -C ₆ alkyl, C ₁ -C ₆ alkyl, -C ₁ -C ₆ alkyl-OH or C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl;

R ₁₁ is a hydrogen atom, a halogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;

m is an integer from 1 to 4;

In the present invention, a composition for controlling plant diseases comprising at least one selected from compounds represented by Formula 1a, Formula 2a, Formula 2b, Formula 3a and Formula 3b, optical isomers thereof, or pharmaceutically acceptable salts thereof to provide.

[Formula 1a]

;

;

[Formula 2a]

;

;

[Formula 2b]

;

;

[Formula 3a]

;

;

[Formula 3b]

.

.

In the present invention, the compound of Formula 1a is (6β,α)-6,9-dihydroxy-6,20-epoxypimara-8(14),15-diene-7,20-dione ((6β ,α)-6,9-Dihydroxy-6,20-epoxypimara-8(14),15-diene-7,20-dione) or sphaeropsidin A.

In addition, Formula 2 may have a Cis-Trans isomer form with a double bond formed by carbons 2 and 3 as shown in the following formula.

Preferably, the compound represented by Formula 2a and the compound represented by Formula 2b are Cis-Trans isomers, and the compound of Formula 2a is Cis-form and the compound of Compound 2b is Trans-form. In addition, the compound represented by Formula 2a and the compound represented by Formula 2b have a chiral center at the 8th carbon position and may include R-form, S-form or racemic compounds, preferably R-form. It can be in the form of -form.

The compound represented by Formula 2a is 1-[(2Z,4E,6E,8R)-8-hydroxy-6-methyldodeca-2,4,6-trienoyl]pyrrolidin-2-one ( It is named 1-[(2Z,4E,6E,8R)-8-hydroxy-6-methyldodeca-2,4,6-trienoyl]pyrrolidin-2-one) or formosusin A, and is represented by the following formula.

[formosusin A]

.

.

In addition, the compound of Formula 2b is 1-[(2E,4E,6E,8R)-8-hydroxy-6-methyldodeca-2,4,6-trienoyl]pyrrolidin-2-one (1 It is named -[(2E,4E,6E,8R)-8-hydroxy-6-methyldodeca-2,4,6-trienoyl]pyrrolidin-2-one) or variotin and is represented by the following chemical formula.

[variotin]

.

.

In addition, the compounds of Chemical Formulas 3a and 3b have chiral centers at the 3rd and 8th carbon positions, so they may include R-form, S-form or racemic compounds, preferably at the 3rd-position carbon atoms. It may be a compound in which is S-form and the carbon at position 8 is R-form.

Preferably, the compound represented by Formula 3a is a novel compound, 1-((3S,4E,6E,8R)-3,8-dihydroxy-6-methyldodeca-4,6-dienoyl)pyrroly It is named din-2-one (1-((3S,4E,6E,8R)-3,8-dihydroxy-6-methyldodeca-4,6-dienoyl)pyrrolidin-2-one) and is represented by the following chemical formula . We named this compound as candidusin I.

[candidusin I]

.

.

In addition, the compound represented by Formula 3b is a novel compound, (3S,4E,6E,8R)-methyl 3,8-dihydroxy-6-methyldodeca-4,6-dienoate ((3S, It was named 4E,6E,8R)-methyl 3,8-dihydroxy-6-methyldodeca-4,6-dienoate and represented by the following chemical formula: We named this compound as candidusin II.

[candidusin II]

.

.

In one aspect of the present invention, there is provided a composition for controlling plant diseases comprising at least one selected from a compound represented by Formula 1, an optical isomer thereof, or a pharmaceutically acceptable salt thereof.

[Formula 1]

In Formula 1,

R ₁ to R ₄ are each independently a hydrogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ .

Preferably, R ₁ and R ₄ may each independently be a hydrogen atom, -OH or C ₁ -C ₆ alkyl, more preferably R1 and R2 are each independently C ₁ -C ₆ alkyl, and R3 and R4 are each independently -OH.

The compound represented by Formula 1 may preferably be a compound represented by Formula 1a below.

[Formula 1a]

.

.

In one aspect of the present invention, there is provided a composition for controlling plant diseases comprising at least one selected from a compound represented by Formula 2, an optical isomer thereof, or a pharmaceutically acceptable salt thereof.

[Formula 2]

In Formula 2,

R ₅ is a hydrogen atom, a halogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ,

R ₆ and R ₇ are each independently a hydrogen atom, -OH, -OC ₁ -C ₆ alkyl, C ₁ -C ₆ alkyl, -C ₁ -C ₆ alkyl-OH or C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl;

n is an integer from 1 to 4;

Preferably, R ₅ is a hydrogen atom, R ₆ and R ₇ are each independently -OH or C ₁ -C ₆ alkyl, more preferably R ₅ is a hydrogen atom, and R ₆ is C ₁ -C ₆ alkyl, R ₇ is -OH, and n is 1.

The compound represented by Formula 2 may most preferably be a compound represented by Formula 2a or Formula 2b below, and the composition of the present invention includes one or more of the compounds represented by Formula 2a or Formula 2b below. can do.

[Formula 2a]

;

;

[Formula 2b]

.

.

In one aspect of the present invention, there is provided a composition for controlling plant diseases comprising at least one selected from a compound represented by Formula 3, an optical isomer thereof, or a pharmaceutically acceptable salt thereof.

[Formula 3]

In Formula 3,

또는 -O-C₁-C₆ 알킬이고,X is each independently

or -OC ₁ -C ₆ alkyl;

R ₈ to R ₁₀ are each independently a hydrogen atom, -OH, -OC ₁ -C ₆ alkyl, C ₁ -C ₆ alkyl, -C ₁ -C ₆ alkyl-OH or C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl;

R ₁₁ is a hydrogen atom, a halogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;

m is an integer from 1 to 4;

Preferably, R ₈ to R ₁₀ are each independently -OH or C ₁ -C ₆ alkyl, more preferably R ₈ and R ₁₀ are -OH, R ₉ is C ₁ -C ₆ alkyl, n is 1.

In addition, R ₁₁ is preferably a hydrogen atom or C ₁ -C ₆ alkyl, more preferably a hydrogen atom.

The compound represented by Formula 3 may most preferably be a compound represented by Formula 3a or Formula 3b below, and the composition of the present invention may include one or more of the compounds represented by Formula 3a or Formula 3b below. can

[Formula 3a]

;

;

[Formula 3b]

.

.

In the present invention, the compound may have a bactericidal activity, and the sterilization may mean physically or chemically destroying all types of microorganisms such as fungi, viruses, and bacteria, and may also be sterilized.

In this specification, "control" is intended to be used in the sense of including removal and death as well as prevention and avoidance of diseases and pests. However, in plant disease control, since the control effect by preventive treatment is the main control mechanism, the control effect of the compounds represented by Formulas 1 to 3 on plant diseases was investigated as a preventive treatment.

In the present invention, all of the compounds that can be included in the composition are derived from natural products, are harmless to the human body, and have excellent control effects against plant diseases caused by phytopathogenic fungi without causing environmental pollution.

