KR102507377B1 - Multiplex primer for detection of salmonella and uses thereof - Google Patents

Abstract

The present invention relates to a composition for multiple detection of Salmonella, a kit, a detection method and a screening method using the same.

Description

Multiplex primer for detection of Salmonella and its use {MULTIPLEX PRIMER FOR DETECTION OF SALMONELLA AND USES THEREOF}

The present invention relates to a composition for multiple detection of Salmonella, a kit, a detection method and a screening method using the same.

Food poisoning refers to symptoms caused by ingesting food contaminated with pathogenic bacteria, toxins, viruses, parasites, chemicals, natural toxins, etc. The main symptoms include abdominal pain, nausea, vomiting, diarrhea, fever, headache, fatigue, hives, etc. includes Microbial food poisoning is divided into bacterial food poisoning and viral food poisoning, and bacterial food poisoning is divided into toxin type and infectious type. Causative bacteria of toxin-type food poisoning include Staphylococcus aureus, Bacillus cereus bacteria, and Clostridium bacteria, and pathogenic bacteria of infection-type food poisoning include Escherichia coli, Vibrio enteritis, Salmonella bacteria, and Shigella bacteria.

Salmonella ( Salmonella spp. ) Bacteria are typical pathogenic microorganisms that cause food poisoning as the causative bacteria of typhoid fever and paratyphoid belonging to group 1 statutory infectious diseases. Salmonella is classified into more than 2,800 serotypes as gram-negative, asporogenic, facultative anaerobic bacilli, but among them, the representative strain causing food poisoning is Salmonella Enterica ( Salmonella. Enterica ), which accounts for about 50% of disease occurrence. In particular, Salmonella enterica subspecies. Enterica I ( Salmonella. enterica subsp . enterica I) accounts for 99% of all human Salmonella infections.

According to the food poisoning occurrence status by causative bacteria (2002-2014) data from the food poisoning statistics system of the Ministry of Food and Drug Safety, a total of 9,488 patients with food poisoning caused by Salmonella were 1,065 in 2011, 690 in 2013, and 1,416 in 2014. There is an increasing trend by name.

Accordingly, there is a need for the development of a method for detecting Salmonella bacteria with high accuracy capable of rapidly identifying genus, subspecies, and serotype levels.

Korean Patent Registration No. 10-1496835

An object of the present invention is to provide a composition for detecting Salmonella spp .

Another object of the present invention is to provide a kit for detecting Salmonella containing the composition for detection.

Another object of the present invention is to provide a biochip for detecting Salmonella containing the composition for detection.

Another object of the present invention is to provide a method for identifying Salmonella present in a target sample using the composition for detection.

Another object of the present invention is to provide a screening method for a sample containing Salmonella using the composition for detection.

One aspect of the present invention is a first primer pair comprising the nucleotide sequences of SEQ ID NOs: 1 to 5; a second primer pair comprising the nucleotide sequences of SEQ ID NOs: 6 to 10; a third primer pair comprising the nucleotide sequences of SEQ ID NOs: 11 to 15; It relates to a composition for detecting Salmonella spp. , comprising a primer set consisting of one or more primer pairs selected from the group consisting of.

In the present invention, "primer pair" is a term that generally refers to a combination of forward and reverse primers at the same time, and a primer pair used in loop-mediated isothermal amplification (LAMP) includes two external primers. (forward outer primer and reverse outer primer), two inner primers (forward inner primer and reverse inner primer) and one or two loop primers (forward loop primer and/or reverse loop primer) at the same time. The “primer set” is used as a term referring to a plurality of primer pair bundles composed of one or more selected from the first to third primer pairs.

The design of primer pairs is subject to various constraints, such as A, G, C, and T content ratios, prevention of primer dimer formation, and primer binding temperature. In addition, conditions such as the amount of template DNA, the concentration of primers, the concentration of dNTP, the concentration of Mg ²⁺ , reaction temperature, and reaction time should be appropriate.

The primer is a short nucleic acid sequence containing a free 3' hydroxyl group, capable of forming base pairs with a complementary nucleic acid template, and copying a strand of the nucleic acid template. can serve as a starting point for

The primers can initiate DNA synthesis in the presence of reagents for polymerization and four different nucleoside triphosphates at an appropriate buffer solution and temperature, and hybridize with nucleic acids present in the target material to generate a specific gene of the target material. can be used to amplify.

The primers may specifically be single-stranded in consideration of amplification efficiency, may be deoxyribonucleotides, naturally occurring dNMP (ie, dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural Can contain nucleotides. In addition, the primer may also include ribonucleotides.

The hybridization means that two single-stranded nucleic acids form a duplex structure by pairing complementary nucleotide sequences.

