KR101752324B1 - Method for increasing both phothosynthetic rate and tolerance to drought and salt stresses in plants - Google Patents

Abstract

The present invention relates to an expression vector comprising a gene inducing plant resistance to the enhancement of the photosynthetic efficiency of a plant and the resistance to drying and salting stress without causing dwarfishism, a transformed plant transformed therewith, and a plant using the gene to increase photosynthetic efficiency And to a method for inducing resistance of plants to drying and salting stress. The CANP (CIPK1-Associating Nuclear Protein) gene according to the present invention was found to be involved in the CBL1 / CBL9-CIPK1 calcium signaling pathway, and the transgenic plant overexpressing this gene promoted the photosynthetic efficiency of plants without the side effects of dwarfism Resistant and salt tolerant phenotype. Therefore, these CANP genes can be usefully used for the development of crops resistant to drought and salinity.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for simultaneously increasing the photosynthetic efficiency of a plant, drought and salt resistance,

The present invention relates to an expression vector comprising a gene which promotes the photosynthetic efficiency of a plant and induces resistance of plants to the stress of drying and salting without damaging the plant, the transformed plant transformed thereby, and the photosynthetic efficiency And to a method for inducing resistance of a plant to stress on drying and salting.

Globally, the use of excessive fertilizer to increase crop yields is a serious problem. This has led to the salinization of agricultural land, which is increasing the damage to crops. In addition, damage to agricultural land is increasing by about 500,000 hectares every year due to the increase of sea level, which is the damage of salting. Thus, in recent years, the development of crops resistant to salinity has been proposed as the most effective strategy for the production of crops in soils damaged by salting.

Drought also has a significant impact on crop production. Globally, drought-affected areas in the world have increased by 15-25% since 1960, according to the Palmer Drought Severity Index (PDSI). Rice yields are 5.82% for drought- Corn is down 11.98%, and crop production by 2050 is expected to decline by more than 50%.

The CBL-CIPK calcium signaling network, first identified in Arabidopsis model plants, is known to play an important role in various abiotic environmental stress responses such as drought, high saltiness, and low temperature. There are 10 CBL and 26 CIPK genes in Arabidopsis, and interestingly, nearly all of the plants, including rice, wheat, soybeans and corn, have very similar genes to Arabidopsis CBL and CIPK families . Therefore, CBL-CIPK-related intrinsic information obtained from the Arabidopsis thaliana plant could be applied to other crops.

To date, CBL, a calcium sensor, has been shown to form complexes with CIPK, a serine / threonine protein kinase, in the cytoplasm, plasma membrane, or vacuolar membrane. It has not been known whether the CBL-CIPK complex formed outside the nucleus regulates the expression of stress genes by signaling into the nucleus through any mechanism.

The present invention relates to an expression vector comprising a gene inducing plant resistance to the enhancement of the photosynthetic efficiency of a plant and to the resistance to drying and salting stress without dwarfism, a transformed plant transformed thereby and a method for producing the same, a seed of the transgenic plant And a method for producing the same, a plant cell derived from the transgenic plant, a method for promoting photosynthetic efficiency of a plant using the gene, and a method for inducing resistance to a plant against drying and salting stress.

The present inventors have been continuously studying the Arabidopsis CBL1 / CBL9-CIPK1 calcium signaling pathway, which is known to play an important role in plant response to environmental disasters such as drought and salting. Since it was not known how CBL1 / CBL9-CIPK1 complex formed in the plasma membrane of cells regulates the expression of stress genes by transferring signals into the nucleus, the present inventors found that the proteins interacting with CIPK1 by yeast two- (CIPK1-Associating Nuclear Protein (CANP)), and identified its mechanism of action.

As a result, normal CANP complexes with CIPK1 in cytoplasm. However, when calcium signal is generated by drought or salt, CBL1 / CBL9 protein interacts with CIPK1 and CANP is separated from CIPK1 It enters the nucleus. CANP, which enters into the nucleus, interacts with the bZIP transcription factor AREB / ABF to increase the promoter activity of the stress gene with the ABRE cis-acting element, thereby increasing the resistance to aridity and resistance to salt. In addition, overexpression of the gene has been shown to result in increased photosynthetic efficiency of plants without dwarfism.

Accordingly, the present invention provides an expression vector comprising a gene CANP (CIPK1-Associating Nuclear Protein) that induces plant resistance to photosynthetic efficiency enhancement and dry and salt stress, without transforming plants, And a method for promoting the photosynthesis efficiency of a plant using the gene and inducing resistance of plants to drying and salting stress.

In one embodiment, the present invention provides a recombinant vector for the production of transgenic plants comprising the gene CANP (CIPK1-Associating Nuclear Protein) which induces plant resistance to increased photosynthetic efficiency and photosensitivity of plants without dwarfism.

More particularly, the present invention relates to a method for the production of a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 13 or a conserved sequence comprising RED_N_Superfamily and RED_C_Superfamily at the N- and C- There is provided a recombinant vector for transgenic plant production comprising a CANP (CIPK1-Associating Nuclear Protein) gene encoding an amino acid sequence enhanced in photosynthetic efficiency and enhanced in resistance to drying and salting stress.

In the present invention, the CANP (CIPK1-Associating Nuclear Protein) gene refers to a CANP that is used in the present invention for studying the CBL1 / CBL9-CIPK1 calcium signaling pathway and tomato-derived CANP, It is a concept that includes all CANPs from various plants.

In one embodiment of the present invention, the CANP (CIPK1-Associating Nuclear Protein) gene encodes an amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 13 or a conserved sequence RED_N_Superfamily and RED_C_Superfamily, Is a gene encoding an amino acid sequence consisting of 540 to 600 amino acids contained in N-terminus and C-terminus, respectively.

Herein, the amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 13 correspond to the Arabidopsis thaliana (SEQ ID NO: 1, NCBI No. NP_180214), rice (SEQ ID NO: 2, NCBI No. EEC67667), corn (SEQ ID NO: 3, NCBI No. NP_001105988 ), Soybean (SEQ ID NO: 4, NCBI No. XP_003533803), potato (SEQ ID NO: 5, NCBI No. XP_006344564), group (SEQ ID NO: 6, NCBI No. XP_004978650) 11, NCBI No. XP_004242897), cucumber (SEQ ID No. 8, NCBI No. XP_004136540), grape (SEQ ID No. 9, NCBI No. XP_002274576), strawberry (SEQ ID No. 10, NCBI No. XP_004287674) NCBI No. KDO73769), peach (SEQ ID NO: 12, NCBI No. XP_007204321), and cacao (SEQ ID NO: 13, NCBI No. XP_007012533).

On the other hand, the Arabidopsis thaliana CANP gene has been reported to have high homology with human RED or murine MuRED genes (E. Assier et al., Gene 230 (1999) 145-154). In this report, the CANP gene of Arabidopsis is an undifferentiated protein possessing "RED-like protein N-terminal region" and "RED-like protein C-terminal region" which are highly homologous with RED gene It turned out. The position of the RED-like protein N-terminal region is located at positions 5 to 214 of the amino acid sequence of SEQ ID NO: 1 and the position of the RED-like protein C-terminal region is at positions 461 to 585 of the amino acid sequence of SEQ ID NO: .

As a result of the research conducted by the present inventors, "RED-like protein N-terminal region" and "RED-like protein C-terminal region" appearing in Arabidopsis are evolutionarily conserved conserved sequences in most plants, Is contained in the N-terminus and C-terminus of the CANP (CIPK1-Associating Nuclear Protein) gene referred to in the present invention. In the present invention, these conserved sequences are referred to as RED_N_Superfamily and RED_C_Superfamily, respectively. From FIG. 16 showing the alignment results of the amino acid sequences of SEQ ID NOS: 1 to 13, it can be seen that the conserved sequences RED_N_Superfamily and RED_C_Superfamily are commonly present in the CANPs of most major crops. The amino acid sequence encoding the CANP gene is not limited thereto, but is fixed to 540 to 600 amino acids. This indicates that the amino acid sequences encoded by the CANP gene are not highly conserved in the sequences other than the conserved sequences RED_N_Superfamily and RED_C_Superfamily, and the sequence homology is very high. Therefore, as the CANP gene of the present invention, RED_N_Superfamily and RED_C_Superfamily, which are conserved sequences, as well as genes coding for the amino acid sequences of SEQ ID NOS: 1 to 13, And a gene encoding an amino acid sequence consisting of 540 to 600 amino acids contained in the C-terminus.

RED_N_Superfamily and RED_C_Superfamily defined in this specification may include 7 and 4 storage sequence blocks, respectively, as shown in FIG. These preserved sequence blocks are arbitrary block representations of the regions having the highest degree of conservation among the sequences belonging to RED_N_Superfamily or RED_N_Superfamily, and RED_N_Superfamily or RED_N_Superfamily defined in this specification are not necessarily limited thereto. In the following block, the amino acid represented by X _n means any amino acid existing at the n-th position, and what amino acid X _n is represented separately below. These sequences are commonly represented by Xaa representing any amino acid in the attached sequence listing, and the type of amino acid according to the position will be described in the detailed description of the sequence.

RED_N_Superfamily Block A

SEQ ID NO: 14: PKYRDRAKX ₉ X ₁₀ X ₁₁ ENQNPX ₁₇ YD

X ₉ = E or D

X ₁₀ = D or E

X ₁₁ = Q or K

X ₁₇ = E or D

RED_N_Superfamily Block B

SEQ ID NO: 15: FHAVAPPG

RED_N_Superfamily block C

SEQ ID NO: 16: KISIEX ₆ SKYLGGDVEHTHLVKGLDYALLX ₂₉ KVRSEIX ₃₆ KKP

X ₆ = K, N or H

X ₂₉ = N, H, or T

X ₃₆ = D, E, or V

RED_N_Superfamily block D

SEQ ID NO: 17: AKSVYX ₆ X ₇ WX ₉ VKPQ

X ₆ = Q or K

X ₇ = W or C

X ₉ = V or I

RED_N_Superfamily block E

SEQ ID NO: 18: KX ₆ NEX ₅ FLPGRX ₁₁ X ₁₂ FVY

X ₂ = S, T, or E

X ₅ = M, T or L

X ₁₁ = M, T, or L

X ₁₂ = T, A or S

RED_N_Superfamily block F

SEQ ID NO: 19: DIPX ₄ TLX ₇ RSKADC

X ₄ = T or M

X ₇ = H or Y

RED_N_Superfamily block G

SEQ ID NO: 20: MSYLRLGSS

RED_C_Superfamily block H

SEQ ID NO: 21: YSECYPGYQEYN

RED_C_Superfamily Block I

SEQ ID NO: 22: DLSKMDMGGKAKGX ₁₄ LHRWDFX ₂₇ TEEEWE

X ₁₄ = R or G

X ₂₇ = A or E

RED_C_Superfamily block J

SEQ ID NO: 23: QKEAMPKAAFQFGVKMQDGRKTRKQNRD

RED_C_Superfamily Block K

SEQ ID NO: 24: QKLX ₄ NX ₆ LX ₈ X ₉ INKILX ₁₅ RKK

X ₄ = N, T, or S

X ₆ = E or D

X ₈ = H or N

X ₉ = K, Q or R

X ₁₅ = A or T

The recombinant vector containing the CANP gene is prepared by inserting the gene into a known expression vector used for transformation of a plant. In the present invention, "vector" means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector , And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

As used herein, "transformation" refers to introducing and integrating a nucleic acid encoding a heterologous gene to be introduced into a host cell of a plant or a vector comprising the nucleic acid into a host cell to produce a genetically stable genetic material, &Quot; Transgenic plant " means a plant in which the heterologous gene has been introduced and genetically stably integrated to obtain the desired phenotype.

With regard to producing transgenic plants, genetic engineering methods of plants are well known in the art. Numerous methods for plant transformation have been developed, including, for example, biological and physiological transformation protocols for dicotyledonous plants as well as dicotyledonous plants (see, for example, Goto-Fumiyuki et al., Nature Biotech 17: CRC Press, Inc., Boca Raton, pp. 67-88 (1993)], which is incorporated herein by reference in its entirety); [Miki et al., Methods in Plant Molecular Biology and Biotechnology, Glick, BR and Thompson, JE Eds. ). In addition, vector and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available, for example, in the following references: Gruber et al., Methods in Plant Molecular Biology and Biotechnology, Glick, BR and Thompson, JE Eds., CRC Press, Inc., Boca Raton, pp. 89-119 (1993)].

For example, a number of techniques are available for transforming desired genes into plant host cells. These techniques include, but are not limited to, transformation with non-arm T-DNA using Agrobacterium tumefaciens or Agrobacterium rejugens as a transformation agonist, calcium phosphate transfection, polybrene transformation, protoplast fusion, , Ultrasound method (e.g., sonophoresis), liposome transformation, microinjection, intact DNA, plasmid vectors, viral vectors, biolistics (ultrafine particle impact), silicon carbide WHISKERS mediated transformation, aerosol beading , Or PEG transformation as well as other possible methods.

The present invention also provides a composition for the production of a transgenic plant comprising a recombinant vector comprising the CANP gene, wherein the photosynthetic efficiency is enhanced and the resistance to drying and salting stress is enhanced. In addition to the recombinant vector comprising the CANP gene according to the present invention, the composition for preparing a transgenic plant may further comprise a carrier for transferring the recombinant vector to the host cell, or a carrier or buffer necessary for transformation .

The present invention also relates to a method for enhancing the photosynthetic efficiency of plants and enhancing resistance to drying and salting stress without overexpression of CANP gene in a host cell by transforming a host cell with a recombinant vector containing the CANP gene, A method for producing a transgenic plant is provided.

As described above, the host cell can be transformed by a conventional method using the recombinant vector containing the CANP gene. The host cell according to the present invention is a plant cell to which resistance to drought and salt damage is to be increased and photosynthetic efficiency is to be improved.

The present invention also provides a transgenic plant transformed with a recombinant vector comprising the CANP gene, the plant having enhanced photosynthetic efficiency and enhanced resistance to drying and salting stress, and seeds thereof. But are not limited to, for example, rice plants, rice, corn, beans, potatoes, marsupials, tomatoes, cucumbers, grapes, strawberries, oranges , Peaches or cacao.

After introduction of heterologous foreign DNA into plant cells, transformation or integration of the heterologous gene in the plant genome is identified by a variety of methods, such as analysis of nucleic acids, proteins or metabolites associated therewith.

For example, PCR analysis is a rapid method for screening transformed cells, tissues or suites for the presence of genes involved in the early stages prior to transplantation into soil (Sambrook and Russell, " Molecular Cloning: A Laboratory Manual " (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001)). PCR is carried out using oligonucleotide primers specific for the gene of interest or Agrobacterium vector.

In addition, plant transformation can be confirmed by Southern blot analysis of genomic DNA. In general, whole DNA is extracted from a transformant, digested with appropriate restriction enzymes, fractionated in an agarose gel, filtered through a nitrocellulose or nylon membrane . The membrane or "blot" can then be irradiated with a ³² P target DNA fragment labeled, for example, as a radioactive element, to confirm integration of the introduced gene in the plant genome according to standard techniques Sambrook and Russell (2001)).

For Northern analysis, the RNA is separated from the specific tissue of the transformant, fractionated in formaldehyde agarose gels, and analyzed on a nylon filter according to standard procedures routinely used in the art (Sambrook and Russell (2001), supra). Expression of the RNA encoded by the nucleotide sequences of the present invention is then tested by hybridizing the filter to a radiolabel derived from GDC by methods known in the art (see Sambrook and Russell, 2001).

