KR102488519B1 - New cyclic pentadepsipeptide and composition for wound healing and regeneration comprising new cyclic pentadepsipeptide as an effective ingredient - Google Patents

Abstract

The present invention relates to a novel cyclic pentadepsipeptide, a novel microorganism producing the same, and a composition for wound healing or regeneration containing the compound as an active ingredient. More specifically, a pharmaceutical composition for skin regeneration or wound healing containing acremonitamide, a novel cyclic peptadepsipeptide, as an active ingredient, a cosmetic composition for skin regeneration or wound healing, a quasi-drug composition for skin regeneration or wound healing, And it relates to a health functional food composition for skin regeneration or wound improvement.
Acremonitamide, a novel cyclic pentadepsipeptide isolated from a fungal strain derived from marine sediments according to the present invention, has no cytotoxicity and is safe for the skin, and the cell infiltration ability is significantly increased when acremonitamide is applied , Since it forms new tissue at the wound site and significantly reduces scarring, it can be usefully used in medicines, cosmetics, and foods for skin regeneration and wound healing.

Description

New cyclic pentadepsipeptide compound and composition for wound healing or regeneration containing the same as an active ingredient

The present invention relates to a novel cyclic pentadepsipeptide, a novel microorganism producing the compound, and a composition for wound healing or regeneration containing the compound as an active ingredient. More specifically, a pharmaceutical composition for skin regeneration or wound healing containing acremonitamide, a novel cyclic peptadepsipeptide, as an active ingredient, a cosmetic composition for skin regeneration or wound healing, a quasi-drug composition for skin regeneration or wound healing, And it relates to a health functional food composition for skin regeneration or wound improvement.

The skin is the most basic defense organ that protects the body against external stimuli in contact with the external environment, and plays a role in preventing internal heat and moisture loss. Skin is structurally composed of epidermis, dermis, and subcutaneous tissue, among which the epidermis provides a barrier against invasion of foreign substances and microorganisms.

The stratum corneum, which exists most of the outermost part of the epidermis, is composed of flat, hexagonal dead cells. It is formed by keratinocytes and at the same time constantly peels off to protect the skin from invasion of foreign substances and microorganisms.

However, when various types of damage occur on the skin, such as direct wounds, thermal burns, eczema caused by physical or chemical stimulation, or stretch marks caused by an increase in adrenal cortical hormone, the inside of the skin is exposed to foreign substances and microorganisms.

Therefore, when wounds, burns, abrasions, and other damages occur to the skin, the process of preventing external foreign substance infection and healing the wound is primarily performed.

Wound healing clinically refers to complete closure of the skin through stages of inflammation, proliferation and remodeling. The process of wound healing interacts with various types of cells, such as keratinocytes, fibroblasts, vascular endothelial cells, macrophages, and platelets, and is regulated by signaling substances such as growth factors, cytokines, and chemokines.

When keratinocytes in contact with the basement membrane between the epidermis and the dermis actively proliferate, the shape of the cytoplasm changes and moves to the upper layer of the epidermis. The proliferation and migration of keratinocytes play a role in suturing wounds in the wound healing process.

In addition, proliferation of keratinocytes stimulates fibroblasts to promote the production of collagen and elastin filled in the extracellular matrix. That is, proliferation and migration of keratinocytes are major factors in wound healing.

To date, various types of wound healing agents have been developed and marketed. Representative examples include peptides such as epidermal growth factor, cytokine, interleukin, transforming growth factor-beta (TGF-β), and Madecasol (Asiaticoside). However, peptides are expensive to manufacture, making it impossible to produce in large quantities, and are unstable, making them difficult to store and prone to denaturation.

Representatively commercialized products used for skin wound healing include Fucidin from Dongwha Pharm Co., Ltd. and Madecassol from Dongkuk Pharm Co., Ltd. However, studies have been reported that the number of Staphylococcus aureus resistant to fucidic acid, the main component of fucidin, is increasing (Dobie D. & Gray J., Arch Dis Child. , 89(1): 74-77, 2004). In addition, side effects such as allergic reactions and rashes are steadily reported when using fucidin and madecassol, and the need for research on new products is emerging.

