KR102493765B1 - Method for regulating photosynthesis of plant - Google Patents

Abstract

The present invention relates to a gene that negatively regulates the photosynthetic efficiency of a plant, a method for controlling the photosynthetic efficiency of a plant by regulating the expression of the gene, and a composition for regulating the photosynthetic efficiency. Using the method or composition of the present invention, it is possible to provide core knowledge and technology for cultivating excellent crop varieties through gene editing.

Description

Plant photosynthesis control method {METHOD FOR REGULATING PHOTOSYNTHESIS OF PLANT}

The present invention relates to a gene that negatively regulates photosynthetic efficiency of plants, a method for controlling photosynthetic efficiency of plants, and a composition for controlling them.

Photosynthesis is the process of producing organic assimilation products necessary for plant growth and physiological functions using carbon dioxide and light energy in the atmosphere. Therefore, photosynthesis in plants is a very important process that determines plant development and growth. Photosynthesis takes place in chloroplasts, which are organelles in plant cells, and therefore, genes regulating chloroplast development play a very important role in plant photosynthetic efficiency.

Chloroplasts have a unique genome and two distinct RNA polymerases, nuclear-encoded RNA polymerase (NEP) and plastid-encoded RNA polymerase (PEP), which mediate transcription of plastid genes. NEP is a single-subunit RNA polymerase, and PEP is a multimeric RNA polymerase composed of four core proteins: rpoA, rpoB, rpoC1 and rpoC2. Both NEP and PEP are required for chloroplast development. For example, mutants defective in RPOTp or RPOTmp encoding NEP have delayed chloroplast production and delayed growth, and mutants lacking PEP activity exhibit an albino phenotype. PEP activity is essential for the formation of fully activated chloroplasts because it promotes the expression of photosynthesis-related genes. PEP forms a complex with PEP-associated proteins (PAPs). In mutant plants that do not express PAP, the expression of PEP-dependent genes is suppressed, leading to defects in chloroplast development.

Control of photosynthetic efficiency is a very important part for excellent crop varieties, and the present invention provides core knowledge and technology for cultivating excellent crop varieties through gene editing.

Korean Patent Publication No. 2016-0029679

An object of the present invention is to provide a method for controlling photosynthetic efficiency of plants and a composition for controlling photosynthetic efficiency.

1. A plant photosynthetic efficiency control method comprising the step of regulating FSD3S (Fe-superoxide dismutase 3 splicing variant) gene expression in plants.

2. The method according to 1 above, wherein the FSD3S gene is a splicing variant comprising introns 6 and 7 of the FSD3 gene.

3. The method according to 1 above, wherein the FSD3S gene comprises the sequence of SEQ ID NO: 1.

4. The method for regulating plant photosynthetic efficiency according to 1 above, wherein the expression of the gene is deleted or inhibited to increase the photosynthetic efficiency of the plant.

5. In the above 4, the deletion or inhibition of the FSD3S gene expression is CRISPR / Cas nuclease ((Clustered 　 Regularly 　 Interspaced 　 Short 　 Palindromic 　 Repeats / CRISPR-associated 　 sequences nuclease), T-DNA (transfer-DNA), siRNA (small Interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme (ribozyme) or PNA (peptide nucleic acids) performed by introducing into a plant or plant cell, a plant photosynthetic efficiency control method.

6. A composition for regulating plant photosynthetic efficiency comprising a plant FSD3S (Fe-superoxide dismutase 3 splicing variant) gene expression regulator.

7. The expression regulator according to 6 above, CRISPR / Cas nuclease ((Clustered 　 Regularly 　 Interspaced 　 Short 　 Palindromic 　 Repeats / CRISPR-associated 　 sequences nuclease), T-DNA (transfer-DNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme (ribozyme) and PNA (peptide nucleic acids) expression deficiency or inhibitors selected from the group consisting of, plant photosynthesis efficiency control composition.

The present invention has the effect of regulating the photosynthetic efficiency of plants by regulating the expression of the FSD3S gene that regulates chloroplast development. When the expression of the FSD3S gene is deleted or inhibited, the photosynthetic efficiency of plants can be increased.

Figure 1 shows the simplified structure of the mRNA of FSD3 gene and its splicing variant, FSD3S, and the high hydrophobicity of the C-terminal region of FSD3S.
Figure 2 shows that there is no significant difference between the SOD activities of FSD3 and FSD3S.
Figure 3 shows the positional specificity of the FSD3S protein, which is different from the FSD3 protein.
Figure 4 shows that the FSD3S protein has a transmembrane (TM) domain of the C-terminal region.
5 shows that the FSD3S protein has a tendency to localize to the chloroplast membrane.
Figure 6 shows that the transgenic plants overexpressing the FSD3S gene have reduced chlorophyll content and photosynthetic activity compared to wild-type plants.
7 shows that the transgenic plants overexpressing the FSD3S gene have lower levels of chloroplast gene expression and higher levels of senescence-related genes than wild-type plants.
Figure 8 shows that the transgenic plants overexpressing the FSD3S gene have no significant difference in ROS levels when compared to wild-type plants.
9 shows the co-localization test results of PEND and FSD3, which are nucleoid-related proteins, indicating that each signal is located at the same location in the chloroplast.
10 and 11 show the bioinformatics analysis results of OsFSD3 in rice.
Figure 12 shows the location of FSD3S protein visualized in the guard cell of 35S::FSD3S-GFP.
Figure 13 shows that FSD3S proteins with TM domains tend to localize to the chloroplast membrane, but can also localize to the chloroplast matrix.
Figure 14 shows the FSD3S expression levels of wild-type plants and FSD3S overexpressing transgenic plants (L1, L2).
15 shows that expression of FSD3S does not complement the FSD3 mutant phenotype.
16 shows that FSD3S protein accumulated in the substrate reduces plant growth and photosynthetic activity.
Figure 17 shows the formation of plasmoglobulin in 35S::FSD3S transgenic plants.
18 shows the transcription levels of FSD3 and FSD3S in 3-week-old and 10-week-old leaves, indicating that FSD3 and FSD3S have different functions in chloroplast development.