The hybridization may occur when complementarity between single-stranded nucleic acid sequences is perfect (perfect match) or when some mismatch bases exist. The degree of complementarity required for the hybridization may vary depending on the hybridization reaction conditions, and may be particularly controlled by temperature. In general, if the hybridization temperature is high, hybridization is highly likely to occur in case of a perfect match, and if the hybridization temperature is low, hybridization may occur even if some mismatches exist.

The primer set can hybridize to a specific gene present in the target raw material, and when the desired raw material is present in the sample, the nucleotide sequence of the characteristic gene is amplified by the polymerase chain reaction, so that the amplified product (amplicon) Through this, it is possible to determine the presence or absence of the raw material.

The primers can incorporate additional features that do not alter the basic properties. That is, nucleic acid sequences can be modified using a number of means known in the art. Examples of such modifications are methylation, capping, substitution of nucleotides with one or more homologues, and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates, or phosphorothioates or phosphorodithioates. Transformation of nucleotides into charged linkages such as Nucleic acids may also contain one or more nucleic acids, such as nucleases, toxins, antibodies, signal peptides, proteins such as poly-L-lysine, intercalating agents such as acridine or psoralen, chelating agents and alkylating agents such as metals, radioactive metals, and iron oxidizing metals. It may have additional covalently linked moieties.

In addition, the primer sequence may be modified using a label capable of directly or indirectly providing a detectable signal. The primer may include a label that can be detected using spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA), biotin or haptens, and proteins for which antiserum or monoclonal antibodies are available.

The primers were cloned with appropriate sequences and digested with restriction enzymes, followed by the phosphotriester method of Narang et al. (1979, Meth, Enzymol. 68:90-99), and the diethylphosphoramidite method of Beaucage et al. (1981, Tetrahedron Lett. 22: 1859-1862), and any other well-known method including direct chemical synthesis, such as the solid support method of US Pat. No. 4458066.

Specifically, the primer pair may be a primer pair for isothermal amplification (LAMP) analysis for Salmonella detection.

In the present invention, "Loop-mediated isothermal amplification (LAMP)" is denatured at a constant temperature, unlike conventional PCR that requires temperature changes in three steps: denaturation, annealing, and extension. , splicing and elongation are possible methods. For example, in isothermal amplification, Bst. DNA polymerase is used, and this Bst. DNA polymerase is Taq. Unlike DNA polymerase, it has the characteristics of a helicase, so that denaturation, conjugation and elongation can be performed at a junction temperature close to the Tm value without undergoing thermal denaturation of the double helix structure of DNA. The isothermal amplification method includes a method using at least 4 primer sets specifically designed for DNA polymerase and various sites of a target nucleic acid as a standard method, and a method using 5 or 6 primer sets.

The primer pair for LAMP analysis includes the following types of primers: four types of primers consisting of a forward inner primer (FIP), a backward inner primer (BIP), a forward outer primer (F3), and a backward outer primer (B3); and LF (Loop F) and/or LB (Loop B) for Accelerated LAMP.

The LAMP method can amplify 6 to 8 specific regions, unlike conventional PCR that can target only 2 to 3 regions, is faster than conventional PCR, and has excellent specificity and detection sensitivity.

In the present invention, a composition capable of simultaneously detecting the genus, subspecies, and serotype of Salmonella was devised by combining multiplex PCR technology capable of detecting multiple targets in a single reaction with the LAMP method.

In the present invention, “multiplex LAMP” refers to a method of amplifying a plurality of target genes in the same reaction solution by simultaneously using a plurality of primer pairs. Provided is a method capable of simultaneously detecting genus, subspecies and serum of Salmonella. The multiplex LAMP is economical and time-saving because it can identify various samples in one amplification reaction.

Specifically, the detection composition may include a plurality of primer sets for LAMP analysis capable of simultaneously detecting the genus, subspecies, and serovar of Salmonella.

In one embodiment, the detection composition includes a first primer pair targeting the genus Salmonella; a second primer pair targeting Salmonella subspecies I; Alternatively, it may include a third primer pair targeting Salmonella enterica serovar typhimurium.

In one embodiment, the detection composition includes a first primer pair targeting the genus Salmonella; a second primer pair targeting Salmonella subspecies I; and any two or more primer pairs of a third primer pair targeting Salmonella enterica serovar typhimurium.

In one embodiment, the detection composition includes a first primer pair targeting the genus Salmonella; a second primer pair targeting Salmonella subspecies I; and a third primer pair targeting Salmonella enterica serovar typhimurium.

Specifically, the detection composition includes a first primer pair comprising the nucleotide sequences of SEQ ID NOs: 1 to 5 targeting Salmonella genus; A second primer pair comprising the nucleotide sequences of SEQ ID NOs: 6 to 10 targeting Salmonella subspecies I; and a third primer pair comprising the nucleotide sequences of SEQ ID NOs: 11 to 15 targeting Salmonella enterica serovar Typhimurium.