Korean Patent Publication No. 2005-0037106 (published on April 21, 2005)

Dobie D. & Gray J., Arch Dis Child., 89(1):74-77, 2004

One object of the present invention is to provide a cyclic pentadepsipeptide compound represented by the following formula (1) as a novel compound.

[Formula 1]

Another object of the present invention is to provide a novel microorganism, Acremonium sp. CNQ049 (Accession No. KCTC 14114BP), which is a novel microorganism that produces the compound of Formula 1.

Another object of the present invention is to provide a pharmaceutical composition for skin regeneration or wound healing comprising the cyclic pentadepsipeptide of Formula 1 as an active ingredient.

Another object of the present invention is to provide a cosmetic composition for skin regeneration or wound improvement comprising the cyclic pentadepsipeptide of Formula 1 as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for skin regeneration or wound improvement comprising the cyclic pentadepsipeptide of Formula 1 as an active ingredient.

Another object of the present invention is to provide a health functional food composition for skin regeneration or wound improvement comprising the cyclic pentadepsipeptide of Formula 1 as an active ingredient.

In order to achieve the above object, as one aspect, the present invention provides a cyclic pentadepsipeptide compound of Formula 1 for skin regeneration or wound healing.

[Formula 1]

In another aspect, the present invention provides a new microorganism, Acremonium sp. CNQ049 (Accession No. KCTC 14114BP), which is a novel microorganism that produces the compound of Formula 1.

In another aspect, the present invention provides a pharmaceutical composition for skin regeneration or wound healing, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

As another aspect, the present invention provides a cosmetic composition for skin regeneration or wound improvement comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

In another aspect, the present invention provides a quasi-drug composition for skin regeneration or wound healing, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

In another aspect, the present invention provides a health functional food composition for skin regeneration or wound improvement, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

Acremonitamide, a novel cyclic pentadepsipeptide isolated from Acremonium strain, which is a novel fungal strain derived from marine sediments according to the present invention, is not only safe for the skin because it has no cytotoxicity, but also when acremonitamide is applied Since cell infiltration ability is significantly increased, new tissue is formed at the wound site and scarring is significantly reduced, it can be usefully used in medicines, cosmetics, and foods for skin regeneration and wound healing.

1 is a diagram showing a ¹ H NMR spectrum (top) and a ¹³ C NMR spectrum (bottom) of a cyclic pentadepsipeptide of Formula 1 according to the present invention.
Figure 2 is a graph showing the in vitro skin wound healing effect of the cyclic pentadepsipeptide of Formula 1 according to the present invention, a micrograph (left) confirming the degree of cell infiltration and a graph showing the quantification of the degree of cell infiltration (right) is.
Figure 3 is a graph showing the in vivo skin wound healing effect of the cyclic pentadepsipeptide of Formula 1 according to the present invention, a graph showing the incision area reduction size calculated as a relative reduction ratio (left) and visual observation This is a photo (right) taken with

As a result of the inventors' diligent efforts to develop an excellent wound healing material that is more stable than before, acremonitamide, a novel cyclic pentadepsipeptide isolated from a novel fungal strain derived from marine sediments, has no cytotoxicity and is only safe for the skin. In addition, the present invention was completed by confirming that cell infiltration ability was significantly increased when acremonitamide was applied, and skin regeneration and wound healing effects, such as forming new tissue at the wound site and significantly reducing scarring, were present.

In one aspect, the present invention provides a cyclic pentadepsipeptide compound of Formula 1 for skin regeneration or wound healing.

[Formula 1]

In the present invention, "cyclic pentadepsipeptide" is a compound having a structure represented by Formula 1, and can be isolated from natural strains found in nature or synthesized artificially, and even when artificially synthesized, the same effect can be obtained. It is obvious to those skilled in the art to have.

As one specific example, the cyclic pentadepsipeptide may be produced from Acremonium sp. CNQ-049 (Accession No. KCTC 14114BP), which is a novel microorganism derived from marine sediments.

In the present invention, the cyclic pentadepsipeptide is acremonitamide, N -Me-Phe, N -Me-Ala, Val, Phe and 2-hydroxyisovaleric acid ) is made up of

On the other hand, in the present invention, acremonitamide, the cyclic pentadepsipeptide isolated from Acremonium sp. Also referred to as 592.

In another aspect, the present invention provides a CNQ-049 microorganism of the genus Acremonium deposited under Accession No. KCTC 14114BP that produces the compound of Formula 1.

