KR102466565B1 - Pharmaceutical compositions for preventing or treating bone diseases - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating bone disease, and more particularly, inhibits osteoclast differentiation and/or generation by including a compound of a specific formula, and excellent prevention or treatment for various bone diseases including periodontitis effect can be shown.

Description

Pharmaceutical compositions for preventing or treating bone diseases {Pharmaceutical compositions for preventing or treating bone diseases}

The present invention relates to a pharmaceutical composition for preventing or treating bone disease and a health functional food.

Bone tissue is a tissue in which bone resorption by osteoclasts and bone formation by osteoblasts are continuously maintained. Osteoblast differentiation is promoted by signaling factors such as bone morphogenetic protein 2 (BMP2). The differentiation of osteoclasts is promoted by the RANKL (Receptor Activator of Nuclear factor Kappa-β Ligand) signal transmitter generated in the osteoblast differentiation stage, and when the differentiation is completed, apoptosis occurs. Therefore, it is important to harmonize the differentiation and activity of osteoblasts and osteoclasts in the normal bone regeneration process.

Periodontal inflammation is an inflammatory response by immune cells against bacterial infection at the apex, and neutrophils, mainly involved in periodontal inflammation, secrete prostaglandins, an inflammatory mediator. Cell signaling substances such as prostaglandin and RANKL activate osteoclasts that absorb bone tissue, thereby causing resorption of alveolar bone around the inflamed area. For the treatment of chronic periodontitis, it is necessary to develop a bone regeneration accelerator or a bone resorption inhibitor. In addition, the development of osteoclast differentiation inhibitors is required to control abnormal bone resorption and restore normal bone regeneration processes.

Korea Registered Patent No. 1992821

An object of the present invention is to provide a pharmaceutical composition for preventing or treating bone disease.

An object of the present invention is to provide a health functional food for preventing or improving bone disease.

1. A pharmaceutical composition for preventing or treating bone disease induced by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is C2 to C3 alkyl or phenyl;

R ₂ and R ₃ are each independently H or halo.

2. The pharmaceutical composition for preventing or treating bone disease according to the above 1, wherein R ₁ is ethyl or phenyl.

3. The method of 1 above, wherein R ₁ is C2 to C3 alkyl, R ₂ is halo, and R ₃ is H; R ₁ is phenyl, R ₂ is H, and R ₃ is haloin, a pharmaceutical composition for preventing or treating bone disease.

4. In the above 1, wherein the compound represented by Formula 1 is a compound represented by Formula 2 or Formula 3, a pharmaceutical composition for preventing or treating bone disease:

[Formula 2]

[Formula 3]

.

.

5. The method of 1 above, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur, bone disease prevention or A therapeutic pharmaceutical composition.

6. Health functional food for preventing or improving bone disease caused by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is C2 to C3 alkyl or phenyl;

R ₂ and R ₃ are each independently H or halo.

7. The health functional food for preventing or improving bone disease according to the above 6, wherein R ₁ is ethyl or phenyl.

8. The above 6, wherein R ₁ is C2 to C3 alkyl, R ₂ is halo, and R ₃ is H; R ₁ is phenyl, R ₂ is H, and R ₃ is haloin, a health functional food for preventing or improving bone disease.

9. In the above 6, wherein the compound represented by Formula 1 is a compound represented by Formula 2 or Formula 3, a health functional food for preventing or improving bone disease:

[Formula 2]

[Formula 3]

.

.

10. The method of 6 above, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur, bone disease prevention or Health functional food for improvement.

The pharmaceutical composition of the present invention may exhibit an excellent preventive or therapeutic effect against various bone diseases including periodontitis and the like by inhibiting osteoclast differentiation and/or generation.

The health functional food of the present invention can exhibit an excellent preventive or ameliorating effect on various bone diseases including periodontitis and the like by inhibiting osteoclast differentiation and/or generation.