In one embodiment of the present invention, it was confirmed that each primer pair of the present invention exhibits very high sensitivity and specificity to Salmonella bacteria when treated individually or simultaneously (Tables 2 and 3).

In one embodiment of the present invention, as a result of detecting Salmonella from chicken, it was confirmed that the primer set can specifically amplify each target gene, including Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium. It was confirmed that the target gene of was clearly detected (Table 4).

Another aspect of the present invention relates to a kit for detecting Salmonella bacteria including the composition for detection.

The kit for detection may have a solution, lyophilized powder, frozen solution, or strip form, and each form may be formulated by a conventional method in the art. For example, a detection kit in the form of a solution may be formulated by separately or mixing proteins or primers in buffers such as sodium-phosphate, potassium-phosphate, tris-hydrochloric acid, and other various buffers, and, if necessary, It can also be frozen or freeze-dried.

The detection kit may be one using an immunolateral flow strip method. A lateral flow assay is a protein or nucleic acid detection method based on a chromatography method. This lateral flow analysis method is widely used in various fields such as pregnancy diagnosis, cancer diagnosis, presence or absence of other specific proteins or genes, or microorganism detection. The lateral flow assay is based on a specific reaction between two substances, such as an antigen-antibody reaction, and has the advantage of high sensitivity and specificity and quick confirmation of results, enabling diagnosis of diseases and quick preventive measures. .

The detection kit of the present invention includes experiments (e.g., PCR, LAMP) necessary for detecting Salmonella strains using the primer set of the present invention and various reagents necessary for confirming the results, such as PCR compositions, restriction enzymes, agarose, A buffer solution required for hybridization and electrophoresis may be additionally included. Specifically, the LAMP composition may include an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water (dH ₂ O) in addition to the primer pair provided in the present invention.

The detection kit may be a LAMP kit, and specifically, a multiplex LAMP kit capable of multiplex detection. The composition for LAMP analysis may be prepared in a lyophilized form in a plastic tube, and the kit may further include, in addition to the composition for LAMP analysis, appropriate reagents and tools used for analysis. Such reagents and tools include suitable carriers, solubilizers, detergents, and the like. Suitable carriers include, but are not limited to, soluble carriers such as physiologically acceptable buffer solutions known in the art such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, poly esters, polyacrylonitriles, fluororesins, cross-linked dextran, polysaccharides, agaroses, and combinations thereof.

The kit can detect any one or more of Salmonella genus, Salmonella subspecies I and Salmonella Enterica serovar typhimurium, and more specifically, can detect Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium at the same time. can

Another aspect of the present invention relates to a biochip for detecting Salmonella bacteria including the composition for detection.

In the present invention, the “bio chip” is also called a DNA chip, and very small pieces of DNA are integrated on a solid surface, and a sample solution and reagent are placed on a substrate made of a transparent or translucent material such as plastic, glass, or silicon. It may have a form including a chamber and a channel capable of accommodating.

Since the biochip is thin, transparent, and has a large contact area with the heater block, the PCR time can be greatly shortened, and at the same time, at least hundreds of genes can be searched in a short time. In addition, by using a solid body, a very small amount of genetic material can be attached at high density, a large number of genes can be searched at the same time, the expression level of a large amount of genes can be measured simultaneously, or the genotype of various parts of the genome can be identified. can be used to do

Biochips can be classified into cDNA (complementary DNA) chips and oligonucleotide chips according to the size of the attached genetic material. A cDNA chip can contain a gene (full-length open reading frame or EST) of at least 500 bp. An oligonucleotide consisting of about 15 to 40 bases may be attached to the oligonucleotide chip, and may be included in a solution included in the chip, but is not limited to the above form and may be appropriately modified as necessary.

Specifically, the biochip can detect any one or more of the genus Salmonella, subspecies Salmonella I, and Salmonella enterica serovar typhimurium.

Another aspect of the present invention relates to a method for detecting Salmonella bacteria comprising the step of treating a target sample with the composition for detection.

The target sample used in the detection method can be obtained from any material in which Salmonella bacteria can be found, preferably from foods such as chicken, pork, and beef suspected of being infected or contaminated with Salmonella.

In the present invention, a Salmonella detection method using a direct multiplex LAMP method omitting the DNA extraction process in the target sample was used, and through an optimized method, speed and accuracy were increased (FIG. 4).

In addition, the target sample may be proteinase K-treated.

In the present invention, “Proteinase K” has a molecular weight (MW) of 289,000 Daltons and is an enzyme first isolated from a fungus extract in 1974, which has the amino acid serine and breaks peptide bonds by hydrolysis has Such proteinase K can release nuclear DNA while destroying proteins and inactivating nucleases (RNase and DNase), and is used in studies such as protein digestion and DNA extraction. In DNA extraction, proteinase K treatment can have high purity and high molecular weight DNA, and can be used for PCR and electrophoresis because of its excellent stability.