The Acremonium genus ( Acremonium sp.) CNQ-049 is a novel fungal strain isolated and identified from marine sediments by the present inventors on January 23, 2020 at the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center Microbial Accession No. KCTC 14114BP It is a strain deposited with

In one specific embodiment, the genus Acremonium ( Acremonium sp.) CNQ-049 has the 18S rRNA sequence of SEQ ID NO: 1.

In one specific embodiment, the Acremonium sp. CNQ-049 has the ability to produce a novel compound of Formula 1 having skin regeneration and/or wound healing effects.

In another aspect, the present invention provides a pharmaceutical composition for skin regeneration or wound healing, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

[Formula 1]

In the present invention, the term "skin regeneration" is a tissue recovery process for damage, including chemotaxis, cell differentiation and replication, matrix protein synthesis, angiogenesis, wound reconstruction, and the like. It is a complex biological process that On the other hand, the damage may be caused by ultraviolet rays, external contaminants, wounds, trauma, burns, stress, etc., but is not limited thereto.

In the present invention, the term "wound" means that the normal continuity of the skin structure is disrupted due to physical damage to the skin, specifically contusion or bruise, laceration, avulsion, Penetrated wound, non-healing traumatic wound, destruction of tissue by irradiation, abrasion, bone gangrene, gun shot wound, cut, burn, frostbite, skin ulcer, dry skin, keratosis dermatosis, Cracks, bursts, dermatitis, pain due to dermatophytosis, surgical wounds, vascular disease wounds, corneal wounds, bedsores, swollen sores, conditions related to diabetes and poor circulation, chronic ulcers, sutured areas after plastic surgery, spinal injuries , gynecological wounds, chemical wounds, and acne, etc., comprehensively refer to damage to a part of an object.

Also, in the present invention, the term "wound healing" refers to a complex process in which the skin or body tissue spontaneously recovers its discontinuity after a wound. Thus, wound healing ultimately means the promotion, amelioration, progression, acceleration or advancement of one or more steps or processes involved in the cutaneous wound healing process.

The pharmaceutical composition for skin regeneration or wound healing of the present invention includes acremonitamide, a cyclic pentadepsipeptide compound having a structure represented by Formula 1, or an acceptable salt thereof as an active ingredient.

The 'acceptable salt' of the present invention includes an acid addition salt formed by a pharmaceutically acceptable free acid or a metal salt formed by a base. As the free acid, inorganic acids and organic acids may be used. Examples of the inorganic acid may include hydrochloric acid, sulfuric acid, hydrobromic acid, sulfurous acid or phosphoric acid. Examples of the organic acid may include citric acid, acetic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, and the like. The metal salt includes an alkali metal salt or an alkaline earth metal salt, and a sodium, potassium or calcium salt may be usefully used.

In one embodiment of the present invention, the novel cyclic pentadepsipeptide 'acremonitamide' of Formula 1 isolated from marine sediment-derived actinomycete strains has no cytotoxicity, and cell invasion ability significantly increases when acremonitamide is applied. , and it was confirmed that new tissue was formed in the wound-induced mouse and the scar was significantly reduced (see Examples 2 to 4). Therefore, it was ultimately found that acremonitamide (CNQ049.592) can be usefully used in medicines, cosmetics, and foods for skin regeneration and wound healing.

In the present invention, the pharmaceutical composition may further include a carrier, an excipient and a diluent. The carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.

The dosage of the pharmaceutical composition can be appropriately selected by a doctor or pharmacist in the art in consideration of the severity and extent of the wound, the time elapsed since the wound occurred, and the treatment period. In addition, it can be administered once or several times a day according to the judgment of a doctor or pharmacist, and the administration period may vary depending on the severity of the wound and the course of treatment, but the desired effect can be obtained even if it is continued for only 6 days from the date of occurrence of the wound. .

Since there is no particular limitation on the administration method, it is possible to inject directly into the wound site in the form of an injection, or it can be administered in the form of application.

Specifically, the pharmaceutical composition is formulated into various formulations of medicines, healing aids, and medical devices (semi-solid preparations such as ointments and gels, mask packs, dressings, bands/gauze, liquids, etc.) together with pharmaceutically acceptable carriers. It is an applicable material, and the type of formulation is not particularly limited, and it can be prepared in an obvious formulation by a technique known to those skilled in the art. Non-limiting examples thereof include ointments, liquids, patches, gels, creams, lotions, sprays, or aerosol formulations.

