KR102466564B1 - Pharmaceutical compositions for preventing or treating bone diseases - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating bone diseases, and more particularly, by including a novel N -phenyl-methylsulfonamido-acetamide compound to inhibit osteoclast differentiation and/or generation, periodontitis, etc. It can exhibit excellent preventive or therapeutic effects for various bone diseases, including

Description

Pharmaceutical compositions for preventing or treating bone diseases {Pharmaceutical compositions for preventing or treating bone diseases}

The present invention relates to a pharmaceutical composition for preventing or treating bone disease and a health functional food.

Bone tissue is a tissue in which bone resorption by osteoclasts and bone formation by osteoblasts are continuously maintained. Osteoblast differentiation is promoted by signaling factors such as bone morphogenetic protein 2 (BMP2). The differentiation of osteoclasts is promoted by the RANKL (Receptor Activator of Nuclear factor Kappa-β Ligand) signal transmitter generated in the osteoblast differentiation stage, and when the differentiation is completed, apoptosis occurs. Therefore, it is important to harmonize the differentiation and activity of osteoblasts and osteoclasts in the normal bone regeneration process.

Periodontal inflammation is an inflammatory response by immune cells against bacterial infection at the apex, and neutrophils, mainly involved in periodontal inflammation, secrete prostaglandins, an inflammatory mediator. Cell signaling substances such as prostaglandin and RANKL activate osteoclasts that absorb bone tissue, thereby causing resorption of alveolar bone around the inflamed area. For the treatment of chronic periodontitis, it is required to develop a bone regeneration accelerator or a bone resorption inhibitor. In addition, the development of osteoclast differentiation inhibitors is required to control abnormal bone resorption and restore normal bone regeneration processes.

Korea Registered Patent No. 1992821

An object of the present invention is to provide a pharmaceutical composition for preventing or treating bone disease.

An object of the present invention is to provide a health functional food for preventing or improving bone disease.

1. A pharmaceutical composition for preventing or treating bone disease induced by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is H or C1 to C3 alkoxy;

R ₂ and R ₃ are each independently H, C1 to C3 acyl or halo;

R ₄ is phenyl, phenylthio, phenoxy or phenylamino.

2. The above 1, wherein R ₁ is H or methoxy; The R ₂ and R ₃ are each independently H, acetyl or chloro, a pharmaceutical composition for preventing or treating bone disease.

3. The method of 1 above, wherein R ₁ is C1 to C3 alkoxy, and R ₃ is halo; The R ₁ and R ₃ are H, and R ₂ is C1 to C3 acyl, a pharmaceutical composition for preventing or treating bone disease.

4. In the above 1, the compound represented by Formula 1 is 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; 2-(N-(5-chloro-2-methoxyphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; N-([1,1′-biphenyl]-2-yl)-2-(N-(3-acetylphenyl)methylsulfonamido)acetamide); 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylamino)phenyl)acetamide; and 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-phenoxyphenyl)acetamide, a pharmaceutical composition for preventing or treating bone disease.

5. The method of 1 above, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur, bone disease prevention or A therapeutic pharmaceutical composition.

6. Health functional food for preventing or improving bone disease caused by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is H or C1 to C3 alkoxy;

R ₂ and R ₃ are each independently H, C1 to C3 acyl or halo;

R ₄ is phenyl, phenylthio, phenoxy or phenylamino.

7. The above 6, wherein R ₁ is H or methoxy; The R ₂ and R ₃ are each independently H, acetyl or chloro, a health functional food for preventing or improving bone disease.

8. The above 6, wherein R ₁ is C1 to C3 alkoxy, and R ₃ is halo; wherein R ₁ and R ₃ are H, and R ₂ is C1 to C3 acyl, a health functional food for preventing or improving bone disease.

9. In the above 6, the compound represented by Formula 1 is 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; 2-(N-(5-chloro-2-methoxyphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; N-([1,1′-biphenyl]-2-yl)-2-(N-(3-acetylphenyl)methylsulfonamido)acetamide); 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylamino)phenyl)acetamide; and 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-phenoxyphenyl)acetamide, which is a health functional food for preventing or improving bone disease.

10. The method of 6 above, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur, bone disease prevention or Health functional food for improvement.

The pharmaceutical composition of the present invention may exhibit an excellent preventive or therapeutic effect against various bone diseases including periodontitis and the like by inhibiting osteoclast differentiation and/or generation.

The health functional food of the present invention can exhibit an excellent preventive or ameliorating effect on various bone diseases including periodontitis and the like by inhibiting osteoclast differentiation and/or generation.

1 shows the results of confirming osteoclasts by TRAP staining by fixing the cells on the 3rd day of differentiation from mononuclear cells (M-CSF) to giant multinuclear cells by RANKL treatment (Scale bar = 1 mm).
Figure 2 shows the result of confirming the osteoclast differentiated through TRAP staining (* p <0.05, ** p <0.01).
Figure 3 is the result of checking the osteoclast differentiation inhibitory ability by calculating the area of the differentiated osteoclasts (* p <0.05, ** p <0.01).
Figure 4 shows the result of confirming the bone resorption ability, Figure 4A shows the result of confirming the calcium phosphate decomposed by the formation of osteoclasts. 4B shows the results of analyzing the degree of bone resorption capacity using fluorescence absorbance.
5 shows the results of confirming the expression of NFATc1 and NF-kB in each organelle by western blotting by separating osteoclasts on the third day of differentiation into nuclear and cytoplasmic proteins.
6 shows the results of confirming the expression of osteoclast-specific genes in osteoclasts on the third day of differentiation through RT-PCR (** P <0.01).
7 shows the results of confirming the osteoblast differentiation ability by the PMSA compound through ALP staining.
8 shows the results of verifying the in vivo effects of PMSA compounds in OVX mice.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating bone disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is selected from the group consisting of H or C1 to C3 alkoxy;

R ₂ and R ₃ are each independently H, a C1 to C3 acyl group or halo;

R ₄ may be phenyl, phenylthio, phenoxy or phenylamino.