Immunoprecipitates are prepared using antibodies that bind to one or more epitopes that are present on the herbicide-resistant protein, such as Western blot, ELISA, lateral flow tests, and biochemical assays, To determine the presence of the protein encoded by the herbicide tolerance gene by the transgenic plants.

After introducing the genetic construct into plant cells, plant cells can grow and mature plants can be produced at the time of emergence of differentiable tissues such as shoots and roots. In some embodiments, multiple plants may be generated. Methodologies for regenerating plants are known to those of ordinary skill in the art and are described, for example, in Plant Cell and Tissue Culture, 1994, Vasil and Thorpe Eds. Kluwer Academic Publishers] and [Plant Cell Culture Protocols (Methods in Molecular Biology 111, 1999 Hall Eds Humana Press). The genetically modified plants described herein can be cultivated in a fermentation medium or grown in a suitable medium such as soil. In some embodiments, growth media suitable for higher plants may include growth media for all plants, including soil, sand, all other particulate media (e.g., vermiculite, perlite, etc.) that support root growth, But are not limited to, nutritional supplements that optimize the growth of suitable light, water, and higher plants.

Transgenic plant cells produced by any of the above transformation techniques can be cultured to harvest the transformed genotype and regenerate whole plants with the desired phenotype. This regeneration technique depends on the manipulation of the particular plant hormone in the tissue culture growth medium, typically depending on the biocide and / or herbicide marker introduced with the desired nucleotide sequence. Plant regeneration from cultured protoplasts is described in Evans, et al., "Protoplasts Isolation and Culture" in Handbook of Plant Cell Culture , pp. 124-176, Macmillian Publishing Company, New York, 1983; And Binding, Regeneration of Plants, Plant Protoplasts , pp. 21-73, CRC Press, Boca Raton, 1985). Regeneration can also be obtained from plant callus, eating horns, organs, pollen, embryos, or parts thereof. Such regeneration techniques are generally described in Klee et al. (1987) Ann. Rev. of Plant Phys . 38: 467-486.

It will be appreciated by those skilled in the art that the use of reporter or marker genes to select transformed cells or tissues or plant parts or plants may be included in the transformation vector or construct. Examples of selectable markers include those that confer resistance to antimetabolites, such as herbicides or antibiotics, such as dihydrofolate reductase, which confers resistance to methotrexate (Reiss, Plant Physiol. (Life Sci. (Herrera Estrella et al., Nature 303: 209-213, 1983; Meijer et al., Plant Mol. Biol. 16: 807-820, 1991); Neomycin phosphotransferase (Herrera-Estrella, EMBO J. 2: 987-995, 1983) and Fraley et al. Proc. Natl. Immunol.) Which confers resistance to aminoglycoside neomycin, kanamycin and paromycin. (Marsh, Gene 32: 481-485, 1984; Waldron et al., &Quot; Acad. Sci. USA 80: 4803 (1983)] and hygromycin phosphotransferase which confers resistance to hygromycin Plant Mol. Biol. 5: 103-108, 1985; Zhijian et al., Plant Science 108: 219-227, 1995); TrpB, which allows cells to utilize indole instead of tryptophan; HisD (Hartman, Proc. Natl. Acad. Sci., USA 85: 8047, 1988), which allows cells to utilize histinol instead of histidine; Mannose-6-phosphate isomerase (WO 94/20627) which allows cells to utilize mannose; Ornithine decarboxylase inhibitor, ornithine decarboxylase inhibitor, which imparts resistance to 2- (difluoromethyl) -DL-ornithine (DFMO) (McConlogue, 1987, In: Current Communications in Molecular Biology , Cold Spring Harbor Laboratory ed.); And Aspergillus < RTI ID = 0.0 > ( Aspergillus < / RTI > deaminase (documents from terreus): and a [Tamura, Biosci Biotechnol Biochem 59. .. 2336-2338, 1995]).

Unless specifically defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology are described, for example, in Lewin B., Genes V , Oxford University Press, 1994 (ISBN 0-19-854287-9); [Kendrew et al. (eds.), The Encyclopedia of Molecular Biology , Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); And Meyers RA (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference , VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

The present invention also provides a method for producing an amino acid sequence comprising 540 to 600 amino acid residues in which RED_N_Superfamily and RED_C_Superfamily which encode the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 13 or conserved sequences are included at the N- and C- Plant cells derived from a transgenic plant transformed with a recombinant vector comprising a CANP (CIPK1-Associating Nuclear Protein) gene coding for enhancing photosynthesis efficiency and enhanced resistance to drying and salting stress. It is obvious that the "transgenic plant" according to the present invention includes not only mature plants and parts thereof, that is, leaves, stems, flowers and fruits but also plant cells constituting plants and tissues.

The present invention also provides a method of producing seeds of a transgenic plant having enhanced photosynthetic efficiency and enhanced resistance to drying and salting stress, comprising the steps of:

(a) encoding an amino acid sequence consisting of 540 to 600 amino acid residues in the N-terminus and C-terminus of RED_N_Superfamily and RED_C_Superfamily which encode the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 13 or conserved sequences, Transforming a plant with a vector comprising a CANP (CIPK1-Associating Nuclear Protein) gene;

(b) screening plant populations that exhibit one or more phenotypes of the CANP gene being introduced, thereby increasing resistance to salt, dryness, and photosynthetic efficiency; And

(c) seeding the seed from the selected plant population.

The method of transformation and the selection method of the transgenic plant populations are as described above.

Seeds harvested from selected transgenic plants may exhibit one or more phenotypes of resistance to salt, dryness, and increase in photosynthetic efficiency.

According to the present invention, the CANP (CIPK1-Associating Nuclear Protein) gene has been shown to be involved in the CBL1 / CBL9-CIPK1 calcium signaling pathway. Transgenic plants overexpressing this gene are able to increase photosynthetic efficiency, And a salt tolerance phenotype. Therefore, these CANP genes can be usefully used for the development of crops resistant to drought and salinity.

Figure 1 is a schematic representation of CANP protein assay results.
Figure 2 is a schematic representation of the CANP full-length cDNA sequence.
FIG. 3 is a diagram showing that the full-length CANP interacts with CIPK1 through a yeast two-hybrid assay.
Figure 4 is a schematic diagram (A) of pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA and their expression on onion (B), Arabidopsis thaliana (C), and tobacco (D) Focused laser scanning shows the result of observing the complex of CANP and CIPK1 protein.
Figure 5 shows a schematic diagram (A) of the pGADT7.CANP and pBridge.CIPK1 / CBL1 (or CBL9) constructs and an analysis (B) of the yeast three-hybrid assay.
Figure 6 shows intracellular migration of CANP-GFP by calcium treatment.
FIG. 7 shows a schematic diagram (A) of a canp mutant line in which T-DNA is inserted in the CANP gene, a genomic Southern blot assay result (B), and an RT-PCR analysis result (C).
FIG. 8 shows the complementation construct of the CANP gene (A) and real-time RT-PCR analysis of CANP / CANP complementation plant (B).
Figures 9 and 10 show the reactivity of canp mutants and wild type against salting stress.
Figure 11 shows the reactivity of canp mutants and wild type against drought stress.
12 shows a schematic diagram (A) of a plant transforming construct (pBI121ΔGUS.CANP) for the production of an Arabidopsis plant with overexpression of CANP and a screening (B) of a transformant through real-time RT-PCR .
Figure 13 shows the resistance of CANP overexpressing transformants to salt stress.
Figure 14 shows the resistance of CANP overexpressants to drought stress.
Fig. 15 is a graph showing the increase in the photosynthetic efficiency of CANP overexpressor compared to the wild type.
Figure 16 shows the results of sequencing showing the evolutionary conservation of the CANP gene.
Fig. 17 shows the results of comparing the amino acid sequences of the Arabidopsis thaliana CANP (AtCANP) and the tomato CANP (SlCANP).
Figure 18 shows the structure of the tomato CANP overexpression vector (pATC940 vector).
Fig. 19 shows the soil purification of tomato wild type (WT) and tomato CANP overexpressing transformants.
FIG. 20 shows the results of real-time RT-PCR in which the amount of SlCANP gene expression was confirmed in a tomato CANP overexpressing transformant.
Figure 21 shows the appearance of tomato wild type (WT) and CANP overexpressed (SICANP OX-1 and SICANP OX-3) grown in soil for 7 weeks.
FIG. 22 is a graph showing the increase in the photosynthetic efficiency of an overexpressed tomato cannabis, compared to the wild type.

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. The present invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Is provided to fully convey the scope of the invention to those skilled in the art, and the invention is only defined by the scope of the claims.

[ Example ]

I. CANP ( CIPK1 -Associating Nuclear Protein), and Arabidopsis CANP  Generation and phenotyping of transgenic Arabidopsis overexpressing genes

<Experimental Methods and Materials>

1. Yeast Two-Hybrid Screening

Y190 yeast cell line, auxotroph of His, Leu and Trp, was used for yeast transformation. Y190 cells were streaked on YPD medium (bacto yeast extract, bacto peptone, glucose) to obtain a single clone of Y190 cells. The clonidine was cultured in 5 ml of YPD medium and precultured at 30 ° C and 200 rpm for 14-16 hours. OD _600nm = 1.0 ~ 2.0, and incubated until the cells were transferred to a 5 to 50 ㎖ ㎖ YPD medium OD _600nm = 0.2 to 0.5. The cultured cells were centrifuged at 3,000 rpm for 5 minutes to precipitate, the medium was removed, and the medium was washed with 20 ml of distilled water and resuspended in 1 ml of distilled water. The cells were then transferred to a 1.5 ml tube and centrifuged at 13,200 rpm for 15 seconds to completely remove the supernatant. 400 쨉 l of 100 mM lithium acetate (pH 7.5) was added to the remaining cells, followed by resuspension and incubation at 30 째 C for 15 minutes. In the meantime, 2 mg / ml salmon sperm DNA was boiled for 10 minutes and placed in ice for cooling. The transforming mix (50% PEG solution, 1 M Litume Acetate, DI, salmon sperm DNA) was prepared. After 15 min incubation, cells were divided into 50 μl aliquots, centrifuged for 15 sec, and the supernatant was removed. The transforming DNA and transformation mix were mixed well and incubated at 30 ° C for 30 min. After heat shock at 42 ° C for 20 minutes, the transformation mix solution was removed by centrifugation at 13,200 rpm and resuspended in 1 ml of distilled water. 200 μl aliquots were spread in the SC-LW (synthetic complete medium lacking Leu and Trp) medium and grown at 30 ° C for 3 days.

2. β- Galactosidase  Filter-Lift Assay

The transformed yeast cells were streaked on SC-LW plate medium and grown at 30 ° C, followed by β-galactosidase filter-lift assay as follows. First, to 1.8 ml of a Z buffer (60 mM Na ₂ HPO ₄ H ₂ O, 40 mM Na ₂ HPO ₄ , 10 mM KCl, 1 mM MgSO ₄ ) was added 5-bromo-4chloro-3-indolyl- 90 μl of β-D-galactosidase (20 mg / ml) is added, and 4.86 μl of β-mercaptoethanol is mixed. The solution is poured into a Petri dish and 3MM peter is placed upright. Then, a nitrocellulose filter (Osmonics Inc., NitroPure, 45 Micron, 82 mm) was placed on the cell-containing plate to transfer the cells to the membrane. When the cells were transferred to the membrane, the membrane was immersed in liquid nitrogen, the cells were frozen and taken out at room temperature. At this time, the part with the cell always comes up. The melted membranes were superimposed on paper moistened with a Z-buffer containing X-gal and incubated at 30 ° C to observe for blue coloration.

3. Fabrication of plasmid

To generate the pGAD.CANP plasmid, the coding region of the CANP cDNA was amplified with CANP-1 and CANP-2 primers, and the PCR product was cloned into the EcoRI and SalI sites of the pGAD.GH vector. To construct pGEX.4T-3.CANP, the pGAD.CANP plasmid was digested with EcoRI and SalI restriction enzymes, and the insert was inserted into the pGEX.4T-3 vector. To obtain the promoter region of CANP gene, Col-0 genomic DNA was used as a template and PCR was performed using CANP-PF and CANP-PR primers. The 1,560 bp PCR product was digested with HindIII and BamHI and cloned into the pBI101.1 vector containing the GUS gene to construct pBI101.CANPp plasmid. PCR was performed using CANP-5 and CANP-6 primer sets to construct the pMDDI.CANP plasmid, and the CANP PCR product lacking the termination codon was obtained and digested with XbaI and BamHI restriction enzymes. This was cloned into a binary vector pMDDI (Shiu et al., 1996) in which sGFP (S65T) was inserted to create a CANP-GFP construct. PCR was performed with CANP-11 and CANP-6 primers using the CANP cDNA template to construct the pMDDI.CANPC plasmid, and the amplified PCR products were digested with XbaI and BamHI restriction enzymes. This PCR product was inserted into the pMDDI vector to construct a CANPC-GFP construct with the N-terminal deletion. To construct pCAM35S.CBL9 and pCAM35S.CIPK1, CBL9 and CIPK1 cDNA were amplified using a template using CBL9-3 / CBL9-4 primer and CIPK1-14 / CIPK1-23 primer set. The amplified PCR products were digested with XbaI and BamHI restriction enzymes, respectively, and cloned into pCAM35S vector. To generate the complementation line, 5,700 bp genomic DNA fragments including 2,000 bp of the start codon and the stop codon of the CANP gene and 3,700 bp of the promoter region were amplified by PCR using CANPP-1 and CANP-17 primer sets The pCAM1300.CANPG plasmid was constructed by inserting it into the plant transformation vector pCAM1300 vector. To construct the pVYNE.CANP-c-myc and pMAS.SCYCE (R) .CIPK1-HA constructs, CANP-5 / CANP-10 and CIPK1-14 / CIPK1-23 primer sets were used as templates for CANP and CIPK1 cDNA Respectively. Each of the obtained PCR products was digested with XbaI and BamHI restriction enzymes and cloned into pVYNE-c-myc, pMAS.SCYCE (R) -HA vector. To obtain CANP overexpression construct (pBI121ΔGUS.CANP), PCR products using CANP-5 and CANP-10 primer sets were digested with XbaI and BamHI restriction enzymes and cloned into pBI121ΔGUS vector with CaMV 35S promoter inserted. To perform Yeast three hyrid, pGADT7.CANP, pBridge.CIPK1, pBridge.CIPK1 / CBL1 and pBridge.CIPK1 / CBL9 were prepared. pGADT7.CANP and pBridge.CIPK1 amplified CANP and CIPK1 cDNA as template using CANP-12 / CANP-2 primer and CIPK1-15 / CIPK1-2 primer set. The amplified PCR products were digested with EcoRI and SalI and cloned into pGADT7 and pBridge vectors, respectively. In addition, pBridge.CIPK1 / CBL1 and pBridge.CIPK1 / CBL9 were amplified using CBL1-7 / CBL1-8 primer and CBL9-5 / CBL9-6 primer set with CBL1 and CBL9 cDNA as template, , Digested with BglII and cloned into pBridge.CIPK1 plasmid. All constructed constructs were identified by DNA sequencing.

4. Used in plasmid construction Oligonucleotide primer

The primers used in this study are listed underlined with restriction sites. Considering the influence of formation of Dimer and hairpin and the Tm value, three additional bases were added to the 5 'end of the primer, and then a primer was prepared by attaching a restriction enzyme site as necessary.