Specifically, the plant pathogenic fungi are Botrytis cinerea ( Botrytis cinerea ; Gray mold disease), Colletotrichum coco des ( Colletotrichum coccodes ; Pepper anthracnose), Fusarium oxysporum ( Fusarium oxysporum ; Wilting fungus), Magnaporthe oryzae (rice blast fungus), Puccinia triticina (wheat red rust fungus), Bloomeria gramininis F. esp. Hordei ( Blumeria graminis f. sp. hordei ; barley powdery mildew), Phytophthora infestans (potato/tomato blight), Alternaria brassicicola (Brabaceae crop black blotch), etc. And, preferably Botrytis cinerea ( Botrytis cinerea ; Gray mold fungus), Colletotrichum coccodes (Capsicum anthracnose), Magnaporthe oryzae (rice blast fungus), Puccinia triticina ( Puccinia triticina ; Wheat red rust), Bloomeria graminis F. esp. Hordei ( Blumeria graminis f. sp. hordei ; barley powdery mildew), Phytophthora infestans (potato/tomato blight), but the scope of the present invention is not limited thereto.

In the present invention, the plant disease is preferably rice blast (causative fungus: Magnaporthe oryzae ), tomato gray mold disease (causative fungus: Botrytis cinerea ), tomato blight (causative fungus: Phytophthora infestans ), wheat red rust (causative fungus: Puccinia triticina ), barley powdery mildew (causative fungus: Blumeria graminis f. sp. hordei ), pepper anthracnose (causative bacteria: Colletotrichum coccodes ), but is not limited thereto.

In the present invention, the compounds represented by Formulas 1 to 3 are Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11), and the strain may have the calmodulin (CaM) gene sequence of SEQ ID NO: 1 as follows.

GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTCCATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC(서열번호 1).

In the present invention, the strain is sandfish ( Arctoscopus japonicus ), and specifically, it may be separated from sandfish eggs collected from Jeongam Beach, Jeongam-ri, Ganghyeon-myeon, Yangyang-gun, Gangwon-do.

In the present invention, the strain may have plant disease control activity and bactericidal activity.

In the present invention, the compounds represented by Formulas 1 to 3 are Aspergillus candida (Aspergillus candidus) KACC83032BP (SFC20200425-M11) may be separated from the culture filtrate or a fraction thereof, and the fraction is water, C_One to C₄It can be fractionated using organic solvents such as lower alcohols (eg, methanol, ethanol, propanol, isopropanol, butanol, etc.), hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile, and combinations thereof, , Preferably, the fraction may be prepared using water, methanol, ethanol, propanol, isopropanol, butanol, or ethyl acetate, but the scope of the organic solvent used to prepare the fraction in the present invention is not limited thereto.

In the present invention, using the fractions, compounds were separated and identified to obtain 5 types of compounds having plant disease control effects.

In the present invention, the compound may be included in a concentration of 0.1 to 1000 μg / ml in the composition for controlling plant diseases. The concentration refers to the concentration included in the composition when the plant, its seed or its habitat is treated with a plant disease, and when the concentration is less than 0.1 μg / ml, the concentration of the compound is too low and the control effect of plant disease There is a problem of falling, and if the concentration exceeds 1000 μg / ml, the concentration of the compound is too high than necessary, which is uneconomical and may have a negative impact on the environment. However, the amount of the composition for controlling plant diseases is not limited to the above concentration range, and may be appropriately adjusted in consideration of the type, degree of occurrence, environment, etc. of plant pathogens or plant pathogenic fungi and bacteria.

The composition of the present invention may be a mixture further containing an inert carrier, and a surfactant and It is prepared by adding other necessary auxiliaries. The above-mentioned composition for controlling plant diseases can also be used as a seed treatment agent in the present invention by itself or by adding other inactive ingredients.

In the present invention, examples of the liquid carrier that can be used in the formulation include water; alcohols such as methanol and ethanol; ketones such as acetone and methyl ethyl ketone; aromatic hydrocarbons such as benzene, toluene, xylene, ethylbenzene and methylnaphthalene; aliphatic hydrocarbons such as hexane, cyclohexane, kerosene and light oil; esters such as ethyl acetate and butyl acetate; nitriles such as acetonitrile and isobutyrnitrile; ethers such as diisopropylether and dioxane; acid amides such as N,N-dimethyl formamide and N,N-dimethylacetamide; halogenated hydrocarbons such as dichloromethane, trichloroethane and carbon tetrachloride; dimethyl sulfoxide; and vegetable oils such as soybean oil and cottonseed oil.

Further, examples of solid carriers that can be used in the formulation include fine powders or granules such as minerals such as kaolin clay, attapulgite clay, bentonite, montmorillonite, acid white clay, pyrophyllite, talc, diatomaceous earth and talcite; natural organic substances such as corn stalk meal and walnut husk meal; synthetic organic substances such as urea; salts such as calcium carbonate and ammonium sulfate; synthetic inorganic materials such as synthetic hydrated silicon oxide; As liquid carriers, aromatic hydrocarbons such as xylenes, alkylbenzenes and methylnaphthalenes; alcohols such as 2-propanol, ethylene glycol, propylene glycol and ethylene glycol monoethyl ether; ketones such as acetone, cyclohexanone and isophorone; vegetable oils such as soybean oil and cottonseed oil; petroleum aliphatic hydrocarbons, esters, dimethylsulfoxide, acetonitrile and water.

Further, examples of surfactants include anionic surfactants such as alkyl sulfate ester salts, alkylaryl sulfonate salts, dialkylsulfosuccinate salts, polyoxyethylene alkylaryl ether phosphate ester salts, lignosulfonate salts, and naphthalene sulfonates. nate formaldehyde polycondensate; and nonionic surfactants such as polyoxyethylene alkyl aryl ethers, polyoxyethylene alkylpolyoxypropylene block copolymers and sorbitan fatty acid esters, and cationic surfactants such as alkyltrimethylammonium salts.

Examples of other formulation auxiliaries are water-soluble polymers such as polyvinyl alcohol and polyvinylpyrrolidone, polysaccharides such as gum arabic, alginic acid and its salts, CMC (carboxymethyl-cellulose), xanthan gum, inorganic materials such as aluminum magnesium silicate and alumina sol ( alumina sol), preservatives, colorants and stabilizers such as PAP (acid phosphate isopropyl) and BHT (butylhydroxyltoluene).

In one embodiment of the present invention, the compounds represented by Formulas 1 to 3 are Aspergillus candida ( Aspergillus candidus ) KACC83032BP was isolated from the fraction of the culture filtrate, and it was confirmed through the examples that it had a control effect on plant pathogens, and from this, it can be seen that there is a plant disease control effect.