Hereinafter, the present invention will be described in detail.

The present invention relates to a method for regulating the photosynthetic efficiency of a plant, comprising the step of regulating the expression of a Fe-superoxide dismutase 3 splicing variant (FSD3S) gene of the plant.

The type of "plant" is not particularly limited, and the 'plant' to which the method of the present invention is applied is not particularly limited, and most dicotyledonous plants including lettuce, Chinese cabbage, potato and radish, or rice, barley, banana monocotyledonous plants such as can all be used, and food crops including rice, wheat, barley, corn, soybean, potato, wheat, red bean, oat and sorghum; vegetable crops including Arabidopsis, Chinese cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion and carrot; Specialty crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwi trees, grapes, tangerines, persimmons, plums, apricots and bananas; flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; and fodder crops including ryegrass, red clover, orchard grass, alpha alpha, tall fescue and perennial ryegrass. For example, the target plant may be a cruciferous plant, specifically Arabidopsis, radish, broccoli, cauliflower, kale, lettuce, Chinese cabbage, red cabbage, cabbage, Brussels sprouts, kohlrabi, and bok choy. there is.

The FSD3S gene may be a splicing variant including introns 6 and 7 of the FSD3 gene. Specifically, FSD3 mRNA containing 8 exons is generated by removing 7 introns from FSD3 pre-mRNA, but the 6th and 7th introns of FSD3 pre-mRNA are not removed and only the 1st to 5th introns remain. FSD3S mRNA is generated, and the FSD3S mRNA may include 5 exons identical to the 1st to 5th exons of FSD3 and 1 exon different from the 6th exon of FSD3, for a total of 6 exons. According to one embodiment of the present invention, the stop codon of FSD3S is positioned earlier (771 bp) compared to FSD3 (792 bp), so that FSD3S mRNA encodes a shorter protein consisting of 256 amino acids compared to 263 amino acids of FSD3. it may be More specifically, the FSD3S gene may consist of the sequence of SEQ ID NO: 1, but is not limited thereto.

The FSD3S gene may be an endogenous gene (endogeneous) of the target plant or an exogeneous gene introduced into the target plant.

Since the FSD3S protein negatively regulates the expression of the plastid-encoded RNA polymerase (PEP)-dependent chloroplast gene to reduce photosynthetic activity, the photosynthetic efficiency of plants can be controlled by regulating the expression of the FSD3S gene.

Modulation of gene expression includes increasing, inhibiting or deleting the expression of a gene (DNA or mRNA) or protein. The expression control can be performed using a material or method designed to match the sequence in the target plant.

Specifically, regulation of gene expression may be expression loss or inhibition.

The term “deletion or inhibition of expression” means to completely ablate or inhibit (reduction in expression) the expression of a gene (DNA or mRNA) or protein, and “totally ablate” means that gene or protein expression becomes undetectable or insignificant. This includes being present at a level.

When the expression of the FSD3S gene is deleted or inhibited, photosynthetic efficiency can be increased by increasing or maintaining the expression of the plastid-encoded RNA polymerase (PEP)-dependent chloroplast gene.

Deletion or inhibition of the FSD3S gene can be performed by a method known in the art, for example, CRISPR/Cas nuclease ((Clustered 　 Regularly 　 Interspaced 　 Short 　 Palindromic 　 Repeats/ CRISPR-associated 　 sequences nuclease), T-DNA (transfer -DNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, or PNA (peptide nucleic acids) may be introduced into plants or plant cells, but are limited thereto In the case of the nucleic acids exemplified above, they may be designed according to the FSD3S sequence of the target plant and consist of a sequence capable of deleting or inhibiting its expression.

Individual specific examples of these are as follows.

For example, deletion or inhibition of the FSD3S gene produces a T-DNA recombinant plasmid containing gRNA (guide RNA) and Cas nuclease that can target the plant's FSD3S gene, and infects the plant through Agrobacterium. This can be done by introducing The T-DNA may be designed according to the FSD3S sequence of the target plant and consist of a sequence capable of deficient or inhibiting its expression.

For example, deletion or inhibition of the FSD3S gene can be carried out by introducing siRNA composed of a sense RNA strand having a sequence homologous to the mRNA of the FSD3S gene, which is a target gene, and an antisense RNA strand having a sequence complementary thereto, into the plant cell. there is. The siRNA may be designed according to the mRNA sequence of the FSD3S gene of the target plant, and may consist of a sequence capable of deficient or inhibiting its expression.