CANP-1, 5'-TAA GAATTC AATGAAACCTTCAAAATCGC-3 '(SEQ ID NO: 25);

CANP-2, 5'-GAT GTCGAC TCAATGCTT-GGATCTCTTA-3 '(SEQ ID NO: 26);

CANP-5, 5'-TAA TCTAGA ATGAAACCTTCAAAATCGCA-3 '(SEQ ID NO: 27);

CANP-6, 5'-TTT GGATCC ATGCTTGGATCTCTTAGGAG-3 '( SEQ ID NO: 28);

CANP-10, 5'-TTT GGATCC TCAATGCTT-GGATCTCTTAG-3 '( SEQ ID NO: 29);

CANP-11, 5'-AAA TCTAGA ATGCGTGCTAAAGAAAGAAG-3 '(SEQ ID NO: 30);

CANP-12, 5'-TAA GAATTC ATGAAACCTTCAAAATCGCA-3` (SEQ ID NO: 31);

CANP-17, 5 &apos; -TTT TCTAGA TCAATGCTTGG-ATCTCTTAG-3 &apos; (SEQ ID NO: 32);

CANPP-1, 5 &apos; -ACT AAGCTT CTTGGTGATAAGGATTCAAT-3 &apos; (SEQ ID NO: 33);

CANP-PF, 5'-ACT AAGCTT CTTGGTGATAAGGATTCAAT-3 '(SEQ ID NO: 34);

CANP-PR, 5'-ATA GGATCC TAGATTTCGT-TAATTCGATT-3 '( SEQ ID NO: 35);

CIPK1-2, 5'-TTA GTCGAC CTAAGTTACTATCTCTTGCT-3 (SEQ ID NO: 36);

CIPK1-14, 5'-ATA TCTAGA ATGGTGAGAAGGCAAGAGGA-3 '(SEQ ID NO: 37);

CIPK1-23, 5'-TTT GGATCC AGTTACTATCTCT- TGCTCCG-3 '( SEQ ID NO: 38);

CIPK1-15, 5'-ATA GAATTC ATGGTGAGAAGGCAAGAGGA-3 '(SEQ ID NO: 39);

CBL1-7, 5 &apos; -ATA GCGGCCGC AATGGGCTGCTTCCACTC-3 &apos; (SEQ ID NO: 40);

CBL1-8, 5'-TAA AGATCT TCATGTGGCAATC-TCATCGA-3 '(SEQ ID NO: 41)

CBL9-3, 5'-TTT TCTAGA ATGGGTTGTTTCCATTCCAC- 3` (SEQ ID NO: 42);

CBL9-4, 5`-AAA GGATCC - TCACGTCGCAATCTCGTCCA -3` ( SEQ ID NO: 43);

CBL9-5, 5'-TTA GCGGCCGC AATGGGTTGTTTCCATTC-3` (SEQ ID NO: 44);

CBL9-6, 5'-TTT AGATCT TCACGTCGCAATCTCGTCCA- 3` (SEQ ID NO: 45).

5. Particle Bambardments

The pMDDI.CANP construct was coated on a tungsten microcarrier (Bio-RAD, Tungsten M-17, 11.1 micron) and inserted into onion cells using particle bambardment (Bio-RAD Laboratories). First, the plasmid was prepared at a concentration of 5 ㎍. Then, 1 mg of 100% ethanol was added to 3 mg of tungsten, resuspended, and centrifuged at 10,000 rpm for 10 seconds. The supernatant was removed, washed twice with 1 ml of sterile water, centrifuged to remove supernatant, and 30 μl of sterile water was added. 5 [mu] g of CANP plasmid was added to tungsten and vortexed. DNA was coated on tungsten by vortexing for 3 minutes while adding 50 μl of 2.5 M CaCl ₂ and 20 μl of 0.1 m spermidine. Thereafter, the supernatant was removed by centrifugation at 10,000 rpm for 10 seconds, and 250 μl of 100% ethanol was added to the supernatant. The supernatant was removed by centrifugation, and 60 μl of ethanol was added. After putting the macrocarrier in the macrocarrier holder, tungsten coated with plasmid was taped on it and loosened, and then 10 μl of the tungsten was dropped and dried. The epidermal layer of onion was separated and prepared on MS medium. A 1,100 psi rupture disk (Bio-RAD Laboratories) was used for bambardment and then incubated at 23 ° C for 16-24 hours.

6. DAPI  dyeing

Particle bambardment To stain DAPI with a sample, DAPI was made in DMSO to 5,000-fold at 10 mg / ml. DAPI was diluted 1 / 5,000 in running buffer (1X PBS buffer, 5 mM sodium phosphate, pH 7.0, 10 mM EDTA, 0.01% Tween-80) and the tissue was incubated in this buffer for 5 minutes. The buffers were then removed and the stained, remaining DAPI was washed by incubation three times for 5 min each in a buffer without DAPI.

7. Protoplast Isolation and DNA Injection

The leaf was picked from 4-week-old Arabidopsis plant which did not come up from the peduncle and cut to a thickness of 0.5 ~ 1 mm. Cut immediately leaves Enzyme solution (20 mM MES, pH 5.7, containing 1.5% (w / v) cellulase R10, 0.4% (w / v) macerozyme R10, 0.4 M mannitol, 20 mM KCl, 10 mM CaCl 2, 1 mM β-mercaptoethanol and 0.1% BSA), wrapped in a foil, and incubated in a vacuum state for 30 minutes and then at room temperature for 3 hours using a desiccator. To the petri dish, W5 solution (2 mM MES, pH 5.7 containing 154 mM NaCl, 125 mM CaCl ₂ and 5 mM KCl, pH 5.7) was added to the Petri dish and mixed well by shaking. The protoplast was harvested by filtering the solution using a nylon mesh. The solution was centrifuged at 200 g for 2 minutes to remove the supernatant, and then the MMG solution (0.4 M mannitol and 15 mM MgCl ₂ (4 mM MES (pH 5.7) containing 1 mM Tris-HCl buffer) at a concentration of 1 × 10 ^{6 /} ml. 2.5 μg / μl of DNA and protoplast were mixed in 4 ml of a 40% PEG solution (0.2 M mannitol and 100 mM CaCl ₂ ), carefully inverted, and 10 minutes later, W5 buffer (154 mM NaCl, 125 mM CaCl ₂ and 5 mM KCl 2 mM MES, pH 5.7) was added and inverted again. After centrifugation at 100 g for 2 minutes, the supernatant was removed and W1 buffer (4 mM MES, pH 5.7 containing 0.5 M mannitol and 20 mM KCl, pH 5.7) was immediately added. Transferred to a 12-well plate, wrapped in foil, and incubated at 24 DEG C for 15 hours.

8. Agrobacterium  Infiltration and BiFC (Bimolecular Fluorescence Complementation) analysis

In order to examine whether the proteins interact with each other in vivo, CANP was cloned into the pVYNE vector with the N-terminal part of Venus, and the required construct was constructed by cloning CIPK1 into the pMAS.SCYCE vector having the C-terminal part of SCFP3A Respectively. pVYNE.CANP-c-myc, pMAS.SCYCE.CIPK1-HA were transformed into Agrobacterium GV1301 and single colonies were cultured at 28 DEG C in LB Kn, Gn liquid medium. Each gene has an OD ₆₀₀ = 0.5, p19 is OD ₆₀₀ The cells were harvested to a concentration of 0.3, re-suspended in infiltration buffer, infiltrated into the back of the leaves of N. benthamiana and SR1, and observed 5 days later using a confocal laser scanning microscope (Leica TCS SP5, Microsystems) .

9. Production of transformant by Flower Bud Infiltration

1 μg of the constructed construct was mixed with 50 μl of competent cells of Agrobacterium tumefaciens (GV3101), heat shock treated for 5 minutes in a 37 ° C water bath, and 1 ml of LB medium was added. After incubation at 28 ° C for 3 hours, centrifugation (Centrifuge 5415D, 16,100 g) was carried out for 30 seconds to precipitate the cells, 800 μl of LB medium was removed and the cells were resuspended in the remaining LB medium. Was plated on LB solid medium containing 25 占 퐂 / ml gentamicin and 50 占 퐂 / ml kanamycin antibiotic and incubated at 28 占 폚 for 3 days. The colon was inserted into 200 ml of LB medium containing 25 μg / ml gentamycin and 50 μg / ml kanamycin antibiotics, shaking at 250 rpm at 28 ° C, and cells were grown overnight. The cells were collected by centrifugation (Centrifuge 5810R, 2,129 g) at room temperature for 10 minutes and the medium was removed. This previously prepared in infiltration buffer (the number of 1/2 MS, 50g Cross, 1 ㎖ 1000X Gamborg's vitamin, 10 ㎕ benzylamide purine (1 ㎎ / ㎖), 250 ㎕ Silwet L-77) to the cells resuspended in OD ₆₀₀ = 1.5 to 2.0. The silique of the 4-week-old wild-type Arabidopsis (Col-0) plant was removed and sprayed with water throughout the plant. Cells were resuspended. The plants were inverted into a turbid infiltration buffer, the flowers were soaked and soaked to remove air bubbles and the flowers were fully immersed in the infiltration buffer. Two minutes later, the plants were taken out, placed flat on a flat surface, wrapped in a wrap, and kept at room temperature for 24 hours to avoid light. After that, the lap was removed and the plants were immediately raised and grown in a 24 ° C growth chamber and the first three days were not watered. After receiving the seeds from the plants, the transformed plants were selected by growing them in a selection medium.

10. Quantitative Real-Time RT- PCR

To perform quantitative real-time RT-PCR, a Roter-Gene Real-Time Centrifugal DNA Amplification System (Corbett Research) and QuantiTect SYBR Green RT-PCR Kit (Quiagen) were used. (SEQ ID NO: 46) and CANP-RT3 (5'-TCCCCGACGACCCAAGGCGAAGATA-3`) (SEQ ID NO: 47), RD29A is RD29A-RT1 (SEQ ID NO: 48) and RD29A-RT2 (CTTCAGGTTCTAGCTCGTCATCATC-3`) (SEQ ID NO: 49), RD29B is RD29B-RT1 (5'- ACCAATCAGAATTCACCATCCAGAA- 3) (SEQ ID NO: 52) and RD22-RT2 (5'-TCCACGCGTACACCTCCCTTTCCAA-3 ') (SEQ ID NO: 51) No. 53) was used. Actin2-1 (5'-GAGATCACCGCTCTTGCACCTAGCA-3`) (SEQ ID NO: 54) and actin2-2 (5`-TTCCTGTGAACAATCGATGGACCT-3`) (SEQ ID NO: 54) were used as an internal control, No. 55) primer set was used. Total RNA was extracted from each organ using the RNeasy Plant mini kit (Quiagen) and 40 ㎎ per reaction was used as a template. Basically, RNA was reverse-transcribed at 50 ° C for 30 minutes, and the resultant cDNA was denaturation at 95 ° C for 20 minutes. PCR was performed for 35 cycles under the following conditions: denaturation at 94 ° C for 20 sec, annealing at 58 ° C for 20 sec, and extension at 72 ° C for 30 sec. The specificity of the amplified transcript was confirmed using the melting curve generated after the reaction, and the degree of gene expression was analyzed by using Roter-Gene software compared to the control group actin2.

11. Drought stress treatment

Drought stress was assessed by four-week rehydration (Col-0), knockout mutation ( canp ), CANP / CANP complementation, CANP overexpression, The survival rate was measured after observation.

12. Salt stress treatment

The wild-type (Col-0), CANP knockout mutant ( canp ), CANP / CANP complementation and CANP overgrown seeds were germinated on MS medium and transferred to MS medium containing 125 mM or 150 mM NaCl 4 days later, Root growth was observed. In addition, the plants grown in the soil for 4 weeks were treated with 150 mM or 300 mM NaCl for sensitization to salt.

13. Water-loss assay

The fresh weight was measured for four weeks with wild type (Col-0), knockout mutation ( canp ), and canp / CANP complementation in the soil. Four sets of wild-type (Col-0), knockout mutation ( canp ) and canp / CANP complementation were performed on each of 5 leaves of the same developmental stage and dried in a laminar flow hood, , 1, 2, 3, 4, 5, 6 hours).

14. Photosynthesis Measurements

Photosynthetic (μmol g ^-1 s ^-1 ) measurements were made using plants grown in soil for 5 weeks. The photosynthetic efficiency of whole plants was measured on a mass basis by directly connecting a Whole Plant Arabidopsis (WPA) chamber to a portable photosynthetic analyzer (LI-6400XT) for CO2 gas exchange analysis. LI-6400-18 RGB (red, green, blue) was used as the light source and connected directly to the LI-6400-17 WPA chamber. The measurement conditions were as follows: CO2 concentration in the WPA chamber (400 μmol mol ^-1 ), relative humidity (70%) and temperature (25 ° C) were kept constant and the artificial light was 0, 100, 200, 400, 500, m ^-2 s ^{- 1} was artificially investigated. Immediately after the measurement, the rosettes of the plant were sampled and the mass was measured to calculate the photosynthetic efficiency.

15. Seed harvesting

In a transformant overexpressing a CANP gene or a CANP-like gene (e.g., SlCANP), the above-mentioned 11-14 characteristics (dry resistance, salt resistance, photosynthesis efficiency, etc.) were increased by at least 20% Respectively. Real-time RT-PCR experiments confirmed whether the CANP gene (or SlCANP) was stably fixed to the genome from the transformant grown by seeding the selected seeds by self-moisturizing the seeds and re-seeding the seeds . For future use, the seeds were harvested from individuals that showed an increase in one or more of dryness, salt resistance, and photosynthetic efficiency.

<Experimental Results>

Example  One: CIPK1 and Interactive  Isolation of new nuclear proteins

The Arabidopsis calcium binding proteins CBL1 and CBL9 recognize calcium signals generated by dry and high salt stimulation and are involved in inducing stress responses in plants by transferring them to CIPK1, one of the CBL-Interacting Protein Kinase (CIPK) family members . There is little known how the CBL1 / CBL9-CIPK1 complex formed in the plasma membrane of plant cells promotes the expression of stress genes such as RD22 and RD29B by directing signals into the nucleus. The present inventors searched the Arabidopsis cDNA library using a yeast two-hybrid method using CIPK1 as a bait to search for proteins that interact with CIPK1 in order to find a protein that performs such a function. The amino acid sequences of these interacting proteins were analyzed to identify those that could be located in the nucleus and named CIPK1-associated nuclear protein (CANP). As shown in FIG. 1, the CANP protein was analyzed by the TIGR website ( http://www.tigr.org ). As a result, CANP showed a bipartite nuclear localization signal at the N-terminal region and proline-rich region.

Example  2: CANP  Full-length cDNA of the gene Cloning

The CANP clone isolated by screening with the yeast protein hybrid method was not a full-length cDNA. Thus, CANP full-length cDNA was PCR amplified using CANP-1 forward primer and CANP-2 reverse primer set and cloned into pGBT.BS vector. The nucleotide sequence of this full-length cDNA clone was determined and analyzed. As a result, it was confirmed that CANP full-length cDNA had an open reading frame of 1,758 bp as shown in FIG.

We also investigated whether CAMP interacts with CIPK1 through a yeast two-hybrid assay. FIG. 3 is a diagram showing that the full-length CANP interacts with CIPK1 through a yeast two-hybrid assay. The first panel on the left side of Figure 3 shows the arrangement of Y190 yeast cells carrying pGBT and pGAD plasmids. The second and third panels show the growth of yeast in synthetic media lacking Leu and Trp (SC-LT) in complete medium, synthetic media deficient in His, Leu, Trp (SC-HLW) in complete medium. The final panel shows the results of a filter-lift assay showing the? -Galactosidase activity. Interestingly, pGBT.CANP cloned with CANP in the binding domain (BD) region of the Gal4 transcription factor showed autoactivation activity.