1 shows the results of confirming the effect of the compound on osteoclast differentiation ability through Tartrate-resistant acid phosphatase (TRAP) staining.
2 is a graph showing the osteoclast differentiation area ratio and the number of differentiated osteoclasts per total area confirmed after TRAP staining.
Figure 3 shows the cytotoxicity test results of the 35D35 compound through MTT analysis.
4 shows the results of confirming whether the 35D35 compound affects the osteoclast differentiation period through TRAP staining.
5 shows the results of confirming the F-actin formation inhibitory ability of the 35D35, 35D5, and 35D3 compounds.
6 shows the results of measuring the F-actin formation inhibitory ability for each treatment concentration of the 35D35 compound.
7 shows the results of measuring the bone resorption capacity of 35D35 using the bone resorption assay kit.
8 shows the results of confirming the expression level of osteoclast-specific genes through RT-PCR.
Figure 9 shows the results of comparing the expression level of CtsK in osteoclasts when treated with 35D35 compound (1 μM) and 35D3 compound (6 μM) through RT-PCR.
10 shows the results of ALP staining confirming whether the 35D35 compound affects osteoblast differentiation.
11 shows the results of confirming the effect of increasing the bone density of the compounds 35D35, 35D5 and 35D3 in OVX mice.
12 shows trabecular bone mineral density (BMD) values of OVX mice treated with 35D35, 35D5 and 35D3 compounds.
13 shows the results of confirming the effect of increasing the bone density of the compound 35D35 in OVX mice.
14 shows total bone volume (TV), bone volume (BV), Th. V (trabecular volume), Th. BMD (trabecular bone mineral density), Ct. V (cortical volume), Ct. It represents the cortical bone mineral density (BMD) value.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating bone disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is C2 to C3 alkyl or phenyl;

R ₂ and R ₃ may each independently be H or halo.

The term “alkyl” refers to a straight or branched chain saturated hydrocarbon group, such as methyl, ethyl, propyl, isopropyl, isobutyl, sec butyl, tert butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl. , tridecyl, pentadecyl and heptadecyl, and the like. C1 to C10 alkyl means an alkyl having 1 to 10 carbon atoms.

The term “aryl” refers to a substituted or unsubstituted monocyclic or polycyclic carbon ring that is wholly or partially unsaturated, eg, substituted or unsubstituted phenyl.

The term "halo" refers to a monovalent functional group of an element belonging to group 17 in the periodic table, and may be, for example, fluoro, chloro, bromo or iodo.

In Formula 1, R ₁ may be C2 to C3 alkyl or phenyl.

In Formula 1, R ₁ may be ethyl or phenyl.

In Formula 1, R ₂ and R ₃ may each independently be H or halo.

In Formula 1, R ₂ and R ₃ may each independently be H or chloro.

In Formula 1, R ₁ may be C2 to C3 alkyl, R ₂ may be halo, and R ₃ may be H.

According to one embodiment, in Formula 1, R ₁ may be ethyl, R _2-- may be chloro, and R ₃ may be H.

In Formula 1, R ₁ may be phenyl, R ₂ may be H, and R ₃ may be halo.

According to one embodiment, in Formula 1, R ₁ may be phenyl, R _2-- may be H, and R ₃ may be chloro.

The compound represented by Formula 1 may be a compound represented by Formula 2 or Formula 3 below.

[Formula 2]

[Formula 3]

According to one embodiment, it is possible to provide a pharmaceutical composition for preventing or treating bone disease, including a compound represented by Formulas 2 to 3 or a pharmaceutically acceptable salt thereof.

The term “pharmaceutically acceptable” means exhibiting properties that do not cause serious irritation to the subject, cell, tissue, etc. to which the compound or composition is administered and do not impair the biological activity and physical properties of the compound.

The pharmaceutically acceptable salt may be, for example, an acid addition salt, a base addition salt or a metal salt.

Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It can be formed from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids. These pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, ioda. Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propylate, oxalate, malonate, succinate, suberate, Sebacate, fumarate, maleate, butyne-1,4-dioate, nucleic acid-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxy Benzoate, phthalate, terephthalate, benzenesulfonate, etuenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenyl acetate, phenylpropionate, phenylbutyrate, citrate, lactate, β_hydroxybutyrate, glycol late, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate or mandelate. For example, an acid addition salt of a compound represented by the formula (1) can be obtained by dissolving the compound in an excess aqueous acid solution, and precipitating the salt using a hydrating organic solvent such as methanol, ethanol, acetone or acetonitrile. .

The metal salt may be a sodium, potassium or calcium salt. Metal salts can be prepared using a base, for example, alkali metal or alkaline earth metal salts are prepared by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt and evaporating the filtrate and/or Or it can be obtained by drying.

Formula 1 and a pharmaceutically acceptable salt thereof may exhibit an osteoclast differentiation inhibitory effect.

