KR102504390B1 - Molecular marker to select gummy stem blight resistance of watermelon and use thereof - Google Patents

Abstract

The present invention relates to a molecular marker for selecting watermelon vine blight resistant individuals and its use, and it is possible to select watermelon vine blight resistant individuals at an early stage, saving time, labor, cost, etc., thereby providing competitiveness in cultivating watermelon varieties. can increase

Description

Molecular marker to select gummy stem blight resistance of watermelon and use thereof {Molecular marker to select gummy stem blight resistance of watermelon and use thereof}

The present invention relates to a molecular marker for selecting watermelon vine blight resistant individuals and its use.

Watermelon is the best fruit and vegetable that can relieve heat and thirst in summer. It was introduced and cultivated in Korea before the Joseon Dynasty. It is classified as a climbing annual plant of the Cucurbitaceae family, and its scientific name is Citrullus lanatus . Watermelon is very high in moisture, mostly composed of sugar, has an excellent diuretic effect, and is known to be effective in mouth ulcers, cystitis, blood, and tonic. It is usually harvested in July-August, and now, due to the development of technology, year-round cultivation is also carried out through facility gardening.

During watermelon cultivation, various diseases such as anthracnose, blight, vine blight, and dying disease can occur. Vine blight occurs on stems, leaves, and fruit stems. Brown spots appear at the beginning of the stem and turn into light brown or grayish brown lesions as they progress. The pathogen is known as Didymella bryoniae .

In particular, in the case of facility cultivation, continuous cultivation is unavoidable due to its nature, and the temperature or humidity inside the facility is high, so that vine blight pathogens are likely to occur. This disease occurs rapidly after fruit set in watermelon, and leaves and vines are often withered before fruit ripens. Therefore, for the stable production of watermelon, it is necessary to select or cultivate strains resistant to vine blight.

On the other hand, the use of molecular markers in breeding is not affected by the environment or other genotypes, and has the advantage of greatly increasing selection efficiency, such as saving selection costs and time. In addition, it is possible to select strains with specific traits from multiple genetic resources using molecular markers associated with specific traits, and by directly evaluating and selecting target genotypes in the selection process, accuracy can be improved and differences between many strains can be distinguished. It is known that there is

The inventors of the present invention developed a new marker related to vine blight resistance of watermelon and made research efforts to develop a method for quickly, accurately and easily identifying watermelon resistant to vine blight by using the marker. As a result, it was possible to discover new markers related to vine blight by using the genetic information of the existing watermelon and the genetic information of the newly identified vine blight-resistant watermelon line. It was confirmed that it could be done and the present invention was completed.

1. KR 10-2125528B1

One object of the present invention is to provide a composition for identifying watermelon vine blight resistant individuals comprising all of the nucleotide sequences of SEQ ID NOs: 1 to 12.

Another object of the present invention is to provide a kit for identifying watermelon vine blight resistant individuals comprising the above composition.

Another object of the present invention is to provide a method for identifying a watermelon blight resistant individual comprising the step of assaying a sample watermelon with the composition or the kit and identifying a watermelon blight resistant individual.

One aspect of the present invention provides a composition for identifying watermelon vine blight resistant individuals comprising all of the nucleotide sequences of SEQ ID NOs: 1 to 12.

The base sequences of SEQ ID NOs: 1 to 12 are primers for molecular markers adjacent to QTL associated with blight resistance, and were developed based on flanking sequence information of the corresponding SNP to increase the accuracy of genotyping analysis of molecular markers adjacent to the QTL.

SEQ ID NOs: 1 to 6 are related to chromosome 6 of watermelon, and SEQ ID NOs: 7 to 12 are related to chromosome 8 of watermelon. Specifically, SEQ ID NOs: 1 to 3 are fluorescent primers of KASP_WGRS (3)089, respectively Allele-specific 1 (FAM) (SEQ ID NO: 1), Allele-specific 2 (HEX) (SEQ ID NO: 2) and Common (SEQ ID NO: 2) number 3). And SEQ ID NOs: 4 to 6 are fluorescent primers of KASP_WGRS (3)092, respectively Allele-specific 1 (FAM) (SEQ ID NO: 4), Allele-specific 2 (HEX) (SEQ ID NO: 5) and Common (SEQ ID NO: 6) means In addition, SEQ ID NOs: 7 to 9 are fluorescent primers of KASP_WGRS240, which mean Allele-specific 1 (FAM) (SEQ ID NO: 7), Allele-specific 2 (HEX) (SEQ ID NO: 8) and Common (SEQ ID NO: 9), respectively. . And SEQ ID NOs: 10 to 12 are fluorescent primers of KASP_WGRS (3) 185, respectively Allele-specific 1 (FAM) (SEQ ID NO: 10), Allele-specific 2 (HEX) (SEQ ID NO: 11) and Common (SEQ ID NO: 12) means