The method may further include performing isothermal amplification (LAMP).

In addition, the method can simultaneously detect any one or more of the genus Salmonella, subspecies Salmonella I, and Salmonella enterica serovar typhimurium.

In one embodiment of the present invention, as a result of performing the LAMP reaction after treating the target sample with proteinase K, the sensitivity was significantly improved compared to the case where proteinase K was not treated (Table 5 and FIG. 5), it was confirmed that rapid and accurate Salmonella detection is possible through this.

Another aspect of the present invention is a) treating a target sample with the composition for detection; and b) simultaneously identifying Salmonella genus, subspecies, and serovar in the sample.

In the present invention, the "sample" refers to a target material to be confirmed whether or not Salmonella is included. Specifically, food, nutritional supplements, beverages, additives, substances included in various diets, etc. may be targeted, but not limited to the above types, and any target sample may be any to determine whether or not Salmonella is included.

The Salmonella bacteria may be any one or more of the genus Salmonella, subspecies Salmonella I, and Salmonella enterica serovar typhimurium.

Specifically, step b) may be a step of confirming the genus, subspecies, and serotype of Salmonella by performing isothermal amplification (LAMP), and more specifically, through multiplex LAMP analysis, genus Salmonella, Salmonella subspecies I and Salmonella enterica serovar typhimurium can be screened.

The screening method may be performed through any genetic screening method performed by a method known in the art without particular limitation.

By using a composition for detecting Salmonella consisting of one or more selected from the first to third primer pairs of the present invention, it is possible to accurately determine the genus, subspecies, and serotype level of Salmonella present in a target sample.

In addition, the first to third primer pairs of the present invention are primers for multiplex LAMP, and can simultaneously detect three target genes, and have excellent sensitivity and specificity.

The effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 schematically shows a direct multiplex loop-mediated isothermal amplification assay.
Figure 2 shows the location of the primers for LAMP analysis (A: Salmonella , B: Salmonella subsp. I, C: Salmonella enterica serovar Typhimurium)
Figure 3 shows the sensitivity of a triplex LAMP assay using DNA extracted from Salmonella enterica serovar Typhimurium (A: ATCC131, B: ATCC 14028, C: ATCC14028)
Figure 4 shows a comparison of optimization of sample preparation for the LAMP reaction (A: proteinase K untreated, B: proteinase K treatment).
^Figure 5 is the detection ^limit (limited of detection, LOD) (A: proteinase K untreated, B: proteinase K treatment).

Hereinafter, the embodiments of the present invention will be described in detail with reference to the accompanying drawings, but it is obvious that the present invention is not limited by the following examples.

Example 1. Salmonella strain and DNA extraction

A total of 15 Salmonella strains, including three types of strains of S. enterica ser Typhimurium, were obtained from the American Type Culture Collection (ATCC) and used as reference strains.

42 Salmonella isolated from raw chicken meat were obtained from the Korea Consumer Agency and the applicability of the triplex LAMP assay was evaluated. All Salmonella strains were cultured in tryptic soy medium (Difo Laboratories, Franklin Lakes, NJ, USA) with shaking at 37° C., and the final cultures were harvested for DNA extraction.

Genomic DNA was extracted from cultured Salmonella strains using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The purity and concentration of genomic DNA was determined using a UV-spectrophotometer (model UV-1700; Shimadzu, Tokyo, Japan). Genomic DNA with an A260/A280 ratio of 1.8 to 2 was used as a DNA template. Genomic DNA was diluted to a concentration of 25 ng/μl using distilled water and stored at -20°C.

Example 2. Design of LAMP primers

The sequences of STM3098, STM4057 and STM4497 (GenBank accession number: NC_003197) were obtained from the National Center for Biotechnology Information GenBank database. Three sets of LAMP primers consisting of five primers were designed using PrimerExplorer version 5 (Eiken Chemical Co., Ltd., Tokyo, Japan). Each of the primer sets contained two external primers (forward primer, F3 and reverse primer, B3), two internal primers (forward internal primer, FIP and reverse internal primer, BIP) and one loop primer (forward loop primer, LF). include Seven regions of the target gene were amplified using the primers. Details of the sequences and positions of the LAMP primers used in this study are presented in Table 1 and Figure 2. All primers were synthesized by Macrogen (Macrogen, Inc. Seoul, Korea).