Example  3: CIPK1 - CANP  Interaction Analysis

The interaction between CIPK1 and CANP in the yeast two-hybrid assay was verified by the BiFC assay. 4B), Arabidopsis protoplast (Fig. 4C), and tobacco (Fig. 4C). The vector for BiFC was prepared as shown in Fig. 4A (pVYNE.CANP-c-myc and pMAS.SCYCE Cells (Fig. 4D) and then observed by confocal laser scanning. As can be seen in FIG. 4, the CANP and CIPK1 proteins also form complexes in plant cells. Their interaction was mainly observed in the plasma membrane and cytoplasm, but not interestingly in the nucleus.

Example  4: CBL1 and CBL9 end CIPK1 - CANP  Effect on Complex

A yeast three-hybrid assay was performed to determine the effect of CIPK1-CANP complexes on CBL1 or CBL9, another known interacting protein of CIPK1. For this, CIPK1 and CBL1 (or CBL9) were cloned into the pBridge vector, and CANP was inserted into the pGADT7 vector. Figure 5 (A) shows a schematic diagram of pGADT7.CANP and pBridge.CIPK1 / CBL1 (or CBL9) constructs. To co-transform yeast strain Y190, a bridge vector expressing both pGADT7.CANP and BD-fused CIPK1 and CBL1 (or CBL9) expressing AD-fused CANP was used as the third protein. The transformed yeast culture was diluted to 0.2 absorbance units at 600 nm and plated on SD / -Met / -Leu / -Trp medium (-MLW) (left side of FIG. 5 (B) (Right panel of Fig. 5 (B)) on SD / Met / -His / -Leu / -Trp medium (-MHLW) for protein interaction. Similar to the results of the yeast two-hybrid assay, yeast cells expressing only BD-CIPK1 and AD-CANP grow in SC-MLWH medium while three proteins BD-CIPK1, AD-CANP and CBL1 (or CBL9) Simultaneously expressing yeast cells did not grow in SC-MLWH medium. This suggests that CBL1 or CBL9 interacts with CIPK1 to prevent CIPK1 from interacting with CANP.

Example  5: Ca ^{2 +} Combination CBL1 / CBL9  Dependently into the nucleus CANP

The results of the previous experiments show that CANP is interacting with CIPK1 outside the nucleus and that this interaction can be interrupted by CBL1 or CBL9. In order to confirm this in plant cells, CBL9, CIPK1 and CANP-GFP proteins were expressed and the position of CANP-GFP protein with or without calcium was observed. Particle bombardment was used to introduce the pCAM35S.CBL9, pCAM35S.CIPK1, and pMDDI.CANP constructs into the epidermal cells of the onion at a 4: 2: 1 ratio (molar ratio), respectively. After incubation for 18 h in the absence of calcium (1 mM EGTA) to determine the intracellular location of CANP-GFP, the same cells were treated with calcium solution (10 mM CaCl ₂ and 3.8 mM calcium ionophore A 23187) Changes in intracellular location of GFP were observed by fluorescence microscopy.

As shown in FIG. 6, CANP-GFP exists mainly in the cytoplasm in the absence of calcium (FIG. 6 (A)), ). This is because, in normal cases, CANP complexes with CIPK1 in the cytoplasm, but when a calcium signal is generated by drought or salting, CBL1 / CBL9 protein interacts with CIPK1 in the plasma membrane and CANP is separated from CIPK1 It means going into me and the nucleus.

Example  6: CANP  T-DNA knock-out mutation ( canp ) And preparation of complementation line

The T-DNA tagging line of SALK was examined to obtain a can mutant line in which T-DNA was inserted into the CANP gene (Fig. 7A). In order to investigate the number of copies of T-DNA inserted in this mutant strain, a genomic Southern blot assay was performed using the NPTII gene, a kanamycin resistance gene, as a probe. As a result, it was confirmed that 1 copy of T-DNA was present. In addition, genomic zone blot analysis was performed once again on the whole CANP cDNA as a probe to confirm that the canp mutant was a homozygous line (Fig. 7B). In addition, RT-PCR was performed to confirm that CANP gene expression was completely disappeared in the can mutant (Fig. 7C).

In order to test whether the phenotype of the CANP mutant is the result of the loss of function of the CANP gene, it is necessary to investigate whether phenotype rescue is induced by the introduction of the normal CANP gene. Thus, a complementation construct was constructed as shown in Fig. 8A. A genomic DNA fragment of 5,700 bp comprising 2,000 bp of the start and stop codons of the CANP gene and 3,700 bp of the promoter region was cloned into the plant transformation vector pCAM1300 Respectively. CANP / CANP complementation plant was constructed by introducing this complementation construct into canp mutant by floral dipping method. Real-time RT-PCR analysis was performed by extracting total RNA from transgenic plants in T2 generation to select complementation lines with CANP transcript levels similar to those of wild-type Arabidopsis. As a result, a complementation line pCAMBIA1300.CANPG-3-A showing almost the same level of expression as the wild type was obtained (Fig. 8B).

Example  7: canp  Phenotype analysis and phenotype rescue of mutants

Under normal conditions, the Arabidopsis canp mutant showed morphological phenotypes that grow slightly smaller than wild-type (Col-0). In addition, canp mutants responded more sensitively to high salinity and drought stress than the wild type. Reactivity to high salt stress was investigated in two ways. First, seeds of wild-type and canp mutant were sprayed on 1/2 MS medium for 4 days, seedling was transferred to 1/2 MS medium containing 0 mM, 110 mM, 125 mM and 150 mM NaCl, Respectively.

As shown in Fig. 9, the canp mutants were significantly more susceptible to salting than the wild type. In the treatment of 110 mM NaCl, the root growth of the canp mutants was inhibited and whitening was observed in the leaves. These phenotypes are recovered from the complementation line, indicating that the cannabinoid susceptibility is due to loss of normal CANP gene expression.

In addition, salting-sensitivity studies were performed by treating 150 mM NaCl or 300 mM NaCl once a day in 4-week-old plants grown in soil. As can be seen in FIG. 10A, it was confirmed that whitening occurred in the rosette leaf of the canp , unlike the wild type, at 300 mM NaCl treatment. On the other hand, when shoot growth assay was performed with 150 mM NaCl, the canp mutants did not form stem properly, unlike the wild type (FIG. 10B). In the complementation line, these phenotypes were restored as wild type.

On the other hand, the sensitivity test for drought was carried out as follows. The survival rate of the plants grown in the soil for 4 weeks was determined by drought treatment for 14 days and then water recovery for 4 days. As a result, it was confirmed that the canp mutant was more sensitive to drought than the wild type, and the survival rate was reduced about 3 times (FIG. 11A). In addition, the water loss of the plant was measured by measuring fresh weights. As a result, the canp mutant lost about 17% more moisture than the wild type (Fig. 14C). In the complementation line, these phenotypes were also recovered as wild type.

Example  8: CANP  Overexpression transformant production and phenotypic analysis

These results suggest that canp mutants failing to express CANP protein are slightly smaller in size than wild type and less resistant to salt stress and drought stress. This suggests that the transformants over-expressing CANP are likely to exhibit improved resistance to the stress. Therefore, we investigated the stress resistance of CANP overexpressed Arabidopsis transformants.

In order to produce Arabidopsis plants with overexpression of CANP, a plant transformation construct (pBI121ΔGUS.CANP) was constructed so that CANP could be expressed by the CaMV 35S promoter (FIG. 12A). This construct was introduced into Arabidopsis thaliana (Col-0) by floral dipping method to produce transformants. CANP overexpressing transgenic plants (CANP OX-4 and OX-9) were identified by real-time RT-PCR and a homozygous line was selected (Fig. 12B). Using the selected transformants, the stress response was examined in the same manner as in the canopy mutant phenotype survey. First, CANP-overexpressing transformants showed a superior resistance to wild-type (Col-0) when treated with saline (125 mM, 300 mM NaCl) (FIG.

In addition, the drought stress test was carried out for four weeks, and the plants grown in the soil were treated with drought stress for 16 days, followed by water for 4 days to recover. As shown in FIG. 14, the overexpressed CANP exhibited markedly increased resistance to drought stress over wild-type (Col-0). The survival rates of Col-0, CANP OX-4 and CANP OX-9 plants were 3%, 47% and 72%, respectively, at the given stress conditions, indicating that the overexpression of CANP was about 15 to 24 times higher than that of the wild type. This confirms that the overexpressed CANP exhibits much higher resistance to salt and drought stress than the wild type.

On the other hand, the multilayer CANP overexpressor was slightly larger than the wild-type Arabidopsis (Col-0). Therefore, photosynthetic efficiency was measured. From PAR 100 μmol m ^-2 s ^-1 , it was found that the photosynthetic efficiency of CANP overexpressant was increased by about 20% as compared to the wild type (FIG. 15).

Example  9: In the plant Evolutionarily  Preserved CANP  gene

As a result of searching the GenBank database, it can be seen that genes similar to Arabidopsis CANP exist in almost all plants, as shown in Fig. This evolutionary conservation implies that CANP performs a similar function in other plants as in Arabidopsis. Therefore, it is expected that CANP - like genes existing in other plants can be used to develop plants that are resistant to salting and drought and have increased photosynthesis efficiency.

Example  II: Tomato CANP  Transgenic tomatoes overexpressing genes and phenotyping assays

Example  10: Tomatoes CANP  Full-length cDNA of the gene Cloning

SlCANP full-length cDNA was amplified by PCR using a cDNA prepared from a leaf of Solanum lycopersicum as a template and a primer set of SlCANP-1 (ATAACTAGTATGTCTTCTTCAAAGCGAAA) (SEQ ID NO: 56) and SlCANP-2 (TTTGAGCTCTCATACACGCTGCTTCTTTC) And cloned into the pBS vector. The nucleotide sequence of this full-length cDNA clone was determined and analyzed. As a result, it was found that SICANP full-length cDNA designated 558 amino acids with an open reading frame of 1,677 bp as expected. In addition, it was confirmed once again that the amino acid sequence of the Arabidopsis thaliana was 63.4% homologous with the amino acid sequence (Fig. 17).

Example  11: Tomato CANP  Transformant preparation and assay

Tomato was a Moneymaker variety (Solanum lycopersicum L cv. Moneymaker). The seeds were disinfected in 70% EtOH for 3 minutes, 50% bleach for 7 minutes, then rinsed 5 times with tertiary distilled water and germinated. Cotton cotyledons of 9-12 days old were harvested and plated on pre-culture medium, followed by incubation at 25 ° C for 2 days. A plant transformation construct (pATC940 vector) was constructed so that CANP could be expressed by a super promoter for overexpression of CANP (Fig. 18).

The plasmid-containing Agrobacterium strain (LBA4404) was inoculated on LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin on the day before co-culture. The co-cultured strain was collected by centrifugation and then dissolved in liquid MS-0.2% liquid medium containing 200 uM acetosyringone to adjust OD _600nm value to 0.4. The strains were cultivated at 28 ° C at 100 rpm for 1 hour and then used as a co-culture material. The cotyledon sections pre-cultured were inoculated on the strains for 5 minutes. The cotyledon sections were dried on a filter paper, and then incubated for 2 days at 28 ° C in a co-culture medium. The co-cultivated cotyledonary slices were washed with agitation in distilled water containing cefotaxime to remove uninoculated bacteria and residual Agrobacterium. This was followed by regeneration and selection of the medium, followed by growth at 28 ° C. Subsequently, the cells were cultured for 8 weeks in a fresh selection medium at intervals of 15 days. During the regeneration process, callus - derived shoots from cotyledon were transferred to shoot kidney culture medium and cultured at 28 ℃ for 14 days. The cultured shoots were transferred to a rooting medium to induce roots from shoots. After the roots were induced, they were transferred to the rooting medium once more to induce root growth, and then transferred to the soil to purify (Fig. 19).

The expression of SlCANP gene in four transformants obtained by the transformation process was examined. Real-time RT-PCR was performed to confirm the expression level of SlCANP mRNA. As a result, it was found that the transformant overexpresses SlCAN from 7 to 19 times that of tomato wild type (WT) (Fig. 20).

Example  12: Tomato CANP Overexpressing  Photosynthesis measurement

Photosynthetics (μmol g ^-1 s ^-1 ) were measured in tomato wild type (WT) and CANP overexpressed plants grown in soil for 7 weeks (Figures 21). The photosynthetic efficiency of the whole plant was measured by directly connecting the chamber to the photosynthesis measuring instrument (LI-6400XT) for carbon dioxide gas exchange analysis. The concentrations of carbon dioxide in the chamber (400 μmol mol ^-1 ), relative humidity (65%) and temperature (25 ° C) were kept constant and the artificial light was 0, 100, 200, 400, 500, 600, 800 μmol m ^-2 s ^-1 was artificially investigated. As a result, the number of tomatoes overexpressing tomato 1 increased 39% and the number 3 tomatoes increased 20% from PAR 400 μmol m2s1 (FIG. 22), compared with the wild type (WT). This indicates that the photosynthetic efficiency increases as the expression of CANP increases compared to the results of real-time RT-PCR. These results are evidence that the function of the CANP gene identified in Arabidopsis can be equally applied to tomatoes. Furthermore, we can deduce that CANP genes present in other plants can perform similar functions.

Example 13: Harvesting tomato seeds

Self-moisture was applied to harvest the seeds from the tomato transgenic possessing the above properties. Real-time RT-PCR confirmed that the SlCANP gene was stably integrated into the tomato genome from the resulting tomato seeds obtained by seeding the seeds from the tomato fruit produced as a result of self-pollination.