The information of the nucleotide sequences of SEQ ID NOs: 1 to 12 is summarized as follows:

SNP markers chromosome Physical location (bp) Opposition
gene fluorescent primer Base sequence (5'→3') sequence number KASP_WGRS(3)089 6 7,533,583 T Allele-specific 1 (FAM) GAATTCAAACTGACATCCAGCACCA One C Allele-specific 2 (HEX) AATTCAAACTGACATCCAGCACCG 2 - Common GTAACGACGGTCAATCTGTAACGACAA 3 KASP_WGRS(3)092 6 7,625,669 A Allele-specific 1 (FAM) GAGGCAACAGAAGAAGAAGGCAT 4 G Allele-specific 2 (HEX) GAGGCAACAGAAGAAGAAGGCAC 5 - Common GAGGCTTATCTTACGTTTCTAGTTCGTTT 6 KASP_WGRS240 8 20,663,001 A Allele-specific 1 (FAM) TGATGAGTAAGAAAAAGAGATTAAAAGCAAAAA 7 G Allele-specific 2 (HEX) GATGAGTAAGAAAAAGAGATTAAAAGCAAAG 8 - Common GACTCATTTCAAAAGATTTTCTCTGAGGTA 9 KASP_WGRS(3)185 8 21,535,005 C Allele-specific 1 (FAM) ATATGATTCATCTTGGCGGAAACAAT 10 A Allele-specific 2 (HEX) AAAATATGATTCATCTTGGCGGAAACAATT 11 - Common TCCAAACCATCATCATCGCTATGACTTA 12

The term 'primer' of the present invention is a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be replicated, and can act as a starting point for a synthetic product of a polymerase chain reaction. The length and sequence of the primers should allow for initiating the synthesis of extension products. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use of the primer, such as temperature and ionic strength. In addition, the primer sequence may include all sequences added, deleted, or substituted to the nucleotide sequences of SEQ ID NOs: 1 to 12.

The nucleotide sequences of SEQ ID NOs: 1 to 12 may be KASP molecular markers.

The term "KASP (kompetitive allele specific PCR)" of the present invention is one of PCR-based analysis methods, and is a homogenous and fluorescence-based genotyping technology. KASP is a technology based on fluorescence resonance energy transfer for allele-specific oligo extension and signal generation.

Since the composition of the present invention, specifically, the nucleotide sequence of SEQ ID NOs: 1 to 12 included in the composition is a primer of the KASP molecular marker adjacent to the QTL associated with blight resistance, it can be used to confirm the blight resistance of watermelon varieties of various watermelons. .

Another aspect of the present invention provides a kit for identifying watermelon blight resistant individuals comprising the composition.

In one embodiment of the present invention, the kit may be a PCR kit, microarray or fluidigm SNP analysis kit.

The PCR kit may include a configuration capable of utilizing the base sequence. The PCR kit may further include a DNA polymerase, a dNTP mixture, and a PCR buffer solution. The DNA polymerase may be, for example, a klenow fragment of E.coli DNA polymerase I, a thermostable DNA polymerase or a bacteriophage T7 polymerase. The PCR buffer may contain KCl, Tris-HCl and MgCl2. In addition, the PCR kit may include components required for identification of the amplification product. The PCR kit may include a guide. The guide may be a printout explaining how to use the kit, for example, how to prepare a PCR buffer solution, and suggested reaction conditions.

The microarray may be one in which polynucleotides capable of utilizing the nucleotide sequence, for example, probes, are immobilized at a high density on distinct regions of a substrate surface.

The Fluidigm SNP analysis kit may include primers for the Fluidigm system, and may specifically include STA, LSP, and ASP 1&2 primers. The Fluidigm SNP analysis kit may further include a DNA polymerase, a dNTP mixture, and a PCR buffer solution. DNA polymerase and PCR buffer solution can be understood by referring to the contents described in the PCR kit.