The term “alkoxy” refers to a functional group formed when a hydroxyl group of an alcohol loses one hydrogen atom, and may be represented by C _n H _2n+1 O ⁻ (n is an integer greater than or equal to 1). Alkoxy may be straight chain or branched chain alkoxy, C1 to C3 alkoxy means straight chain or branched chain alkoxy containing 1 to 3 carbon atoms. Representative examples of the alkoxy group may include a methoxy group, an ethoxy group, a propoxy group, and an isopropoxy group. The term "hydroxyl group" means a functional group represented by -OH.

The term “acyl” refers to an alkylcarbonyl group containing an “alkyl” group bonded to a carbonyl group, a cycloalkylcarbonyl group containing a “cycloalkyl” group bonded to a carbonyl group, an arylcarbonyl group containing an “aryl” group bonded to a carbonyl group. means a nyl group, for example, acetyl, n-propanoyl, i-propanoyl, n-butyloyl, t-butyloyl, cyclopropanoyl, cyclobutanoyl, cyclopentanoyl, cyclohexanoyl, benzoyl, α-naphthoyl and β-naphthoyl groups C1 to C3 acyl group means an acyl group containing 1 to 3 carbon atoms.

The term “halogen” or “halo” refers to a monovalent functional group of elements belonging to group 17 in the periodic table, and may be, for example, a fluoro group, a chloro group, a bromo group and an iodo group.

In Formula 1, R ₁ may be selected from the group consisting of H and C1 to C3 alkoxy.

In Formula 1, R ₁ may be H or methoxy.

In Formula 1, R ₂ and R ₃ may be each independently selected from the group consisting of H, C1 to C3 acyl and halo.

In Formula 1, R ₂ and R ₃ may be each independently selected from the group consisting of H, acetyl, and chloro.

In Formula 1, R ₄ may be selected from the group consisting of phenyl, phenylthio, phenoxy and phenylamino.

In Formula 1, R ₁ is C1 to C3 alkoxy, R ₂ and R ₃ are each H or halo, and R ₄ may be selected from the group consisting of phenyl, phenylthio, phenoxy and phenylamino.

According to one embodiment, in Formula 1, R ₁ may be methoxy, R _2-- may be H, R ₃ may be chloro, and R ₄ may be phenylthio.

In Formula 1, R ₁ and R ₃ may each be H or halo, R ₂ may be C1 to C3 acyl, and R ₄ may be selected from the group consisting of phenyl, phenylthio, phenoxy and phenylamino.

According to one embodiment, in Formula 1, R ₁ is H, R _2-- is acetyl, R ₃ is H, and R ₄ may be selected from the group consisting of phenyl, phenylthio, phenoxy and phenylamino. have.

The compound represented by Formula 1 may include 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; 2-(N-(5-chloro-2-methoxyphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; N-([1,1′-biphenyl]-2-yl)-2-(N-(3-acetylphenyl)methylsulfonamido)acetamide; 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylamino)phenyl)acetamide; and 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenoxyphenyl)acetamide.

The compound represented by Formula 1 may be selected from the group consisting of compounds represented by Formulas 2 to 6 below.

[Formula 2]

[Formula 3]

[Formula 4]

[Formula 5]

[Formula 6]

According to one embodiment, it is possible to provide a pharmaceutical composition for preventing or treating bone disease, comprising a compound represented by Formulas 2 to 6 or a pharmaceutically acceptable salt thereof.

The term “pharmaceutically acceptable” means exhibiting properties that do not cause serious irritation to the subject, cell, tissue, etc. to which the compound or composition is administered and do not impair the biological activity and physical properties of the compound.

The pharmaceutically acceptable salt may be, for example, an acid addition salt, a base addition salt or a metal salt.

Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It can be formed from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids. These pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, ioda. Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propylate, oxalate, malonate, succinate, suberate, Sebacate, fumarate, maleate, butyne-1,4-dioate, nucleic acid-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxy Benzoate, phthalate, terephthalate, benzenesulfonate, etuenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenyl acetate, phenylpropionate, phenylbutyrate, citrate, lactate, β_hydroxybutyrate, glycol late, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate or mandelate. For example, an acid addition salt of a compound represented by the formula (1) can be obtained by dissolving the compound in an excess aqueous acid solution, and precipitating the salt using a hydrating organic solvent such as methanol, ethanol, acetone or acetonitrile. .

The metal salt may be a sodium, potassium or calcium salt. Metal salts can be prepared using a base, for example, alkali metal or alkaline earth metal salts are prepared by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt and evaporating the filtrate and/or Or it can be obtained by drying.

The compound represented by Formula 1 and a pharmaceutically acceptable salt thereof may exhibit an osteoclast differentiation inhibitory effect.

The compounds represented by Formulas 2 to 6 and pharmaceutically acceptable salts thereof may exhibit an osteoclast differentiation inhibitory effect.

The term “prevention” refers to any action that inhibits or delays bone disease.

The term "treatment" refers to any action that improves or beneficially changes the symptoms of the suspected and onset subject of bone disease.

The compounds represented by Formulas 1 to 6 included in the composition of the present invention may be derived from nature or may be synthesized using a known chemical synthesis method.

Bone diseases that can be prevented or treated by the pharmaceutical composition of the present invention may be those caused by an imbalance in the activity of osteoblasts and osteoclasts.

Since bone is a living tissue, old bone is constantly destroyed and undergoes a remodeling process to create new bone again. Among these processes, osteoclasts destroy old and unnecessary bone tissue and release calcium into the bloodstream to help maintain body functions, and osteoblasts play a role in regenerating destroyed bones. This action continues 24 hours a day, and about 10% to 30% of an adult's bone is rebuilt in this way per year. Therefore, the balance between osteoclasts and osteoblasts is very important, and this balance is regulated by various hormones and other chemical components of the body.