For example, deletion or inhibition of the FSD3S gene can be performed by introducing shRNA into the plant cells. The shRNA may be designed according to the mRNA sequence of the FSD3S gene of the target plant and consist of a sequence capable of deficient or inhibiting its expression.

For example, deletion or inhibition of the FSD3S gene is a complementary nucleotide sequence of the mRNA strand of the FSD3S gene, and a ribozyme composed of a region that binds with specificity to the mRNA of the FSD3S gene and a region that cleaves the corresponding mRNA is introduced into the plant cell. can be introduced and implemented.

For example, deletion or inhibition of the FSD3S gene can be performed by introducing peptide nucleic acid (PNA) capable of complementarily binding to the RNA of the FSD3S gene into the plant cell.

The present invention relates to a composition for regulating the photosynthetic efficiency of a plant, including an FSD3S (Fe-superoxide dismutase 3 splicing variant) gene expression regulator.

The target plant may be within the above range.

The FSD3S gene expression regulator may be an expression promoter, an expression-defective agent, or an expression inhibitor of the FSD3S gene, and specifically may be an expression-defective agent or an expression inhibitor.

An expression enhancer of the FSD3S gene may decrease plant photosynthetic efficiency, and an expression-defective agent or expression inhibitor may promote plant photosynthetic efficiency.

FSD3S gene expression deletion or inhibitors include CRISPR/Cas nuclease ((Clustered　Regularly　Interspaced　Short　Palindromic　Repeats/ CRISPR-associated　sequences nuclease), T-DNA (transfer-DNA), siRNA (small interfering RNA), shRNA (short hairpin RNA) ), miRNA (microRNA), ribozyme, or PNA (peptide nucleic acids), and may be within the above range, but is not limited thereto. and may consist of a sequence capable of deleting or inhibiting its expression.

Hereinafter, examples will be described in detail to explain the present invention in detail.

Example

Experiment materials and methods

1. Plant materials and growth conditions

Arabidopsis thaliana (Arabidopsis thaliana) ecotype Columbia (Col-0) was used as a control. The fsd3-1 mutant ( Salk_103228 ) was obtained from the Arabidopsis Biological Resource Center. Seeds were sterilized and plated on 1/2 strength Murashige and Skoog (1/2 x MS) solid medium. After vernalization for 2 days at 4°C under dark conditions, plants were grown in a growth chamber at 22°C with a light regime of 16/8 hours (light/dark). Seedlings were transferred to soil for analysis of mature plants. For growth in continuous light or dark conditions, plants were grown in chambers at 22°C.

2. Construction of recombinant DNA plasmids for transgenic plants

The GATEWAY system (Invitrogen) was used to construct recombinant DNA plasmids. For the construction of 35S::FSD3S , full-length FSD3S cDNA was amplified by RT-PCR from total RNA of Arabidopsis. The cDNA was inserted into the pDONR221 vector (Invitrogen) by BP reaction. Then, the pENTRY clones were recombined into a modified pMDC plant binary vector carrying the 35S promoter by LR reaction. For the construction of 35S::FSD3S-GFP and 35S::FSD3SㅿTM-GFP , each pENTRY clone containing FSD3S or FSD3SㅿTM cDNA without a stop codon was subjected to in-frame recombination with the 35S promoter and GFP by LR reaction It became. Primer sequences are listed in Table 1.

name order purpose sequence number FSD3 geno-5 GCCTTCTAGCTCACGGCTTG fsd3 genotype 2 FSD3 geno-3 GCAGCGTTGTTGAACTCGGG fsd3 genotype 3 FSD3-5 CTGGACTACAAGAACGACAG qRT-PCR 4 FSD3S-5 TCCGGTTGCTAGAACGACAG qRT-PCR 5 FSD3 and 3S-3 GCGATTGGGATGTTGGGTTC qRT-PCR 6 rpoB-5 GAACATCTGCAATACCCGG qRT-PCR 7 rpoB-3 GTTCTACCAATTGATATGTTTCC qRT-PCR 8 rbcL-5 GCTGCTGAATCTTCTACTGG qRT-PCR 9 rbcL-3 GAGTTTCTTCTCCTGGAACG qRT-PCR 10 psbA-5 GTCCTTGGATTGCTGTTGC qRT-PCR 11 psbA-3 GAGATTCCTAGAGGCATACC qRT-PCR 12 SAG12-5 GATGTCAAGGATAAACAAGGAC qRT-PCR 13 SAG12-3 CAATCCCACACAAACATACAC qRT-PCR 14 ATC2-5 CTTGCACCAAGCAGCATGAA qRT-PCR 15 ATC2-3 CCGATCCAGACACTGTACTTCC qRT-PCR 16 FSD3 BP-5 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGAGTTCTTG TGTTGTG GFP, Ox 17 FSD3S BP-3 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAAGCTAGGTT TTTACCT OX 18 FSD3 BP-3 nonstop GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCGATTGGGATGTTGGGTTC GFP and GST fusion 19 FSD3S BP-3 nonstop GGGGACCACTTTGTACAAGAAAGCTGGGTCAGCTAGGTTTTTACCTTGTAG GFP and GST fusion 20 FSD3SㅿTM BP-3 nonstop GGGGACCACTTTGTACAAGAAAGCTGGGTCAAAATGTTTCAAAGTGTTTCTTG GFP and GST fusion 21 PEND fusion-5 CCCCTTGCTCCGTGGATCCATGCACTCTCTTAAGACTACTTGC CFP fusion 22 PEND fusion-3 no stop CCTCGCCCTTGCTCACGGATCCACCAGGACCAAGGACTC CFP fusion 23 CFP fusion-5 GTGAGCAAGGGCGAGGAG CFP fusion 24 CFP fusion-3 CCAAATGTTTGAACGATCTGCAGTCACTTGTACAGCTCGTCCATG CFP fusion 25 pTAC10 HA-5 GGAACCAATTCAGTCGACTGGATCCATGCAGATTTGCCAAAACCAAG Co-IP 26 pTAC10 HA-3 CAGGCTCCGCTTGCGGCCGCGTCTGTCAAGACTTGAGTAC Co-IP 27