Formulas 2 to 3, and pharmaceutically acceptable salts thereof, may exhibit an osteoclast differentiation inhibitory effect.

The term “prevention” refers to any action that inhibits or delays bone disease.

The term "treatment" refers to any action that improves or beneficially changes the symptoms of the suspected and onset subject of bone disease.

The compounds represented by Formulas 1 to 3 included in the composition of the present invention may be derived from nature or may be synthesized using a known chemical synthesis method.

Bone diseases that can be prevented or treated by the pharmaceutical composition of the present invention may be those caused by an imbalance in the activity of osteoblasts and osteoclasts.

Since bone is a living tissue, old bone is constantly destroyed and undergoes a remodeling process to create new bone again. Among these processes, osteoclasts destroy old and unnecessary bone tissue and release calcium into the bloodstream to help maintain body functions, and osteoblasts play a role in regenerating destroyed bones. This action continues 24 hours a day, and about 10% to 30% of an adult's bone is rebuilt in this way per year. Therefore, the balance between osteoclasts and osteoblasts is very important, and this balance is regulated by various hormones and other chemical components of the body.

Specifically, the bone disease may be due to osteoclast hyperdifferentiation or reduced osteoblast activity, and specifically, bone disease may be caused by osteoclast hyperdifferentiation.

When osteoclasts are hyperdifferentiated, osteoclasts increase abnormally, resulting in excessive bone resorption, and bone density may decrease. For example, various diseases such as osteoporosis, osteomalacia, osteopenia, bone atrophy, and periodontitis may appear.

Bone diseases include fractures, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis or avascular necrosis of the femur, bone defects, osteoporotic fractures in fractures, diabetic fractures, nonunion fractures, osteogenesis imperfecta, osteomalacia Sexual fracture, osteogenic disorder, degenerative bone disease, malocclusion, bone union disorder, pseudoarthrosis, osteonecrosis, osteoarthritis, bone tumor, bone cancer, etc., but is not limited thereto. Preferably, the bone disease may be a fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis or avascular necrosis of the femur, but is not limited thereto.

Periodontitis is an inflammatory reaction caused by the protective action of immune cells against bacterial infection at the apical end. Neutrophils, which are mainly involved in periodontitis, secrete prostaglandins, which are mediators of inflammation. Osteoclasts that absorb bone tissue are activated by cell signaling substances such as prostaglandins, and loss of alveolar bone around the inflamed area is observed. In addition, chronic periodontitis indicates continuous apical inflammation and alveolar bone erosion. In order to prevent this, antibiotic administration to reduce the number of cells that cause infection in the initial stage of periodontitis and osteoclast inhibitors that can overcome osteoclast activation by inflammatory mediators can be expected to alleviate and treat chronic periodontitis. The pharmaceutical composition for preventing or treating bone disease of the present invention can be used for the prevention or treatment of periodontitis through the effect of inhibiting bone resorption.

The pharmaceutical composition of the present invention may be provided by mixing with a known bone disease treatment material.

The pharmaceutical composition of the present invention may be administered in combination with known prophylactic or therapeutic substances for bone diseases.

The term "administration" means introducing a predetermined substance to a subject by an appropriate method, and the term "subject" refers to all animals, including humans, mice, mice, livestock, etc., which have or may develop bone disease. As a specific example, it may be a mammal including a human.

If necessary, the pharmaceutical composition of the present invention may additionally include a known anti-bone disease compound.

Examples of such anti-bone disease compounds include cinchonin, brown mealworm extract, aloe-imodine and omega-3 fatty acids, arteanuin B, indole-2-carboxylate derivative, euphobia factor L1, sculcapflavone derivative, fraxinelone, etc. may be mentioned, but is not limited thereto.

The pharmaceutical composition of the present invention may be in the form of a capsule, tablet, granule, injection, ointment, powder or beverage.

The pharmaceutical composition of the present invention may be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and injections.

The pharmaceutical composition of the present invention may include an active ingredient alone, or may further include one or more pharmaceutically acceptable carriers, excipients or diluents.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may be binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, flavoring agents, etc., in the case of oral administration, and in the case of injections, buffers, preservatives, analgesics, Solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.