In one aspect of the present invention, in order to obtain the compounds of Formulas 1 to 3, Aspergillus candida ( Aspergillus candidus ) The fraction of the culture filtrate of KACC83032BP may be prepared by a manufacturing method including the following steps, but is not limited thereto:

For example, Aspergillus candida ( Aspergillus candidus ) The step of preparing the fraction of the culture filtrate of the KACC83032B strain may include the following steps:

1) Aspergillus candida ( Aspergillus candidus ) culturing KACC83032BP in a medium;

2) preparing hyphal discs using the flora formed in the medium of step 1;

3) preparing a strain culture solution by inoculating the mycelial disk of step 2 into a culture medium and culturing with shaking;

4) preparing a culture filtrate by filtering the culture solution prepared in step 3; and

5) preparing fractions by mixing the culture filtrate and the organic solvent and separating the layers.

In the present invention, the medium in step 1 and step 3 is PDA (Potato dextrose agar) medium, MEB (Malt extract broth) medium, PDB (Potato dextrose broth) medium, CDB (Czapek dox broth) medium or SDB (Sabouraud dextrose medium) broth) medium, preferably PDA (Potato dextrose agar) medium or PDB (Potato dextrose broth) medium.

More preferably, PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1L) and artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl ₂ 6H ₂ O 5.48 g, MgSO ₄ 7H ₂ O 7.39 g, CaCl ₂ 1.11 g NaHCO ₃ 0.2 g, distilled water 1 L) may be a PDA (potato starch 4 g, glucose 20 g, agar 15 g, artificial seawater 1 L) medium; It may be a PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and a PDB medium (potato starch 4 g, glucose 20 g, agar 15 g, artificial sea water 1 L) to which artificial seawater is added instead of distilled water.

The organic solvent is water, C ₁ to C ₄ lower alcohol (eg, methanol, ethanol, propanol, isopropanol, butanol, etc.), hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile, combinations thereof and the like, preferably water, methanol, ethanol, propanol, isopropanol, butanol, hexane, or ethyl acetate.

In the present invention, Aspergillus candida ( Aspergillus candidus ) KACC83032BP fractions of the culture filtrate can be separated by thin layer chromatography or liquid chromatography to separate the compounds represented by Chemical Formulas 1 to 3.

The thin layer chromatography is a method of developing and separating substances using a particulate carrier on a support phase as a stationary phase and a solvent as a mobile phase, and the liquid chromatography technique refers to a chromatography technique in which the mobile phase is a liquid, and (column) or in the plane to which the stationary phase is attached. The fraction of the culture filtrate of Aspergillus candidus KACC83032BP of the present invention is not limited as long as it is a solvent fraction, but may be a hexane fraction, a chloroform fraction, or an ethyl acetate fraction, but is not limited thereto. As the mobile phase, organic solvents such as water, hexane, methanol, ethanol, acetonitrile, acetone, chloroform, dichloromethane, and ethyl acetate may be used alone or in combination, and as the stationary phase, silica gel, Diaion HP-20 , RP-18 or Sephadex LH-20 may be used, but is not limited thereto.

The compound represented by any one of Formulas 1 to 3 of the present invention includes not only salts thereof, but also solvates, optical isomers, hydrates, and the like that can be prepared therefrom by conventional methods.

In the present invention, as the “salt” of a compound represented by any one of Formulas 1 to 3, an acid addition salt formed by a free acid is useful. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, phosphorous acid, etc., aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It is obtained from non-toxic organic acids such as dioate, aromatic acids, aliphatic and aromatic sulfonic acids, etc., organic acids such as acetate, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid and the like. These salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, iodide, fluoride , acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, Fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, methoxybenzoate, Phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, βhydroxybutyrate, glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate and the like.

In addition, the acid addition salt can be prepared by a conventional method. For example, a compound represented by any one of Formulas 1 to 3 is dissolved in an organic solvent such as methanol, ethanol, acetone, methylene chloride, acetonitrile, or the like, and an organic acid or It can be prepared by filtering and drying the precipitate produced by adding an inorganic acid, or by distilling the solvent and excess acid under reduced pressure, drying it, and crystallizing it in an organic solvent.

Also, a metal salt can be made using a base. An alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt. In addition, the corresponding salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg, silver nitrate).

In the present invention, the term “optical isomer” includes each R-form, S-form or racemic form.

"Pharmaceutically acceptable salt" of the present invention means a salt commonly used in the pharmaceutical industry, for example, an inorganic ion salt prepared with calcium, potassium, sodium, magnesium, etc., hydrochloric acid, nitric acid, phosphoric acid, bromic acid , inorganic acid salts prepared with iodic acid, perchloric acid and sulfuric acid; Acetic acid, trifluoroacetic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid organic acid salts prepared from acids, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid, and the like; sulfonic acid salts prepared from methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and naphthalenesulfonic acid; amino acid salts made of glycine, arginine, lysine, and the like; and amine salts prepared with trimethylamine, triethylamine, ammonia, pyridine, picoline, etc., but the types of salts meant in the present invention are not limited by these listed salts.

"Hydrate" of the present invention is a compound represented by any one of Formulas 1 to 3 in which water is non-covalently bonded by intermolecular forces, and may contain a stoichiometric or non-stoichiometric amount of water. Specifically, the hydrate may include about 0.25 to about 10 moles of water based on 1 mole of the active ingredient, and more specifically, about 0.5 moles, about 1.5 moles, about 2 moles, about 2.5 moles, about 3 moles, etc., but is not limited thereto.

The "solvate" of the present invention is a compound represented by any one of Formulas 1 to 3 in which a solvent other than water is bound by intermolecular force, and may contain a stoichiometric or non-stoichiometric amount of water. . Specifically, the hydrate may include about 0.25 to about 10 moles of water based on 1 mole of the active ingredient, and more specifically, about 0.5 moles, about 1.5 moles, about 2 moles, about 2.5 moles, about 3 moles, about 5 moles, and the like, but is not limited thereto.

Aspergillus candidas ( Aspergillus candidus ) KACC83032BP containing strain-derived compounds plant disease using a pesticide composition plant disease control method

In another aspect of the present invention, a composition for controlling plant diseases comprising at least one selected from the compounds represented by Formulas 1 to 3, optical isomers thereof, or pharmaceutically acceptable salts thereof is provided to plants, their seeds or their It provides a plant disease control method comprising a; step of treating the habitat.

The treatment may be indirect spraying by spraying the composition directly on the plant, spraying on the soil where the plant is growing, or spraying on the culture medium of the plant.

The control method of the present invention includes treatment of the stem and leaves of the plant, treatment of the place where the plant grows (eg soil), treatment of the seed such as seed sterilization/seed coating, and treatment of the root.

Treatment of stems and leaves with the control method of the present invention may include, in particular, application on plant surfaces, such as for example by spraying stems and leaves. As the treatment of the soil in the control method of the present invention, for example, spraying on the soil, mixing with the soil, spraying the liquid treatment agent into the soil (irrigation of the liquid treatment agent, injection into the soil, dripping of the liquid treatment agent) may be included. Examples of places to be treated are planting holes, furrows, around planting holes, around planting furrows, the entire surface of the growth area, the part between the soil and the plant, the part between the roots, and the part under the stem of the plant. , main furrow, growing soil, seed bed. It includes boxes for growing seedlings, trays for growing seedlings, and seedlings. The treatment may be performed before application, at the time of application, immediately after application, during the simulated cultivation period, before cultivation establishment, during cultivation establishment, and during the growth period after cultivation establishment. In the above-mentioned soil treatment, the active ingredient may be simultaneously applied to the plants, or a solid fertilizer such as a paste fertilizer containing the active ingredient may be applied to the soil. The active ingredient can be mixed in an irrigation liquid, for example injected into an irrigation facility (irrigation tube, irrigation pipe, sprinkler, etc.), mixed into a furrow overflow liquid, or mixed into a water culture medium. can Alternatively, the irrigation liquid and the active ingredient may be pre-mixed and used for treatment by suitable irrigation methods including, for example, the aforementioned irrigation methods and other methods such as sprinkling and flooding.