3. Ultra-microsectioning and transmission electron microscopy

For chloroplast microstructure analysis, ultramicrosections were performed as previously described by Motohashi et al. with minor modifications. Leaves from the indicated plants were fixed using fixative solution 1 (0.86 M Na-P [pH 7.2], 1% glutaraldehyde and 1% paraformaldehyde) at room temperature for 1 day. Samples were washed three times using washing solution (0.137 M Na-P [pH 7.2]) and then fixed solution 2 (0.86 M Na-P [pH 7.2], 2% osmium tetroxide) for 1 h at room temperature. second fixed treatment. After washing three times, the samples were dehydrated with an acetone gradient (25, 50, 75 and 100% in ddH ₂ O (v/v)) for 1 hour each and then incubated overnight in absolute acetone. Dehydrated samples were incubated on Spurr resin (Sigma) gradients (25, 50, 75 and 100% in acetone (v/v)) for 2 hours each and overnight on absolute Spurr resin. For solidification, the samples were placed in a mold at 65° C. for 2 days. Sections (80 nm) were imaged with an ultramicrotome (EM UC7, Leica). Images were captured with a transmission electron microscope (TEM), JEM1010.

4. Measurement of chlorophyll content and photosynthetic activity

Chlorophyll content was measured in 5-week-old Col-0 and FSD3S-OX . Fresh leaves (0.75 g) were homogenized with a plant tissue homogenizer in 15 mL of 95% ethanol (v/v in ddH ₂ O). Homogenized samples were centrifuged at 12,000 xg for 15 minutes at 4°C. The supernatant was diluted 10-fold using 95% ethanol. Chlorophyll content was measured with a UV/visible spectrophotometer (OPTIZEN POP, Mecasys). To measure the photosynthetic activity of these transgenic plants, leaf discs were collected from 6 to 8 leaves of 5-week-old Col-0 and indicated transgenic plants. Leaf discs were placed under dark conditions for 30 minutes prior to measurement. The Fv/Fm values of the leaves were measured with a pulse modulation fluorometer (mini-PAM, Walz, Germany).

5. In-gel SOD activity assay

FSD3 and FSD3S cDNAs were fused to the expression vector pMBP-DC using the gateway system (Invitrogen). Each construct was introduced into an E. coli BL21(DE3) pLysS plus RIL strain, respectively. Expression of the recombinant protein was induced by 1 mM isopropyl-β-D-thiogalactoside at 18°C for 14 hours. The crude extract was purified with amylose resin (NEB). After washing 4 times with an extraction buffer (20 mM Tris-HCl [pH 7.4], 200 mM NaCl, 1 mM EDTA, and 10 mM β-mercaptoethanol), elution was performed with an extraction buffer containing 10 mM maltose. The SOD activity of proteins has been studied by Beauchamp and Fridovich (1971) and Myouga et al. (2008). Each protein was loaded on native-PAGE. The gel was washed three times with ddH ₂ O and then incubated with nitroblue tetrazolium (NBT) solution (0.1% NBT in ddH ₂ O (w/v)) for 15 minutes in the dark with gentle shaking. After washing with ddH ₂ O, the gel was immersed in a riboflavin solution (0.028 mM riboflavin and 28 mM TEMED in 0.1 M potassium phosphate buffer [pH 7.0]) for 15 minutes and then rinsed with ddH ₂ O. The gel was illuminated with a white light box to initiate the photochemical reaction. Image J software was used for quantification of SOD activity.

6. Purification and fractionation of chloroplast proteins

Intact chloroplasts were isolated from wild-type 35S::FSD3S-GFP and 35S::FSD3SㅿTM-GFP plants using the Minute Chloroplast Isolation Kit (Invent Biotechnologies). Chloroplasts were osmotically lysed by suspension in 50 mM Tris-Cl [pH7.5]. Samples were vortexed vigorously and then centrifuged at 10,000 xg for 20 minutes at 4°C. The supernatant was used as the soluble fraction. For preparation of the insoluble fraction, the remaining pellet was suspended and boiled for 5 minutes with 2x Laemmli Sample Buffer (Bio-Rad). Proteins were loaded on a 10% SDS-polyacrylamide gel and then transferred to a polyvinylidene fluoride membrane. Immunoblot analysis was performed using GFP polyclonal antibodies (Santa Cruz) and anti-rabbit HRP-linked secondary antibodies (Thermo Fisher) to detect FSD3S-GFP and FSD3SㅿTM-GFP. Western blot signals were detected using Amersham ECL prime (GE Healthcare).