Another aspect of the present invention provides a skin regeneration or wound healing method comprising administering the pharmaceutical composition to a subject in need thereof.

The description of "skin regeneration" and "wound healing" is as described above.

As used herein, the term "subject" refers to all animals, including humans, in need of skin regeneration or wound healing, such as monkeys, cows, horses, pigs, sheep, dogs, cats, rats, mice, chimpanzees, and other mammals. .

As used herein, the term "administration" means introducing a predetermined substance into a subject by an appropriate method. The composition of the present invention can be administered through any general route capable of reaching the target in vivo. The route of administration of the composition of the present invention is not particularly limited, but may be administered orally or parenterally. Specifically, it can be administered parenterally, and more specifically, it can be applied in a manner applied to the skin (ie, transdermal administration).

Specifically, the skin regeneration or wound healing method of the present invention may include administering the pharmaceutical composition to a subject in a pharmaceutically effective amount.

As used herein, the term "pharmaceutically effective amount" means an amount that is sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level is dependent on the patient's gender, Factors including age, weight, health condition, type and severity of disease, activity of drug, sensitivity to drug, method of administration, time of administration, route of administration, and excretion rate, duration of treatment, combinations or drugs used concurrently, and other medical It can be readily determined by a person skilled in the art according to factors well known in the art.

The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, or may be administered sequentially or simultaneously with conventional therapeutic agents. In addition, single or multiple administrations may be possible. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without causing side effects, which can be easily determined by those skilled in the art.

In addition, the pharmaceutical composition of the present invention may be provided as an external skin preparation.

The term "external skin preparation" of the present invention is a concept encompassing all materials generally used for external application to the skin, and non-limiting examples of external preparations for skin include plasters, lotions, and liniments. (liniment), liquid and solution, aerosol, extracts, ointment, fluid extracts, emulsion, suspensions, capsules ), creams, soft or hard gelatin capsules, patches, or sustained-release preparations.

The external skin preparation according to the present invention may be a parenteral preparation formulated in a solid, semi-solid or liquid form by adding a commercially available inorganic or organic carrier, excipient, and diluent. The preparation for parenteral administration may be a transdermal dosage form selected from the group consisting of drops, ointments, lotions, gels, creams, patches, sprays, suspensions and emulsions, but is not limited thereto.

In the composition for external application for skin of each dosage form, a person skilled in the art can select and blend ingredients other than the composition of the present invention described above without difficulty according to the formulation or purpose of use of other external preparations for skin, in which case they are applied simultaneously with other ingredients. In doing so, a synergistic effect can occur.

In another aspect, the present invention provides a cosmetic composition for skin regeneration or wound improvement, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

[Formula 1]

Description of the cyclic pentadepsipeptide of Formula 1 is as described above.

The 'acceptable salt' of the present invention includes an acid addition salt formed by a cosmetically acceptable free acid or a metal salt formed by a base. As the free acid, inorganic acids and organic acids may be used. Examples of the inorganic acid may include hydrochloric acid, sulfuric acid, hydrobromic acid, sulfurous acid or phosphoric acid. Examples of the organic acid may include citric acid, acetic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, and the like. The metal salt includes an alkali metal salt or an alkaline earth metal salt, and a sodium, potassium or calcium salt may be usefully used.

The cosmetic composition according to the present invention is a solution, external ointment, cream, foam, nutrient lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath additive, sunscreen-cream, sun oil, suspension , Emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, may be prepared in a formulation selected from the group consisting of patches and sprays, but is limited thereto It doesn't work.

In addition, the cosmetic composition of the present invention may further include one or more cosmetically acceptable carriers formulated in general skin cosmetics, and as typical ingredients, for example, oil, water, surfactants, moisturizers, lower alcohols, A thickener, a chelating agent, a colorant, a preservative, a flavoring agent, and the like may be suitably blended, but are not limited thereto.

Cosmetically acceptable carriers included in the cosmetic composition of the present invention vary depending on the formulation.