                         SEQUENCE LISTING <110> Industry-Academia Cooperation Group of Sejong University   <120> Method for increasing both phothosynthetic rate and tolerance to        drought and salt stresses in plants <130> IP-2015-143 <150> KR10-2014-0119236 <151> 2014-09-05 <160> 57 <170> PatentIn version 3.2 <210> 1 <211> 585 <212> PRT <213> Arabidopsis thaliana <400> 1 Met Lys Pro Ser Lys Ser His His Lys Glu Lys Thr Ala Arg Arg Arg 1 5 10 15 Glu Glu Lys Leu Glu Glu Ser Asp Asn Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asn Gln Asn Pro Asp Tyr Asp Pro Ser Glu Leu         35 40 45 Ser Ser Phe His Ala Val Ala Pro Pro Gly Ala Val Asp Ile Arg Ala     50 55 60 Ala Asp Ala Leu Lys Ile Ser Ile Glu Asn Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 Asn Lys Val Arg Ser Glu Ile Val Lys Lys Pro Asp Gly Glu Asp Gly             100 105 110 Asp Gly Gly Lys Thr Ser Ala Pro Lys Glu Asp Gln Arg Val Thr Phe         115 120 125 Arg Thr Ile Ala Ala Lys Ser Val Tyr Gln Trp Ile Val Lys Pro Gln     130 135 140 Thr Ile Ile Lys Ser Asn Glu Met Phe Leu Pro Gly Arg Met Thr Phe 145 150 155 160 Val Tyr Asp Met Glu Gly Gly Tyr Thr His Asp Ile Pro Thr Thr Leu                 165 170 175 Tyr Arg Ser Ser Ays Asp Cys Pro Val Pro Glu Glu Phe Val Thr Val             180 185 190 Asn Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Ser Tyr         195 200 205 Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Lys Glu     210 215 220 Lys Asp Gly Lys Gly Lys Met Ser Thr Ile Ala Asn Asp Tyr Asp Glu 225 230 235 240 Asp Asp Asn Lys Ser Lys Ile Glu Asn Gly Ser Ser Val Asn Ile Ser                 245 250 255 Asp Arg Glu Val Leu Pro Pro Pro Pro Pro Leu Pro Pro Gly Ile Asn             260 265 270 His Leu Asp Leu Ser Thr Lys Gln Glu Glu Pro Pro Val Ala Arg Thr         275 280 285 Asp Asp Asp Ile Phe Val Gly Glu Gly Val Asp Tyr Thr Val Pro     290 295 300 Gly Lys Asp Val Thr Gln Ser Pro Ile Ser Glu Asp Met Glu Glu Ser 305 310 315 320 Pro Arg Asp Lys Glu Lys Val Ser Tyr Phe Asp Glu Pro Ala Tyr Gly                 325 330 335 Pro Val Gln Glu Lys Val Pro Tyr Phe Ala Glu Pro Ala Tyr Gly Pro             340 345 350 Val Gln Pro Ser Ala Gly Gln Glu Trp Gln Asp Met Ser Ala Tyr Gly         355 360 365 Ala Met Gln Thr Gln Gly Leu Ala Pro Gly Tyr Pro Gly Glu Trp Gln     370 375 380 Glu Tyr Gln Tyr Ala Glu Gln Thr Gly Tyr Gln Glu Gln Tyr Leu Gln 385 390 395 400 Pro Gly Met Glu Gly Tyr Glu Val Gln Pro Glu Thr Asp Val Leu Leu                 405 410 415 Asp Pro Gln Leu Met Ser Gln Glu Glu Lys Asp Arg Gly Leu Gly Ser             420 425 430 Val Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu Ser Asp         435 440 445 Ala Arg Glu Lys Asp Pro Thr Phe Val Ser Glu Ser Tyr Ser Glu Cys     450 455 460 Tyr Pro Gly Tyr Gln Glu Tyr Asn His Glu Ile Val Gly Ser Asp Glu 465 470 475 480 Glu Pro Asp Leu Ser Lys Met Asp Met Gly Gly Lys Ala Lys Gly Gly                 485 490 495 Leu His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Glu Lys Tyr Asn             500 505 510 Glu Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys         515 520 525 Met Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Arg Asp Arg Asp Gln     530 535 540 Lys Leu Asn Asn Glu Leu His Gln Ile Asn Lys Ile Leu Thr Arg Lys 545 550 555 560 Lys Met Glu Lys Glu Gly Gly Asp Val Ala Ser Leu Asp Ala Ala Glu                 565 570 575 Ala Gln Thr Pro Lys Arg Ser Lys His             580 585 <210> 2 <211> 556 <212> PRT <213> Oryza sativa <400> 2 Met Ala Phe Lys Arg Glu Glu Lys Lys Glu Glu Pro Glu Thr Pro Arg 1 5 10 15 Tyr Arg Asp Arg Ala Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr             20 25 30 Glu Pro Thr Glu Leu Gly Ser Phe His Ala Val Ala Pro Pro Gly Ala         35 40 45 Asp Leu Arg Leu Ala Asp Ala His Lys Ile Ser Ile Glu Lys Ser Lys     50 55 60 Tyr Leu Gly Gly Asp Leu Glu His Thr His Leu Val Lys Gly Leu Asp 65 70 75 80 Tyr Ala Leu Leu His Lys Val Arg Ser Glu Ile Glu Lys Lys Pro Glu                 85 90 95 Ala Glu Asp Gly Lys Asp Thr Gln Ser Arg Ser Thr Lys Glu Asp Gln             100 105 110 Ala Val Ser Phe Arg Thr Ala Ala Ala Lys Ser Val Tyr Gln Trp Ile         115 120 125 Ile Lys Pro Gln Ser Ile Ile Lys Ser Asn Glu Met Phe Leu Pro Gly     130 135 140 Arg Met Ala Phe Ile Tyr Asn Met Glu Asp Gly Leu Thr Asn Asp Ile 145 150 155 160 Pro Thr Thr Leu His Arg Ser Ser Ays Asp Cys Ser Val Pro Glu Glu                 165 170 175 Met Val Thr Val Ser Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys             180 185 190 Ile Met Ser Tyr Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys         195 200 205 Lys Lys Lys Glu Arg Asp Thr Lys Gly Lys Asn Ser Leu Ala Ser Gly     210 215 220 Asp Tyr Asp Glu Val Ala Arg Pro Gly Gln Thr Asn Gly Ser Ala Leu 225 230 235 240 Lys His Gln Phe Glu Lys Asp Met Pro Pro Pro Pro Pro Arg Arg Asn                 245 250 255 Asn Asn Leu Ser Lys Asn Glu Lys Pro Ser Val Pro Val Ala Arg Ala             260 265 270 Asp Gly Asp Asp Ile Phe Val Gly Asp Gly Val Asp Tyr Ser Val Pro         275 280 285 Asn Lys Glu Met Ser Gln Ser Pro Val Ser Glu Asp Met Asp Glu Ser     290 295 300 Pro His Asn His Gln Lys Gln Ser Tyr Phe Thr Glu Glu Lys Pro Ile 305 310 315 320 Tyr Gly Pro Ile Pro Pro Ser Asp Pro Ala Gln Ala Trp Pro Gln Pro                 325 330 335 Asn Ala Tyr Asp Ala I Gln Ala Gln Met Val Ala Ala Gly Tyr Gln             340 345 350 Gly Glu Trp Ser Gly Tyr Gln Tyr Gly Glu Gln Gln Met Ala Tyr Pro         355 360 365 Glu Gln Tyr Met Gln Gln Ser Ala Gln Asp Cys Asp Val Leu Ala Asp     370 375 380 Pro Asn Ile Thr Gln Asp Pro Arg Leu Met Thr Gln Ala Asp Lys Asp 385 390 395 400 Arg Gly Leu Gly Ser Val Phe Lys Arg Asp Asp Glu Arg Leu Lys Gln                 405 410 415 Leu Arg Glu Lys Asp Ala Arg Glu Lys Asp Pro Asn Phe Ile Ser Asp             420 425 430 Ser Tyr Ser Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr Asn His Glu Ile         435 440 445 Ala Gly Ser Asp Glu Glu Asp Asp Leu Ser Lys Met Asp Met Gly Gly     450 455 460 Arg Ala Lys Gly Arg Leu His Arg Trp Asp Phe Glu Thr Glu Glu Glu 465 470 475 480 Trp Ala Thr Tyr Asn Asp Gln Lys Glu Ala Met Pro Lys Ala Ala Phe                 485 490 495 Gln Phe Gly Val Lys Met Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn             500 505 510 Lys Asp Gln Lys Leu Thr Asn Asp Leu His Lys Ile Asn Lys Ile Leu         515 520 525 Ala Arg Lys Lys Gly Asp Lys Asp Gly Gly Asp Asp Gly Gly His Tyr     530 535 540 Asp Asp Met Pro Ser Gly Lys Lys Gln Arg Ala 545 550 555 <210> 3 <211> 565 <212> PRT <213> Zea mays <400> 3 Met Ser Ser Lys Lys Asn Tyr Tyr Lys Glu Lys Leu Met Arg Arg Lys 1 5 10 15 Glu Glu Lys Lys Glu Glu Pro Glu Thr Pro Arg Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Pro Thr Glu Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Asn Asp Leu Arg Leu Ala     50 55 60 Asp Ala His Lys Ile Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly Asp 65 70 75 80 Leu Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu His                 85 90 95 Lys Val Arg Ser Glu Ile Glu Lys Lys Pro Glu Ala Glu Asp Gly Lys             100 105 110 Asp Thr Lys Ser Arg Ala Ala Lys Glu Asp Gln Ala Val Ser Phe Arg         115 120 125 Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Ile Lys Pro Gln Ser     130 135 140 Ile Ile Lys Glu Asn Glu Leu Phe Leu Pro Gly Arg Met Ser Phe Ile 145 150 155 160 Tyr Asn Met Glu Glu Gly Val Thr Asn Asp Ile Pro Thr Thr Leu His                 165 170 175 Arg Ser Ays Asp Cys Pro Val Val Glu Glu Met Val Thr Val Ser             180 185 190 Val Asp Gly Ser Val Leu Glu Arg Ile Ala Lys Ile Met Thr Tyr Leu         195 200 205 Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Gly Arg     210 215 220 Asp Ile Lys Gly Lys Ser Asn Leu Ala Ser Gly Asp Tyr Gly Glu Ser 225 230 235 240 Val Lys Pro Ser Gln Thr Asn Gly Ser Thr Leu Lys His Gln Ser Asp                 245 250 255 Met Pro Pro Pro Pro Ala Pro Pro Pro Arg Asn Asn Asn Phe Asn Gly             260 265 270 Lys Glu Lys Gln Pro Val Val Val Ser Arg Glu Asp Asp Asp Asp Ile         275 280 285 Phe Val Gly Asp Gly Val Asp Tyr Leu Val Pro Asn Lys Glu Met Ser     290 295 300 Gln Ser Pro Val Ser Asp Met Asp Glu Ser Pro His Asn His Gln Lys 305 310 315 320 Gln Ser Asn Phe Thr Glu Pro Leu Tyr Gly Pro Val Pro Ser Ser Glu                 325 330 335 Ser Ala Gln Ala Trp Gln Gln Pro Asn Thr Tyr Asp Ala Ala Val Gln             340 345 350 Ala Gln Met Ala Ala Ala Gly Tyr Gln Gly Asp Trp Ser Ser Tyr Val         355 360 365 Tyr Ala Glu Gln Gln Leu Gly Tyr Pro Glu Gln Tyr Val Gln Gln Ser     370 375 380 Thr Gln Glu Tyr Asp Val Leu Ala Asp Pro Ser Ser Ser Gln Asp Pro 385 390 395 400 Arg Phe Met Thr Gln Ala Asp Lys Asp Arg Gly Leu Gly Ser Val Phe                 405 410 415 Lys Arg Asp Asp Gln Arg Leu Asn Gln Leu Arg Glu Lys Asp Ala Arg             420 425 430 Glu Arg Asp Pro Asn Phe Ile Ser Asp Ser Tyr Ser Glu Cys Tyr Pro         435 440 445 Gly Tyr Gln Glu Tyr Asn Asn Glu Ile Ala Gly Ser Asp Asp Glu Asp     450 455 460 Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys Gly Arg Leu His 465 470 475 480 Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Lys Tyr Asn Asp Gln                 485 490 495 Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys Met Gln             500 505 510 Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln Lys Leu Thr Asn         515 520 525 Asp Leu His Lys Ile Asn Lys Ile Leu Ala Arg Lys Lys Gly Glu Lys     530 535 540 Asp Gly Ala Glu Asp Gly Gly His Tyr Asp Asp Asp Leu Pro Ser Ser 545 550 555 560 Lys Lys Gln Arg Gly                 565 <210> 4 <211> 567 <212> PRT <213> Glycine max <400> 4 Met Thr Ala Ser Asn Lys Lys Asn Pro Lys Glu Lys Pro Ile Arg Arg 1 5 10 15 Lys Glu Glu Lys Pro Glu Glu Pro Glu Val Pro Lys Tyr Arg Asp Arg             20 25 30 Ala Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Gln Thr Glu         35 40 45 Leu Gly Phe His Ala Val Ala Pro Pro Gly Thr Val Asp Ile Arg Ser     50 55 60 Ser Asp Ala His Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 Asn Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Glu Ala Gly Asp Asp             100 105 110 Val Glu Gly Lys Ser Ser Ser Ala Met Glu Asp Gln Gln Val Ser Ile         115 120 125 Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Val Lys Pro Gln     130 135 140 Thr Ile Ser Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Met Thr Phe 145 150 155 160 Ile Tyr Asn Met Glu Gly Gly Tyr His His Asp Ile Pro Thr Thr Leu                 165 170 175 His Arg Ser Lys Ala Asp Cys Pro Val Val Glu Glu Met Val Thr Val             180 185 190 Asn Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Ser Tyr         195 200 205 Leu Arg Leu Gly Ser Ser Gly Lys Ile Leu Lys Lys Lys Arg Lys Glu     210 215 220 Lys Asp Ala Lys Gly Lys Ile Leu Ala Val Gly Asn Gly Phe Asp Lys 225 230 235 240 Glu Asp Lys Pro Ser Lys Val Glu Gly Gly Ala Lys Asn Gln Thr Glu                 245 250 255 Lys Glu Ile Ile Leu Pro Pro Pro Pro Ile Lys Lys Asn Pro Leu             260 265 270 His Ser Ile Glu Lys Gln Gly Pro Ala Val Ala Arg Ala Glu Asp Asp         275 280 285 Asp Ile Phe Val Gly Glu Gly Val Asp Tyr Asp Ile Pro Gly Lys Asp     290 295 300 Leu Ser Gln Ser Pro Val Ser Glu Asp Met Glu Glu Ser Pro Arg Asn 305 310 315 320 Lys Glu Lys Pro Ser Tyr Phe Thr Glu Pro Thr Tyr Gly Pro Val Gln                 325 330 335 Pro Ser Met Val Pro Gln Gly Trp Gln Glu Thr Asn Gly Tyr Asp Val             340 345 350 Met Gln Thr Gln Ala Leu Ala Ala Gly Tyr Gln Gly Glu Trp Gln Glu         355 360 365 Tyr Gln Tyr Ala Glu Gln Leu Ala Tyr Pro Asp Gln Tyr Leu Gln Gln     370 375 380 Asn Met Gln Ala Tyr Asp Glu Gln Ala Asp Leu Asn Leu Pro Leu Asp 385 390 395 400 Pro Arg Phe Met Thr Gln Glu Glu Lys Asp Arg Gly Leu Gly Ser Val                 405 410 415 Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu Lys Asp Ala             420 425 430 Arg Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser Tyr Ser Glu Cys Tyr         435 440 445 Pro Gly Tyr Gln Glu Tyr Asn Arg Glu Ile Val Asp Ser Asp Asp Glu     450 455 460 Asp Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys Gly Arg Leu 465 470 475 480 His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Thr Tyr Asn Glu                 485 490 495 Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys Met             500 505 510 Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln Lys Leu Asn         515 520 525 Asn Asp Leu His Lys Ile Asn Lys Ile Leu Ala Arg Lys Lys Met Glu     530 535 540 Lys Asp Thr Asn Gly Glu Gly Gly Asn His Tyr Asp Asp Glu Pro Thr 545 550 555 560 Pro Gly Lys Lys Leu Arg Ile                 565 <210> 5 <211> 558 <212> PRT <213> Solanum tuberosum <400> 5 Met Ser Ser Ser Lys Arg Asn His Lys Glu Lys Ile Val Arg Arg Asn 1 5 10 15 Lys Glu Glu Lys Val Glu Glu Pro Glu Leu Pro Lys Tyr Arg Asp Arg             20 25 30 Ala Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Leu Thr Glu         35 40 45 Phe Gly Gly Phe His Ala Val Ala Pro Pro Gly Asn Val Asp Leu Leu     50 55 60 Ser Ala Asp Ala Gln Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly 65 70 75 80 Gly Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu                 85 90 95 Leu His Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Glu Ala Gly Asp             100 105 110 Glu Ala Phe Glu Gly Lys Pro Arg Gly Val Lys Glu Asp His Gln Leu         115 120 125 Ser Phe Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Ile Lys     130 135 140 Pro Gln Thr Val Ile Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Met 145 150 155 160 Ala Phe Ile Phe Asn Met Asp Ser Gly Tyr Ser Asn Asp Ile Pro Thr                 165 170 175 Thr Leu His Arg Ser Lys Ala Asp Cys Pro Val Leu Glu Glu Met Val             180 185 190 Thr Val Ser Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met         195 200 205 Ser Tyr Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys     210 215 220 Lys Glu Lys Asp Ser Lys Gly Lys Thr Val Ile Phe Asn Gly Tyr Asp 225 230 235 240 Glu Val Ser Lys Ser Asp Ala Ser Lys Ser Gln Ser Asp Lys Glu Thr                 245 250 255 Val His Ser Ser Ala Gln Leu Pro Lys Lys Asn His Ser Glu Arg Arg             260 265 270 Glu Asp Gln Gly Pro Ala Val Ala Arg Thr Glu Glu Glu Asp Ile Phe         275 280 285 Ile Gly Glu Gly Val Asp Tyr Ser Val Pro Ala Gly Asp Met Gly Gln     290 295 300 Ser Pro Val Ser Glu Asp Met Glu Glu Ser Pro Arg Asn Lys Glu Arg 305 310 315 320 Thr Ser Tyr Phe Ser Glu Pro Ala Tyr Gly Pro Val Pro Ser Ser Glu                 325 330 335 Pro Ser His Asp Trp Gln His Ala Asn Gly Tyr Asp Ala Val Gln Ala             340 345 350 Gln Ala Val Ala Gly Val Tyr Gln Pro Glu Trp Gln Asp Tyr Gln Tyr         355 360 365 Pro Glu Gln Val Ala Tyr Pro Glu Gln Tyr Leu Gln Gln Asn Tyr Asp     370 375 380 Met Gln Ala Gly Val Asp Gly Leu Gln Asp Pro Gln Phe Met Thr Gln 385 390 395 400 Glu Glu Lys Asp Arg Gly Leu Gly Ser Val Phe Lys Arg Asp Asp Gln                 405 410 415 Arg Leu Leu Gln Leu Arg Glu Arg Asp Ala Arg Glu Lys Asp Pro Asn             420 425 430 Phe Ile Ser Glu Ser Tyr Ser Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr         435 440 445 Asn Arg Glu Val Val Asp Ser Asp Asp Glu Ala Asp Leu Ser Lys Met     450 455 460 Asp Met Gly Gly Arg Ala Lys Gly Arg Leu His Arg Trp Asp Phe Glu 465 470 475 480 Thr Glu Glu Glu Trp Ala Thr Tyr Asn Glu Gln Lys Glu Ala Met Pro                 485 490 495 Lys Ala Ala Phe Gln Phe Gly Val Lys Met Gln Asp Gly Arg Lys Thr             500 505 510 Arg Lys Gln Asn Lys Asp Gln Lys Leu Thr Asn Glu Leu His Lys Ile         515 520 525 Asn Lys Ile Leu Thr Arg Lys Lys Met Glu Lys Asp Lys Gly Glu Ala     530 535 540 Leu Glu Asp Gly Glu Ile Gln Pro Gly Lys Lys Gln Arg Val 545 550 555 <210> 6 <211> 573 <212> PRT <213> Setaria italica <400> 6 Met Ser Ser Lys Lys Asn Tyr Tyr Lys Glu Lys