Specifically, the bone disease may be due to osteoclast hyperdifferentiation or reduced osteoblast activity, and specifically, bone disease may be caused by osteoclast hyperdifferentiation.

When osteoclasts are hyperdifferentiated, osteoclasts increase abnormally, resulting in excessive bone resorption, which may decrease bone density, and various diseases such as osteoporosis, osteomalacia, osteopenia, bone atrophy, and periodontitis may appear.

Bone diseases include fractures, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis or avascular necrosis of the femur, bone defects, osteoporotic fractures in fractures, diabetic fractures, nonunion fractures, osteogenesis imperfecta, osteomalacia Sexual fracture, osteogenic disorder, degenerative bone disease, malocclusion, bone union disorder, pseudoarthrosis, osteonecrosis, osteoarthritis, bone tumor, bone cancer, etc., but is not limited thereto. Preferably, the bone disease may be a fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis or avascular necrosis of the femur, but is not limited thereto.

Periodontitis is an inflammatory reaction caused by the protective action of immune cells against bacterial infection at the apical end. Neutrophils, which are mainly involved in periodontitis, secrete prostaglandins, which are mediators of inflammation. Osteoclasts that absorb bone tissue are activated by cell signaling substances such as prostaglandins, and loss of alveolar bone around the inflamed area is observed. In addition, chronic periodontitis indicates continuous apical inflammation and alveolar bone erosion. In order to prevent this, antibiotic administration to reduce the number of cells that cause infection in the initial stage of periodontitis and osteoclast inhibitors that can overcome osteoclast activation by inflammatory mediators can be expected to alleviate and treat chronic periodontitis. The pharmaceutical composition for preventing or treating bone disease of the present invention can be used for the prevention or treatment of periodontitis through the effect of inhibiting bone resorption.

The pharmaceutical composition of the present invention may be provided by mixing with a known bone disease treatment material.

The pharmaceutical composition of the present invention may be administered in combination with known prophylactic or therapeutic substances for bone diseases.

The term "administration" means introducing a predetermined substance to a subject by an appropriate method, and the term "subject" refers to all animals, including humans, mice, mice, livestock, etc., which have or may develop bone disease. As a specific example, it may be a mammal including a human.

If necessary, the pharmaceutical composition of the present invention may additionally include a known anti-bone disease compound.

Examples of such anti-bone disease compounds include cinchonin, brown mealworm extract, aloe-imodine and omega-3 fatty acids, arteanuin B, indole-2-carboxylate derivative, euphobia factor L1, sculcapflavone derivative, fraxinelone, etc. may be mentioned, but is not limited thereto.

The pharmaceutical composition of the present invention may be in the form of a capsule, tablet, granule, injection, ointment, powder or beverage.

The pharmaceutical composition of the present invention may be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and injections.

The pharmaceutical composition of the present invention may include an active ingredient alone, or may further include one or more pharmaceutically acceptable carriers, excipients or diluents.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may be binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, flavoring agents, etc., in the case of oral administration, and in the case of injections, buffers, preservatives, analgesics, Solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.

The dosage form of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier, for example, tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., when administered orally. It may be prepared in the form of injections, and in the case of injections, it may be prepared in the form of unit dose ampoules or multiple doses. In addition, the dosage form of the pharmaceutical composition of the present invention may be prepared as a solution, suspension, tablet, capsule, sustained release formulation, and the like.

Carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, filler, anticoagulant, lubricant, wetting agent, flavoring, emulsifying agent or preservative and the like.

The route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. not limited

The pharmaceutical composition of the present invention may be administered orally or parenterally, and when administered parenterally, external or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection may be selected. have.

The dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route of administration, and the duration, but may be appropriately selected by those skilled in the art.

For example, the pharmaceutical composition of the present invention may be administered in an amount of 0.0001 mg to 1000 mg/kg or 0.001 mg to 500 mg/kg per day. Administration of the pharmaceutical composition of the present invention may be administered once a day, may be administered several times divided. The above dosage does not limit the scope of the present invention in any way.

In addition, the present invention provides a health functional food for preventing or improving bone disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is selected from the group consisting of H or C1 to C3 alkoxy;

R ₂ and R ₃ are each independently H, a C1 to C3 acyl group or halo;

R ₄ may be phenyl, phenylthio, phenoxy or phenylamino.

According to one embodiment, it is possible to provide a health functional food for preventing or improving bone disease, comprising the compound represented by Formulas 2 to 6 or a pharmaceutically acceptable salt thereof.

Since the compounds and bone diseases represented by Formulas 1 to 6 have been described above, detailed descriptions thereof will be omitted.

The health functional food of the present invention may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules and liquid formulations, further comprising one or more of carriers, diluents, excipients and additives.

The health functional food may be, for example, various foods, powders, granules, tablets, capsules, syrups, beverages, gums, tea, vitamin complexes, or health functional foods.

Additives that may be included in health functional foods include natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), lactic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, antioxidants, glycerin, alcohols, carbonating agents and pulp.

Natural carbohydrates include, for example, monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agent, natural flavoring agents (taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

Health functional foods include various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids , protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, pulp for the production of natural fruit juices and vegetable beverages, and the like.

Carriers, excipients, diluents and additives include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, fine Crystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil. It can be selected from the group consisting of.

When formulating the health functional food of the present invention, it may be prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant.

Hereinafter, in order to describe the present invention in detail, it will be described in detail with reference to Preparation Examples and Examples.

PMSA-3-Ac (#25) in the Preparation Examples and Examples below is a compound represented by Formula 2, and PMSA-2-OMe-5-Cl (#25-D12) (ChemBridge Corp. ID 7795298) is the formula 3, PMSA-Ph (#25-C) is a compound represented by Formula 4, PMSA-PhN (#25-N) is a compound represented by Formula 5, and PMSA-PhO (# 25-O) is a compound represented by Formula 6 above. In the present specification, the compounds represented by Formulas 1 to 6 are PMSA ( N -phenyl-methylsulfonamido-acetamide) It can be expressed as a compound.

production example

Preparation Example 1. Preparation of PMSA-3-Ac (#25)

PMSA-3-Ac (#25) was prepared through the steps described below.