Another aspect of the present invention provides a method for identifying a watermelon blight resistant individual comprising the steps of assaying a watermelon sample with the composition or the kit and identifying a watermelon blight resistant individual.

The step of assaying the sample watermelon is the step of assaying the sample watermelon with the composition or the kit. Specifically, since the composition or kit includes the above-described nucleotide sequence, watermelon blight resistance of various watermelon varieties can be confirmed using this.

An example of the assay method may include extracting the genome of a watermelon sample, amplifying the extracted genome, and analyzing the amplified genome.

Specifically, the step of extracting the genome of the watermelon sample may be performed by a conventional method known in the art, for example, using a CetylTrimethylAmmonium Bromide (CTAB) method, a phenol/chloroform extraction method, an SDS extraction method, or a commercially available method. A DNA extraction kit (QIagen prep kit) sold as may be used, but is not limited thereto.

In addition, the step of amplifying the extracted genome may be performed by PCR (Polymerase Chain Reaction). PCR can be performed using a PCR reaction mixture containing components known in the art to be necessary for a PCR reaction or using commercially available kits. The PCR reaction mixture may include genomic DNA extracted from the sample watermelon, a primer set, an appropriate amount of DNA polymerase, dNTP, a PCR buffer solution, and water (H ₂ O), and the PCR buffer solution may include Tris-HCl, MgCl ₂ , KCl, and the like, but are not limited thereto.

In addition, the step of analyzing the amplified genome can be performed by a conventional method known in the art, for example, electrophoresis such as gel electrophoresis and capillary electrophoresis, DNA chip, radioactivity measurement, fluorescence measurement, or phosphorescence measurement. It may be performed through measurement, but is not limited thereto. For example, capillary electrophoresis may be performed to detect amplification products, and may be performed using an ABi Sequencer, but is not limited thereto. In addition, gel electrophoresis can be performed, and for gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the size of the amplification product. For example, 1 to 5%, preferably 1.5% agarose gel electrophoresis can be used. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactive measurement method is to label the amplification product by adding a radioactive isotope such as 32 P or 35 S to the PCR reaction solution during PCR, and then use a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter. When the amplified DNA product is analyzed using gel electrophoresis, the amplification product is electrophoresed on an agarose gel or acrylamide gel, and bands can be identified by ethidium bromide (EtBr), silver staining, etc. However, it is not limited thereto.

The identifying step is a step of identifying individuals resistant to watermelon vine blight. As an example of the identification, it can be determined that the case of having the R allele in the KASP_WGRS240 and KASP_WGRS(3)185 molecular marker assays among the gene sequences exhibits high resistance to blight blight.

The composition and kit of the present invention can select watermelon vine blight-resistant individuals at an early stage, saving time, labor, and costs, thereby increasing competitiveness in cultivating watermelon varieties.

Figure 1 shows the standard for leaf lesion area ratio of watermelon.
Figure 2 shows the criteria for stem blight symptoms.
Figure 3 shows the distribution of parents and F ₂ group individuals, Figure 3 (a) shows the leaf lesion area rate, Figure 3 (b) shows the stem blight distribution.
Figure 4 shows a watermelon gene association map created with SNP molecular markers.
5 shows the results of QTL analysis associated with watermelon vine blight (LOD graph by location).
Figure 6 shows the degree of disease resistance according to the genotype (or combination) of QTL and adjacent molecular markers.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

Example 1: Materials and Methods

1-1. Plant material and DNA extraction

A vine blight resistant strain, 'PI 189225 (wild, Citrullus amarus )' and a susceptible strain, '920533 (cultivated, C. lanatus )' were collected, respectively. Then, F ₁ was obtained by mating '920533' with 'PI 189225' on the paternal line, and then self-pollination (selfing) was performed to construct an F ₂ group (178 individuals). In addition, watermelon resources (9 items) introduced from foreign countries and commercial varieties (13 items) at home and abroad were collected.

Genomic DNA was extracted using the CTAB (cetyltrimethylammonium bromide) method, and the concentration was adjusted to 20 ng/μL for subsequent analysis.

1-2. Pathogen strain culture and inoculation, diagnosis of symptoms

The 'KACC40937' strain possessed by the Genetic Resources Center of the National Institute of Agricultural Sciences was distributed and propagated. The reason for selecting this strain was that it had good spore productivity and showed symptoms well when inoculated into watermelon plants.