target order gene primer Sequence (5′→3′) Concentration (μM) Salmonella genus One STM3098 3098-F3 ACAACCGAATCAAAGCCTGA 0.2 2 3098-B3 AAGCATGAATGCCTGGCC 0.2 3 3098-FIP CGCGACATCCGATAGCACGG-TAGATGGCATTCGCTGTCTG 0.8 4 3098-BIP AATACCACGCGCGTTAATCGCC-CTCATCCTGCATCGTGAGTC 0.8 5 3098-LF TCGCTGGAGACCAGATATTG 0.4 Salmonella subspecies I 6 STM4057 4057-F3 TGAAAATGCGGTGGCGATC 0.2 7 4057-B3 TGCACCGCATCAAACTCG 0.2 8 4057-FIP CGGGTGCATATACGTTGCGGC-AGAATTTTTGGTGGCCTCGA 0.4 9 4057-BIP TTACCTTCACCGGAGGCCGG-CTTCACCCACTTGTAGCGAG 0.4 10 4057-LF GCGTTCAGCATCGGGA 0.4 Salmonella enterica ser Typhimurium 11 STM4497 4497-F3 AGCCGCATTAGCGAAGAG 0.2 12 4497-B3 GCGGTCAAATAACCCACGT 0.2 13 4497-FIP ACCTGCAGCTCATTCTGAGCAG-TCAAAAACAACGGCTCCGG 0.6 14 4497-BIP GAAAAGGACCACAAGTTCGCGC-TCAGTGAGCATGTCGACGAT 0.6 15 4497-LF CAAAAATCCAGAACCCAATCTC 0.4

Example 3. Confirmation of specificity and sensitivity of multiplex LAMP primers

To evaluate the specificity and sensitivity of the LAMP primers, 15 μL of isothermal master mix ISO-001 (OptiGene, West Sussex, UK), 0.2 μM of each external primer (F3 and B3), 1.6 μM of each internal primer (FIP and A simplex LAMP reaction was performed using a 25 μL reaction volume containing BIP), 0.8 μM of loop primer (LF) and 25 ng of DNA template.

In addition, a triplex LAMP reaction was performed using different concentrations of primers for the genus Salmonella, Salmonella subspecies I and Salmonella enterica serovar typhimurium. Simplex and triplex LAMP reactions were performed at 63 °C for 30 min followed by heating and cooling steps from 98 °C to 80 °C (0.05 °C/s) for annealing curve analysis using a Genie III LAMP detector (OptiGene). did Afterwards, the data were analyzed using the Genie Explorer program. In all LAMP experiments, the absence of template DNA was set as a negative control.

The specificity of each LAMP primer set for the genus Salmonella, Salmonella subspecies I and Salmonella enterica serovar typhimurium in simplex and triplex LAMP assays was evaluated using 25 ng of DNA template extracted from 15 Salmonella strains. . Specifically, the sensitivity of the simplex LAMP assay was evaluated using 10-fold serial dilutions of Salmonella enterica serovar typhimurium DNA (ATCC 19585). The sensitivity of the triplex LAMP assay was evaluated using approximately 10-fold serial dilutions of Salmonella enterica serovar typhimurium strains (ATCC 19585, ATCC 13311 and ATCC 14028) DNA ranging from 25 ng to 25 fg. These assays were performed in triplicate under identical conditions. After the LAMP reaction, annealing curve analysis was performed to confirm the target gene.

Salmonella strain Subspecies Source Results ^a [annealing temperature (°C)] Simplex LAMP Triplex LAMP STM3098 STM4057 STM4497 STM3098 STM4057 STM4497 Serovar Typhimurium I ATCC 19585 + (88.8) + (90.0) + (86.8) + (88.6) + (89.9) + (86.8) Serovar Typhimurium I ATCC 13311 + (88.9) + (90.1) + (86.8) + (88.7) + (89.9) + (86.8) Serovar Typhimurium I ATCC 14028 + (88.8) + (89.9) + (86.8) + (88.6) + (89.9) + (86.8) Serovar Typhi I ATCC 33459 + (88.7) + (90.7) - + (88.7) + (90.2) - Serovar Paratyphi C I ATCC 13428 + (88.6) + (90.5) - + (88.5) + (90.2) - Serovar Choleraesuis I ATCC 13312 + (88.6) + (90.4) - + (88.5) + (90.2) - Serovar Enteritidis I ATCC 4931 + (88.8) + (90.6) - + (88.8) + (90.1) - Serovar Gallinarum I ATCC 9184 + (88.7) + (90.6) - + (88.8) + (90.1) - Serovar Pullorum I ATCC 9120 + (88.8) + (90.6) - + (88.7) + (90.1) - Enterica salamae II ATCC 15793 + (88.4) - - + (88.4) - - Enterica arizonae IIIa ATCC 13314 + (88.3) - - + (88.4) - - Enterica diarizonae IIIb ATCC 43973 + (88.0) - - + (88.0) - - Enterica houtenae IV ATCC 43974 + (88.7) - - + (88.7) - - Enterica indica VI ATCC 43976 + (88.8) - - + (88.9) - - Bongori V ATCC 43975 + (89.1) - - + (89.1) - -