7. Quantitative RT-PCR

Quantitative RT-PCR analysis was performed using total RNA extracted from indicated plants. Total RNA extraction was performed using the RNeasy plant mini-prep kit (Qiagen) and DNase treated for 15 min according to the manufacturer's instructions. A 20 μl reaction was performed using 2 μg of total RNA and Superscript III reverse transcriptase (Invitrogen) for cDNA synthesis. For quantitative PCR, a LightCycler 480 with SYBR GREEN I Master Mix (Roche) was used. PCR and fluorescence detection were performed using a LightCycler NANO Real-Time PCR machine (Roche). PCR conditions were programmed according to the manufacturer's instructions (initial denaturation at 95 °C for 5 min, followed by 45 cycles of denaturation at 95 °C for 10 sec, annealing at 60 °C for 10 sec, extension at 72 °C for 10 sec). Expression levels were analyzed using three technical replicates. AtACT2 (At3g18780) was used as an internal control. Three technical replicates of qRT-PCR were performed using three biological replicates. Primer sequence information is listed in Table 1.

8. Co-immunoprecipitation and co-localization analysis

Protoplasts were isolated from wild-type, 35S::FSD3-GFP and 35S::FSD3S-GFP plants and transformed with the 35S::pTAC10-HA plasmid. To construct the 35S::pTAC10-HA plasmid, the pTAC10 cDNA was introduced into the BamHI/NotI -digested pE2C plasmid for pTAC10 -HA using the Gilson assembly system (NEB). Entry clone was inserted into pMDC plasmid by LR reaction. A co-immunoprecipitation assay was performed by Chang et al. (2017) with minor modifications. For the co-localization analysis of FSD3-GFP and PEND-CFP, protoplasts isolated from 35S::FSD3-GFP plants were used. To construct 35S::PEND-CFP , PEND cDNA encoding the N-terminal 88-amino acid sequence was amplified and introduced into the Bam HI-digested pHBT-CFP plasmid. The fluorescence signal of the protoplasts was detected with a confocal microscope (STED, Leica).

9. Histochemical detection of ROS by CM-H ₂ DCFDA and nitroblue tetrazolium (NBT) staining

A slightly modified CM-H ₂ DCFDA staining was performed to visualize ROS accumulation in leaves. Two-week-old wild-type and 35S::FSD3S plants were incubated for 1 hour at 4°C in 10 μM CM-H ₂ DCFDA solution. Samples were washed with 0.1 mM KCl and 0.1 mM CaCl ₂ (pH 6.0) and then incubated for 1 hour at RT. CM-H ₂ DCFDA signals were visualized using a confocal microscope (STED, Leica). NBT staining was performed as follows. Mature rosette leaves taken from wild-type and 35S::FSD3S plants grown in soil for 6 weeks were stained with NBT staining solution (6 mM NBT, 2.7 mM KCl, 1.8 mM KH ₂ PO ₄ , 10 mM NaH ₂ PO ₄ and 137 mM NaCl [pH 7.1]). After vacuum infiltration for 10 min in the dark, the samples were exposed to light for 20 min at room temperature and then transferred to absolute ethanol to remove chlorophyll. NBT staining images were captured using a digital camera Coolpix p300 (Nikon).

result

1. FSD3S, a splicing variant of FSD3

Plastid-encoded RNA polymerase-associated protein (PAP) regulates chloroplast development by regulating the activity of the PEP (Plastid-encoded RNA polymerase) complex. We identified FSD3S, a splicing variant of FSD3/PAP4. FSD3 contains 8 exons, and mature FSD3 mRNA was created by removing 7 introns from the pre-mRNA through splicing. In contrast, FSD3S contains only 6 exons; The 6th and 7th introns remain in the mRNA (Fig. 1a). As a result of comparing the predicted amino acid sequences of FSD3 and FSD3S, it is shown that the C-terminal region of FSD3S between amino acids 215 and 256 is composed of amino acids different from those of FSD3 due to the presence of the 6th and 7th introns. . The stop codon of FSD3S is located earlier (771 bp) compared to FSD3 (792 bp). As a result, FSD3S mRNA encodes a shorter protein consisting of 256 amino acids compared to FSD3's 263 amino acids. The presence of unspliced introns also affected the properties of FSD3S (Fig. 1b). When the hydrophobicity of FSD3 and FSD3S was predicted ( http://web.expasy.org/protscale/ ), the C-terminal region, especially the region located between amino acids 230 and 250, differed between FSD3 and FSD3S. The C-terminal region of FSD3S showed much higher hydrophobicity than FSD3, suggesting that FSD3S function may be different from that of FSD3.