Met Met Arg Arg Lys 1 5 10 15 Glu Glu Lys Lys Glu Glu Pro Glu Thr Pro Arg Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Pro Thr Glu Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Thr Asp Leu Arg Leu Ala     50 55 60 Asp Ala His Lys Ile Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly Asp 65 70 75 80 Leu Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu His                 85 90 95 Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Asp Ala Glu Asp Gly Lys             100 105 110 Asp Ala Lys Ser Arg Ala Thr Lys Glu Asp Gln Ala Val Ser Phe Arg         115 120 125 Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Ile Lys Pro Gln Ser     130 135 140 Ile Ile Lys Glu Asn Glu Leu Phe Leu Pro Gly Arg Met Ser Phe Ile 145 150 155 160 Tyr Asn Met Glu Glu Gly Phe Thr Asn Asp Ile Pro Thr Thr Leu His                 165 170 175 Arg Ser Ays Asp Cys Pro Val Val Glu Glu Met Val Thr Val Ser             180 185 190 Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Thr Tyr Leu         195 200 205 Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Gly Arg     210 215 220 Asp Thr Lys Gly Lys Asn Asn Leu Ala Ser Gly Asp Tyr Asp Glu Ala 225 230 235 240 Val Lys Pro Thr Gln Thr Asn Gly Ser Asp Leu Lys His Gln Ser Glu                 245 250 255 Lys Asn Met Pro Pro Pro Pro Pro Pro Pro Leu Asn Asn As Ser             260 265 270 Asn Gly Lys Glu Lys Gln Ser Val Pro Leu Ala Arg Ala Asp Asn Asp         275 280 285 Asp Ile Phe Val Gly Asp Gly Val Asp Tyr Ser Val Pro Asn Lys Glu     290 295 300 Met Ser Gln Ser Pro Val Ser Glu Asp Met Asp Glu Ser Pro His Asn 305 310 315 320 His Gln Lys Gln Ser Tyr Phe Thr Glu Pro Met Tyr Gly Pro Val Pro                 325 330 335 Pro Ser Glu Pro Ala Gln Ala Trp Gln Gln Pro Asn Gly Tyr Asp Ala             340 345 350 Val Gln Ala Gln Met Val Ala Gly Tyr Gln Gly Asp Trp Ser Gly         355 360 365 Tyr Ala Tyr Ala Glu Gln Gln Leu Gly Tyr Pro Glu Gln Tyr Val Gln     370 375 380 Gln Ser Ile Gln Glu Tyr Asp Val Leu Ala Asp Pro Ser Ile Ala Gln 385 390 395 400 Asp Pro Ser Ile Ala Gln Asp Pro Arg Phe Met Thr Gln Ala Asp Lys                 405 410 415 Asp Arg Gly Leu Gly Ser Val Phe Lys Arg Asp Asp Gln Arg Leu Asn             420 425 430 Gln Leu Arg Glu Lys Asp Ala Arg Glu Lys Asp Pro Asn Phe Ile Ser         435 440 445 Asp Ser Tyr Ser Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr His Asn Glu     450 455 460 Val Ala Gly Ser Asp Asp Glu Asp Asp Leu Ser Lys Met Asp Met Gly 465 470 475 480 Gly Arg Ala Lys Gly Arg Leu His Arg Trp Asp Phe Glu Thr Glu Glu                 485 490 495 Glu Trp Ala Lys Tyr Asn Asp Gln Lys Glu Ala Met Pro Lys Ala Ala             500 505 510 Phe Gln Phe Gly Val Lys Met Gln Asp Gly Arg Lys Thr Arg Lys Gln         515 520 525 Asn Lys Asp Gln Lys Leu Asn Asn Asp Leu His Lys Ile Asn Lys Ile     530 535 540 Leu Ala Arg Lys Lys Gly Glu Lys Asp Gly Thr Asp Asp Gly Gly His 545 550 555 560 Tyr Asp Asp Asp Leu Pro Ser Ala Lys Lys His Arg Gly                 565 570 <210> 7 <211> 558 <212> PRT <213> Solanum lycopersicum <400> 7 Met Ser Ser Ser Lys Arg Asn His Lys Glu Lys Ile Val Arg Arg Asn 1 5 10 15 Lys Glu Glu Lys Val Glu Glu Pro Glu Leu Pro Lys Tyr Arg Asp Arg             20 25 30 Ala Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Leu Thr Glu         35 40 45 Phe Gly Gly Phe His Ala Val Ala Pro Pro Gly Asn Ile Asp Leu Leu     50 55 60 Ser Ala Asp Ala Gln Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly 65 70 75 80 Gly Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu                 85 90 95 Leu His Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Glu Thr Gly Asp             100 105 110 Glu Ala Leu Glu Gly Lys Ala Arg Gly Val Lys Glu Asp His Gln Leu         115 120 125 Ser Phe Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Ile Lys     130 135 140 Pro Gln Thr Val Ile Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Met 145 150 155 160 Ala Phe Ile Phe Asn Met Asp Ser Gly Tyr Ser Asn Asp Ile Pro Thr                 165 170 175 Thr Leu His Arg Ser Lys Ala Asp Cys Pro Val Leu Glu Glu Met Val             180 185 190 Thr Val Ser Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met         195 200 205 Ser Tyr Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys     210 215 220 Lys Glu Lys Asp Ser Lys Gly Lys Thr Val Ser Ser Asn Gly Tyr Asp 225 230 235 240 Glu Val Leu Lys Ser Asp Ala Ser Lys Ser Gln Ile Asp Lys Glu Thr                 245 250 255 Val His Ser Ser Ala Gln Leu Pro Lys Lys Asn His Ser Glu Arg Arg             260 265 270 Glu Val Gln Gly Pro Val Val Ala Arg Pro Glu Glu Glu Asp Ile Phe         275 280 285 Ile Gly Glu Gly Val Asp Tyr Ser Val Pro Ala Gly Asp Met Gly Gln     290 295 300 Ser Pro Val Ser Glu Asp Met Glu Glu Ser Pro Arg Asn Lys Glu Arg 305 310 315 320 Thr Ser Tyr Phe Ser Glu Pro Ala Tyr Gly Pro Val Pro Ser Ser Glu                 325 330 335 Pro Ser His Asp Trp Gln Tyr Thr Asn Gly Tyr Asp Ala Ala Gln Ala             340 345 350 Gln Ala Val Ala Gly Val Tyr Gln Pro Glu Trp Gln Asp Tyr Gln Tyr         355 360 365 Pro Glu Gln Val Ala Tyr Pro Glu Gln Tyr Leu Gln Gln Asn Tyr Asp     370 375 380 Met Gln Ala Asp Val Asp Gly Leu Gln Asp Pro Gln Phe Met Thr Gln 385 390 395 400 Glu Glu Lys Asp Arg Gly Leu Gly Ser Val Phe Lys Arg Asp Asp Gln                 405 410 415 Arg Leu Leu Gln Leu Arg Glu Arg Asp Ala Arg Glu Lys Asp Pro Asn             420 425 430 Phe Ile Ser Glu Ser Tyr Ser Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr         435 440 445 Asn Arg Glu Val Val Asp Ser Asp Asp Glu Ala Asp Leu Ser Lys Met     450 455 460 Asp Met Gly Gly Arg Ala Lys Gly Arg Leu His Arg Trp Asp Phe Glu 465 470 475 480 Thr Glu Glu Glu Trp Ala Thr Tyr Asn Glu Gln Lys Glu Ala Met Pro                 485 490 495 Lys Ala Ala Phe Gln Phe Gly Val Lys Met Gln Asp Gly Arg Lys Thr             500 505 510 Arg Lys Gln Asn Lys Asp Gln Lys Leu Thr Asn Glu Leu His Lys Ile         515 520 525 Asn Lys Ile Leu Thr Arg Lys Lys Met Glu Lys Asp Lys Gly Glu Ala     530 535 540 Leu Glu Asp Gly Glu Ile Gln Pro Gly Lys Lys Gln Arg Val 545 550 555 <210> 8 <211> 561 <212> PRT <213> Cucumis sativus <400> 8 Met Ser Ser Ala Lys Lys His Tyr Lys Asp Lys Phe Ala Arg His Lys 1 5 10 15 Glu Glu Lys Thr Glu Glu Pro Glu Thr Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Pro Thr Glu Leu         35 40 45 Gly Phe His Ala Val Ala Pro Pro Gly Thr Val Asp Ile Arg Ala Ala     50 55 60 Asp Ala His Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly Asp 65 70 75 80 Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu Asn                 85 90 95 Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Asp Ala Val Gly Asp Ala             100 105 110 Glu Gly Lys Ala Ser Ala Pro Lys Glu Asp Gln Gln Val Leu Phe Arg         115 120 125 Thr Ala Thr Ala Lys Ser Val Tyr Lys Trp Ile Val Lys Pro Gln Thr     130 135 140 Gly Ile Lys Ser Asn Glu Thr Phe Leu Pro Gly Arg Thr Ser Phe Ile 145 150 155 160 Tyr Asn Met Glu Gly Gly Tyr Ser His Asp Ile Pro Thr Thr Leu His                 165 170 175 Arg Ser Ays Asp Cys Pro Val Pro Glu Glu Met Val Thr Val Asn             180 185 190 Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Ser Tyr Leu         195 200 205 Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Lys Asp Lys     210 215 220 Asp Val Lys Gly Lys Ile Ser Ser Ile Val Asn Glu Tyr Val Gly Ile 225 230 235 240 Asn Lys Pro Ser Thr Leu Asp Thr Gly Val Pro Lys Lys Gln Met Glu                 245 250 255 Arg Glu Met Leu Pro Pro Pro Pro Pro Leu Lys Lys Asn Gln Ile Val             260 265 270 Leu Lys Glu Lys Gln Gly Pro Val Val Thr Arg Val Glu Asp Asp Asp         275 280 285 Ile Phe Val Gly Ala Gly Val Asp Tyr Thr Val Gly Lys Asp Leu     290 295 300 Ser Gln Ser Pro Leu Ser Glu Asp Met Glu Glu Ser Pro Arg Asn Lys 305 310 315 320 Glu Lys Pro Ser Tyr Phe Ser Glu Pro Ala Tyr Gly Pro Val Pro Pro                 325 330 335 Ser Gly Pro Pro Gln Glu Trp Gln Glu Thr Asn Gly Tyr Gly Val Met             340 345 350 Gln Pro Gln Ala Phe Pro Ala Gly Tyr Gln Gly Glu Trp Gln Asp Tyr         355 360 365 Gln Tyr Ser Glu Gln Leu Ala Tyr Ser Glu Gln Tyr Leu Gln Leu Asn     370 375 380 Met Gln Ala Tyr Asp Met Gln Thr Gly Ala Asn Ile Gln Gln Asp Pro 385 390 395 400 Arg Leu Met Thr Gln Glu Glu Lys Asp Arg Gly Leu Gly Ser Val Phe                 405 410 415 Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu Arg Asp Ala Arg             420 425 430 Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser Tyr Ser Glu Cys Tyr Pro         435 440 445 Gly Tyr Gln Glu Tyr Asn Arg Glu Ile Val Asp Ser Asp Asp Glu Asp     450 455 460 Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys Gly Arg Leu His 465 470 475 480 Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Lys Tyr Asn Glu Gln                 485 490 495 Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys Met Gln             500 505 510 Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln Lys Leu Asn Asn         515 520 525 Glu Leu His Lys Ile Asn Lys Ile Leu Ala Lys Lys Lys Met Glu Lys     530 535 540 Glu Met Asn Gly Asp Asp Glu Asp Ile Gln Pro Gly Lys Lys Ile Arg 545 550 555 560 Val      <210> 9 <211> 567 <212> PRT <213> Vitis vinifera <400> 9 Met Ala Ser Ser Lys Arg Asn His Lys Glu Lys Ile Ile Arg Arg Lys 1 5 10 15 Glu Glu Lys Pro Glu Glu Pro Glu Leu Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Pro Thr Glu Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Thr Val Asp Leu Arg Ser     50 55 60 Thr Asp Ala Asn Lys Ile Ser Ile Glu His Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 His Lys Val Arg Ser Glu Ile Glu Lys Lys Pro Glu Val Gly Asp Asp             100 105 110 Ala Asp Gly Asn Lys Thr Ser Asn Pro Arg Lys Asp Gln Pro Leu Ser         115 120 125 Phe Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Val Lys Pro     130 135 140 Gln Thr Val Val Lys Ser Asn Glu Met Phe Leu Pro Gly Arg Met Ala 145 150 155 160 Phe Ile Phe Ser Met Glu Gly Gly Phe Ser Ser Asp Ile Pro Thr Thr                 165 170 175 Leu His Arg Ser Ser Ays Asp Cys Pro Val Pro Glu Glu Met Val Thr             180 185 190 Val Gly Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Ser         195 200 205 Tyr Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys     210 215 220 Glu Arg Asp Val Lys Gly Lys Ile Ser Thr Val Gly Asn Glu Phe Asp 225 230 235 240 Glu Glu Lys Lys Pro Ser Lys Leu Asp Gly Gly Met Ser Lys Asn Gln                 245 250 255 Thr Glu Arg Glu Ser Leu Pro Pro Pro Leu Pro Pro Arg Lys Asn Tyr             260 265 270 Val Asp Ser Arg Glu Lys His Gly Pro Ser Val Ala Arg Ser Glu Gln         275 280 285 Asp Ile Phe Val Gly Asp Gly Val Glu Tyr Asp Ile Pro Ser Lys     290 295 300 Asp Met Ser Gln Ser Pro Val Ser Glu Asp Met Glu Glu Ser Pro Arg 305 310 315 320 Asn Lys Glu Arg Ile Ser Tyr Leu Ser Glu Pro Ala Tyr Gly Pro Val                 325 330 335 Pro Pro Ser Glu Pro Gln Glu Trp Gln Gln Thr Asn Gly Tyr Asp Ala             340 345 350 Met Gln Ala Gln Ala Leu Ala Ala Gly Tyr Gln Gly Asp Trp Gln Glu         355 360 365 Tyr Gln Tyr Ala Glu Gln Met Ala Tyr Pro Glu Gln Tyr Leu Gln Gln     370 375 380 Asn Met Gln Thr Tyr Asp Val Gln Ala Gly Met Gly Ile Pro Gln Asp 385 390 395 400 Pro Arg Phe Met Thr Gln Glu Glu Lys Asp Arg Gly Leu Gly Ser Val                 405 410 415 Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu Lys Asp Ala             420 425 430 Arg Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser Tyr Ser Glu Cys Tyr         435 440 445 Pro Gly Tyr Gln Glu Tyr Asn Arg Glu Val Val Asp Ser Asp Asp Glu     450 455 460 Asp Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys Gly Arg Leu 465 470 475 480 His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Thr Tyr Asn Glu                 485 490 495 Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys Met             500 505 510 Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln Lys Leu Thr         515 520 525 Asn Glu Leu His Lys Ile Asn Lys Ile Leu Ala Arg Lys Lys Met Glu     530 535 540 Lys Gly Glu Met Asn Asp Asp Gly Gly Arg Tyr Asp Asp Asp Ser Gln 545 550 555 560 Pro Gly Lys Lys Leu Arg Ile                 565 <210> 10 <211> 567 <212> PRT <213> Fragaria vesca subsp. vesca <400> 10 Met Lys Ala Ser Lys Lys His Tyr Lys Asp Lys Val Val Arg Arg Lys 1 5 10 15 Asp Glu Lys Pro Glu Leu Pro Glu Leu Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Asp Glu Lys Asn Pro Asp Tyr Glu Ala Asn Gln Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Asn Val Asp Leu Gly Ala     50 55 60 Ala Asp Val His Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Leu Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 Thr Lys Val Arg Ser Glu Met Asp Lys Lys Pro Asp Ala Gly Asp Asp             100 105 110 Glu Gly Asp Ala Lys Ser Arg Ala Ser Lys Glu Asp Gln Lys Val Ser         115 120 125 Phe Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Val Lys Pro     130 135 140 Gln Thr Val Ile Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Leu Ser 145 150 155 160 Phe Ile Phe Asn Met Glu Gly Gly Tyr Thr His Asp Ile Pro Met Thr                 165 170 175 Leu His Arg Ser Lys Ala Asp Cys Pro Gln Pro Glu Glu Met Ala Thr             180 185 190 Val Ser Phe Asp Gly Ala Val Leu Glu Lys Ile Ser Ala Ser Met Ser         195 200 205 Tyr Leu Arg Val Gly Ser Ser Gly Lys Ala Ala Lys Lys Lys Lys Lys     210 215 220 Gly Lys Asp Ala Lys Gly Lys Ile Ser Val Gly Asn Gly Tyr Ala Glu 225 230 235 240 Glu Asp Lys Pro Ser Lys Pro Val Val Asp Val Ala Lys Asn Glu Thr                 245 250 255 Lys Arg Glu Phe Leu Pro Pro Pro Pro Pro Leu Pro Arg Lys Ser Gln             260 265 270 Ile Asp Ser Asn Glu Lys Gln Gly Pro Thr Ile Ala Arg Ala Asp Glu         275 280 285 Asp Asp Ile Phe Val Gly Asp Gly Val Asp Tyr Ala Ile Pro Gly Lys     290 295 300 Asp Leu Ser His Ser Pro Leu Ser Glu Asp Met Glu Glu Ser Pro Arg 305 310 315 320 Asn Lys Glu Lys Val Ser Tyr Phe Asp Glu Pro Ala Tyr Gly Pro Val                 325 330 335 Gln Pro Gln Gly Leu Pro Asn Glu Trp Gln Glu Met Asn Gly Tyr Asp             340 345 350 Gly Thr Thr Gln Gln Pro Met Val Gly Pro Tyr Ser Gly Glu Trp Gln         355 360 365 Glu Tyr His Gln Tyr Thr Glu Gln Met Ala Tyr Pro Glu Gln Tyr Leu     370 375 380 Gln Pro Asn Met Glu Gly Tyr Asp Val Gln Glu Gly Pro Thr Ile Gln 385 390 395 400 Asp Pro Arg Phe Met Thr Gln Glu Glu Lys Asp Arg Gly Leu Gly Ser                 405 410 415 Val Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu Lys Asp             420 425 430 Ala Arg Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser Tyr Ser Glu Cys         435 440 445 Tyr Pro Gly Tyr Gln Glu Tyr Asn Arg Glu Val Val Asp Ser Asp Asp     450 455 460 Glu Asp Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys Gly Arg 465 470 475 480 Leu His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Thr Tyr Asn                 485 490 495 Glu Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys             500 505 510 Met Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln Lys Ile         515 520 525 Ser Asn Asp Leu Asn Arg Ile Asn Lys Ile Leu Ala Arg Lys Lys Ser     530 535 540 Glu Lys Asp Gly Asp Asp Gly Gly Gly His Tyr Asp Glu Asp Val Gln 545 550 555 560 Pro Gly Lys Lys Leu Arg Val                 565 <210> 11 <211> 569 <212> PRT <213> Citrus sinensis <400> 11 Met Thr Ser Gly Lys Lys Tyr Tyr Lys Glu Lys Ile Ala Arg Arg Lys 1 5 10 15 Asp Glu Lys Pro Glu Glu Pro Glu Gln Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Pro Thr Glu Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Asn Val Asp Leu Arg Leu     50 55 60 Ala Asp Ala Gln Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 Asn Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Asp Ala Gly Asp Asp             100 105 110 Thr Asp Gly Lys Ser Arg Thr Ser Lys Glu Asp Gln Gln Leu Ser Phe         115 120 125 