It was cultured in PDA (potato dextrose agar) medium and proliferated for 5 days on the growth phase in which a temperature of 25 ° C and 12 hours (day) / 12 hours (night) were maintained, and then spores were collected to form 4 × 10 ⁵ spores. A suspension was prepared according to the /mL concentration.

Thereafter, the spore suspension was spray inoculated by spraying 10 mL per individual, and maintained in the dark for 48 hours on a humid growth phase maintained at 25 to 27 ° C. In addition, the degree of development of symptoms of the plant was observed in the growth phase at 25 ° C temperature conditions.

Symptoms were defined as leaf lesion (LL), stem blight (SB), and disease index (DI) based on these two conditions on the 5th day after inoculation. , evaluated by three criteria. The diseased area ratio of leaves is the ratio of the areas where symptoms appear among them when the area of all true leaves is 100, and is expressed as 0 to 100. In addition, stem blight symptoms were indicated by symptoms on the stem as 0, 1, 2, and 3 (Figs. 1, 2 and Table 2).

Symptom index (DI) Resistance/susceptibility determination description of symptoms 0 resistance
(Resistant)) no symptoms One Less than 20% of lesions occur on leaves only 2 More than 20% but less than 45% lesions on leaves only 3 >45% lesions on leaves only 4 sensibility
(Acceptible) Less than 20% lesions on leaves, mild symptoms on stems and petioles 5 More than 20% lesions on leaves, mild symptoms on stems and petioles 6 Necrosis in stems and petioles 7 Severe stem blight symptoms, plant death

1-3. F ₂ Population disease resistance degree Individual distribution map, genetic pattern analysis

Parents ('920533', 'PI 189225') and individuals in the F ₁ and F ₂ groups (178 individuals) were inoculated with the disease as described above to investigate the degree of disease resistance.

Resistant/susceptible individuals were determined based on the disease index (DI), and genetic patterns such as chi-square tests were analyzed. In addition, the individual distribution of the F ₂ group according to the degree of disease resistance was prepared.

1-4. F using already developed Fluidigm ₂ Population genotyping

At the request of the Agricultural Technology Commercialization Foundation, the genotype analysis of the F ₂ group was conducted using the previously developed watermelon Fluidigm-based SNP marker set (438 markers).

1-5. SNP selection using next-generation sequencing (NGS), HRM molecular marker development

In order to additionally select polymorphic SNPs for both parents, '920533' and 'PI 189225' were re-analyzed using the Illumina Hiseq 4000, a next-generation sequencing equipment, respectively. was performed. Subsequently, mapping was performed on the watermelon reference genome ('97103' ver.1) (Utilizing Burrow-Wheeler Aligner, BWA program), and SNP information with polymorphism between parental sequences was extracted (Using programs such as SAMtools). ).

Among SNPs with polymorphism, it is homozygous and has a combination of A/G, A/C, T/G, and T/C except for A/T and G/C, and through BLASTN, one SNPs with only copies were selected.

A total of 888 primers for high-resolution melting (HRM) analysis were designed. For genotyping (using HRM primers), PCR was performed in a volume of 20 μL, 2.0 μL of genomic DNA, 2.0 μL of 10 × buffer, 1.0 μL of 2.5 mM dNTP, 0.1 μL of Taq DNA polymerase, 1.0 μL of SYTO9 nucleic acid fluorescent staining reagent (green-fluorescent nucleic acid stain), 0.5 μL of each of the forward and reverse primers at a concentration of 10 pmole/mL, and the rest were performed with a composition of triple distilled water (TDW). The PCR conditions were initial denaturation at 98°C for 2 minutes, denaturation at 98°C for 5 seconds with 40 cycles, annealing at 60°C for 10 seconds, and extension using Bio-rad CFX96 equipment for HRM melting curve analysis. Fluorescence values were quantified while lowering the temperature from 94.6 °C to 70 °C at °C intervals.

Through HRM analysis, the genotype was analyzed as 'A (homozygous, maternal genotype)', 'H (heterozygous)', and 'B (homozygous, paternal genotype)' in the F ₂ group (178 individuals).

1-6. F using previously reported KASP molecular markers ₂ Population genotyping

Using the KASP information (10 pairs of primers) disclosed in a recently published paper in China (Ren et al., 2020), genotype analysis was conducted for the F ₂ population (178 individuals).