1) Step 1: Preparation of methyl (3-acetylphenyl) glycinate (4)

[Scheme 1]

N,N-Diisopropylethylamine dissolved in 10 mL of acetonitrile in a stoppered 50 mL round bottom flask to which 1-(3-aminophenyl)ethan-1-one (1) (7.39 mmol, 1.0 equiv) was added. (3) (DIEPA) (11.08 mmol, 1.5 equiv) and methyl-2-bromoacetate (2) were slowly added. The solution was stirred with a condenser at 50° C. for 6 hours. After the reaction was completed, acetonitrile was removed by vacuum distillation at 50°C. After the acetonitrile was completely removed, EtOAc (30 mL) and water (20 mL) were charged and washed. EtoAc was collected. After repeating the above process twice, the organic layer was collected and removed by vacuum distillation at 50 °C. After the organic layer was completely removed in a vacuum, 10 mL of EtOAc: n-Hexane was added at a ratio of 50:50 and stirred for 15 minutes. The precipitate was filtered to obtain methyl (3-acetylphenyl) glycinate (4) (yield: 90%, 1.379 g), which was used in the next step without column purification.

2) Step 2: Preparation of methyl N-(3-acetylphenyl)-N-(methylsulfonyl)glycinate (7)

[Scheme 2]

In a stoppered 50 mL round-bottomed flask to which methyl(3-acetylphenyl)glycinate (4) (4.8 mmol, 1.0 equiv) was added, dichloromethane (DCM) (15 mL), triethylamine ( 6) (TEA) (5.76 mmol, 1.2 equiv) was added. After 15 minutes, methanesulfonyl chloride (5) (12 mmol, 2.5 equiv) was added slowly and stirring was continued at room temperature for 12 hours. The resulting reaction mixture was diluted with DCM (10 mL) and washed with water (10 mLX2). The organic layer was collected and evaporated at 40° C. using a rotor vacuum. The mixture was purified by silica gel column chromatography (eluent: n-hexane/EtOAc=1:1), and methyl N-(3-acetylphenyl)-N-(methylsulfonyl)glycinate (7) (yield: 65) %, 1.0725 g) was obtained.

3) Step 3: Preparation of 3 N-(3-acetylphenyl)-N-(methylsulfonyl)glycine (10)

[Scheme 3]

Potassium hydroxide (KOH) (9) (6.62 mmol, 2.0 equiv) and ethanol (10 mL) were added to a 20 mL screw cap vial and stirred at room temperature until a clear solution was obtained. Then methyl N-(3-acetylphenyl)-N-(methylsulfonyl)glycate (8) (3.1 mmol, 1 equiv) was added. The solution was heated at 35° C. and stirred for 1 hour. Water (10 mL) and Et ₂ O (10 mL) were added to the reaction mixture. The organic layer was collected and evaporated using a rotor vacuum at 40 °C to give a pale orange precipitate of 3 N-(3-acetylphenyl)-N-(methylsulfonyl)glycine (10) (yield: 72%, 0.616). g).

4) Step 4: PMSA-3-Ac Preparation

[Scheme 4]

2-(phenylthio)aniline (11) (0.43 mmol, 1.2 equiv) and N,N'-dicyclohexylcarbodiimide (DCC) in CH ₂ Cl ₂ (2mL) (12) (0.54 mmol, 1.5 equiv) ) was added N- (3-acetylphenyl) -N- (methylsulfonyl) glycine (10) (0.36 mmol, 1 equiv) to a 5 mL screw cap vial, and stirred at room temperature for 2 hours. The reaction mixture was filtered. The organic solvent of the filtrate was evaporated, and the mixture was purified using silica gel column chromatography (eluent: n-haxane/EtOAc = 4/6), and 2-(N-(3-acetylphenyl)methylsulfonamido)- N-(2-(phenylthio)phenyl)acetamide (13) was obtained (yield: 40%, 0.03 g). The molecular weight of the obtained PMSA-3-Ac was 454.56 g/mol, and ¹ H NMR and ¹³ C NMR values were as follows.

¹ H NMR (500 MHz, CDCl ₃ ) δ 9.10 (s, lH), 8.44 (d, J = 8.2 Hz, lH), 8.05 (t, J = 1.8 Hz, lH), 7.86 (dt, lH), 7.58 - 7.53 (m, 2H), 7.44 - 7.41 (m, lH), 7.35 (t, J = 7.9 Hz, lH), 7.23-7.20 (m, 2H), 7.16 - 7.12 (m, 2H), 7.09-7.07 (m, 2H), 4.44 (s, 2H), 3.00 (s, 2H), 2.57 (s, 3H).

¹³ C NMR (126 MHz, CDCl ₃ ) δ 196.75 (s), 166.00 (s), 140.16 (s), 139.09 (s), 138.55 (s), 136.73 (s), 135.57 (s), 132.73 (s) , 130.91(s), 130.03(s), 129.37(s), 128.21(s), 127.46(s), 126.57(s), 126.40(s), 125.17(s), 120.83(s), 120.74(s) , 55.10 (s), 38.06 (s), 26.69 (s).

Preparation Example 2. PMSA-Ph (#25-C) Preparation

Synthesized in the same manner as in Preparation Example 1, but in step 4 of Preparation Example 1, 2-(phenylthio)aniline (11) (0.43 mmol, 1.2 equiv) instead of [1,1'-biphenyl]-2-amine ( 18) (0.43 mmol, 1.2 equiv) was used to carry out the reaction to N-([1,1'-biphenyl]-2-yl)-2-(N-(3-acetylphenyl)methyl sulfonamide)acet amide) (19) was obtained (yield: 70%, 0.064 g). The specific reaction scheme is shown in Scheme 5 below.