When the dosage form of the present invention is an ointment, paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or Mixtures of these may be used.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder or a mixture thereof may be used as a carrier component, and in particular, in the case of a spray, chloro propellants such as fluorohydrocarbons, propane/butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, fatty acid esters of glycerol, polyethylene glycol or sorbitan may be used. there is.

In the case where the formulation of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol, ethoxylated isostearyl alcohols, suspending agents such as polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, Crystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.

When the formulation of the present invention is a soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolyzates, isethionates, lanolin derivatives, aliphatic alcohols, vegetable oils, glycerol, sugars, etc. may be used as carrier components. can

When the formulation of the present invention is a pack (peel-off pack, wash off pack, or mask sheet pack), polyvinyl alcohol, kaolin, talc, zinc oxide, or titanium dioxide may be used as a carrier component. .

In another aspect, the present invention provides a quasi-drug composition for skin regeneration or wound healing, comprising the cyclic pentadepsipeptide of Formula 1 below or an acceptable salt thereof as an active ingredient.

[Formula 1]

Descriptions of the cyclic pentadepsipeptide of Formula 1 and acceptable salts thereof are as described above.

In the present invention, the term "quasi-drugs" refers to products that are less active than pharmaceuticals among products used for the purpose of diagnosing, treating, improving, mitigating, treating, or preventing human or animal diseases. For example, quasi-drugs under the Pharmaceutical Affairs Act exclude items used for pharmaceutical purposes, and include products used for the treatment or prevention of human/animal diseases, products with minor or no direct action on the human body, and the like.

When acremonitamide or an acceptable salt thereof, a novel cyclic pentadepsipeptide compound of Formula 1 isolated from marine sediment-derived actinomycete strains according to the present invention, is used as a quasi-drug additive, the composition is added as it is or other quasi-drugs or It can be used together with quasi-drug ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).

The quasi-drug composition is not particularly limited thereto, but may be specifically prepared and used in the form of an ointment, lotion, spray, patch, cream, powder, suspension, gel or gel.

As another aspect, the present invention provides a health functional food composition for skin regeneration or wound improvement, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.

[Formula 1]

Descriptions of the cyclic pentadepsipeptide of Formula 1 and acceptable salts thereof are as described above.

In the present invention, the term "functional food" is the same term as food for special health use (FoSHU), and is processed to efficiently display bioregulatory functions in addition to nutrient supply, medical and medical effects. Means high food. In the present invention, the health functional food is mixed with health food or health supplement food.

Since the health functional food composition of the present invention can be consumed on a daily basis, high skin regeneration or wound healing effects can be expected, and it can be used very usefully for health promotion purposes.

The health functional food may be prepared as a formulation selected from the group consisting of pills, powders, granules, infusions, tablets, capsules and beverages in order to obtain useful effects for skin regeneration or wound healing. In addition, the type of health functional food is not particularly limited, and may be, for example, various beverages, chewing gum, tea, vitamin complexes, health supplements, and the like.

Other ingredients that do not interfere with the preventive or improving effect of the health functional food may be added to the health functional food composition, and the type is not particularly limited. For example, it may contain various herbal extracts, food-acceptable food additives, or natural carbohydrates as additional ingredients, like conventional foods.

In addition, the health functional food composition may further include a food-acceptable carrier or a component that is commonly used in food compositions to improve odor, taste, and visual properties, which can be appropriately selected and used by those skilled in the art. there is.

A pharmaceutical or cosmetic composition comprising the novel cyclic pentadepsipeptide, acremonitamide of Formula 1 or an acceptable salt thereof as an active ingredient according to the present invention is administered into a wound of an individual, subcutaneously, or administered locally by application. There is an advantage in achieving purposes such as skin wound healing and skin regeneration by forming new tissue at the incision site and reducing scarring by the back.

On the other hand, acremonitamide (CNQ049.592) of the present invention is a compound isolated from a natural strain found in nature and has no cytotoxicity, so it can be safely used even when used for a long time, so it can be safely used in medicines, cosmetics, or food. .

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Production and isolation of novel cyclic pentadepsipeptide

As a result of isolating microorganisms from marine sediments collected from the southern coast of California, analyzing 18S rRNA (Table 1 and SEQ ID NO: 1), and identifying Acremonium fusidioides ( Acremonium fusidioides FMR 10444), it has 99.4% homology with Acremonium. After confirming that it was a new microorganism belonging to the genus Acremonium sp., it was named Acremonium sp. CNQ-049 (Acremonium sp . CNQ049) and deposited at the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology under the microorganism deposit number KCTC 14114BP. Acremonitamide, a novel cyclic pentadepsipeptide having wound healing properties, was isolated from the deposited Acremonium genus CNQ-049.

