KR102466562B1 - Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same - Google Patents

Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same Download PDF

Info

Publication number
KR102466562B1
KR102466562B1 KR1020217019404A KR20217019404A KR102466562B1 KR 102466562 B1 KR102466562 B1 KR 102466562B1 KR 1020217019404 A KR1020217019404 A KR 1020217019404A KR 20217019404 A KR20217019404 A KR 20217019404A KR 102466562 B1 KR102466562 B1 KR 102466562B1
Authority
KR
South Korea
Prior art keywords
seq
sexually transmitted
primer
diagnosing
herpes simplex
Prior art date
Application number
KR1020217019404A
Other languages
Korean (ko)
Other versions
KR20220088629A (en
Inventor
임남진
Original Assignee
주식회사 제이에이치바이오홀딩스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제이에이치바이오홀딩스 filed Critical 주식회사 제이에이치바이오홀딩스
Publication of KR20220088629A publication Critical patent/KR20220088629A/en
Application granted granted Critical
Publication of KR102466562B1 publication Critical patent/KR102466562B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 다중중합효소 연쇄 반응을 이용한 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법으로, 구체적으로 총 12개의 성매개 감염의 병원균을 특이적으로 증폭하는 프라이머 12쌍을 제공하고 이를 통해 성매개 감염을 통상적인 PCR을 통해서 효과적으로 신속하게 검출할 수 있다.The present invention is a primer set for diagnosing sexually transmitted infection using multiple polymerase chain reaction, a diagnostic composition, and a method for diagnosing sexually transmitted infection using the same, specifically, 12 pairs of primers that specifically amplify a total of 12 pathogens of sexually transmitted infection It provides, and through this, sexually transmitted infections can be effectively and quickly detected through conventional PCR.

Description

성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법{PRIMER SET FOR DIAGNOSING SEXUALLY TRANSMITTED INFECTION, DIAGNOSTIC COMPOSITION, AND METHOD FOR DIAGNOSING SEXUALLY TRANSMITTED INFECTION USING THE SAME}Primer set for diagnosing sexually transmitted infection, composition for diagnosis, and method for diagnosing sexually transmitted infection using the same

본 발명은 다중중합효소 연쇄 반응을 이용한 성매개 감염 진단용 프라이머 세트, 진단용 조성물, 및 이를 이용한 성매개 감염 진단 방법에 관한 것이다.The present invention relates to a primer set for diagnosing sexually transmitted infection using polypolymerase chain reaction, a diagnostic composition, and a method for diagnosing sexually transmitted infection using the same.

성매개 감염(Sexually Transmitted Infection, STI)은 성적 접촉에 의해 감염자로부터 상대방에게 전염되는 것을 의미한다. 보다 자세하게는 명백한 증후를 갖고 있는 질환을 성 매개성질환(Sexually Transmitted Disease, STD)이라 하고, 증상 및 증후가 없는 무증상 감염까지 포함하는 개념을 성매개 감염(Sexually Transmitted Infection, STI)으로 구분하였지만, 최근에는 STI로 통용되고 있다. STI는 전체 성인남녀의 약 50%가 평생에 한 번 이상 감염될 만큼 흔한 질병으로, 세계보건기구에 따르면 전세계적으로 치료 가능한 STI 환자는 매년 3억4천만 명 이상 새롭게 발생한다고 한다(J Microbiol., 45:453-459. 2007; WHO. Global Strategy for the prevention and control of sexually transmitted infections 2006-2015, 2007).Sexually Transmitted Infection (STI) means transmission from an infected person to another through sexual contact. In more detail, a disease with obvious symptoms is called a sexually transmitted disease (STD), and a concept that includes symptoms and asymptomatic infections without symptoms is classified as a sexually transmitted infection (STI). Recently, it has been commonly used as an STI. STIs are so common that about 50% of all adult men and women will be infected at least once in their lifetime, and according to the World Health Organization, more than 340 million new treatable STI patients worldwide occur each year (J Microbiol. , 45:453-459. 2007; WHO. Global Strategy for the prevention and control of sexually transmitted infections 2006-2015, 2007).