[Scheme 5]

The obtained PMSA-Ph (#25-C) has a molecular weight of 422.499 g/mol, and ¹ H NMR and ¹³ C NMR values are as follows.

¹ H NMR (500 MHz, CDCl ₃ ) δ 8.36 (d, J = 8.3 Hz, 2H), 8.20 (s, 2H), 7.89 - 7.80 (m, 4H), 7.57 (t, J = 7.5 Hz, 4H) , 7.49 (dd, J = 13.8, 6.6 Hz, 2H), 7.45 - 7.35 (m, 8H), 7.27 (dd, J = 7.6, 1.4 Hz, 3H), 7.20 (t, J = 7.4 Hz, 2H), 7.08 (d, J = 6.8 Hz, 2H), 4.38 (s, 4H), 2.95 (s, 6H), 2.57 (s, 6H).

¹³ C NMR (126 MHz, CDCl ₃ ) δ 196.68 (s), 165.55 (s), 140.17 (s), 138.57 (s), 137.73 (s), 133.94 (s), 132.53 (s), 132.32 (s) , 130.27(s), 130.00(s), 129.59(s), 129.28(s), 128.47(s), 128.22(d, J = 4.5 Hz), 125.98(s), 124.75(s), 120.70(s) , 54.99(s), 37.55(s), 26.71(s).

Preparation Example 3. PMSA-PhN (#25-N) Preparation

Synthesized in the same manner as in Preparation Example 1, but in step 4 of Preparation Example 1, 2- (phenylthio) aniline (11) (0.43 mmol, 1.2 equiv) instead of N'-phenylbenzene-1,2-diamine (16 ) (0.43 mmol, 1.2 equiv) to give 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylamino)phenyl)acetamide (17) (Yield: 55%, 0.051 g). The specific reaction scheme is shown in Scheme 6 below.

[Scheme 6]

The molecular weight of the obtained PMSA-PhN (#25-N) was 437.514 g/mol, and ¹ H NMR and ¹³ C NMR values were as follows.

¹ H NMR (500 MHz, CDCl ₃ ) δ 8.60 (s, 2H), 8.05 - 8.02 (m, 2H), 7.98 (dd, J = 5.9, 3.6 Hz, 2H), 7.86 (d, J =7.8 Hz, 2H), 7.53 (dd, J = 8.0, 1.3 Hz, 2H), 7.38 (t, J = 7.9 Hz, 2H), 7.30 - 7.26 (m, 3H), 7.21 (dd, J = 8.3, 7.6 Hz, 4H) ), 7.17 - 7.11 (m, 4H), 6.88 (t, J = 7.4 Hz, 2H), 6.80 (d, J = 7.7 Hz, 4H), 4.47 (s, 4H), 2.97 (s, 3H), 2.56 (s, 3H).

¹³ C NMR (126 MHz, CDCl ₃ ) δ 196.94 (s), 166.40 (s), 144.81 (s), 140.38 (s), 138.56 (s), 133.71 (s), 132.56 (s), 131.35 (s) , 130.14(s), 129.47(s), 128.24(s), 126.52(s), 125.99(s), 124.91(s), 123.91(s), 122.45(s), 120.45(s), 116.25(s) , 55.16 (s), 38.11 (s), 26.65 (s).

Preparation Example 4. PMSA-PhO (#25-O) Preparation

Synthesized in the same manner as in Preparation Example 1, but in step 4 of Preparation Example 1, 2-(phenylthio)aniline (11) (0.43 mmol, 1.2 equiv) instead of 2-phenoxyaniline (14) (0.43 mmol, 1.2 equiv) ) to perform the reaction using

2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-phenoxyphenyl)acetamide (15) was obtained (yield: 62%, 0.059 g). The specific reaction scheme is shown in Scheme 7 below.

[Scheme 7]

The molecular weight of the obtained PMSA-PhO (#25-O) was 438.498 g/mol, and ¹ H NMR and ¹³ C NMR values were as follows.

¹ H NMR (500 MHz, CDCl ₃ ) δ 8.56 (s, lH), 8.39 (dd, J = 8.1, 1.1 Hz, lH), 8.04 (t, J = 1.8 Hz, lH), 7.94 -7.78 (m, lH), 7.68 7.51 (m, lH), 7.43 7.31 (m, 3H), 7.22 7.14 (m, lH), 7.11 (td, J = 7.9, 1.3 Hz, lH), 7.08 - 7.00 (m, 3H), 6.86 (dd, J = 8.1, 1.3 Hz, lH), 4.54 (s, 2H), 3.04 (s, 3H), 2.54 (s, 3H).

¹³ C NMR (126 MHz, CDCl ₃ ) δ 196.78 (s), 165.78 (s), 156.15 (s), 145.92 (s), 140.16 (s), 140.16 (s), 138.61 (s), 132.71 (s) , 130.07 (s), 128.79 (s), 128.22 (s), 126.59 (s), 124.71 (s), 124.13 (s), 123.93 (s), 120.77 (s), 118.77 (s), 117.68 (s) , 55.14(s), 38.31(s), 26.61(s).

Confirmation of osteoclast differentiation inhibitory effect

Macrophage was isolated from the bone marrow of 8-week-old C57BL/6J mice, seeded with lx 10 ⁴ cells per well in a 96-well plate, and then treated with osteoclast differentiation factors, M-CSF and RANKL, at 30 ng/ml and 50 ng/ml, respectively. and the compound was treated at the same time, and the differentiation effect was evaluated through TRAP staining and cell counting after incubation for 3 to 4 days. Specific experimental methods and results are as follows.