2. Superoxide dismutase (SOD) activity of FSD3S

FSD3 encodes iron SOD. Because FSD3 and FSD3S proteins have different properties, it was expected that the SOD activity of FSD3S protein would be different from that of FSD3 protein. To confirm this, the SOD activities of FSD3 and FSD3S proteins were analyzed (FIG. 2). We expressed MBP-fused recombinant FSD3 and FSD3S in E. coli and measured their activities by in-gel SOD activity assay. Unexpectedly, the FSD3S protein showed SOD activity, and the activity of FSD3S was slightly lower than or similar to that of FSD3. These observations suggested that the hydrophobic C-terminal region did not significantly affect the SOD activity of FSD3S.

3. Subcellular localization of FSD3S

To test whether the hydrophobic C-terminal region of FSD3S affects its subcellular localization, we generated 35S::FSD3-GFP and 35S::FSD3S-GFP transgenic plants and monitored the fluorescence signals of these transgenic plants. The localization of FSD3-GFP and FSD3S-GFP was analyzed. We tested at least four independent lines of FSD3-GFP and FSD3S-GFP transgenic plants. All transgenic plants exhibited a green fluorescence signal in the chloroplasts, despite some differences in the intensity of the GFP signal among them. However, the subcellular localization pattern of the fluorescent signal differed between 35S::FSD3-GFP and 35S::FSD3S-GFP plants (Fig. 3). The fluorescence signal of the FSD3 protein appeared as a dot-like structure in the chloroplast (FIG. 3). Co-localization tests using the nucleoid-associated proteins PEND (PEND-CFP) and FSD3 (FSD3-GFP) showed that the CFP and GFP signals co-localized in the chloroplast (Fig. 9). This showed that FSD3 is located on the nucleoid where the PAP and PEP complex functions. However, 35S::FSD3S-GFP did not show a dotted signal in the chloroplast, and the fluorescence signal of the FSD3S protein tended to be distributed throughout the chloroplast (FIG. 3). These observations suggested that FSD3 is located on chloroplast nucleoids, but FSD3S is not. These results suggest that the hydrophobic C-terminal region of FSD3S affects FSD3S localization.

4. The hydrophobic C-terminal region of FSD3S contains a transmembrane domain

Since the N-terminal region is identical between FSD3 and FSD3S proteins, but the C-terminal region is different, we expected that the hydrophobic C-terminal region of FSD3S protein could determine FSD3S localization. To confirm this, bioinformatics analysis was performed to identify some domains that could be responsible for the localization of FSD3S. This shows that the hydrophobic region of FSD3S contains a putative TM helix domain that is conserved in the transmembrane (TM) domains of many membrane and transporter proteins in plants and microorganisms (Fig. 4). These results suggest that FSD3S contains a TM helix domain in its C-terminal region and that the TM domain affects FSD3S localization. This finding was further supported by bioinformatics analysis of OsFSD3 in rice (Figs. 10 and 11). FSD3, LOC_Os06g05110.1 (OsFSD3) and its splicing variant, LOC_ Os06g05110, were identified through a protein BLAST search using the full-length amino acid sequence of Arabidopsis FSD3 (http://rice.plantbiology.msu.edu/analyses_search_blast.shtml). A rice homologue of .3(OsFSD3S) was identified. In addition, the C-terminal region of OsFSD3S protein showed higher hydrophobicity than OsFSD3, and contained the predicted TM helix region like FSD3S. These observations indicate that FSD3S has a TM helix domain in the hydrophobic C-terminal region, and the TM domain is involved in the localization of FSD3S.

5. The tendency of FSD3S to localize in the chloroplast membrane

To further understand the function of the transmembrane (TM) domain at the FSD3S locus, we generated a transgenic plant (FSD3SㅿTM-GFP) expressing a GFP-fusion FSD3S lacking the TM domain and detected fluorescence of the FSD3SㅿTM protein in the chloroplast. signal was analyzed. Similar to 35S::FSD3S plants, where GFP signals are not located on nucleoids, 35S::FSD3SㅿTM-GFP plants did not show a punctate signal in the chloroplast, and the fluorescent signal was diffuse and found throughout the chloroplast ( Fig. 5). However, the FSD3S-GFP signal was observed along the stoma-forming membrane of guard cells, but the FSD3S ㅿTM-GFP signal was not observed (FIGS. 5a and 12). These results suggest that the TM domain influences FSD3S localization and that FSD3S with a TM domain tend to localize to the membrane. To further explore the localization of SFD3S in the chloroplast, a series of optical sections were performed using the z-stack capability of the confocal microscope. This approach showed that the localization pattern of FSD3SㅿTM was different from that of the FSD3S protein (Figs. 5b and 5c). The FSD3S-GFP signal tended to be localized to the chloroplast membrane, whereas the FSD3SㅿTM-GFP signal tended to spread throughout the chloroplast. These observations suggest that the TM domain of FSD3S promotes FSD3S localization to the chloroplast membrane. This finding was supported by Western blotting analysis using proteins extracted from 35S::FSD3S-GFP and 35S::FSD3ㅿTM-GFP chloroplasts and GFP antibody (FIG. 13). Both FSD3 and FSD3S proteins were detected in the soluble fraction. However, FSD3S protein having a TM domain was also detected in the insoluble fraction, unlike FSD3ㅿTM. This suggests that FSD3S proteins with a single TM domain tend to localize to the chloroplast membrane, but may also localize to the chloroplast stroma.