The dosage form of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier, for example, tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., when administered orally. It may be prepared in the form of injections, and in the case of injections, it may be prepared in the form of unit dose ampoules or multiple doses. In addition, the dosage form of the pharmaceutical composition of the present invention may be prepared as a solution, suspension, tablet, capsule, sustained release formulation, and the like.

Carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, filler, anticoagulant, lubricant, wetting agent, flavoring, emulsifying agent or preservative and the like.

The route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. not limited

The pharmaceutical composition of the present invention may be administered orally or parenterally, and when administered parenterally, external or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection injection method may be selected.

The dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route of administration, and the duration, but may be appropriately selected by those skilled in the art.

For example, the pharmaceutical composition of the present invention may be administered in an amount of 0.0001 mg to 1000 mg/kg or 0.001 mg to 500 mg/kg per day. Administration of the pharmaceutical composition of the present invention may be administered once a day, may be administered several times divided.

In addition, the present invention provides a health functional food for preventing or improving bone disease comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:

[Formula 1]

In Formula 1,

R ₁ is C2 to C3 alkyl or phenyl;

R ₂ and R ₃ may each independently be H or halo.

According to one embodiment, it is possible to provide a health functional food for preventing or improving bone disease, comprising the compound represented by Formulas 2 to 3 or a pharmaceutically acceptable salt thereof.

The compounds represented by Formulas 1 to 3 and bone diseases have been described above, and thus detailed descriptions thereof will be omitted.

The health functional food of the present invention may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules and liquid formulations, further comprising one or more of carriers, diluents, excipients and additives.

The health functional food may be, for example, various foods, powders, granules, tablets, capsules, syrups, beverages, gums, tea, vitamin complexes, or health functional foods.

Additives that may be included in health functional foods include natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), lactic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, antioxidants, glycerin, alcohols, carbonating agents and pulp.

Natural carbohydrates include, for example, monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agent, natural flavoring agents (taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

Health functional foods include various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids , protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, pulp for the production of natural fruit juices and vegetable beverages, and the like.

Carriers, excipients, diluents and additives include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, fine Crystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil. It can be selected from the group consisting of.

When formulating the health functional food of the present invention, it may be prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant.

Hereinafter, in order to describe the present invention in detail, it will be described in more detail with the following examples.

35D35 in Examples below is a compound represented by Formula 2 (2-(2-chlorophenoxy)-N-[2-(4-propionyl-1-piperazinyl)phenyl]acetamide), and 35D5 is a compound represented by Formula 3 , 35D3 is N-(2-(4-acetylpiperazin-1-yl)phenyl)-2-(2-chlorophenoxy)acetamide, 35D8 is 2-(4-chlorophenoxy)-N-(2-(4-methylpiperazin) -1-yl)phenyl)acetamide.

Confirmation of osteoclast differentiation inhibitory effect

1) Isolation of mouse bone marrow cells and differentiation of osteoclasts

Bone marrow of 10-week-old female mice was isolated from hip bone, femur, and tibia, and Macrophage Colony Stimulating Factor, M-CSF, PeproTech, 315 -02, 30ng/ml) was cultured in α-MEM medium (Gibco, 12561-056, 10% fetal bovine serum, 1% penicillin/streptomycin) for 3 days to separate only monocytes. The isolated mononuclear cells were treated with RANKL (Receptor Activator of Nuclear factor kappa B ligand, PeproTech, 315-11, 50 ng/ml) to induce osteoclast differentiation. During RANKL treatment, each compound (35D35, 35D5, 35D3, 35D8) was treated and cultured for 3 or 5 days to determine the degree of osteoclast differentiation.

2) Confirmation of osteoclast differentiation inhibitory ability through TRAP staining and analysis

lx 10 ⁴ mononuclear cells isolated from mouse bone marrow were placed in a 96-well plate and treated with RANKL and each compound (35D35, 35D5, 35D3, 35D8) to determine the effect of each compound on osteoclast differentiation ability. Using the TRAP activity assay kit (Cosmo Bio, PMC-AK04F-COS), the activity of tartrate-resistant acid phosphatase (TRAP), whose expression increases during osteoclast differentiation, was confirmed. As a result of confirming the degree of osteoclast differentiation by TRAP staining, compounds 35D35 and 35D5 showed a superior osteoclast differentiation inhibitory effect compared to other derivatives (see FIG. 1 ). After staining, multinuclear cells formed during osteoclast differentiation were confirmed under a microscope, and each well was photographed to show the differentiation area ratio per total area using Image J software. As a result, the 35D35 compound exhibited effective osteoclast differentiation inhibitory ability at a concentration of 0.5 uM (see FIG. 2 ). On the other hand, as a result of confirming cytotoxicity using the 35D35 compound, even when treated with a concentration of 10 uM, no apoptotic effect was observed (see FIG. 3 ).