STI의 조기 진단과 치료가 이루어지지 않을 경우, 불임, 태아 사망, 자궁 외 임신, 항문생식기계통의 암, 미성숙 사망, 영유아 감염과 같은 합병증 또는 후유증을 초래할 수 있으며, 때론 치명적인 질환으로 생명에 위협을 줄 수 있다. STI는 무증상으로 잠복되어 증세가 악화되는 경우가 많고, 재감염이 용이하므로 STI의 진단 대상자인 유흥접객원 및 기타 STI 매개우려자 등에 대해 정기적인 STI 검진을 통한 감염자의 조기 발견과 치료로 STI 전파를 미연에 방지하는 것이 중요하다(Korean J UTII, 3:55-62, 2008).If STIs are not diagnosed and treated early, complications or sequelae such as infertility, fetal death, ectopic pregnancy, cancer of the anogenital tract, prematurity death, and infant infection can occur, and sometimes life-threatening diseases are fatal. can give Since STI is often asymptomatic, symptoms are often exacerbated, and re-infection is easy, STI transmission is prevented by early detection and treatment of infected people through regular STI examinations for entertainment guests and other STI mediators who are subject to STI diagnosis. (Korean J UTII, 3:55-62, 2008).

그러므로 STI 병원체를 조기에 검출하여 무증상의 감염자도 효과적으로 진단할 수 있는 방법의 개발이 중요하다. 또한, STI는 질환별 다양한 병원체에 따른 약제 및 치료 경과가 서로 다르기 때문에 병원체의 유전자 검사법을 이용한 정확한 병원체의 진단을 통해 적합한 약제처방으로 신속한 치료를 받을 수 있을 뿐만 아니라, 감염 증세 및 임상소견의 최종진단 결정에 확신성을 유도하기에 약물 오남용을 막을 수 있다.Therefore, it is important to develop a method that can detect STI pathogens early and effectively diagnose even asymptomatic infected individuals. In addition, since STI has different drugs and treatment progress according to various pathogens for each disease, accurate diagnosis of the pathogen using the pathogen genetic test method allows prompt treatment with appropriate drug prescription, as well as final diagnosis of infection symptoms and clinical findings. It can prevent drug misuse by inducing certainty in diagnostic decisions.

이러한 성병을 진단하는 이전의 방법으로는 감염부위를 채취해 도말염색하여 현미경상에서 검사하는 방법으로 임질의 경우 그람음성 쌍구균을 관찰, 칸디다 진균, 헤르페스 바이러스와 같은 경우 그람양성을 관찰하는 현미경 검사와 선택배지에 배양동정 검사하는 방법 등이 있는데 이러한 방법들은 균의 형태학적이나 생장 특성에 근거하고 있어 번거롭고 복잡하며, 장시간이 소요된다는 문제점을 갖고 있다. 최근에는 유전자를 표적으로 하는 빠르면서도 보다 간편한 방법들이 점차 많이 사용되고 개발되고 있다. 이 방법에는 특정 유전자를 대상으로 병원균의 특이적 염기서열의 종 특이적 프라이머를 제작한 후 PCR을 이용한 검사법이 개발 사용되고 있다.Previous methods for diagnosing these sexually transmitted diseases include sampling the infected area, staining a smear, and examining it under a microscope. There are methods for culturing identification in culture medium, etc., but these methods are cumbersome, complicated, and take a long time because they are based on the morphology or growth characteristics of bacteria. Recently, faster and simpler methods for targeting genes are increasingly being used and developed. In this method, a PCR test method is developed and used after preparing a species-specific primer for a specific nucleotide sequence of a pathogen targeting a specific gene.