The volatilization treatment method in the control method of the present invention is, for example, spraying the soil for culturing plants with the composition for controlling plant diseases of the present invention and a medium such as a hydroponic medium for culturing plants, seedlings, etc. to volatilize the sprayed composition. It is a method to protect plants from pests and diseases through the plant, and in addition, the plant can be exposed to the volatilized gaseous composition by passing the composition around the plant.

Seed treatment as a control method of the present invention is, for example, a method of treating seeds to be protected from diseases and pests with the composition for controlling plant diseases of the present invention, a specific example of which is atomization of the suspension of the composition for controlling plant diseases of the present invention. a spray treatment method of spraying on the seed surface; a spraying treatment method in which wettable powder, emulsion, glidant, etc. of the composition for controlling plant diseases of the present invention is applied on the surface of seeds by itself or with the addition of a small amount of water; an impregnation treatment method in which seeds are impregnated in a solution of the composition for controlling plant diseases of the present invention for a specific period of time; It includes a film coating treatment method and a pellet coating treatment method.

When plants or soil for plant growth are treated with the compound according to the present invention, the amount of treatment may vary depending on the type of plant to be treated, the type and frequency of occurrence of pests to be controlled, the type of formulation, the duration of treatment, climatic conditions, and the like.

Emulsions, wettable powders, glidants and the like are usually diluted with water and then applied for treatment. In this case, the concentration of the active ingredient is usually in the range of 0.0001 to 3% by weight, preferably 0.0005 to 1% by weight. Powders, granules and the like are usually used for treatment without dilution.

The control method of the present invention can be used in cultivated or uncultivated land such as rice fields.

Aspergillus candida ( Aspergillus candidus ) KACC83032BP-derived composition for controlling plant diseases is harmless to the human body as a natural product and is biodegradable in the natural world, so it is effective in controlling plant diseases without causing environmental pollution, so it can be developed as an environmentally friendly biological pesticide. It can be usefully used in the production of high value-added organic products.

1 is Aspergillus candida according to Example 1 ( Aspergillus candidus ) This is an image showing the flora of SFC20200425-M11 strain.
2 is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) shows a phylogenetic tree based on the results of sequencing of the calmodulin gene of the strain.
3 is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) is a process diagram for separating the active compound from the fraction of the culture filtrate.
4 is Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) This is a photograph showing the control effects of compound 1a and compound 2a isolated from strains of wheat red rust (WLR), tomato late blight (TLB), and tomato gray mold (TGM) (from the left, untreated group (a ), 125 μg/ml treatment (b), 250 μg/ml treatment (c), 50 μg/ml treatment (d), and control agent treatment (e)).

Hereinafter, examples will be described in detail.

However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

< Example 1> Aspergillus candidas ( Aspergillus candidus ) KACC83032BP Isolation and identification of (SFC20200425-M11) strain

(One) SFC20200425 -Isolation of the M11 strain

The surface of sandfish ( Arctoscopus japonicus ) eggs collected from Jeongam Beach, Jeongam-ri, Ganghyeon-myeon, Yangyang-gun, Gangwon-do was mixed with artificial seawater (NaCl 28.32 g, KCl 0.77 g, MgCl ₂ 6H ₂ O 5.48 g, MgSO ₄ 7H ₂ O 7.39 g, CaCl ₂ 1.11 g , NaHCO ₃ 0.2 g, distilled water 1 L) to remove impurities, cut it into about 5 mm length, and add artificial seawater to the PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, artificial sea water 1 L) ), and incubated at 25 ° C for 1 to 2 weeks. Aspergillus candida ( Aspergillus candida), which forms white hyphae with round colonies by pure culture of the formed flora. candidus ) KACC83032BP (SFC20200425-M11) strain was isolated (FIG. 1).

Thereafter, the isolated SFC20200425-M11 strain was immersed in a sterilized 20% glycerol aqueous solution and stored at a temperature of -80°C.

(2) SFC20200425 -Identification of strain M11

For taxonomic identification of the SFC20200425-M11 strain isolated in Example 1, molecular phylogenetic analysis was performed based on the calmodulin gene sequence.

Specifically, the SFC20200425-M11 strain was inoculated into PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and cultured with shaking at 25 ° C. for one week at 150 rpm. Genomic DNA was extracted from the cells obtained by culturing using AccuPrep DNA extraction kit (Bioneer, Daejeon, Korea), and PCR was performed using the extracted DNA as a template.

PCR (polymerase chain reaction) was performed using forward primer CF1D (5′-CAGGTCTCCGAGTACAAG-3′: SEQ ID NO: 2), reverse primer CF4 (5′-CAGGTCTCCGAGTACAAG TTTYTGCATCATRAGYTGGAC-3′: SEQ ID NO: 3) and Ex Taq polymerase (Takara, Otsu, Japan) was used at 94°C for 5 minutes once, 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds 34 times, and 72°C for 7 minutes once. After electrophoresis of the obtained PCR product and purification using an Expin PCR purification kit (GeneAll, Seoul, Korea), a sequencing analysis service (Macrogen, Daejeon, Korea) was requested for sequencing.

Based on the sequenced nucleotide sequence result (SEQ ID NO: 1 below), comparison and analysis were performed with the ITS nucleotide sequences of other strains registered in the NCBI BLASTn database. After aligning the base sequences with the MAFFT program, a neighbor-joining tree was created using the MEGA program with the Kimura 2-parameter model and 1,000 bootstrap method.

[SEQ ID NO: 1]

GTCTCCGAGTACAAGGAGGCCTTCTCCCTCTTCGTAAGTCCTCCGTTCGGGGTGTCCTGCACCGGAAGATGGAACGGCGCTGATCGCAGGTCGTTTTTGCTCGTGTAACAGGATAAGGATGGCGATGGTTAGTACTCCGTCTGGACGATGCGACCGGCGTGGATCGATTCTGATGATCACGTTTCTTTGCGAACTTCTTATCTGACGTACGGCAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGGTCGCTGGGCCAGAACCCCTCCGAGTCGGAACTCCAGGACATGATCAACGAGGTTGACGCGGACAACAACGGCACCATCGATTTCCCTGAATTCCTCACCATGATGGCTCGTAAGATGAAGGACACCGACTCGGAGGAGGAGATCCGGGAAGCGTTCAAGGTCTTTGATCGCGACAACAACGGCTTCATCTCCGCCGCGGAGCTGCGCCACGTCATGACCTCCATCGGCGAGAAGCTGACCGACGACGAGGTTGACGAGATGATCCGCGAGGCCGACCAGGACGGCGACGGCCGCATCGACTGTACTTC

As a result of creating a phylogenetic tree using the above sequence number, the SFC20200425-M11 strain of the present invention is Aspergillus candida ( Aspergillus candidus ) showed high homology (more than 99.4%) with the NRRL 303 strain (FIG. 2).