In addition, the effect of the compound 35D35, which is excellent in inhibiting osteoclast formation, was confirmed for each osteoclast differentiation period. Specifically, BMM was divided into 5 groups (Ctrl, Period I to IV), and cultured for 4 days in a culture medium containing 30 ng/mL M-CSF and 50 ng/mL RANKL. BMMs from Periods I to IV groups were exposed to 1 μM 35D35 for 24 hours on different days. After 4 days, the cells of each group were fixed, and the presence of osteoclasts was confirmed after performing TRAP staining. As a result, it was confirmed that osteoclast differentiation was inhibited for the initial 24 hours in the group treated with the 35D35 compound (see FIG. 4, "M+R" means M-CSF+RANKL treatment).

From the above results, it was confirmed that the compounds 35D35 and 35D5 exhibit excellent osteoclast differentiation inhibitory effects, and particularly affect the early stage of osteoclast differentiation.

3) Evaluation of the ability to inhibit bone resorption

To confirm the activity of differentiated osteoclasts, F-actin ring formation ability (formation) was measured. Specifically, 12 mm cover glasses with or without compound (35D3: 6 μM, 35D5 and 35D35: 2 μM) were seeded with BMM and treated with M-CSF and LANKL. After osteoclasts were formed in the control group, the osteoclasts were fixed in 4.0% paraformaldehyde for 15 minutes, and then incubated in 5% FBS and blocked for about 60 minutes. After washing with PBS, rhodamine-conjugated phalloidin (1:40) was added to each well to visualize the F-actin belt. After 20 min, the DAPI (1:5000) solution was incubated with the cells for 5 min. After washing 3 times with PBS, cells were observed using a fluorescence microscope. As a result, 35D35 and 35D5 exhibited an excellent RANKL-induced F-actin belt formation inhibitory effect (see FIG. 5, scale bar=200 μm, “Con” = M-CSF+RANKL treated group).

In addition, the F-actin ring formation ability was confirmed by treating the 35D35 compound showing excellent F-actin belt formation inhibitory effect at various concentrations. As a result, it was confirmed that the F-actin ring formation ability decreased by more than 50% in cells treated with 35D35 0.5uM (See FIG. 6, scale bar = 200 μm, "Con" = M-CSF + RANKL treatment group, "M" = M-CSF treatment group). F-actin size was measured using Image J.

In addition, the bone resorption capacity of 35D35 was measured using a bone resorption assay kit (Cosmo Bio, CSR-BRA). Specifically, BMM was seeded on fluoresceinamine-labeled calcium phosphate plates and treated with 35D35 at various doses. After 6 days, fluorescence intensity was measured at absorption and emission wavelengths of 485 nm and 535 nm using a fluorescence reader. The resorption pit area was calculated using Image J. As a result, it was confirmed that the bone resorption capacity was decreased by approximately 10% in the cells treated with 35D35 0.5uM compared to the control cells (Ctrl) not treated with the compound (see FIG. 7, scale bar=200μm, “Con”=M -CSF+RANKL treated group, "M" = M-CSF treated group).

4) Confirmation of decreased expression of transcription factors related to osteoclast differentiation

To determine the expression level of osteoclast-specific genes, mRNA expression levels were measured by RT-PCR in cells treated with 35D35 (1 μM) and 35D3 (6 μM) compounds. RNA was isolated from cells differentiated into osteoclasts using an RNA extraction kit, and cDNA was synthesized using reverse transcriptase (Takara, RR037 A) from 0.5 ug of RNA quantified with a spectrophotometer. qRT-PCR was performed using cDNA synthesized with the QuantStudio 3 real-time PCR system (Applied Biosystems). After treatment with cell lysates, immunoblotting was performed with anti-Ctsk antibody. β-actin was used as a loading control.