Strain DNA amount (ng) Result ^a [annealing temperature (°C)] Simplex LAMP ^b Triplex LAMP ^c STM3098 STM4057 STM4497 STM3098 STM4057 STM4497 Salmonella enterica serovar Typhimurium 25 + (88.6) + (90.1) + (86.8) + + + (88.5 ± 0.1) + + + (89.8 ± 0.06) + + + (86.7 ± 0.06) 2.5 + (88.6) + (90.0) + (86.8) +++(88.5 ± 0.12) +++(89.7 ± 0.06) +++(86.7 ± 0.06) 0.25 + (88.7) + (90.1) + (86.9) +++(88.6 ± 0.06) +++(89.8 ± 0.06) +++(86.8 ± 0.06) 0.025 + (88.6) + (90.1) + (86.8) +++(88.5 ± 0.06) +++(89.8 ± 0.15) +++(86.8 ± 0.06) 0.0025 + (88.7) + (90.0) + (86.9) +++(88.5 ± 0.06) +++(89.8 ± 0.12) +++(86.7 ± 0.1) 0.00025 - + (89.9) + (86.9) +--(88.4) --+89.6) +--(86.6) 0.000025 - - +--(88.6) --- ---

^a Positive and negative results are indicated by + and - respectively

^b Simplex LAMP is S . performed on enterica serovar Typhimurium ATCC 19585

^c Triplex LAMP is S . performed on enterica serovar Typhimurium ATCC 19585, ATCC 13311 and ATCC 14028 (shown in order of strain above)

As a result of simplex LAMP analysis, as shown in Table 2, the Salmonella genus-specific primer set based on STM3098 was amplified at an annealing temperature of 88.0 ° C to 89.1 ° C in all Salmonella strains. Salmonella subsp.I -specific primer sets targeting the Salmonella subgenus STM4057 include S. ser. Typhimurium and S. ser. Typhi ) , Paratyphi C, Salmonella Enterica serovar Choleraesuis, Salmonella Enteritidis, Salmonella Gallinarum, and Salmonella Pullorum Only strains belonging to Salmonella subspecies I such as were amplified at an annealing temperature of 89.9 ° C to 90.7 ° C. The Salmonella enterica serovar typhimurium-specific primer set had no cross-reactivity with non-target serotypes, and the annealing temperature was 86.8°C. The above result suggests that the triplex LAMP assay is possible as the difference in annealing temperature between all target genes allowed simultaneous detection by the method within approximately 35 minutes.

As a result of triplex LAMP analysis, amplification of genes other than the target gene was not observed, and the annealing temperature of the primer set for Salmonella genus was 88.0 ° C to 89.1 ° C, and the annealing temperature of Salmonella subspecies I was 89.9 ° C to 90.2 ° C. , and Salmonella enterica serovar typhimurium was 86.8 ° C, which was the same as the simplex LAMP analysis result.

These results show that the triplex LAMP assay of the present invention uses 15 primers: 6 external, 6 internal and 3 loop primers to target genes of the genus Salmonella, Salmonella subspecies I and Salmonella Enterica serovar typhimurium without cross-reactivity. It is shown that can be specifically amplified, and through the above experiment, it was confirmed that triplex LAMP reaction and annealing curve analysis for simultaneous detection of STM3098, STM4057 and STM4497 are possible within about 35 minutes.

In addition, as shown in Figure 3 and Table 3, in the case of the sensitivity of each primer set in the simplex LAMP assay, the sensitivity of the genus Salmonella was 2.5 pg, the sensitivity of Salmonella subspecies I was 0.25 pg, and the sensitivity of Salmonella Enterica serovar Typhimurium Sensitivity was found to be 0.25 pg.

As a result of measuring the sensitivity of the triplex LAMP assay, it was confirmed that all of them were 2.5 pg for Salmonella enterica serovar typhimurium DNA, and the same or higher than when using simplex LAMP. The LOD result was determined only when it was detected in all three replicates, and the result was indicated as “+++”.

The above results suggest that the multiplex LAMP assay of the present invention has high sensitivity and is sufficiently sensitive to simultaneously detect Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium.

Example 4. Detection of Salmonella in Chicken Using Direct Multiplex LAMP

Each Salmonella enterica serovar typhimurium strain was cultured in tryptic soy medium at 37° C. for 18 hours at dilutions ranging from approximately 1.6 x 10 ¹ to 10 ⁶ CFU/mL. 1 mL of each dilution was added to 25 g of chicken. All samples inoculated with Salmonella enterica serovar typhimurium were kept at room temperature for 2 hours.

Each sample was mixed with 225 mL of buffered peptone water (Difco Laboratories, Franklin Lakes, NJ, USA) and homogenized by hand for 30 seconds. 1 mL of each homogenized sample was centrifuged at 16,000 x g for 5 minutes and the supernatant was removed. The pellet was resuspended in PBS (phosphate buffered saline) solution and then heated at 99 °C for 8 minutes.