Based on these analysis results, the SFC20200425-M11 strain was named Aspergillus candidus SFC20200425-M11 strain, and deposited with the National Institute of Agricultural Sciences Microorganism Bank on July 31, 2020 under accession number KACC 83032BP.

< Example 2> Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate plant disease Control effect evaluation

Step 1: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate manufacturing

Aspergillus candida isolated in Example 1 ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain (hereinafter referred to as SFC20200425-M11) was cultured in a sterilized PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1 L), and then formed on the medium Mycelial discs (8 mm in diameter) were prepared by piercing the colonies with a cork borer. Inoculate the mycelial disk into a sterilized PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) and incubate with shaking (150 rpm) for 1 week at 25 ° C. Filter the strain culture medium with filter paper (or gauze) to obtain the culture filtrate. manufactured.

Step 2: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate of the composition comprising plant disease Investigation of control activity

Aspergillus candida of the present invention ( Aspergillus candidus ) Rice blast of the composition containing the SFC20200425-M11 strain culture filtrate (pathogen: Magnaporthe oryzae ), tomato gray mold (pathogen: Botrytis ) cinerea ), tomato blight (pathogen: Phytophthora infestans ), wheat red rust (pathogen: Puccinia triticina ), barley powdery mildew (pathogen: Blumeria graminis f. sp. hordei ), and pepper anthracnose (pathogen: Colletotrichum coccodes ) were evaluated in greenhouse conditions.

Specifically, after preparing a composition containing the culture filtrate by adding Tween 20 as a spreading agent to the culture filtrate obtained in step 1 to a concentration of 0.025% (w / v), the composition was prepared for rice, tomato, Wheat, barley and pepper seedlings were sprayed and air-dried for 24 hours, and each pathogen was inoculated. At this time, 4 pots were used for each plant bottle, and each plant was filled with about 80% of potting soil or horticultural potting soil in a plastic pot with a diameter of 4.5 cm, and then the seeds were sown and kept in a greenhouse at 25 ± 5 ° C for 1 week to 80%. Cultivated for 4 weeks was used.

Tomato gray mold, tomato blight, and pepper anthracnose were investigated 3 days after inoculation, wheat red rust and barley powdery mildew 7 days after inoculation, and the lesion area (%) was investigated. Control value (%) was calculated according to the formula.

The untreated group was treated only with Tween 20 at a concentration of 0.025% (w/v) without the culture filtrate.

<expression>

Control value (%) = [1 - (lesion area ratio of treated group / lesion area ratio of untreated group)] × 100

[Table 1]

(TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)

As shown in Table 1, the culture filtrate of the SFC20200425-M11 strain of the present invention showed a control effect on tomato gray mold, tomato blight, wheat red rust, barley powdery mildew and pepper anthracnose, in particular, tomato gray mold and pepper anthracnose showed excellent control effects of 82% and 91%, respectively.

< Example 3> Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) strain culture filtrate fraction including plant disease composition for controlling plant disease Control effect evaluation

Step 1: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate fractional manufacturing

Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) In order to prepare a fraction of the culture filtrate, the same method as in step 1 of Example 1 was performed to Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate was prepared, and solvent fractionation of the culture filtrate of the strain was performed.

Specifically, the culture filtrate of the SFC20200425-M11 strain was put into a separatory funnel, mixed with an equal amount of ethyl acetate, shaken, allowed to stand, and when the layers were separated, an organic solvent layer and an aqueous solution layer were obtained. The same amount of butanol was mixed with the aqueous layer, shaken, allowed to stand, and the organic solvent layer was separated and concentrated under reduced pressure to obtain an ethyl acetate fraction, a butanol fraction, and a water fraction.

Step 2: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate fraction including plant disease Preparation of composition for control

Aspergillus candida ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) For the plant disease control effect evaluation experiment of the plant disease control composition containing the fractions of the culture filtrate, each fraction obtained in step 1 was prepared at a concentration of 1,000 μg / ml, and the fractions For dissolution, the content of methanol was added to 5%, and Tween 20 as a spreading agent was added to a concentration of 0.025% (w / v) to prepare a composition containing the fraction of the culture filtrate.

Step 3: Aspergillus candidas ( Aspergillus candidus ) KACC 83032BP (SFC20200425-M11) culture filtrate fraction including plant disease composition for controlling plant disease Confirmation of control activity

Rice blast of the composition prepared in step 2 (pathogen: Magnaporthe oryzae ), tomato gray mold (pathogen: Botrytis ) cinerea ), tomato blight (pathogen: Phytophthora infestans ), wheat red rust (pathogen: Puccinia triticina ), barley powdery mildew (pathogen: Blumeria graminis f. sp. hordei ) and pepper anthracnose (pathogen: Colletotrichum coccodes ) were evaluated for plant disease control effects in greenhouse conditions in the same manner as in step 2 of Example 2, and the results are shown in Table 2.

[Table 2]

(RCB, rice blast; TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)

As shown in Table 2, when plants were treated with the ethyl acetate fraction at a concentration of 1,000 μg/ml, control effects were shown against 6 plant diseases, especially against tomato gray mold, tomato late blight, and pepper anthracnose. Excellent control effects of 100%, 94%, and 91% were shown, respectively, and 73% and 56% respectively against wheat rust and rice blast.

On the other hand, the butanol fraction and the water fraction were found to have a control effect only on some plant diseases, showing no significant control effect.

From the above results, Aspergillus candida ( Aspergillus candidus ) KACC83032BP It was confirmed that the antibacterial active compound contained in the culture filtrate was a non-polar substance, not a water-soluble substance, and the ethyl acetate fraction showed excellent overall control activity against several plant diseases, making them suitable for separation and purification of bactericidal active components. used

< Example 4> plant disease Isolation of compounds with control activity

Aspergillus candida of the present invention ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) strain was cultured in PDA medium (potato starch 4 g, glucose 20 g, agar 15 g, distilled water 1 L), and then the flora formed on the medium was punctured with a cork borer to form hyphal discs (diameter 8). mm) was prepared. A 2 L-erlenmeyer flask filled with 400 mL of PDB medium (potato starch 4 g, glucose 20 g, distilled water 1 L) was completely blocked and sterilized, and 20 mycelial disks per flask were inoculated. After inoculation, shaking culture (150 rpm) at 25 ° C for 7 days to prepare a strain culture solution. The prepared culture medium (3.6 L) was filtered through a filter paper (or gauze) to prepare a culture filtrate, and an ethyl acetate fraction (370 mg) was prepared in the same manner as in Example 3, step 1.