Arg Thr Ala Met Ala Lys Ser Val Tyr Gln Trp Ile Val Lys Pro Gln     130 135 140 Thr Val Met Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Met Ser Phe 145 150 155 160 Ile Phe Asn Thr Glu Gly Gly Tyr Ser Asn Asp Ile Pro Thr Thr Leu                 165 170 175 His Arg Ser Lys Ala Asp Cys Pro Val Pro Asp Glu Met Val Thr Val             180 185 190 Ser Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Thr Tyr         195 200 205 Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Lys Glu     210 215 220 Arg Asp Val Lys Val Thr Gly Lys Thr Ser Thr Val Val Asn Glu Tyr 225 230 235 240 Asp Glu Glu Asp Lys Pro Ser Lys Ala Asn Ser Gly Ile Pro Asn Gly                 245 250 255 Lys Thr Glu Lys Glu Ile Leu Pro Pro Pro Pro Pro Pro Lys Lys             260 265 270 Asn His Val Asp Ser Arg Glu Lys Gln Gly Pro Ile Val Ala Arg Ser         275 280 285 Glu Glu Asp Asp Ile Phe Val Gly Ala Gly Thr Asp Tyr Thr Val Pro     290 295 300 Gly Lys Asp Met Asn Gln Ser Pro Val Ser Glu Asp Met Glu Glu Ser 305 310 315 320 Pro Arg Asn Lys Glu Lys Val Ser Tyr Phe Ser Glu Ser Val Tyr Gly                 325 330 335 Pro Val Pro Pro Ala Glu Pro Pro Leu Ala Trp Gln Asp Thr Asn Gly             340 345 350 Tyr Asp Ala Met Gln Ala Gln Ala Leu Ala Gly Gly Tyr Gln Gly Glu         355 360 365 Trp Gln Asp Tyr Gln Tyr Ala Glu Gln Leu Ala Tyr Pro Glu Gln Tyr     370 375 380 Leu Gln Pro Asp Met Gln Thr Tyr Glu Met Gln Ala Gly Leu Asn Met 385 390 395 400 Pro Gln Asp Pro Arg Phe Met Thr Gln Glu Glu Lys Asp Arg Gly Leu                 405 410 415 Gly Ser Val Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu             420 425 430 Lys Asp Ala Arg Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser Ser Ser Ser         435 440 445 Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr Asn Arg Glu Ile Val Asp Ser     450 455 460 Asp Asp Glu Asp Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys 465 470 475 480 Gly Arg Leu His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Thr                 485 490 495 Tyr Asn Glu Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly             500 505 510 Val Lys Met Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln         515 520 525 Lys Leu Thr Asn Glu Leu His Lys Ile Asn Lys Ile Leu Ala Arg Lys     530 535 540 Lys Met Glu Lys Asp Thr Asn Gly Glu Gly Gly His Tyr Asp Asp Asp 545 550 555 560 Val Gln Pro Gly Lys Lys Pro Arg Val                 565 <210> 12 <211> 574 <212> PRT <213> Prunus persica <400> 12 Met Thr Ser Ser Lys Lys His His Lys Glu Lys Val Ile Arg Arg Lys 1 5 10 15 Glu Glu Lys Ala Glu Gln Pro Glu Leu Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Gln Thr Glu Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Asn Val Asp Leu Arg Ala     50 55 60 Ala Glu Ala Gln Lys Leu Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 Asn Lys Ile Arg Ser Glu Ile Asp Lys Lys Pro Asp Ala Glu Asp Glu             100 105 110 Ala Asp Ala Lys Ser Arg Ala Ser Lys Glu Asp Gln Lys Leu Ser Phe         115 120 125 Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Cys Ile Val Lys Pro Gln     130 135 140 Ala Val Ile Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Met Ser Phe 145 150 155 160 Ile Phe Asn Met Glu Gly Gly Tyr Thr His Asp Ile Pro Thr Thr Leu                 165 170 175 His Arg Ser Lys Ala Asp Cys Pro Gln Pro Glu Glu Met Val Thr Val             180 185 190 Ser Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Met Ser Tyr         195 200 205 Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Lys Glu     210 215 220 Lys Asp Ala Lys Gly Lys Ile Ser Ile Ile Gly Asn Glu Phe Val Glu 225 230 235 240 Glu Asp Lys Pro Ser Lys Pro Asp Ala Gly Thr Ser Lys Asn Glu Thr                 245 250 255 Lys Arg Glu Ile Leu Pro Pro Pro Pro Pro Pro Pro Gly Pro Pro             260 265 270 Pro Arg Lys Asn His Ile Asp Ser Lys Ala Gln Gln Gly Pro Thr Met         275 280 285 Ala Arg Ala Asp Glu Asp Asp Ile Phe Val Gly Asp Gly Val Asp Tyr     290 295 300 Ala Ile Pro Gly Lys Asp Leu Ser Gln Ser Pro Leu Ser Glu Asp Met 305 310 315 320 Glu Glu Ser Pro Arg Asn Lys Glu Lys Val Ser Tyr Phe Asp Glu Pro                 325 330 335 Val Tyr Gly Pro Val Gln Pro Tyr Gly Ala Pro Gln Glu Trp Gln Glu             340 345 350 Thr Asn Gly Tyr Asp Ala Thr Gln Thr Gln Met Ala Gly Ala Tyr Gln         355 360 365 Gly Glu Trp Pro Ala Glu Tyr Gln Tyr Ala Glu Gln Met Ala Tyr Pro     370 375 380 Glu Gln Tyr Leu Gln Pro Asn Met Glu Gly Tyr Asp Val Glu Ala Gly 385 390 395 400 Leu Asn Ile Gln Asp Pro Arg Phe Met Thr Gln Glu Glu Lys Asp Arg                 405 410 415 Gly Leu Gly Ser Val Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu             420 425 430 Arg Glu Lys Asp Ala Arg Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser         435 440 445 Tyr Ser Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr Asn Arg Glu Ile Val     450 455 460 Asp Ser Asp Asp Glu Asp Asp Leu Ser Lys Met Asp Met Gly Gly Arg 465 470 475 480 Ala Lys Gly Arg Leu His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp                 485 490 495 Ala Thr Tyr Asn Glu Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln             500 505 510 Phe Gly Val Lys Met Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys         515 520 525 Asp Gln Lys Ile Thr Asn Asp Leu His Lys Ile Asn Lys Ile Leu Ala     530 535 540 Arg Lys Lys Met Asp Lys Asp Ile Asp Gly Gly Gly Gly Gly Gly Gly Gly 545 550 555 560 His Tyr Asp Asp Val Gln Pro Gly Lys Lys Leu Arg Val                 565 570 <210> 13 <211> 569 <212> PRT <213> Theobroma cacao <400> 13 Met Ser Ser Ser Lys Lys Tyr Tyr Lys Glu Lys Ile Ala Arg Arg Lys 1 5 10 15 Glu Glu Lys Ala Glu Glu Pro Glu Gln Pro Lys Tyr Arg Asp Arg Ala             20 25 30 Lys Glu Arg Arg Glu Asp Gln Asn Pro Asp Tyr Glu Pro Thr Glu Leu         35 40 45 Gly Ser Phe His Ala Val Ala Pro Pro Gly Thr Val Asp Leu Arg Ser     50 55 60 Ala Asp Ala His Lys Ile Ser Ile Glu Lys Ser Lys Tyr Leu Gly Gly 65 70 75 80 Asp Val Glu His Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu                 85 90 95 Asn Lys Val Arg Ser Glu Ile Asp Lys Lys Pro Asp Ala Gly Glu Asp             100 105 110 Gly Asp Gly Lys Ser Arg Lys Ser Lys Glu Asp Gln Gln Ile Ser Phe         115 120 125 Arg Thr Ala Thr Ala Lys Ser Val Tyr Gln Trp Ile Val Lys Pro Gln     130 135 140 Thr Val Met Lys Thr Asn Glu Met Phe Leu Pro Gly Arg Met Ala Phe 145 150 155 160 Ile Phe Asn Met Glu Gly Gly Tyr Ser Asn Asp Ile Pro Thr Thr Leu                 165 170 175 His Arg Ser Lys Ala Asp Cys Pro Val Pro Asp Glu Met Val Thr Val             180 185 190 Ser Val Asp Gly Ser Val Leu Asp Arg Ile Ala Lys Ile Leu Ser Tyr         195 200 205 Leu Arg Leu Gly Ser Ser Gly Lys Val Leu Lys Lys Lys Lys Lys Lys Glu     210 215 220 Arg Asp Ala Lys Gly Lys Val Leu Ala Leu Gly Asn Glu Tyr Asp Glu 225 230 235 240 Glu Asp Lys Pro Ser Lys Pro Asn Gly Gly Met Ser Asn Gly Arg Thr                 245 250 255 Glu Lys Glu Ile Leu Pro Pro Pro Pro Pro Pro Arg Lys Asn Tyr             260 265 270 Leu Asp Ser Arg Glu Lys Gln Gly Pro Thr Val Ala Arg Ala Glu Glu         275 280 285 Asp Asp Ile Phe Val Gly Asp Gly Ile Asp Tyr Asp Ser Pro Arg Lys     290 295 300 Asp Met Asn Pro Ser Pro Leu Ser Glu Asp Met Glu Glu Ser Pro Arg 305 310 315 320 His Lys Glu Arg Val Ser Tyr Phe Ala Glu Pro Ala Tyr Gly Pro Val                 325 330 335 Gln Pro Ser Ala Ala Pro Gln Glu Trp Gln Glu Leu Ser Gly Tyr Asp             340 345 350 Ala Leu Gln Thr Gln Ala Leu Ala Gly Gly Tyr Gln Gly Glu Trp Gln         355 360 365 Asp Tyr Gln Tyr Thr Glu Gln Met Ala Tyr Pro Glu Gln Tyr Leu Gln     370 375 380 Ala Asn Met Gln Gly Tyr Asp Val Gln Ala Gly Leu Asn Ile Pro Gln 385 390 395 400 Asp Pro Arg Phe Met Thr Gln Glu Glu Lys Asp Arg Gly Leu Gly Ser                 405 410 415 Val Phe Lys Arg Asp Asp Gln Arg Leu Gln Gln Leu Arg Glu Lys Asp             420 425 430 Ala Arg Glu Lys Asp Pro Asn Phe Ile Ser Glu Ser Tyr Ser Glu Cys         435 440 445 Tyr Pro Gly Tyr Gln Glu Tyr Asn Arg Glu Ile Val Asp Ser Asp Asp     450 455 460 Glu Asp Asp Leu Ser Lys Met Asp Met Gly Gly Arg Ala Lys Gly Arg 465 470 475 480 Leu His Arg Trp Asp Phe Glu Thr Glu Glu Glu Trp Ala Thr Tyr Asn                 485 490 495 Glu Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys             500 505 510 Met Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Lys Asp Gln Lys Leu         515 520 525 Asn Asn Glu Leu His Lys Ile Asn Lys Ile Leu Ala Arg Lys Lys Met     530 535 540 Glu Lys Asp Ser Gly Gly Glu Gly Gly His His Asn Asp Asp Val Gln 545 550 555 560 Pro Gly Lys Lys Leu Arg Ile Ser Gly                 565 <210> 14 <211> 19 <212> PRT <213> Conserved seqences in plant <220> <221> MISC_FEATURE &Lt; 222 > (9) <223> X = E or D <220> <221> MISC_FEATURE &Lt; 222 > (10) <223> X = D or E <220> <221> MISC_FEATURE &Lt; 222 > (11) <223> X = Q or K <220> <221> MISC_FEATURE &Lt; 222 > (17) <223> X = E or D <400> 14 Pro Lys Tyr Arg Asp Arg Ala Lys Xaa Xaa Xaa Glu Asn Gln Asn Pro 1 5 10 15 Xaa Tyr Asp              <210> 15 <211> 8 <212> PRT <213> conserved sequences in plant <400> 15 Phe His Ala Val Ala Pro Pro Gly 1 5 <210> 16 <211> 39 <212> PRT <213> conserved sequences in plant <220> <221> MISC_FEATURE <222> (6) X = K, N or H <220> <221> MISC_FEATURE <222> (29). (29) X = N, H or T <220> <221> MISC_FEATURE &Lt; 222 > (36) &Lt; 223 > X = D, E or V <400> 16 Lys Ile Ser Ile Glu Xaa Ser Lys Tyr Leu Gly Gly Asp Val Glu His 1 5 10 15 Thr His Leu Val Lys Gly Leu Asp Tyr Ala Leu Leu Xaa Lys Val Arg             20 25 30 Ser Glu Ile Xaa Lys Lys Pro         35 <210> 17 <211> 13 <212> PRT <213> conserved sequences in plant <220> <221> MISC_FEATURE <222> (6) <223> X = Q or K <220> <221> MISC_FEATURE <222> (7) (7) &Lt; 223 > X = W or C <220> <221> MISC_FEATURE &Lt; 222 > (9) <223> X = V or I <400> 17 Ala Lys Ser Val Tyr Xaa Xaa Trp Xaa Val Lys Pro Gln 1 5 10 <210> 18 <211> 15 <212> PRT <213> conserved sequences in plant <220> <221> MISC_FEATURE <222> (2) (2) X = S, T or E <220> <221> MISC_FEATURE &Lt; 222 > (5) <223> X = M, T or L <220> <221> MISC_FEATURE &Lt; 222 > (11) <223> X = M, T or L <220> <221> MISC_FEATURE (12). (12) &Lt; 223 > X = T, A or S <400> 18 Lys Xaa Asn Glu Xaa Phe Leu Pro Gly Arg Xaa Xaa Phe Val Tyr 1 5 10 15 <210> 19 <211> 13 <212> PRT <213> conserved sequences in plant <220> <221> MISC_FEATURE <222> (4) (4) <223> X = T or M <220> <221> MISC_FEATURE <222> (7) (7) &Lt; 223 > X = H or Y <400> 19 Asp Ile Pro Xaa Thr Leu Xaa Arg Ser Lys Ala Asp Cys 1 5 10 <210> 20 <211> 9 <212> PRT <213> conserved sequences in plant <400> 20 Met Ser Tyr Leu Arg Leu Gly Ser Ser 1 5 <210> 21 <211> 12 <212> PRT <213> conserved sequences in plant <400> 21 Tyr Ser Glu Cys Tyr Pro Gly Tyr Gln Glu Tyr Asn 1 5 10 <210> 22 <211> 27 <212> PRT <213> conserved sequence in plant <220> <221> MISC_FEATURE &Lt; 222 > (14) &Lt; 223 > X = R or G <220> <221> misc_feature &Lt; 222 > (21) <223> Xaa can be any naturally occurring amino acid <220> <221> MISC_FEATURE &Lt; 222 > (27) &Lt; 223 > X = A or E <400> 22 Asp Leu Ser Lys Met Asp Met Gly Gly Lys Ala Lys Gly Xaa Leu His 1 5 10 15 Arg Trp Asp Phe Xaa Thr Glu Glu Glu Trp Glu             20 25 <210> 23 <211> 28 <212> PRT <213> conserved seqeunces in plant <400> 23 Gln Lys Glu Ala Met Pro Lys Ala Ala Phe Gln Phe Gly Val Lys Met 1 5 10 15 Gln Asp Gly Arg Lys Thr Arg Lys Gln Asn Arg Asp             20 25 <210> 24 <211> 18 <212> PRT <213> conserved sequences in plant <220> <221> MISC_FEATURE <222> (4) (4) X = N, T or S <220> <221> MISC_FEATURE <222> (6) <223> X = E or D <220> <221> MISC_FEATURE &Lt; 222 > (8) &Lt; 223 > X = H or N <220> <221> MISC_FEATURE &Lt; 222 > (9) X = K, Q or R <220> <221> MISC_FEATURE &Lt; 222 > (15) <223> X = A or T <400> 24 Gln Lys Leu Xaa Asn Xaa Leu Xaa Xaa Ile Asn Lys Ile Leu Xaa Arg 1 5 10 15 Lys Lys          <210> 25 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-1 primer <400> 25 taagaattca atgaaacctt caaaatcgc 29 <210> 26 <211> 28 <212> DNA Artificial sequence <220> <223> CANP-2 primer <400> 26 gatgtcgact caatgcttgg atctctta 28 <210> 27 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-5 primer <400> 27 taatctagaa tgaaaccttc aaaatcgca 29 <210> 28 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-6 primer <400> 28 tttggatcca tgcttggatc tcttaggag 29 <210> 29 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-10 primer <400> 29 tttggatcct caatgcttgg atctcttag 29 <210> 30 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-11 primer <400> 30 aaatctagaa tgcgtgctaa agaaagaag 29 <210> 31 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-12 primer <400> 31 taagaattca tgaaaccttc aaaatcgca 29 <210> 32 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-17 primer <400> 32 ttttctagat caatgcttgg atctcttag 29 <210> 33 <211> 29 <212> DNA Artificial sequence <220> <223> CANPP-1 primer <400> 33 actaagcttc ttggtgataa ggattcaat 29 <210> 34 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-PF primer <400> 34 actaagcttc ttggtgataa ggattcaat 29 <210> 35 <211> 29 <212> DNA Artificial sequence <220> <223> CANP-PR primer <400> 35 ataggatcct agatttcgtt aattcgatt 29 <210> 36 <211> 29 <212> DNA Artificial sequence <220> <223> CIPK1-2 primer <400> 36 ttagtcgacc taagttacta tctcttgct 29 <210> 37 <211> 29 <212> DNA Artificial sequence <220> <223> CIPK1-14 primer <400> 37 atatctagaa tggtgagaag gcaagagga 29 <210> 38 <211> 29 <212> DNA Artificial sequence <220> <223> CIPK1-23 primer <400> 38 tttggatcca gttactatct cttgctccg 29 <210> 39 <211> 29 <212> DNA Artificial sequence <220> <223> CIPK1-15 primer <400> 39 atagaattca tggtgagaag gcaagagga 29 <210> 40 <211> 29 <212> DNA Artificial sequence <220> <223> CBL1-7 primer <400> 40 atagcggccg caatgggctg cttccactc 29 <210> 41 <211> 29 <212> DNA Artificial sequence <220> <223> CBL1-8 primer <400> 41 taaagatctt catgtggcaa tctcatcga 29 <210> 42 <211> 29 <212> DNA Artificial sequence <220> <223> CBL9-3 primer <400> 42 ttttctagaa tgggttgttt ccattccac 29 <210> 43 <211> 29 <212> DNA Artificial sequence <220> <223> CBL9-4 primer <400> 43 aaaggatcct cacgtcgcaa tctcgtcca 29 <210> 44 <211> 29 <212> DNA Artificial sequence <220> <223> CBL9-5 primer <400> 44 ttagcggccg caatgggttg tttccattc 29 <210> 45 <211> 29 <212> DNA Artificial sequence <220> <223> CBL9-6 primer <400> 45 tttagatctt cacgtcgcaa tctcgtcca 29 <210> 46 <211> 25 <212> DNA Artificial sequence <220> <223> CANP-RT5 primer <400> 46 tcagtttacc agtggattgt taagc 25 <210> 47 <211> 25 <212> DNA Artificial sequence <220> <223> CANP-RT3 primer <400> 47 tccccgacga cccaaggcga agata 25 <210> 48 <211> 25 <212> DNA Artificial sequence <220> <223> RD29A-RT1 primer <400> 48 caacacacac cagcagcacc cagaa 25 <210> 49 <211> 25 <212> DNA Artificial sequence <220> <223> RD29A-RT2 primer <400> 49 cttcaggttc tagctcgtca tcatc 25 <210> 50 <211> 25 <212> DNA Artificial sequence <220> <223> RD29B-RT1 primer <400> 50 accaatcaga attcaccatc cagaa 25 <210> 51 <211> 24 <212> DNA Artificial sequence <220> <223> RD29B-RT2 primer <400> 51 gtttcaccgt tacaccacct ctca 24 <210> 52 <211> 25 <212> DNA Artificial sequence <220> <223> RD22-RT1 primer <400> 52 ctgtcttctt ggttcattca tggta 25 <210> 53 <211> 25 <212> DNA Artificial sequence <220> <223> RD22-RT2 primer <400> 53 tccacgcgta cacctccctt tccaa 25 <210> 54 <211> 25 <212> DNA Artificial sequence <220> <223> actin2-1 primer <400> 54 gagatcaccg ctcttgcacc tagca 25 <210> 55 <211> 24 <212> DNA Artificial sequence <220> <223> actin2-2 primer <400> 55 ttcctgtgaa caatcgatgg acct 24 <210> 56 <211> 29 <212> DNA Artificial sequence <220> <223> SlCANP-1 primer <400> 56 ataactagta tgtcttcttc aaagcgaaa 29 <210> 57 <211> 29 <212> DNA Artificial sequence <220> <223> SlCANP-2 primer <400> 57 tttgagctct catacacgct gcttctttc 29