1) Isolation of mouse bone marrow cells and differentiation of osteoclasts

Bone marrow of 10-week-old female mice was isolated from hip bone, femur, and tibia, and Macrophage Colony Stimulating Factor, M-CSF, PeproTech, 315 -02, 30ng/ml) in α-MEM medium (Gibco, 12561-056, 10% fetal bovine serum, 1% penicillin/streptomycin) for 3 days to separate only monocytes. The isolated mononuclear cells were treated with RANKL (Receptor Activator of Nuclear factor kappa B ligand, PeproTech, 315-11, 50 ng/ml) to induce osteoclast differentiation. After treatment with RANKL, when the fused multinucleated cell morphology starts to appear from the 3rd day, they differentiate into giant multinucleated cells for 4-6 days (see FIG. 1), and die by apoptosis after 6 days. 1 shows the results of confirming osteoclasts by TRAP staining by fixing the cells on the 3rd day of differentiation from mononuclear cells (M-CSF) to giant multinuclear cells by RANKL treatment (Scale bar = 1 mm).

During treatment with RANKL, each PMSA compound was treated together and cultured for 3 or 5 days to confirm the inhibitory effect on osteoclast differentiation.

2) Confirmation of osteoclast differentiation inhibitory ability through TRAP staining and analysis

Ix 10 ⁴ mononuclear cells isolated from mouse bone marrow were placed in a 96 well plate and treated with RANKL and PMSA to check the effect of each PMSA on osteoclast differentiation ability. Each PMSA was treated by concentration. The activity of tartrate-resistant acid phosphatase (TRAP), the expression of which increases during osteoclast differentiation, was confirmed using a TRAP activity assay kit (Cosmo Bio, PMC-AK04F-COS) (see FIG. 2). Figure 2 shows the result of confirming the osteoclast differentiated through TRAP staining (compared to 0 μM, * p <0.05, ** p <0.01).

In addition, after staining, multinuclear cells formed during osteoclast differentiation were confirmed under a microscope, and each well was photographed and the differentiation area ratio per total area was indicated using Image J software. As a result, it was confirmed that each of the PMSA compounds exhibited an effective osteoclast differentiation inhibitory ability (see FIG. 3 ). In particular, at 10 μM concentration, #25 (PMSA-3-Ac) is 30%, #25-C (PMSA-Ph) is 74%, #25-N (PMSA-PhN) is 63%, #25-PhO (PMSA) is -O) differentiated into osteoclasts in 41% and #25-D12 (PMSA-2-OMe-5-Cl) in 1%. Figure 3 is the result of checking the osteoclast differentiation inhibitory ability by calculating the area of the differentiated osteoclasts (compared to 0 μM, * p <0.05, ** p <0.01).

2) Evaluation of the ability to inhibit bone resorption

Bone resorption ability was confirmed using the bone resorption assay kit (Cosmo Bio, CSR-BRA). Mouse bone marrow cells were put into a 48-well plate coated with calcium phosphate, 2.5x10 ⁴ cells per well, and were differentiated for 6 days with PMSA treatment. After 6 days, the fluorescence absorbance was measured with the culture medium to confirm the bone resorption ability. In addition, the degree of decomposition of calcium phosphate was taken under a microscope to confirm the bone resorption ability. As a result, #25 (PMSA-3-Ac), #25-D12 (PMSA-2-OMe-5-Cl), #25-C (PMSA) compared to differentiated osteoclasts (Ctrl) not treated with PMSA compounds. It was confirmed that the bone resorption capacity decreased by 16%, 12.5%, and 13.4%, respectively, in cells treated with -Ph). It was confirmed that the bone resorption capacity also decreased somewhat in cells (see FIG. 4 ). Figure 4A shows the result of confirming the calcium phosphate decomposed by the formation of osteoclasts. 4B shows the results of analyzing the degree of bone resorption using fluorescence absorbance (compared to Ctrl, * p <0.05, ** p < 0.01). In FIG. 4, BMMs refer to mononuclear cells that are not differentiated into osteoclasts.

From the above analysis results, the following experiments were additionally performed using two types of compounds #25 (PMSA-3-Ac) and #25-D12 (PMSA-2-OMe-5-Cl), which are excellent in inhibiting osteoclast differentiation.

3) Confirmation of decreased expression of transcription factors related to osteoclast differentiation

To further confirm the osteoclast differentiation inhibitory effect of the PMSA compound, intranuclear migration of transcription factors NFATc1 and NF-kB and the expression level of osteoclast-specific genes regulated by transcription factors were confirmed.

First, in order to confirm the intranuclear movement of transcription factors, osteoclasts differentiated by RANKL for 3 days were separated into nuclear and cytoplasmic proteins using the NE-PER kit (ThermoFisher scientific 78833). Western blotting was performed in each organelle. The expression of NFATc1 and NF-kB was investigated. As a result, it was confirmed that in the group treated with #25 (PMSA-3-Ac), or #25-D12 (PMSA-2-OMe-5-Cl), NFATc1 was less expressed in the nucleus (see FIG. 5). . 5 is a result of confirming the expression of NFATc1 and NF-kB in each organelle by western blotting by separating osteoclasts on the third day of differentiation into nuclear and cytoplasmic proteins.

In addition, in order to confirm the expression level of osteoclast-specific genes, mRNA expression levels were measured by RT-PCR in cells treated with PMSA compounds. RNA was isolated from cells differentiated into osteoclasts using the RNeasy kit (Qiagen, 74106), quantified using a spectrophotometer, and cDNA was synthesized from 0.5ug of RNA using reverse transcriptase (Takara, RR037 A). qRT-PCR was performed on the synthesized cDNA using Power SYBR Green PCR Master mix (Applied Biosystems) with QuantStudio 3 real-time PCR system (Applied Biosystems).