In order to separate the bactericidal active compound from the obtained ethyl acetate fraction (370 mg), Compound 1a, Compound 2a, Compound 2b, Compound 3a and Compound 3b were separated by the process shown in FIG. 3 .

Specifically, the ethyl acetate fraction was placed on a silica gel column, eluted with hexane: ethyl acetate (3: 1, v/v) and fractionated into E1 to E5, and recrystallization was used to obtain compound 1a ( 50.8 mg) and compound 2a (34.5 mg) were separated. The E5 fraction was added to a preparative thin layer chromatography plate and developed 4 times with hexane:ethylacetate (65:35, v/v) to separate E51 to E55, and compound 3a (13.2 mg) was isolated from the E55 fraction. The E52 fraction was loaded on a Shimadzu LC-6AD high-performance liquid chromatography system equipped with an Agilent Polaris C18-A (250 × 21.2 mm, 5 μm) column and eluted with a 68% methanol aqueous solution at a flow rate of 5 mL per minute to finally obtain compound 2b ( 1.5 mg) and compound 3b (1.0 mg) were separated (FIG. 3).

< Example 5> Identification of the chemical structure of the bactericidal active compound

In order to investigate the chemical structure of the bactericidal active compound isolated in Example 4, the following experiment was performed.

Specifically, Aspergillus candida ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) Nuclear magnetic resonance (NMR) and mass spectroscopy (MS) were mainly used to investigate the chemical structure of the compound isolated from the culture filtrate fraction. The isolated compound 2a was dissolved in CD ₃ OD (99.8 atom % D; Cambridge Isotope Laboratories, Andover, MA, USA), and the remaining isolated compound was dissolved in chloroform- d (99.96 atom % D; Cambridge Isotope Laboratories, Andover, MA, USA). ) and obtained ¹ H- and ¹³ C-NMR spectra using a Bruker Avance 500 MHz nuclear magnetic resonance apparatus. Based on the TMS (tetramethylsilane) peak added to the NMR solvent, the chemical shift value was expressed as δ ( ppm). In addition, the chemical formula of the novel compound isolated using a high-resolution mass spectrometer (Synapt G2 HRMS Q-TOF) was completed.

<5-1> Identification of the chemical structure of compound 1a

The NMR analysis results of Compound 1a isolated in Example 4 are summarized in Table 3 below.

[Table 3] NMR spectrum of Compound 1a (500 MHz, CDCl ₃ )

As shown in Table 3, the ¹ H- and ¹³ C-NMR spectrum of Compound 1a was consistent with the NMR data of a compound known as sphaeropsidin A, a pimaran diterpene-based compound. It was identified as sphaeropsidin A of Formula 1a below.

[Formula 1a]

.

.

<5-2> Identification of the chemical structure of compound 2a

The NMR analysis results of Compound 2a isolated in Example 4 are summarized in Table 4 below.

[Table 4] NMR spectrum of compound 2a (500 MHz, CD ₃ CD)

As can be seen in Table 4, the ¹ H- and ¹³ C-NMR spectra of Compound 2a were consistent with the NMR data of a compound known as formosusin A, and Compound 2a was identified as formosusin A of Formula 2a below. .

[Formula 2a]

.

.

<5-3> Identification of the chemical structure of compound 2b

The NMR analysis results of Compound 2b isolated in Example 4 are summarized in Table 5 below.

[Table 5] NMR spectrum of compound 2b (500 MHz, CDCl ₃ )

As can be seen in Table 5, the ¹ H- and ¹³ C-NMR spectra of compound 2b were consistent with the NMR data of a compound known as variotin, and thus compound 2b was identified as variotin of Formula 2b below.

[Formula 2b]

.

.

<5-4> Identification of the chemical structure of compound 3a

The NMR analysis results of Compound 3a isolated in Example 4 are summarized in Table 6 below.

[Table 6] NMR spectrum of compound 3a (500 MHz, CDCl ₃ )

Compound 3a was detected as a cation of m/z 332.1833 [M + Na] ⁺ in HRESIMS, and the chemical formula is C ₁₇ H ₂₇ NO ₄ (Calculated m/z 332.1838). The ¹ H- and ¹³ C-NMR spectra of compound 3a shown in Table 6 were compared and analyzed with the data shown in the literature, and it was presumed to be a derivative compound of formosusin A, and the chemical structure was determined through 2D NMR analysis. was named candiducin I.

In the ¹³ C-NMR spectrum of compound 3a, three carbonyl carbons ( δ _C 175.8, 173.1, 167.2), 3 quaternary sp ² carbons ( δ _C 168.3, 131.7, 111.1), 3 quaternary sp ³ carbons ( δ _C 85.8, 74.6, 69.2), 5 methine sp ² carbons ( δ _C 144.8, 140.6, 134.2, 132.3, 119.3), four methine sp ³ carbons ( δ _C 84.1, 70.3, 67.1, 41.4), two methylene sp ³ carbons ( δ _C 38.0, 34.4), and two methyl sp ³ carbons ( δ _C 14.1, 13.0). Coupling constants of hydrogen signals H-8 ( δ _H 5.69) and H-9 ( δ _H 6.27) were 15.7 Hz, indicating a trans- double bond. The hydrogen signal H-8 ( δ _H 5.69) correlates with C-7 ( δ _C 68.7) and HMBC, and the hydrogen signal H-7 ( δ _H 4.66) correlates with C-5 ( δ _C 173.1), C-8 ( δ _C 129.5) and C-9 ( δ _C 135.0) showed HMBC correlations, and the hydrogen signals of H-6 ( δ _H 3.12) showed C-5 ( δ _C 173.1) and C-7 ( δ _C 68.7 ) and HMBC correlation.

Based on these results, the chemical structure of the novel compound 3a was identified as a novel compound in which the trans -double bond at position 6 in the chemical structure of formosusin A was hydrated, and was named candiducin I.

In addition, the stereochemical structures of the C-3 and C-8 positions of the novel compound candiducin I were determined using the NOESY experiment and the Mosher method. In the NOESY experiment, the H-9 hydrogen signal correlated with H-7 and H-11, and the H-17 hydrogen signal with H-8 and H-12. In addition, the R / S conformation obtained by reacting α -methoxy-α-(trifluoromethyl)phenylacetyl chloride (MTPA) in the form of R -(-)- or S -(+)- with the secondary alcohol group of the novel compound 3a using the Mosher method Analysis of ¹ H-NMR and ¹ H— ¹ H COZY data of isomeric compounds revealed positive Δ d _H values (Δ d _H = d _S - d _R ) for H-8 and H-9, and H-2 , negative ΔdH values appeared in H-3, H-4 and H-6, and positive ΔdH _{values appeared} in H-13, H-14, H-15 and H-16, Negative ΔdH values appeared at H-11 _.

Based on these results, the stereochemical structures of C-7 and C-12 of the novel compound candiducin I were determined as S - and R - configurations, respectively. In the novel compound candiducin I, the carbon at position 3 is in S-form and the carbon at position 8 is in R-form, and candiducin I is represented by Equation 3a below.

[Formula 3a]

.

.