The primers used for qRT-PCR are shown in Table 1:

Primer name order SEQ ID NO: NFATc1 Forward primer CCCGTCACATTCTGGTCCAT SEQ ID NO: 1 NFATc1 Reverse primer CAAGTAACCGTGTAGCTCCACAA SEQ ID NO: 2 CatK Forward primer GGACGCAGCGATGCTAACTAA SEQ ID NO: 3 CatK Reverse primer CAGAGAGAAGGGAAGTAGAGTTGTCACT SEQ ID NO: 4 c-Fos Forward primer CGAAGGGAACGGAATAAGATG SEQ ID NO: 5 c-Fos Reverse primer GCTGCCAAAATAAACTCCAG SEQ ID NO: 6 DC-STAMP Forward primer GGGAGTCCTGCACCATATGG SEQ ID NO: 7 DC-STAMP Reverse primer AGGCCAGTGCTGACTAGGATGA SEQ ID NO: 8 OC-STAMP Forward primer CAGAGTGACCACCTGAACAAACA SEQ ID NO: 9 OC-STAMP Reverse primer TGCCTGAGGTCCCTGTGACT SEQ ID NO: 10 TRAF6 Forward primer AAAGCGAGAGATTCTTTCCCTG SEQ ID NO: 11 TRAF6 reverse primer ACTGGGGACAATTCACTAGAGC SEQ ID NO: 12

As a result of RT-PCR, the mRNA expression levels of the osteoclast-specific genes AcP5 (TRAP), NFATc1, DC-STAMP, ATP6v0d2, MMP9 and CTSK in the 35D35-treated group were higher than in the 35D35-untreated control group (Ctrl). decreased (see FIG. 8, "M" = M-CSF treatment group). The graph of FIG. 8 is a normalization of the transcription level with the expression level of the control on Day 0. In particular, it was confirmed that the Ctsk protein expression was strongly inhibited even at a low concentration when the 35D35 compound was treated compared to the case where the 35D3 compound was treated (see FIG. 9 ). Through this, compared to the 35D3 compound, 35D35 may function as an effective inhibitor of bone metabolism by inhibiting the differentiation of osteoclasts even in a smaller amount.

Check the effect of osteoblast differentiation

Cells were collected from 3-day-old C57BL/6J mouse calvaria, seeded with 4x10 ³ cells per well in a 96-well plate, and then treated with 100ng/ml of hBMP2, a differentiation inducer. The differentiation effect was evaluated through ALP staining after treatment with the 35D35 compound and cultured for 7 days at the same time as the differentiation inducer treatment. Specific experimental methods and results are as follows.

1) Isolation of mouse cranial cells and differentiation of osteoblasts

HBMP2 (Bone morphogenic protein 2, Sino biological, 10426-HNAE, 100ng/ml) was treated to precursor cells isolated from the skull of a mouse to induce differentiation into osteoblasts. Differentiated osteoblasts can be distinguished by staining with alkaline phosphatase (ALP), an osteoblast-specific protein. When the progenitor cells were treated with hBMP2, each of the 35D35 compounds was treated together, and the medium was changed every 2-3 days and cultured for 7 days.

2) ALP (alkaine phosphatase) staining for osteoblast differentiation ability analysis

4x10 ³ osteoblast progenitor cells were placed in a 96 well plate and treated with hBMP2 to induce osteoblast differentiation. At this time, 35D35 was treated and cultured for 7 days.

For the analysis of osteoblast differentiation capacity, discard the medium 7 days after differentiation induction to confirm the activity of ALP, which is increased in expression at the initial stage of differentiation of osteoblasts, wash once with HBSS (Hanks' Balanced Salt Solution, welgene), and then cool 70 % ethanol was added and the cells were fixed for 1 hour. After discarding the ethanol and washing with HBSS, 100 μl of NBT solution (Sigma, B1911) was added per well and stained for 15 minutes. The remaining dye was removed by washing twice with water. After ALP staining, the degree of color development was measured using Image J software and compared by graphing. As a result, it was confirmed that 35D35 had no effect on osteoblasts (see FIG. 10 ). 10 shows the results of confirming the osteoblast differentiation ability by the 35D35 compound through ALP staining. Figure 10A shows the result of confirming the osteoblasts differentiated through ALP staining, Figure 10B shows the ALP intensity graph ("Con" = BMP2 alone treatment group),

Check the effect in vivo

An animal model of osteoporosis due to estrogen deficiency (OVX, ovariectomized mouse) was produced by performing ovariectomy in 8-week-old female mice. Compounds (35D35, 35D5, 35D3) were intraperitoneally injected into the osteoporosis mouse model once every 2 days. After 4 weeks, the tibia of mice was analyzed for bone density by microcomputer tomography. As a result, in the OVX model injected with the 35D3 compound, higher bone density and bone volume than the control (OVX) were not observed, whereas the OVX model injected with the 35D35 and 35D5 compounds showed higher bone density and bone volume than the control (OVX). was observed (see FIGS. 11 to 14).