6. Effect of FSD3S overexpression to reduce PEP-dependent gene expression

To confirm the function of FSD3S in chloroplast development, FSD3S overexpressing transgenic plants were generated (FIG. 14). Transgenic plants overexpressing FSD3S were smaller in size than wild-type plants grown under the same growth conditions (Figs. 6a and 6b). Overexpression of FSD3S also affected chlorophyll content and photosynthetic activity (Figs. 6c and 6d). The chlorophyll content of 35S::FSD3S transgenic plants was about 15% lower than that of wild-type plants grown under the same conditions. In addition, the photosynthetic activity of FSD3S overexpressing plants was about 6% lower than that of wild-type plants. These observations indicate that FSD3S negatively affects chloroplast development, supported by the finding that expression of FSD3S does not complement the fsd3 mutant phenotype (FIG. 15). In addition, plant growth and photosynthetic activity were reduced in plants overexpressing FSD3S-GFP and FSD3S-TM-GFP (FIG. 16). This suggests that the reduction of plant growth and photosynthetic activity is induced by the FSD3S protein accumulated in the stroma. Since PAP determines the activity of the PEP complex, which regulates the expression of photosynthetic genes, it was expected that overexpression of FSD3S would affect the expression of photosynthetic genes. To confirm FSD3S function in photosynthetic activity, we analyzed the expression of PEP-dependent and NEP-dependent chloroplast genes in 35S::FSD3S transgenic plants (Fig. 7a). Expression of the PEP-dependent genes rbcL, psbA and psaB were down-regulated in 35S::FSD3S transgenic plants, whereas expression of the NEP-dependent rpoB was similar or slightly higher than that of wild-type plants. This indicates that FSD3S negatively regulates the expression of PEP-dependent chloroplast genes, suggesting that negative regulation of PEP-dependent photosynthetic genes is involved in the reduction of photosynthetic activity by FSD3S. In addition, when the chloroplast ultrastructure of wild-type and 35S::FSD3S plants grown under the same growth conditions was analyzed, the FSD3S-overexpressing transgenic plants formed more plastoglobuli in the chloroplasts than the wild-type plants (Fig. 7b and 17). Since the formation of plastoglobulin is promoted with aging, we hypothesized that overexpression of FSD3S affects aging. Although there was no obvious difference in senescence between wild-type and 35S::FSD3S plants, we found that overexpression of FSD3S promoted the expression of the senescence-associated gene SAG12. SAG12 expression in 5-week-old leaves was higher in 35S::FSD3S than in wild-type plants (Fig. 7c). This suggests that FSD3S negatively regulates chloroplast development and is involved in senescence. This finding was supported by the expression pattern of FSD3S (FIG. 18). The transcript level of FSD3S was higher in 10-week-old senescent leaves than in 3-week-old leaves, and the transcript level of FSD3 was higher in 3-week-old leaves than in 10-week-old leaves. As a result, the transcript level of FSD3S was about 20-fold lower than that of FSD3 in young leaves, but about 2-fold lower in old leaves. These results support that FSD3 and FSD3S have different functions in chloroplast development, and suggest that FSD3S negatively regulates chloroplast development.