For KASP genotyping, PCR was performed in a volume of 10 μL, with 5.0 μL of 2×KASP master mix, 0.14 μL of assay mix, and 5 μL of genomic composition. The PCR conditions (touch down with 10 cycles every 20 seconds) were 94°C for 15 minutes, and the annealing temperature of the primer was reduced by 0.6°C at 61°C for each cycle for 1 minute and 94°C for 20 seconds. 26 cycles, 1 min at annealing temperature and 1 min at 37°C were performed. Genotyping of KASP molecular markers was performed using the Bio-rad CFX96 equipment and program.

1-7. Creating a genetic linkage map and exploring quantitative trait loci (QTL)

The genetic association map (set by the Kosambi mapping function) was used to calculate the genetic distance (cM) between molecular markers (based on the recombination ratio) using the JoinMap program. And based on the calculated linkage distance, a genetic linkage map was created using the MapChart program.

Analysis was performed using the MapQTL program to search for quantitative trait loci (QTL). The method was a multiple-QTL model (MQM) based on CIM (composite interval mapping). A threshold value of LOD (logarithm of odds) was calculated through 1,000 permutation tests at a significance level of 0.05.

1-8. Adjacent Molecular Label Effectiveness Test and Candidate Gene Search

The efficacy was tested for watermelon resources and commercial varieties with flanking markers adjacent to significant quantitative trait loci (QTL).

In addition, candidate genes were searched by utilizing gene annotation information from several genes located within the significant quantitative trait locus (QTL) region (using '97103' ver.1 genome information, cucurbitgenomics.org).

Example 2: Research results

2-1. Vine blight resistance genetic analysis and F ₂ group distribution

In this study, a susceptible strain ('920533'), a resistant strain ('PI 189225'), an F ₁ population, and an F ₂ (178 individuals) population were used for genetic pattern analysis. The vine blight was cultured and inoculated with the 'KACC40937' strain according to the previously mentioned method, and the degree of disease resistance was expressed as leaf lesion (LL) and stem blight (SB), Based on this value, it was expressed as a disease index (DI), and finally resistant and susceptible individuals were discriminated.

As a result of the analysis, there was some segregation in the maternal line and the F ₁ population, but overall, the maternal line showed susceptibility and resistance, respectively, and the F ₁ group showed resistance. The genetic pattern was expected to be single factor dominant, and the expected phenotype (resistance : susceptibility = 3 : 1) and the observed phenotype of the F ₂ group and the chi-square test were performed, but the P-value was less than 0.05. Therefore, it was confirmed that disease resistance works by several genes that are affected by the environment, and through several literatures (Gusmini et al., 2017; Ren et al., 2020; Gimode et al., 2020), it is closely related to each other. We have mentioned the phenomenon of segregation distortion due to the death of some individuals in the F ₂ population due to crossbreeding of two distant species (a watermelon cultivar and a wild species). Therefore, QTL analysis was performed to search for loci related to blight resistance in watermelon (Table 3).

group population expectation
Separation ratio chi-square test entire resistance
(R) sensibility
(S) degrees of freedom
( Df ) chi square
( χ ² ) P-value 920533 20 3 17 - - - - PI 189225 20 20 0 - - - - F ₁ 20 16 4 - - - - _F2 178 113 65 3:1 One 12.59 0.0004

Looking at the distribution of individuals in the F ₂ group, two peak patterns were shown in leaf lesion (LL) and stem blight (SB), and the number of individuals was greater than the resistance peak and the susceptibility peak. This is a result indicating that one or more genes regulate disease resistance (FIG. 3).

2-2. Creation of genetic linkage map with SNP-based molecular marker test, QTL search

Using the previously developed Fluidigm marker set (438 markers), genotype analysis was performed on parents, F ₁ , and F ₂ group individuals. As a result, 113 SNPs with polymorphisms in both parents were selected.

In addition, 888 HRM molecular markers were developed among polymorphic SNPs obtained through resequencing of the parents, and 84 pairs of polymorphic HRM primers were actually selected for the parents, F ₁ , and F ₂ populations. And 4 pairs of primers for HRM previously reported (Lee et al., 2015) were also added.

And, using 10 recently reported (Ren et al., 2020) KASP molecular markers, genotyping was performed on parents, F ₁ , and F ₂ group individuals.

Using Fluidigm, HRM, and KASP molecular markers, genotype analysis was performed on parents, F ₁ , and F ₂ group individuals, and genetic association maps were prepared using the previously mentioned JoinMap and MapChart programs. It consisted of a total of 18 linkage groups (LG), and the total linkage distance was 1070.2 cM, showing an average density of 5.69 cM per molecular marker (Table 4, FIG. 4).