11 to 14 show graphs obtained by analyzing the microcomputer tomography results of the shin bones of the mouse model (Sham: a control group in which the ovaries are not removed) and the microcomputer tomography results (* P <0.05, ** P <0.01). , and *** P < 0.001 vs. the control group, OVX. BMD: trabecular bone mineral density).

Through the above experimental results, it was confirmed that the compound of the present invention can exhibit an inhibitory effect on osteoclast differentiation even when treated at a low concentration (eg, 35D35 0.5uM), but does not affect osteoblast differentiation. In addition, it was possible to predict that the compound inhibits the expression of osteoclast-related genes by inhibiting the expression of osteoclast-related genes including NFATc1 through molecular biological experiments. In addition, when the compound was treated (35D35, 35D5) in an ovariectomized osteoporosis mouse model, excellent inhibition of bone resorption was shown. As such, the compound of the present invention may function as an effective inhibitor of bone metabolism by exhibiting an osteoclast differentiation inhibitory effect not only in vitro but also in vivo.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Pharmaceutical compositions for preventing or treating bone diseases <130> 20P06045 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 Forward primer <400> 1 cccgtcacat tctggtccat 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> NFATc1 Reverse primer <400> 2 caagtaaccg tgtagctcca caa 23 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CatK Forward primer <400> 3 ggacgcagcg atgctaacta a 21 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CatK Reverse primer <400> 4 cagagagaag ggaagtagag ttgtcact 28 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> c-Fos Forward primer <400> 5 cgaagggaac ggaataagat g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> c-Fos Reverse primer <400> 6 gctgccaaaa taaactccag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP Forward primer <400> 7 gggagtcctg caccatatgg 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> DC-STAMP Reverse primer <400> 8 aggccagtgc tgactaggat ga 22 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OC-STAMP Forward primer <400> 9 cagagtgacc acctgaacaa aca 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OC-STAMP Reverse primer <400> 10 tgcctgaggt ccctgtgact 20 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRAF6 Forward primer <400> 11 aaagcgagag attctttccc tg 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRAF6 Reverse primer <400> 12 actggggaca attcactaga gc 22

Claims (10)

A pharmaceutical composition for preventing or treating bone disease induced by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
[Formula 1]

In Formula 1,
R ₁ is C2 to C3 alkyl or phenyl;
R ₂ and R ₃ are each independently H or halo.
The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein R ₁ is ethyl or phenyl.
The method according to claim 1, wherein R ₁ is C2 to C3 alkyl, R ₂ is halo, and R ₃ is H; R ₁ is phenyl, R ₂ is H, and R ₃ is haloin, a pharmaceutical composition for preventing or treating bone disease.
The pharmaceutical composition for preventing or treating bone disease according to claim 1, wherein the compound represented by Formula 1 is a compound represented by Formula 2 or Formula 3 below:
[Formula 2]

[Formula 3]

.
The method according to claim 1, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis and avascular necrosis of the femur, for preventing or treating bone disease pharmaceutical composition.
A health functional food for preventing or improving bone disease caused by osteoclast hyperdifferentiation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
[Formula 1]

In Formula 1,
R ₁ is C2 to C3 alkyl or phenyl;
R ₂ and R ₃ are each independently H or halo.
The health functional food for preventing or improving bone disease according to claim 6, wherein R ₁ is ethyl or phenyl.
The method according to claim 6, wherein R ₁ is C2 to C3 alkyl, R ₂ is halo, and R ₃ is H; R ₁ is phenyl, R ₂ is H, and R ₃ is haloin, a health functional food for preventing or improving bone disease.
The health functional food for preventing or improving bone disease according to claim 6, wherein the compound represented by Formula 1 is a compound represented by Formula 2 or Formula 3 below:
[Formula 2]

[Formula 3]

.
The method according to claim 6, wherein the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis and avascular necrosis of the femur, for preventing or improving bone disease health functional food.

Images