The extraction method of direct multiplex LAMP was optimized using chicken inoculated with 6.4 x 10 ² CFU/g of Salmonella enterica serovar typhimurium. Specifically, two sets were prepared by resuspending cells centrifuged from 1 mL of the homogenized solution in three different volumes of 25, 50 and 100 μL of PBS. One set was incubated with 10 μL of Proteinase K (>600 mAU/mL, Qiagen, Hilden, Germany) for 10 minutes at 56° C., and the other set was prepared without the addition of Proteinase K. All six samples were heated at 99°C for 8 minutes, and each was used as a DNA template. 2 μL of the supernatant was analyzed using a multiplex LAMP as described in Example 3 above.

Serovar Multiplex LAMP result ^a STM3098 STM4057 STM4497 Typhimurium 3/3 3/3 3/3 Enteritidis 17/17 17/17 0/17 Virginia 5/5 5/5 0/5 Haardt 5/5 5/5 0/5 Georgia 2/2 2/2 0/2 Agona 2/2 2/2 0/2 Infantis 1/1 1/1 0/1 Hadar 1/1 1/1 0/1 Edinburgh 1/1 1/1 0/1 Paratyphi A 1/1 1/1 0/1 Sandow 1/1 1/1 0/1 Schwarzenground 1/1 1/1 0/1 Istanbul 1/1 1/1 0/1 Tennessee 1/1 1/1 0/1

^a Number of samples that tested positive/Number of total samples

As a result, three target genes were not detected by triplex LAMP analysis in samples without proteinase K, whereas among the three samples treated with proteinase K, 50 and 100 μL of PBS were resuspended, respectively. It was confirmed that both target genes of Salmonella were successfully detected in the two samples (FIG. 4). Especially in the sample treated with 50 μL of PBS and 10 μL of proteinase K, three peaks were clearly detected (FIG. 4B).

Through this, it was confirmed that the use of proteinase K in chicken can increase the efficiency of triplex LAMP as the concentration of inhibitors such as proteins decreases.

Example 5. Limited of detection (LOD) of multiplex LAMP

The limit of detection (LOD) of direct multiplex LAMP was determined using chicken contaminated with Salmonella enterica serovar typhimurium ATCC 19585 at concentrations ranging from approximately 6.4×10 ⁻¹ to 10 ⁴ CFU/g. To confirm the LOD of this assay, Salmonella enterica serovar typhimurium ATCC 13311 and ATCC 14028 were also serially diluted and inoculated into chickens.

All direct multiplex LAMP reactions were performed using an optimized method without the need for DNA extraction. All procedures including Salmonella culture, inoculation into chicken, and multiplex LAMP reaction were performed in triplicate.

spike
(Spiked) Concentration (CFU/g) Triplex LAMP results [annealing temperature (°C)] ATCC 19585 ATCC 13311 ATCC 14028 STM-3098 STM-4057 STM-4497 STM-4057 STM-4497 STM-4497 STM-4057 STM-4497 STM-4497 6.4 x 10 ⁴ + ^b (88.5) + (90.0) + (86.6) + (88.5) + (90.1) + (86.7) + (88.7) + (90.1) + (86.6) 6.4 x 10 ³ + (88.6) + (90.0) + (86.7) + (88.6) + (90.1) + (86.7) + (88.6) + (90.1) + (86.8) 6.4 x 10 ² + (88.6) + (90.0) + (86.7) + (88.6) + (90.1) + (86.7) + (88.5) + (90.0) + (86.6) 6.4 x 10 ¹ + (88.2) + (90.0) + (86.7) + (88.5) + (89.8) + (86.7) + (88.5) + (90.0) + (86.6) 6.4 x 10 ⁰ - + (90.0) - + (88.4) - - - - - 6.4 x 10 ^-1 - - - - - - - - -

^a Positive and negative results are indicated by + and - respectively

As a result, as shown in FIG. 5, in the sample not treated with proteinase K, the lowest concentration at which the Salmonella gene was detected was 6.4X10 ³ , whereas in the sample treated with proteinase K, 6.4X10 ¹ CFU/g appeared (Table 5). These results suggest that protease K treatment increases the sensitivity of direct multiplex LAMP.

In addition, the LOD of the two strains, Salmonella enterica serovar typhimurium ATCC 13311 and ATCC 14028, was 6.4X10 ¹ CFU/g, the same as that of Salmonella enterica serovar typhimurium ATCC 19585. Accordingly, it was confirmed that the triplex LAMP assay of the present invention can successfully detect Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium within a total of 60 minutes from sampling to analysis of the results.

Through the above results, it was confirmed that three target genes can be efficiently and accurately detected in a single tube without the need for additional target-specific probes labeled with fluorescent dyes. In addition, the optimized DNA extraction procedure prior to LAMP analysis is It was confirmed that the sensitivity and reaction efficiency of can be significantly improved.