SEQ ID NO: 1 (18S rRNA of CNQ-049 of the genus Acremonium) AACCTGCGGAGGGATCATTATAGAGTGTAAACTCCCTAACCTTTGTGAACATACCTGTTGCTTCGGCGGTCTTCACCGGCCGCCGAAGGCCTATATTCTTGAATTTACATGAATTTCTGAGTATCAAACAAAAATAAATAAAAACTTTCAGCAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACCAGTACTCTGGTGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAGGGCCCGTTCGCGGGACCTGGTGTTGGGGATCGGCCCCACCGGCCGGCCCCGAAATACAGTGGCGGCACATCCGCGACCTCCTCTGCGTAGTAGCAATGCCTCGCAGCTGGATAGCGGTTGCGCCTCGCCGTAAAACCCCCCACTTTTCAATGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAG

Specifically, strain CNQ-049 was cultured in a 2.5 liter culture vessel (80 × 2.5 L Ultra Yield Flask) while shaking at 120 rpm and incubated for 7 days under 27 ° C temperature conditions. After 7 days, 1 liter of ethyl acetate (EtOAc) was added to the broth to separate the two layers, from which an ethyl acetate soluble layer was obtained. Then, the EtOAc-soluble layer was dried under vacuum conditions using a vacuum rotary evaporator to obtain an organic solvent-free CNQ-049 extract. Silica gel medium pressure liquid chromatography (MPLC) eluting the CNQ-049 extract with a step gradient of 0% to 100% methanol in dichloromethane (contents of 1, 2, 5, 7, 10, 20, 50, and 100% methanol) Column Biotage = SNAP Cartridge, KP-SIL) to obtain fractions. Among the fractions obtained therefrom, the 5% methanol/95% dichloromethane fraction was subjected to C-18 reverse phase column chromatography under the elution condition of 50% aqueous acetonitrile (50% acetonitrile/50% water). The following subfractions were obtained. The third sub-fraction with a retention time of 16 to 22 minutes was additionally treated with Phenomenex Luna C18 (2) 100 Å (250 nm × Acremonitamide (CNQ049.592), a novel cyclic pentadepsipeptide, was obtained with a retention time of 58 minutes by reverse phase high performance liquid chromatography (HPLC) using a 10 nm, 5 μm) column.

The chemical structure of acremonitamide, the novel cyclic pentadepsipeptide obtained above, was established using extensive MS, UV and NMR spectroscopic data analysis, and the chemical structure was shown in [Formula 1] below. Meanwhile, in the present invention, acremonitamide, a novel cyclic pentadepsipeptide represented by the following [Formula 1], was referred to as CNQ049.592.

[Formula 1]

¹ H NMR and ¹³ C NMR spectral results showed that acremonitamide, a compound represented by Formula 1, is a typical cyclic depsipeptide (Table 2).

Through 2D-NMR spectral results (COSY and HMBC), acremonitamide is composed of N -Me-Phe, N -Me-Ala, Val, Phe, and 2-hydroxyisovaleric acid. Confirmed.

In detail, the absolute configuration of the four amino acids was determined by the advanced Marfey method followed by acid hydrolysis and derivatization of 2-hydroxyisovaleric acid with O-pentafluoropropionylated(-)-methyl ester. After GC-MS analysis, the absolute configuration of 2-hydroxyisovaleric acid was deduced.