Associated group number of markers map length
(cM) marker density
(cM/marker) marker type Fluidigm Previously reported HRM Newly developed HRM Previously reported KASP Chr. 1a 6 59.1 9.85 One One 4 - Chr. 1b 4 10.0 2.5 3 - One - Chr. 1c 7 39.2 5.6 3 One 3 - Chr. 2a 11 57.8 5.25 10 - One - Chr. 2b 7 34.8 4.97 6 - One - Chr. 3a 5 21.5 4.3 3 One One - Chr. 3b 5 30.2 6.04 4 - One - Chr. 4 10 81.4 8.14 4 - 6 - Chr. 5a 5 44.0 8.8 4 - One - Chr. 5b 6 44.7 7.45 6 - - - Chr. 6 22 97.0 4.41 5 - 17 - Chr. 7 20 98.8 4.94 12 - 8 - Chr. 8 38 131.7 3.47 10 - 21 7 Chr. 9 18 134.2 7.46 15 - 3 - Chr.10 14 89.5 6.39 11 One 2 - Chr.11 10 96.3 9.63 7 - 3 - unmapped 23 - - 9 - 11 3 entire 211 1070.2 5.69 113 4 84 10

Using the previously investigated phenotypic information (disease resistance), quantitative trait loci (QTL) were searched using the MapQTL program. For leaf lesion area (LL) and stem blight (SB), we could search for a major QTL on chromosome 8. The position on the gene association map was 85.376cM for leaf lesion area ( qLL8.1 ) and 85.263cM for stem blight ( qSB8.1 ). LOD was 4.28 and 4.02, respectively, and R ² (degree of explaining phenotypic variation) was 10.5% and 10.0%. And the adjacent molecular markers were chr8_WGRS240 and chr8_WGRS(3)185, and the physical positions were 20,663,001~21,535,005 bp. For the two traits, it was confirmed that the loci qLL8.1 and qSB8.1 on chromosome 8 are co-located with each other. In addition, as a minor QTL, qSB6.1 was searched for stem dryness (SB) on chromosome 6. Adjacent molecular markers were chr6_WGRS(3)089 and chr6_WGRS(3)092, and the LODs of the corresponding QTLs explained 3.96 and 9.7% of phenotypic variation (Table 5, Fig. 5).

characteristics QTL chromosome
(chromosome) location
(genetic position, cM) adjacent molecular markers
(flanking marker) physical location
(location, bp) LOD R ²
(%) additive effect
(additive effect) dominant effect
(dominance effect) LOD
Threshold
(threshold) leaf area ratio
(LL) qLL8.1 8 85.376 chr8_WGRS240
-
chr8_WGRS(3)185 20,663,001
-
21,535,005 4.28 10.5 9.21 -15.04 3.7 stem blight
(SB) qSB6.1 6 57.139 chr6_WGRS(3)089
-
chr6_WGRS(3)092 7,533,583
-
7,625,669 3.96 9.7 0.07 -0.72 3.7 qSB8.1 8 85.263 chr8_WGRS240
-
chr8_WGRS(3)185 20,663,001
-
21,535,005 4.02 10.0 0.28 -0.64 3.7

In addition, the base sequence information for 4 pairs of HRM primers for molecular markers adjacent to the QTL are shown in the table below (Table 6).

SNP markers chromosome Physical location (bp) Forward primer (5'→3') Reverse primer (5'→3') Tm
(℃) Product size (bp) chr6_WGRS(3)089 6 7,533,583 GCAGATGGATGTAACGACGG TGGTGTAGATGAGGGTCGGT 55 219 chr6_WGRS(3)092 6 7,625,669 CCTTTCCATCTGAGCCCCAA GCTGGTGCATTGCTCTTCTT 57 177 chr8_WGRS240 8 20,663,001 ACGGCTGGTCTCATGTTCAA TAGGGTTTGGTGCTGGTGAC 57 184 chr8_WGRS(3)185 8 21,535,005 GCAAGAGGCAAACATCATGC CTCGTGCGTCGTGCTAAAAT 57 162

2-3. Development of KASP molecular markers, validation of the effectiveness of adjacent molecular markers, search for candidate genes

For the stem blight (SB) trait, the difference in the degree of disease resistance of individuals in the F ₂ group by the combination of genotypes of chromosomes 6 and 8 was analyzed. It was confirmed that when both the active QTL and the minor QTL had the resistance allele, the degree of stem blight was higher by about 1.31 than when both had the susceptibility allele (FIG. 6). (This is because the S/S genotype combination showed stem thinning of 1.69, whereas the R/R genotype showed stem thinning of 0.38)

And in the case of the leaf lesion area (LL) trait, as shown in the box plot analysis, according to the genotype of the molecular marker adjacent to qLL8.1 , the case of the paternal genotype 'B' was the maternal genotype of 'A'. The degree of disease resistance was higher than that of the case (FIG. 6).