The above description of the present invention is for illustrative purposes, and those skilled in the art can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined form.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and equivalent concepts should be interpreted as being included in the scope of the present invention.

<110> University-Industry Cooperation Group of Kyung Hee University <120> MULTIPLEX PRIMER FOR DETECTION OF SALMONELLA AND USES THEREOF <130> 22PP30073 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> 3098-F3 <400> 1 acaaccgaat caaagcctga 20 <210> 2 <211> 18 <212> DNA <213> artificial sequence <220> <223> 3098-B3 <400> 2 aagcatgaat gcctggcc 18 <210> 3 <211> 40 <212> DNA <213> artificial sequence <220> <223> 3098-FIP <400> 3 cgcgacatcc gatagcacgg tagatggcat tcgctgtctg 40 <210> 4 <211> 42 <212> DNA <213> artificial sequence <220> <223> 3098-BIP <400> 4 aataccacgc gcgttaatcg ccctcatcct gcatcgtgag tc 42 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> 3098-LF <400> 5 tcgctggaga ccagatattg 20 <210> 6 <211> 19 <212> DNA <213> artificial sequence <220> <223> 4057-F3 <400> 6 tgaaaatgcg gtggcgatc 19 <210> 7 <211> 18 <212> DNA <213> artificial sequence <220> <223> 4057-B3 <400> 7 tgcaccgcat caaactcg 18 <210> 8 <211> 41 <212> DNA <213> artificial sequence <220> <223> 4057-FIP <400> 8 cgggtgcata tacgttgcgg cagaattttt ggtggcctcg a 41 <210> 9 <211> 40 <212> DNA <213> artificial sequence <220> <223> 4057-BIP <400> 9 ttaccttcac cggaggccgg cttcacccac ttgtagcgag 40 <210> 10 <211> 16 <212> DNA <213> artificial sequence <220> <223> 4057-LF <400> 10 gcgttcagca tcggga 16 <210> 11 <211> 18 <212> DNA <213> artificial sequence <220> <223> 4497-F3 <400> 11 agccgcatta gcgaagag 18 <210> 12 <211> 19 <212> DNA <213> artificial sequence <220> <223> 4497-B3 <400> 12 gcggtcaaat aacccacgt 19 <210> 13 <211> 41 <212> DNA <213> artificial sequence <220> <223> 4497-FIP <400> 13 acctgcagct cattctgagc agtcaaaaac aacggctccg g 41 <210> 14 <211> 42 <212> DNA <213> artificial sequence <220> <223> 4497-BIP <400> 14 gaaaaggacc acaagttcgc gctcagtgag catgtcgacg at 42 <210> 15 <211> 22 <212> DNA <213> artificial sequence <220> <223> 4497-LF <400> 15 caaaaatcca gaacccaatc tc 22

Claims (13)

A first primer pair comprising the nucleotide sequences of SEQ ID NOs: 1 to 5; and a second primer pair comprising the nucleotide sequences of SEQ ID NOs: 6 to 10; and a third primer pair comprising the nucleotide sequences of SEQ ID NOs: 11 to 15; In the composition for detecting Salmonella spp. comprising a primer set consisting of,
The composition for detection is a composition for simultaneously detecting Salmonella genus, Salmonella subspecies I and Salmonella enterica serova Typhimurium at the same time, Salmonella detection composition. According to claim 1,
The primer pair is a primer pair for isothermal amplification (Loop-mediated isothermal amplification, LAMP) analysis for Salmonella detection, a composition for detecting Salmonella. delete In the kit for detecting Salmonella spp. comprising the composition of claim 1,
The kit is a kit for detecting Salmonella, which is for simultaneously detecting Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium. delete A biochip for detecting Salmonella spp. comprising the composition of claim 1,
The biochip for detecting Salmonella, wherein the biochip is for simultaneously detecting Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium. delete In the method for detecting Salmonella bacteria comprising the step of processing the target sample with the composition for detection of claim 1,
The method for detecting Salmonella, which is for simultaneously detecting Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium. According to claim 8,
Isothermal amplification method (Loop-mediated isothermal amplifaction, performing a LAMP); further comprising a method for detecting Salmonella. According to claim 8,
The sample is a method for detecting Salmonella, which is treated with proteinase K. delete a) treating a target sample with the composition of claim 1; and
b) a screening method for a sample containing Salmonella, comprising the step of identifying the genus, subspecies and serovar of Salmonella in the sample,
The Salmonella is at least one of the genus Salmonella and subspecies I of Salmonella,
The screening method is for simultaneously detecting Salmonella genus, Salmonella subspecies I and Salmonella enterica serovar typhimurium, a method for screening a sample containing Salmonella. According to claim 12,
Wherein step b) is to perform isothermal amplification (Loop-mediated isothermal amplifaction, LAMP) to determine the genus, subspecies, and serotype of Salmonella, a method for screening a sample containing Salmonella.

Images