<5-5> Identification of the chemical structure of compound 3b

The NMR analysis results of Compound 3b isolated in Example 4 are summarized in Table 7 below.

[Table 7] NMR spectrum of compound 3b (500 MHz, CDCl ₃ )

Compound 3b was detected as a cation of m/z 279.1569 [M + Na] ⁺ in HRESIMS, and the chemical formula is C ₁₄ H ₂₄ O ₄ (Calculated m/z 279.1572). The ¹ H- and ¹³ C-NMR spectra of Compound 3b shown in Table 7 were compared and analyzed with the data of Compound 3a shown in Table 6 above, and it was judged to be a novel compound that is another derivative of formosusin A, and through 2D NMR analysis The chemical structure of compound 3b was determined. In the ¹³ C-NMR spectrum of compound 3b, one carbonyl carbon ( δ _C 172.8), 1 quaternary methine sp ² carbon ( δ _C 134.5), 2 methine sp ² carbons ( δ _C 135.8, 135.6), two methine sp ³ carbons ( δ _C 69.1, 68.7), four methylene sp ³ carbons ( δ _C 41.5, 37.4, 27.6, 22.8), and three methyl sp ³ carbons ( δ _C 52.0, 14.2, 13.1). When compared with the NMR data of candidusin I, the signal corresponding to the pyrrolidi-2-none ring structure disappeared in the NMR spectrum of compound 3b, and a new O-methyl signal ( δ _H 3.73; δ _C 52.0) was confirmed to appear. O-methyl hydrogen signal in HMBC analysis ( δ _H 3.73) and C-1 ( δ _C 172.8). Based on these results, the chemical structure of compound 3b (new compound) was determined as the chemical structure in which the pyrrolidi-2-none ring was substituted with O-methyl in the chemical structure of candidusin I, and compound 3b was named candidusin II. Same as 3b.

[Formula 3b]

.

.

< Example 6> Variety to plant pathogens Antibacterial activity evaluation of isolated compounds 1a, 2a, 2b, 3a and 3b against

In order to investigate the bactericidal activity spectrum of the compounds 1a, 2a, 2b, 3a and 3b isolated in Example 5 against plant pathogens, the following experiments were performed, and the results are shown in Tables 8 and 9.

Specifically, plant pathogenic fungi as plant pathogenic cabbage black spot blight ( Alternaria brassicicola ), gray mold blight ( Botrytis cinerea ), pepper anthracnose ( Colletotrichum coccodes ), wilt bacteria ( Fusarium oxysporum ), rice blast bacteria ( Magnaporthe oryzae ), potato / tomato blight bacteria ( Phytophthora infestans ) were prepared.

After culturing each fungus, the fungi were prepared to have a spore concentration of 1.0×10 ⁴ spores/ml, and then 99 μl of them were added to each well of a 96-well plate. Then, 1 μl of compounds 1a, 2a, 2b, 3a, and 3b isolated in Experimental Example 5 was added to each concentration of 0.25, 0.5, 1, 2, 4, 8, 16, 31, 63, 125, and 250 μg/ml. Each well was treated so that At this time, the content of methanol was less than 1%, and only 1% methanol was used as an untreated section. The 96-well plate was incubated at 20 ° C to 25 ° C for 2 to 3 days, and then, when observed with the naked eye, the minimum inhibitory concentration (MIC) value, which is the minimum concentration at which the growth of the fungus was completely inhibited, was determined.

Table 8: Minimum inhibitory concentration (MIC) of compounds 1a, 2a, 2b, 3a and 3b against phytopathogenic fungi

(Compound 1a, sphaeropsidin A; Compound 2a, formosusin A; Compound 2b, variotin; Compound 3a, candiducin I; Compound 3b, candiducin II)

As confirmed in Table 8, the pimaran diterpene compound sphaeropsidin A (Compound 1a) is a potato/tomato bacillus ( Phytophthora infestans ) at a concentration of 0.25 μg / ml, and showed very strong activity that completely inhibits the growth, and in the concentration range of 8 to 16 μg / ml, cabbage black spot ( Alternaria brassicicola ) and pepper anthrax ( C. coccodes ) showed strong activity to completely inhibit the growth.

Formosusin A (Compound 2a) is an anthracnose of pepper ( Colletotrichum coccodes ) showed very strong bactericidal activity (MIC = 1 μg / ml), and in the concentration range of 4 to 16 μg / ml, cabbage black spot ( Alternaria brassicicola ), gray mold bacteria ( Botrytis cinerea ), wilt bacteria ( Fusarium oxysporum ) and rice blast fungus ( Magnaporthe oryzae ) exhibited a wide spectrum of bactericidal activity that completely inhibited the growth.

Variotin (Compound 2b) is a cabbage black blotch disease ( Alternaria brassicicola ), gray mold disease ( Botrytis ) in the concentration range of 4 to 16 μg / ml cinerea ) and pepper anthracnose ( Colletotrichum coccodes ) showed bactericidal activity.

Candiducin I (compound 3a) and candiducin II (compound 3b) showed bactericidal activity in the concentration range of 250 μg/ml or more.

< Experimental example 7> of compound 1a and compound 2a to plant disease Evaluation of control effect on

In order to investigate the in vivo plant disease control activity of compound 1a (sphaeropsidin A) and compound 2b (formosusin A) among the five isolated compounds obtained in Example 5, the following experiment was performed. The results are shown in Table 9, Table 10 and FIG. 4 below.

Specifically, rice blast (causative fungus: Magnaporthe oryzae ), tomato gray mold (causative fungus: Botrytis) cinerea ), tomato blight (causative fungus: Phytophthora infestans ), wheat red rust (causative fungus: Puccinia triticina ), barley powdery mildew (causative fungus: Blumeria graminis f. sp. hordei ), pepper anthracnose (causative fungus: Colletotrichum The control effects of spheropsidin A and formosusin A against plant diseases against coccodes ) were evaluated under greenhouse conditions.

Example 3, except that compound 1a (sphaeropsidin A) and compound 2a (formosusin A) were dissolved in methanol and then 250 μg/ml Tween 20 solution was added to adjust the final concentration to 125, 250, or 500 μg/ml. The control effect on plant diseases was investigated in the same way as in . At this time, the final methanol concentration of all samples was tested at 5%, and a solution containing 5% methanol and 250 μg/ml of Tween 20 was used as the untreated group.

[Table 9] Plant disease control effect of compound 1a (= sphaeropsidin A)

(RCB, rice blast; TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)

[Table 10] Plant disease control effect of Compound 2a (= formosusin A)

(RCB, rice blast; TGM, tomato gray mold; TLB, tomato blight; WLR, wheat red rust; BPM, barley powdery mildew; PAN, pepper anthracnose)

As shown in Tables 9 and 10 and FIG. 4, compound 1a (sphaeropsidin A) was an excellent plant that controlled 94% of tomato blight at a concentration of 125 μg/ml and 83% of wheat red rust at a concentration of 250 μg/ml. showed disease control efficacy. These results were consistent with the test results showing the MIC value (0.25 μg/ml) of spheropsidin A against blight blight.