The primers used for qRT-PCR are shown in Table 1:

Primer name order SEQ ID NO: NFATc1 Forward primer CCCGTCACATTCTGGTCCAT SEQ ID NO: 1 NFATc1 Reverse primer CAAGTAACCGTGTAGCTCCACAA SEQ ID NO: 2 CatK Forward primer GGACGCAGCGATGCTAACTAA SEQ ID NO: 3 CatK Reverse primer CAGAGAGAAGGGAAGTAGAGTTGTCACT SEQ ID NO: 4 c-Fos Forward primer CGAAGGGAACGGAATAAGATG SEQ ID NO: 5 c-Fos Reverse primer GCTGCCAAAATAAACTCCAG SEQ ID NO: 6 DC-STAMP Forward primer GGGAGTCCTGCACCATATGG SEQ ID NO: 7 DC-STAMP Reverse primer AGGCCAGTGCTGACTAGGATGA SEQ ID NO: 8 OC-STAMP Forward primer CAGAGTGACCACCTGAACAAACA SEQ ID NO: 9 OC-STAMP Reverse primer TGCCTGAGGTCCCTGTGACT SEQ ID NO: 10 TRAF6 Forward primer AAAGCGAGAGATTCTTTCCCTG SEQ ID NO: 11 TRAF6 reverse primer ACTGGGGACAATTCACTAGAGC SEQ ID NO: 12

All qPCR experiments were performed in duplicate, and 18S was used as a control. The ddCT method was used for data analysis.

As a result of RT-PCR, osteoclast specificity in the group treated with #25 (PMSA-3-Ac) or #25-D12 (PMSA-2-OMe-5-Cl) compared to the control group (Ctrl) not treated with PMSA The mRNA expression of the genes cathepsin K (CtsK), osteoclast stimulatory transmembrane protein (OC-STAMP), and dendritic cell-specific transmembrane protein (DC-STAMP) was decreased (see FIG. 6 ). 6 shows the results of confirming the expression of osteoclast-specific genes in osteoclasts on the 3rd day of differentiation through RT-PCR (compared to the Ctrl control ** P <0.01).

Through the experimental results, #25(PMSA-3-Ac), or #25-D12(PMSA-2-OMe-5-Cl) is an essential regulator of osteoclast differentiation, intranuclear migration of NFATc1 and normal osteoclast differentiation. By suppressing the regulatory mechanism, it was confirmed that the expression of osteoclast-specific genes was suppressed, and consequently the differentiation of osteoclasts was inhibited.

Check the effect of osteoblast differentiation

It was collected from 3-day-old C57BL/6J mouse calvaria and seeded with 4x10 ³ cells per well in a 96 well plate, treated with 100ng/ml of hBMP2, a differentiation inducer, and treated with the compound at the same time and cultured for 7 days, followed by ALP staining. The differentiation effect was evaluated. Specific experimental methods and results are as follows.

1) Isolation of mouse cranial cells and differentiation of osteoblasts

Differentiation into osteoblasts was induced by treating precursor cells isolated from the skull of a mouse with hBMP2 (Bone morphogenic protein 2, Sino biological, 10426-HNAE, 100ng/ml). Differentiated osteoblasts can be distinguished by staining with alkaline phosphatase (ALP), an osteoblast-specific protein. When the progenitor cells were treated with hBMP2, each of the PMSA compounds was treated together, and the medium was changed every 2-3 days and cultured for 7 days.

2) ALP (alkaine phosphatase) staining for osteoblast differentiation ability analysis

4x10 ³ osteoblast progenitor cells were placed in a 96 well plate and treated with hBMP2 to induce osteoblast differentiation. At this time, #25 (PMSA-3-Ac) and #25-D12 (PMSA-2-OMe-5-Cl) were treated and cultured for 7 days.

For the analysis of osteoblast differentiation capacity, discard the medium 7 days after differentiation induction to confirm the activity of ALP, which is increased in expression at the initial stage of differentiation of osteoblasts, wash once with HBSS (Hanks' Balanced Salt Solution, welgene), and then cool 70 % ethanol was added and the cells were fixed for 1 hour. After discarding the ethanol and washing with HBSS, 100ul of NBT solution (Sigma, B1911) was added per well and stained for 15 minutes. The remaining dye was removed by washing twice with water. After ALP staining, the degree of color development was measured using Image J software and compared by graphing. As a result, it was confirmed that #25 (PMSA-3-Ac) and #25-D12 (PMSA-2-OMe-5-Cl) did not inhibit or activate osteoblast differentiation (see FIG. 7). That is, it can be confirmed that the differentiation of osteoblasts is not affected by the PMSA compound treatment.

Figure 7 shows the result of confirming the osteoblast differentiation ability by the PMSA compound through ALP staining, Figure 7A is the result of confirming the differentiated osteoblasts through ALP staining (Scale bar = 100um), Figure 7B is the area of the stained osteoblasts is calculated to show the result of confirming the differentiation ability.

Confirmation of In Vivo Effects of PSMA Compounds

In order to confirm the in vivo efficacy of the PMSA compound, an ovariectomized animal model (OVX, ovariectomized mouse) due to estrogen deficiency was produced by performing oophorectomy in 8-week-old female mice. #25 (PMSA-3-Ac, 25 mg/kg) or #25-D12 (PMSA-2-OMe-5-Cl, 20 mg/kg) was intraperitoneally injected into the osteoporosis mouse model once every 2 days. After 4 weeks, the tibia of mice was analyzed for bone density by microcomputer tomography.

As a result, higher bone density and bone volume were observed in the OVX model injected with #25-D12 (PMSA-2-OMe-5-Cl) than in the control group (OVX). Specifically, the #25-D12 (PMSA-OMe-5-Cl) treatment group had 5.4% TV (total bone volume), 6.9% for BV (bone volume), and 2.7 times for Th.V (trabecular volume) than the control group. , Ct.V (cortical volume) increased by 5.4%, and Th BMD (trabecular bone mineral density) was increased by 42.3% (see FIG. 8). In particular, it was confirmed that #25-D12 treatment was effective in preventing bone loss in the trabecular bone part.