To increase the accuracy of genotyping of molecular markers adjacent to the QTL, KASP molecular markers (4 pairs of primers) were developed based on the flanking sequence information of the corresponding SNP (Table 7).

SNP markers chromosome Physical location (bp) Opposition
gene fluorescent primer Base sequence (5'→3') KASP_WGRS(3)089 6 7,533,583 T Allele-specific 1 (FAM) GAATTCAAACTGACATCCAGCACCA C Allele-specific 2 (HEX) AATTCAAACTGACATCCAGCACCG - Common GTAACGACGGTCAATCTGTAACGACAA KASP_WGRS(3)092 6 7,625,669 A Allele-specific 1 (FAM) GAGGCAACAGAAGAAGAAGGCAT G Allele-specific 2 (HEX) GAGGCAACAGAAGAAGAAGGCAC - Common GAGGCTTATCTTACGTTTCTAGTTCGTTT KASP_WGRS240 8 20,663,001 A Allele-specific 1 (FAM) TGATGAGTAAGAAAAAGAGATTAAAAGCAAAAA G Allele-specific 2 (HEX) GATGAGTAAGAAAAAGAGATTAAAAGCAAAG - Common GACTCATTTCAAAAGATTTTCTCTGAGGTA KASP_WGRS(3)185 8 21,535,005 C Allele-specific 1 (FAM) ATATGATTCATCTTGGCGGAAACAAT A Allele-specific 2 (HEX) AAAATATGATTCATCTTGGCGGAAACAATT - Common TCCAAACCATCATCATCGCTATGACTTA

Marker validation was performed on 9 watermelon genetic resources collected with 4 developed KASP molecular markers and 13 commercial varieties.

As a result of the analysis, in KASP_WGRS240 and KASP_WGRS(3)185 molecular marker assays, cases with the R allele showed high blight resistance. On the other hand, KASP_WGRS(3)089 and KASP_WGRS(3)092 molecular markers did not show a significant correlation with the disease resistance phenotype (Table 8).

If the four KASP molecular markers are used, it is possible to efficiently select watermelon vine blight resistant individuals in a short time with lower cost and effort.

division resource name origin scientific name* phenotype genotype Symptom
jisoo
(DI) KASP_WGRS240 KASP_WGRS(3)185 KASP_WGRS(3)089 KASP_WGRS(3)092 parents
system PI 189225 Congo CA R R R R R '920533' korea CL S S S S S heredity
resource PI 500335 Zambia CA R R R R R PI 482283 Zimbabwe CA R R R R R PI 164248 Liberia CM R S S R - PI 500334 Zambia CA R R R R R PI 244019 south africa
republic CA R R R R R PI 482315 Zimbabwe CA R R R R R PI 379243 North Macedonia CA R R R R R PI 279461 japan CL S S S R R PI 505590 Zambia CL S S S S S commercially available
kind Fair Fax USA CL S S S R R AU-Jubilant USA CL S S S S S AU-Producer USA CL S S S S S Crimson Sweet USA CL S S S R R Speed Plus Honey korea CL S S S H H black tiger korea CL S S S - S yellow mandarin korea CL S S S S S Dalgona korea CL S S S H H our honey korea CL S S S S S orange king korea CL S S S H H Santa honey korea CL S S S H H Charleston Gray USA CL S S S R R Seo Taeja korea CL S S S S S

* Scientific name: CA , C. amarus Schrad.; CL , C. lanatus (Thunb.) Matsum. &Nakai; CM , C. mucosospermus (Fursa) Fursa.