NMR spectral data for streptosanitamide (CDCl ₃ ) ^a location
(position) δ _C , type δ _H , mult ^b
( J in Hz) COZY HMBC N -Me-Ala One 169.6, qC 2 59.9, CH 3.41, q(7.0) 3 C-1, 3, 4, 28 3 13.5 CH ₃ 1.40, d (7.0) 2 C-1, 2 Phe 4 172.2, qC 5 50.0, CH 5.14 m 6 C-4, 6, 7, 11 6 40.3 CH ₂ 3.05, dd(13.5, 6.5)
2.96, dd(13.5, 9.0) 5 C-4, 5, 7, 8 7 135.7, qC 8, 8' 129.6, CH ^7.24c C-6 9, 9' 128.5, CH ^7.24c 10 127.2, CH ^7.24c 5-NH 8.59, d (9.0) 5 C-11 N -Me-Phe 11 170.5, qC 12 73.7, CH 3.69 m 13 C-11, 13, 18, 29 13 36.1 CH ₂ 3.94, dd(13.5, 11.0)
3.22, dd(13.5, 6.0) 12 C-11, 12, 14, 15 14 137.5, qC 15, 15' 128.7, CH ^7.19c C-13 16, 16' 128.6, CH ^7.19c 17 126.7, CH ^7.19c Val 18 173.5, qC 19 56.4, CH 4.35, t(10.0) 20 C-18, 20, 21, 22, 23 20 29.8, CH 2.26 m 21 18.3 CH ₃ 0.89, d (7.0) 20 C-19, 20, 22 22 19.5 CH ₃ 0.84, d (6.5) 20 C-19, 20, 21 19-NH 6.95, d (9.5) 19 C-23 R -Hiv 23 168.6, qC 24 77.9, CH 5.28, d (3.0) 25 C-1, 23, 25, 26, 27 25 29.2, CH 2.49 m 26 16.1, CH ₃ 0.70, d (6.5) 25 C-24, 25, 27 27 19.1, CH ₃ 0.82, d (7.0) 25 C-24, 25, 26 28 37.3 CH ₃ 2.74, s C-2, 4 29 40.0 CH ₃ 2.74, s C-12, 18

500 MHz for ^a1 H NMR and 75 MHz for ¹³ C NMR. ^b Number of attached protons determined by analysis of 2D spectra. ^c Overlapping signals.

Acremonitamide [(3R,6R,9R,12R)-6,9-dibenzyl-3,15-diisopropyl-10,12,13-trimethyl-1-oxa-4,7,10,13-tetraazacyclopentadecane-2 ,5,8,11,14-pentaone] was isolated as a white amorphous solid, which has molecular formula C ₃₃ based on interpretation of the quasi-molecular ion peak at m/z 593.3346 [M+H] ⁺ and ¹³ C NMR data in HRFABMS. H ₄₄ N ₄ O ₆ (molecular weight; 592). ¹³ C NMR and HSQC spectroscopic data showed 2 quaternary sp ² carbons, 17 methines, 5 carbonyls including 2 methylene and 7 methyl carbons, 12 aromatic carbons. The ¹ H and COZY NMR spectra of acremonitamide showed typical characteristics of a peptide with two amide proton signals (δ _H 8.59, 6.95) and four α-amino protons (δ _H 5.14, 4.35, 3.69, 3.41). . The ¹ H NMR spectrum also showed five methyl doublets (δ _H 1.40, 0.89, 0.84, 0.82, 0.70), one oxygenated mesaine proton (δ _H 5.28) and two N -methyl groups [δ _H 2.74 (6H)].

Analysis of 2D NMR spectroscopic data revealed that N -methyl-alanine ( N -Me-Ala), phenylalanine (Phe), N -methyl-phenylalanine ( N -Me-Phe), valine (Val), and 2-hydroxyiso Five distinct fragments were confirmed to assemble, including valeric acid (Hiv).

Example 2: Evaluation of cytotoxicity of novel cyclic pentadepsipeptides

In order to evaluate the degree of cytotoxicity of acremonitamide, a novel cyclic pentadepsipeptide of [Formula 1] isolated from strain CNQ-049 in Example 1, CNQ049.592 of [Formula 1] was tested on a 96-well plate. Colon cancer cell lines, Caco-2 cells (1×10 ³ cells/well) and HCT116 cells (1×10 ⁴ cells/well) were treated for 48 hours. Thereafter, an MTT assay was performed to measure the degree of cytotoxicity, and an IC ₅₀ (50% cell growth inhibition concentration) value was derived.

As a result, as shown in Table 3 below, the IC ₅₀ values of acremonitamide for Caco-2 and HCT116 were 151 μg/ml and 268 μg/ml, respectively, and the concentration at which 50% cell growth was inhibited was low , that is, it was found that acremonitamide, a novel cyclic pentadepsipeptide, did not exhibit cytotoxicity.