8 is a result of verifying the in vivo effect of the PMSA compound in OVX mice. Figure 8A shows the results of microcomputer tomography of the shinbone of the mouse model (Sham: a control group in which the ovaries are not removed), and Figure 8B shows a graph analyzing the results of microcomputer tomography (TV: total bone volume, BV) : bone volume, Th.V: trabecular volume, Th.BMD: trabecular bone mineral density, Ct.V: cortical volume, Ct.BMD: cortical bone mineral density).

ADME (Absorption, Distribution, Metabolism and Excretion) testing of PSMA compounds

In order to analyze the drug metabolism of PMSA compounds, the Daegu Gyeongbuk Advanced Medical Industry Promotion Foundation (DGMIF) was requested to evaluate ADME. Metabolic stability of drugs using liver microsomes, drug metabolism inhibition by 5 CYP450 enzymes, plasma stability, plasma protein binding, intestinal permeability of drugs (PAMPA, parallel artificial membrane permeability assay) was analyzed. As a result, the PMSA compounds of the present invention (#25, #25-12, #25-C, #25-N, #25-O) have low toxicity and good binding to plasma proteins, so they are easily moved in the blood, and It was confirmed that the permeability resistance was also excellent (see Table 2). Meanwhile, the intestinal permeability (PAMPA) of 2-(N-(3,5-dimethylphenyl)methylsulfinamido)-N-(2-(phenylthio)phenyl)propanamide (#25-D5), one of the PMSA derivatives, was measured. It was confirmed that the utilization as a drug was not high compared to other derivatives, such as affecting the activity of CYP3A4 (see Table 2 below).

From the above experimental results, it was confirmed that the PMSA compound exhibited an excellent inhibitory effect on osteoclast differentiation when treated with 10 uM, and did not affect osteoblast differentiation. In addition, through molecular biological experiments, it was confirmed that the PMSA compound inhibited the expression of osteoclast-related genes by blocking the movement of NFATc1 into the nucleus. also effectively reduced in vivo bone loss. In addition, by analyzing drug metabolism, it was confirmed that PMSA compounds can be developed as drugs due to their low toxicity. Therefore, it is considered that the compounds of the present invention can function as effective inhibitors of bone metabolism.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Pharmaceutical compositions for preventing or treating bone diseases <130> 20P05030 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 Forward primer <400> 1 cccgtcacat tctggtccat 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 Reverse primer <400> 2 caagtaaccg tgtagctcca caa 23 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CatK Forward primer <400> 3 ggacgcagcg atgctaacta a 21 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CatK Reverse primer <400> 4 cagagagaag ggaagtagag ttgtcact 28 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> c-Fos Forward primer <400> 5 cgaagggaac ggaataagat g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> c-Fos Reverse primer <400> 6 gctgccaaaa taaactccag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP Forward primer <400> 7 gggagtcctg caccatatgg 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP Reverse primer <400> 8 aggccagtgc tgactaggat ga 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OC-STAMP Forward primer <400> 9 cagagtgacc acctgaacaa aca 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OC-STAMP Reverse primer <400> 10 tgcctgaggt ccctgtgact 20 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRAF6 Forward primer <400> 11 aaagcgagag attctttccc tg 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRAF6 Reverse primer <400> 12 actggggaca attcactaga gc 22

Claims (10)

A pharmaceutical composition for preventing or treating bone disease induced by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
[Formula 1]

In Formula 1,
R ₁ is H or C1 to C3 alkoxy;
R ₂ is H or C1-C3 acyl;
R ₃ is H or halo;
R ₄ is phenyl, phenylthio, phenoxy or phenylamino.
The method according to claim 1, wherein R ₁ is H or methoxy; wherein R ₂ is H or acetyl; R ₃ is H or chloroin, a pharmaceutical composition for preventing or treating bone disease.
The method according to claim 1, wherein R ₁ is C1 to C3 alkoxy, wherein R ₃ is halo; The R ₁ and R ₃ are H, and R ₂ is C1 to C3 acyl, a pharmaceutical composition for preventing or treating bone disease.
The method according to claim 1, wherein the compound represented by Formula 1 is 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; 2-(N-(5-chloro-2-methoxyphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; N-([1,1′-biphenyl]-2-yl)-2-(N-(3-acetylphenyl)methylsulfonamido)acetamide); 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylamino)phenyl)acetamide; and 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-phenoxyphenyl)acetamide, a pharmaceutical composition for preventing or treating bone disease.
The method according to claim 1, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis and avascular necrosis of the femur, for preventing or treating bone disease pharmaceutical composition.
A health functional food for preventing or improving bone disease caused by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
[Formula 1]

In Formula 1,
R ₁ is H or C1 to C3 alkoxy;
R ₂ is H or C1-C3 acyl;
R ₃ is H or halo;
R ₄ is phenyl, phenylthio, phenoxy or phenylamino.
The method according to claim 6, wherein R ₁ is H or methoxy; wherein R ₂ is H or acetyl; R ₃ is H or chloroin, a health functional food for preventing or improving bone disease.
The method according to claim 6, wherein R ₁ is C1 to C3 alkoxy, wherein R ₃ is halo; wherein R ₁ and R ₃ are H, and R ₂ is C1 to C3 acyl, a health functional food for preventing or improving bone disease.
The method according to claim 6, wherein the compound represented by Formula 1 is 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; 2-(N-(5-chloro-2-methoxyphenyl)methylsulfonamido)-N-(2-(phenylthio)phenyl)acetamide; N-([1,1′-biphenyl]-2-yl)-2-(N-(3-acetylphenyl)methylsulfonamido)acetamide); 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-(phenylamino)phenyl)acetamide; and 2-(N-(3-acetylphenyl)methylsulfonamido)-N-(2-phenoxyphenyl)acetamide, which is a health functional food for preventing or improving bone disease.
The method according to claim 6, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis and avascular necrosis of the femur, for preventing or improving bone disease health functional food.

Images