Candidate genes in the region with the dominant QTL on chromosome 8 were searched for. There were 83 total genes, and among them, 4 candidate genes related to disease resistance were searched using annotation information. If molecular markers are created based on SNP mutations within these candidate genes, it is expected that more accurate molecular markers can be developed (Table 9).

gene ID location Gene Annotation
(gene annotation) chromosome Physical location (bp) Cla022133 8 20,710,211-20,711,725 Receptor-like protein kinase Cla022184 8 21,315,878-21,318,792 Receptor kinases Cla022195 8 21,421,183-21,423,645 Receptor kinases Cla022196 8 21,423,671-21,424,567 Leucine-rich repeat receptor-like protein kinase

The above results are summarized as follows:

Parental lineage, population construction, disease resistance test method construction, and genetic patterns were analyzed. Specifically, parental lines and F ₁ , F ₂ groups (178 individuals) were established, and disease resistance test methods were performed for leaf lesion area ratio and stem blight using KACC40937 vine blight strain. As a result, as a result of genetic pattern analysis, it was confirmed that a quantitative trait locus (QTL) in which several genes affected by the environment are involved in disease resistance.

In addition, parental resequencing, SNP selection with polymorphism, Fluidigm and HRM, and KASP marker genotyping were analyzed. Specifically, in order to create a genetic association map, F ₂ Genotyping was performed on the population.

In addition, an association map was created and quantitative trait loci (QTL) associated with blight resistance were searched. As a result, a genetic association map was drawn up based on the genotyping results of a total of 211 molecular markers. The total association distance was 1070.2 cM and the density was 5.69 cM. / was a marker. In addition, the main QTL on chromosome 8 and the minor QTL on chromosome 6 were searched for stem blight trait.

In addition, KASP molecular marker development, efficacy test on watermelon resources, and candidate genes were searched. Specifically, a contiguous molecular beacon was developed by converting from HRM form to KASP form. As a result, as a result of confirming whether the phenotype and genotype matched for 9 watermelon genetic resources and 13 commercial varieties, it was confirmed that the results matched for the molecular marker adjacent to the QTL searched for on chromosome 8.

So far, the present invention has been looked at with respect to its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> REPUBLIC OF KOREA (RURAL DEVELOPMENT ADMINISTRATION) <120> Molecular marker to select gummy stem blight resistance of watermelon and use it <130> RDA-P210013 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)089 Allele-specific 1 (FAM) <400> 1 gaattcaaac tgacatccag cacca 25 <210> 2 <211> 24 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)089 Allele-specific 2 (HEX) <400> 2 aattcaaact gacatccagc accg 24 <210> 3 <211> 27 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)089 Common <400> 3 gtaacgacgg tcaatctgta acgacaa 27 <210> 4 <211> 23 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)092 Allele-specific 1 (FAM) <400> 4 gaggcaacag aagaagaagg cat 23 <210> 5 <211> 23 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)092 Allele-specific 2 (HEX) <400> 5 gaggcaacag aagaagaagg cac 23 <210> 6 <211> 29 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)092 Common <400> 6 gaggcttatc ttacgtttct agttcgttt 29 <210> 7 <211> 32 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS240 Allele-specific 1 (FAM) <400> 7 tgatgagtaa gaaaaagaga ttaaaagcaa aa 32 <210> 8 <211> 31 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS240 Allele-specific 2 (HEX) <400> 8 gatgagtaag aaaaagagat taaaagcaaa g 31 <210> 9 <211> 30 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS240 Common <400> 9 gactcatttc aaaagatttt ctctgaggta 30 <210> 10 <211> 26 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)185 Allele-specific 1 (FAM) <400> 10 atatgattca tcttggcgga aacaat 26 <210> 11 <211> 30 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)185 Allele-specific 2 (HEX) <400> 11 aaaatatgat tcatcttggc ggaaacaatt 30 <210> 12 <211> 28 <212> DNA <213> artificial sequence <220> <223> KASP_WGRS(3)185 Common <400> 12 tccaaaccat catcatcgct atgactta 28

Claims (5)

A composition for identifying watermelon vine blight resistant individuals comprising all of the nucleotide sequences of SEQ ID NOs: 1 to 12.
According to claim 1,
The base sequence of SEQ ID NOs: 1 to 12 is a KASP molecular marker composition for identifying watermelon blight resistant individuals.
A kit for identifying watermelon blight-resistant individuals comprising the composition of claim 1.
The kit according to claim 3, wherein the kit is a PCR kit, a microarray or a kit for Fluidigm SNP analysis.
Assaying a sample watermelon with the composition of claim 1 or the kit of claim 3; and
Including identifying watermelon vine blight resistant individuals
A method for identifying watermelon vine blight resistant organisms.

Images