Claims (8)

1 to SEQ ID NO: 13 or conserved sequences RED_N_Superfamily and RED_C_Superfamily at the N-terminus and at the C-terminus, respectively, and encoding an amino acid sequence consisting of 540 to 600 amino acids (CANP CIPK1-Associating Nuclear Protein) gene,
Wherein the RED_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 14 to 20, and the RED_C_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 21 to 24, which enhances photosynthetic efficiency and enhances resistance to drying and salting stress Recombinant vector for the production of transgenic plants.
A composition for the production of transgenic plants, comprising a recombinant vector comprising the CANP gene according to claim 1, wherein the photosynthetic efficiency is enhanced and resistance to drying and salting stress is enhanced.
A transgenic plant transformed with a recombinant vector comprising the CANP gene according to claim 1, wherein the photosynthetic efficiency is enhanced and the resistance to drying and salting stress is enhanced.
The method of claim 3,
The transgenic plants are transgenic plants such as Arabidopsis, rice, corn, beans, potatoes, roots, tomatoes, cucumbers, grapes, strawberries, oranges, peaches or cacao.
A transformed seed of a transgenic plant according to claim 3 or 4.
1 to SEQ ID NO: 13 or conserved sequences RED_N_Superfamily and RED_C_Superfamily at the N-terminus and at the C-terminus, respectively, and encoding an amino acid sequence consisting of 540 to 600 amino acids (CANP Overexpressing a CANP gene in a host cell by transforming the host cell with a recombinant vector comprising a CIPK1-Associating Nuclear Protein gene,
Wherein the RED_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 14 to 20, the RED_C_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 21 to 24, and the photosynthetic efficiency is enhanced and the resistance to drying and salting stress is enhanced A method for producing a transgenic plant.
1 to SEQ ID NO: 13 or conserved sequences RED_N_Superfamily and RED_C_Superfamily at the N-terminus and at the C-terminus, respectively, and encoding an amino acid sequence consisting of 540 to 600 amino acids (CANP CIPK1-Associating Nuclear Protein) gene,
Wherein the RED_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 14 to 20, and the RED_C_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 21 to 24, which enhances photosynthetic efficiency and enhances resistance to drying and salting stress Plant cells derived from transgenic plants.
A method for producing seeds of a transgenic plant having enhanced photosynthetic efficiency and enhanced resistance to drying and salting stress, comprising the steps of:
(a) encoding an amino acid sequence consisting of 540 to 600 amino acid residues in the N-terminus and C-terminus of RED_N_Superfamily and RED_C_Superfamily which encode the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 13 or conserved sequences, Transforming a plant with a vector comprising a CANP (CIPK1-Associating Nuclear Protein) gene;
(b) screening plant populations for which the CANP gene has been introduced and exhibit a phenotype of increased resistance to salt, dryness, and photosynthetic efficiency; And
(c) seeding the seeds from the selected plant populations,
Wherein the RED_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 14 to 20, and the RED_C_Superfamily is a conserved sequence comprising the amino acid sequence of SEQ ID NOS: 21 to 24.

Images