In addition, compound 2a (Formosusin A) exhibited in vivo bactericidal activity at a concentration of 500 μg/ml, reducing tomato gray mold and wheat rust by 82% and 60%, respectively, compared to the untreated group.

Although the above has been described with reference to preferred embodiments of the present invention, those skilled in the art can variously modify and change the present invention without departing from the spirit and scope of the present invention described in the claims below. You will understand that you can.

Agricultural Biotechnology Research Institute KACC83032BP 20200731

<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY <120> Composition for controlling plant diseases comprising a compound having fungicidal activity derived from Aspergillus candidus strain <130> KRICT1.7P <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 561 <212> DNA <213> artificial sequence <220> <223> calmodulin (CaM) <400> 1 gtctccgagt acaaggaggc cttctccctc ttcgtaagtc ctccgttcgg ggtgtcctgc 60 accggaagat ggaacggcgc tgatcgcagg tcgtttttgc tcgtgtaaca ggataaggat 120 ggcgatggtt agtactccgt ctggacgatg cgaccggcgt ggatcgattc tgatgatcac 180 gtttctttgc gaacttctta tctgacgtac ggcaggacaa atcaccacca aggagctggg 240 caccgtcatg cggtcgctgg gccagaaccc ctccgagtcg gaactccagg acatgatcaa 300 cgaggttgac gcggacaaca acggcaccat cgatttccct gaattcctca ccatgatggc 360 tcgtaagatg aaggacaccg actcggagga ggagatccgg gaagcgttca aggtctttga 420 tcgcgacaac aacggcttca tctccgccgc ggagctgcgc cacgtcatga cctccatcgg 480 cgagaagctg accgacgacg aggttgacga gatgatccgc gaggccgacc aggacggcga 540 cggccgcatc gactgtactt c 561 <210> 2 <211> 18 <212> DNA <213> artificial sequence <220> <223> CF1D Forward <400> 2 caggtctccg agtacaag 18 <210> 3 <211> 39 <212> DNA <213> artificial sequence <220> <223> CF4 Reverse <400> 3 caggtctccg agtacaagtt tytgcatcat ragytggac 39

Claims (16)

A composition for controlling plant diseases comprising at least one selected from compounds represented by Formulas 1, 2a and 3, optical isomers thereof, or pharmaceutically acceptable salts thereof:
[Formula 1]

R ₁ to R ₄ are each independently a hydrogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;
[Formula 2a]

[Formula 3]

In Formula 3,
X is

or -OC ₁ -C ₆ alkyl;
R ₈ to R ₁₀ are each independently a hydrogen atom, -OH, -OC ₁ -C ₆ alkyl, C ₁ -C ₆ alkyl, -C ₁ -C ₆ alkyl-OH or C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl;
R ₁₁ is a hydrogen atom, a halogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;
m is an integer from 1 to 4; According to claim 1,
A composition for controlling plant diseases comprising at least one selected from compounds represented by Formulas 1a, 2a, 3a and 3b, optical isomers thereof, or pharmaceutically acceptable salts thereof:
[Formula 1a]

;
[Formula 2a]

;
[Formula 3a]

;
[Formula 3b]

. According to claim 1,
The compound is a composition for controlling plant diseases that has a bactericidal activity. According to claim 1,
The plant disease is a composition for controlling plant diseases that is caused by plant pathogenic fungi. According to claim 4,
The phytopathogenic fungus is Botrytis cinerea ( Botrytis cinerea ; Gray Mold Bacteria), Colletotrichum Cocodes ( Colletotrichum coccodes ; Pepper anthracnose), Fusarium oxysporum ( Fusarium oxysporum ; Wilt fungus), Magnaporthe oryzae (rice blast fungus), Puccinia triticina ( Puccinia triticina ; Wheat red rust), Bloomeria graminis F. esp. Hordei ( Blumeria graminis f. sp. hordei ; barley powdery mildew), Phytophthora infestans (potato/tomato blight) and Alternaria brassicicola (Brabaceae crop black blotch) A composition for controlling plant diseases that is selected from the group. According to claim 1,
The plant disease is any one selected from the group consisting of rice blast, tomato gray mold, potato / tomato blight, wheat red rust, barley powdery mildew, pepper anthracnose, brassica crop black blotch, and wilt, for controlling plant diseases composition. According to claim 1,
The compounds represented by Formulas 1, 2a and 3 are Aspergillus candidus ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11), a composition for controlling plant diseases that is derived from. According to claim 1,
Compounds represented by Formulas 1, 2a and 3 are Aspergillus candidus ( Aspergillus candidus ) KACC83032BP (SFC20200425-M11) separated from the culture filtrate or a fraction thereof, a composition for controlling plant diseases. According to claim 8,
The fraction is fractionated using an organic solvent selected from the group consisting of water, C ₁ to C ₄ lower alcohol, hexane, chloroform, methylene chloride, ethyl acetate, acetone, acetonitrile and combinations thereof, plant A composition for controlling diseases. According to claim 1,
The compound is contained in the composition for controlling plant diseases at a concentration of 0.1 to 1000 μg / ml, the composition for controlling plant diseases. A compound represented by Formulas 1, 2a and 3, an optical isomer thereof, or a pharmaceutically acceptable salt thereof, comprising a composition for controlling plant diseases comprising at least one member selected from plants, their seeds or their habitats; Plant disease control methods comprising:
[Formula 1]

R ₁ to R ₄ are each independently a hydrogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;
[Formula 2a]

[Formula 3]

In Formula 3,
X is

or -OC ₁ -C ₆ alkyl;
R ₈ to R ₁₀ are each independently a hydrogen atom, -OH, -OC ₁ -C ₆ alkyl, C ₁ -C ₆ alkyl, -C ₁ -C ₆ alkyl-OH or C ₁ -C ₆ alkyl-OC ₁ -C ₆ alkyl;
R ₁₁ is a hydrogen atom, a halogen atom, -OH, C ₁ -C ₆ alkyl or -OC ₁ -C ₆ ;
m is an integer from 1 to 4; According to claim 11,
A method for controlling plant diseases comprising at least one selected from compounds represented by Formulas 1a, 2a, 3a and 3b, optical isomers thereof, or pharmaceutically acceptable salts thereof:
[Formula 1a]

;
[Formula 2a]

;
[Formula 3a]

;
[Formula 3b]

. According to claim 11,
Wherein the control method is carried out by a volatilization treatment method or a seed treatment method. According to claim 11,
The control method is to treat the plant disease control composition on the surface of the stem and leaf surface of the plant, seed sterilization and coating or to treat the habitat in which the plant grows, the control method. According to claim 11,
The habitats are planting holes, furrows, around planting holes, around planting furrows, the entire surface of the growth area, the part between the soil and the plant, the part between the roots, the part under the stem of the plant, the main furrow, the growth A control method selected from the group consisting of soil, seedlings, boxes for growing seedlings, trays for growing seedlings, or seedlings. According to claim 11,
Wherein the treatment is carried out during the simulated cultivation period of the composition, before cultivation settlement, during cultivation settlement and after cultivation settlement, the control method.

Images