Result of deriving IC ₅₀ value sample Caco-2 HCT116 Acremonitamide
(New cyclic pentadepsipeptide of Formula 1) 151 μg/mL 268 μg/mL

Example 3: Analysis of cell invasion ability of novel cyclic pentadepsipeptide

In order to analyze the cell invasion ability of acremonitamide, a novel cyclic pentadepsipeptide of [Formula 1] isolated from strain CNQ-049 in Example 1, 24-transwell was used After treating Caco-2 cells (2×10 ⁴ cells/well) with 10 μg/ml of CNQ049.592 of [Formula 1] for 24 hours, the cell invasion ability was analyzed.

As a result, as shown in FIG. 2, it was confirmed that the cell invasion ability was significantly increased when treated with CNQ049.592 compared to the control group treated only with DMSO. That is, since the cell infiltration ability by acremonitamide, a novel cyclic pentadepsipeptide, is remarkably superior, it was found that excellent effects such as skin regeneration and wound healing will be produced.

Example 4: Evaluation of wound healing activity of novel cyclic pentadepsipeptide

In order to evaluate the wound healing activity of acremonitamide, a novel cyclic pentadepsipeptide of [Formula 1] isolated from strain CNQ-049 in Example 1, a wound was formed on the mouse skin, and CNQ049.592 It was applied to the wound and the degree of wound healing was confirmed after 1 and 6 days. At this time, the ratio of the wound size was calculated by considering the wound size on the day the wound was formed as 1.

As a result of confirming the degree of wound healing, as shown in FIG. 3, it was confirmed that wound healing was significantly improved when CNQ049.592 was applied compared to the control group treated only with DMSO. That is, it was found that skin regeneration and wound healing were effectively promoted by acremonitamide, a novel cyclic pentadepsipeptide.

[Entrusted institution]

Name of depository organization: Korea Research Institute of Bioscience and Biotechnology (KCTC)

Accession number: KCTC 14114BP

Consignment date: January 23, 2020

<110> Ewha University - Industry Collaboration Foundation INDUSTRY-ACADEMIC COOPERATION FOUNDATION OF SUNCHON NATIONAL UNIVERSITY <120> New cyclic pentadepsipeptide and composition for wound healing and regeneration comprising a new cyclic pentadepsipeptide as an effective ingredient <130> PA-19-0123 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 512 <212> RNA <213> Acremonium sp. <220> <221> rRNA <222> (1)..(512) <223> 18S rRNA <400> 1 aacctgcgga gggatcatta tagagtgtaa actccctaac ctttgtgaac atacctgttg 60 cttcggcggt cttcaccggc cgccgaaggc ctatattctt gaatttacat gaatttctga 120 gtatcaaaca aaaataaata aaaactttca gcaacggatc tcttggctct ggcatcgatg 180 aagaacgcag cgaaatgcga aaagtaatgt gaattgcaga attcagtgaa tcatcgaatc 240 tttgaacgca cattgcgccc accagtactc tggtgggcat gcctgtccga gcgtcatttc 300 aaccctcagg gcccgttcgc gggacctggt gttggggatc ggcccccaccg gccggccccg 360 aaatacagtg gcggcacatc cgcgacctcc tctgcgtagt agcaatgcct cgcagctgga 420 tagcggttgc gcctcgccgt aaaacccccc acttttcaat ggttgacctc ggatcaggta 480 ggaatacccg ctgaacttaa gcatatcaat ag 512

Claims (7)

A cyclic pentadepsipeptide compound of Formula 1 below for skin regeneration or wound healing.
[Formula 1]

The compound according to claim 1, wherein the compound is derived from Acremonium sp. CNQ-049 strain deposited under the accession number KCTC 14114BP. Acremonium sp. CNQ-049 strain deposited under Accession No. KCTC 14114BP to produce a compound of Formula 1 below.
[Formula 1]

A pharmaceutical composition for skin regeneration or wound healing, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.
[Formula 1]

A cosmetic composition for skin regeneration or wound improvement comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.
[Formula 1]

A quasi-drug composition for skin regeneration or wound improvement, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.
[Formula 1]

A health functional food composition for skin regeneration or wound improvement, comprising the cyclic pentadepsipeptide of Formula 1 or an acceptable salt thereof as an active ingredient.
[Formula 1]

Images