7. Overexpression of FSD3S does not affect ROS levels

When the level of ROS (reactive oxygen species) was analyzed through CM-H ₂ DCFDA staining, a ROS-sensitive dye with good intracellular retention in wild-type and 35S::FSD3S plants, there was a distinct difference in CM-H ₂ DCFDA staining. was not observed (FIG. 8a). This suggests that ROS levels are similar between these plants. To further test this, plants were stained with nitroblue tetrazolium (NBT) and signals were visualized. Similar to CM-H ₂ DCFDA staining, plants all showed similar NBT staining intensity (Fig. 8b), suggesting that overexpression of FSD3S did not affect ROS levels and that SOD activity of FSD3S was a negative function of FSD3S in photosynthetic activity (Fig. 8b). negative function). Instead, we found that FSD3 and FSD3S proteins interact with pTAC10, a key PAP in the PEP complex (Fig. 8c). Since the formation of the PEP complex is a key process regulating the activity of PEP and the transcription of photosynthesis-related genes, this suggests that the FSD3S-pTAC10 interaction may be involved in the negative function of FSD3S in photosynthetic activity.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> METHOD FOR REGULATING PHOTOSYNTHESIS OF PLANT <130> 20P09002 <160> 27 <170> KoPatentIn 3.0 <210> 1 <211> 771 <212> RNA <213> Arabidopsis thaliana <400> 1 atgagttctt gtgttgtgac gacaagctgt ttctatacaa tttcagattc tagtatacgt 60 ttgaaatccc ccaagctcct caatctgagt aaccagcaga gaagacgctc tcttaggtct 120 cgaggtggtt taaaggttga agcttactac ggtctaaaga cacctcctta tccacttgat 180 gctttggagc cgtatatgag tagaagaaca ctagaagtgc attggggaaa acaccatcga 240 ggttatgtag ataatctgaa taaacagtta gggaaagatg atagactcta tggatacacc 300 atggaagagc ttatcaaggc tacatacaac aacgggaatc ctttacccga gttcaacaac 360 gctgcacagg tctataacca tgatttcttc tgggagtcga tgcaacctgg tggtggagac 420 acgcctcaaa agggtgttct tgagcagatt gataaggatt ttggttcttt cacaaatttt 480 agagaaaagt tcactaatgc agctcttact cagtttggtt ctggatgggt ctggcttgtc 540 ttaaagaggg aagagagaag gcttgaggtg gtcaaaacct caaacgccat taacccactc 600 gtgtgggacg atattccaat catctgcgtg gatgtgtggg aggtacacca tctcctctct 660 tctgtcattc ttccaagaaa cactttgaaa cattttctaa tatctttcgt tttcttctct 720 tactttgcag cactcttatt atctggacta caaggtaaaa acctagctta a 771 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 gccttctagc tcacggcttg 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 gcagcgttgt tgaactcggg 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 gcagcgttgt tgaactcggg 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 tccggttgct agaacgacag 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 tccggttgct agaacgacag 20 <210> 7 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 7 gaacatctgc aatacccgg 19 <210> 8 <211> 23 <212> DNA <213> artificial sequence <220> <223> primer <400> 8 gttctaccaa ttgatatgtt tcc 23 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 9 gctgctgaat cttctactgg 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 10 gagtttcttc tcctggaacg 20 <210> 11 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 11 gtccttggat tgctgttgc 19 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 12 gagattccta gaggcatacc 20 <210> 13 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 13 gatgtcaagg ataaacaagg ac 22 <210> 14 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 14 caatcccaca caaacataca c 21 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 15 cttgcaccaa gcagcatgaa 20 <210> 16 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 16 ccgatccaga cactgtactt cc 22 <210> 17 <211> 49 <212> DNA <213> artificial sequence <220> <223> primer <400> 17 ggggacaagt ttgtacaaaa aagcaggctc catgagttct tgtgttgtg 49 <210> 18 <211> 49 <212> DNA <213> artificial sequence <220> <223> primer <400> 18 gggggaccact ttgtacaaga aagctgggtc ttaagctagg tttttacct 49 <210> 19 <211> 51 <212> DNA <213> artificial sequence <220> <223> primer <400> 19 ggggacact ttgtacaaga aagctgggtc agcgattggg atgttggggt c 51 <210> 20 <211> 51 <212> DNA <213> artificial sequence <220> <223> primer <400> 20 gggggaccact ttgtacaaga aagctgggtc agctaggttt ttaccttgta g 51 <210> 21 <211> 53 <212> DNA <213> artificial sequence <220> <223> primer <400> 21 gggggaccact ttgtacaaga aagctgggtc aaaatgtttc aaagtgtttc ttg 53 <210> 22 <211> 43 <212> DNA <213> artificial sequence <220> <223> primer <400> 22 ccccttgctc cgtggatcca tgcactctct taagactact tgc 43 <210> 23 <211> 39 <212> DNA <213> artificial sequence <220> <223> primer <400> 23 cctcgccctt gctcacggat ccaccaggac caaggactc 39 <210> 24 <211> 18 <212> DNA <213> artificial sequence <220> <223> primer <400> 24 gtgagcaagg gcgaggag 18 <210> 25 <211> 45 <212> DNA <213> artificial sequence <220> <223> primer <400> 25 ccaaatgttt gaacgatctg cagtcacttg tacagctcgt ccatg 45 <210> 26 <211> 46 <212> DNA <213> artificial sequence <220> <223> primer <400> 26 ggaaccaatt cagtcgactg gatccatgca gatttgccaa accaag 46 <210> 27 <211> 41 <212> DNA <213> artificial sequence <220> <223> primer <400> 27 caggcctccg cttgcggccg cgtctgtcaa gacttgagta c 41

Claims (7)

Regulating the expression of the Fe-superoxide dismutase 3 splicing variant (FSD3S) gene of the plant,
Plant photosynthetic efficiency control method for increasing plant photosynthetic efficiency by deleting or inhibiting the expression of the gene.
The method of claim 1,
The FSD3S gene is a splicing variant comprising introns 6 and 7 of the FSD3 gene, a method for regulating plant photosynthetic efficiency.
The method of claim 1,
The FSD3S gene is a plant photosynthetic efficiency control method consisting of the sequence of SEQ ID NO: 1.
delete The method of claim 1,
Deletion or inhibition of the FSD3S gene expression is CRISPR / Cas nuclease ((Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR-associated sequences nuclease), T-DNA (transfer-DNA), siRNA (small interfering RNA), shRNA (short Hairpin RNA), miRNA (microRNA), ribozyme (ribozyme) or PNA (peptide nucleic acids) is introduced into plants or plant cells, performed by introducing a plant photosynthetic efficiency control method.
Contains a plant FSD3S (Fe-superoxide dismutase 3 splicing variant) gene expression regulator,
The expression regulator is CRISPR/Cas nuclease (Clustered Regularly Interspaced Short Palindromic Repeats/ CRISPR-associated sequences nuclease), T-DNA (transfer-DNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme (ribozyme) and PNA (peptide nucleic acids) expression deficiency or inhibitors selected from the group consisting of plant photosynthetic efficiency control composition. delete

Images