PCR은 아주 적은 양의 DNA 만으로도 특정 부위의 DNA 서열을 기하급수적으로 증폭할 수 있는 간단하고 편리한 방법으로, 증폭하고자 하는 DNA에 특이적으로 결합하는 프라이머와, 고온에서도 안정한 Taq DNA 중합효소(polymerase)를 사용하여 변성(Denaturation step), 결합(Annealing step), 연장(Extension step)을 반복적으로 실행함으로써 소량의 DNA만으로도 신속하고 정확하게 진단해 낼 수 있는 검사법이다. 그러나 하나의 반응기 내에서 한 번의 반응으로 검사가 가능한 대상 병원체 수 및 검사 가능 샘플 수에 제한이 있으며, 각 대상 병원체에 대한 정확한 유전자형 검출이 가능한 유전자와 염기서열 부위 선택이 어렵고, 이에 대한 최적의 PCR 조건 수립에 어려움이 있다(J Microbiol., 45:453-459. 2007; Can J Infect Dis Med Microbiol., 16:73-76, 2005; J Microbiol Methods.,62:245-256, 2005). 나아가 경제적 여건이나 의료 시설 기반이 상대적으로 부족한 나라의 경우 성병 감염 문제가 많음에도 불구하고 성병을 진단하기 위한 검사 장비나 시설 등의 제한을 받게 된다.PCR is a simple and convenient method that can exponentially amplify a DNA sequence at a specific site with only a very small amount of DNA. It uses primers that specifically bind to the DNA to be amplified and Taq DNA polymerase, which is stable even at high temperatures. It is a test method that can diagnose quickly and accurately with only a small amount of DNA by repeatedly executing denaturation step, annealing step, and extension step using However, there is a limit to the number of target pathogens and samples that can be tested in one reaction in one reactor, and it is difficult to select genes and nucleotide sequences that can accurately detect genotypes for each target pathogen. There are difficulties in establishing conditions (J Microbiol., 45:453-459. 2007; Can J Infect Dis Med Microbiol., 16:73-76, 2005; J Microbiol Methods., 62:245-256, 2005). Furthermore, in the case of countries with relatively poor economic conditions or medical facility infrastructure, despite the fact that there are many sexually transmitted disease infection problems, testing equipment or facilities for diagnosing sexually transmitted diseases are limited.

따라서, 성병감염 예가 증가되고 여러 종에 의한 감염이 증가함에 따라 이러한 여러 종의 병원균에 의한 감염을 조기에 효과적으로 정확하게 발견해 치료와 예방할 수 있는 유용한 방법이 절실히 요구되고 있다.Therefore, as cases of sexually transmitted infections increase and infections by various species increase, there is an urgent need for a useful method for effectively and accurately detecting infections caused by these various species of pathogens early and for treatment and prevention.

상술한 바와 같은 문제점을 해결하기 위한 본 발명은 여러 종의 성매개 감염을 조기에 효과적으로 검출하고 진단할 수 있는 프라이머 및 이를 이용한 진단 방법을 제공하고자 한다. 또한, 본 발명은 별도의 고가의 장비 없이 통상의 PCR 수행으로 복수의 성매개 감염을 동시에 효과적으로 진단할 수 있는 프라이머 세트 및 이를 이용한 진단 방법을 제공하고자 한다.To solve the problems described above, the present invention aims to provide primers capable of effectively detecting and diagnosing sexually transmitted infections of various species at an early stage and a diagnostic method using the same. In addition, the present invention is intended to provide a primer set capable of effectively diagnosing a plurality of sexually transmitted infections simultaneously and a diagnosis method using the same by performing ordinary PCR without separate expensive equipment.

상술한 과제를 해결하기 위한 본 발명은, 1) 서열번호 1 및 서열번호 2로 이루어진 매독균(Treponema pallidum) 증폭 프라이머 쌍, 2) 서열번호 3 및 서열번호 4로 이루어진 마이코플라스마 제니탈리움(Mycoplasma genitalium) 증폭 프라이머 쌍, 3) 서열번호 5 및 서열번호 6으로 이루어진 임질구균(Neisseria gonorrhoeae) 증폭 프라이머 쌍, 4) 서열번호 7 및 서열번호 8로 이루어진 유레아플라즈마 파붐(Ureaplasma parvum) 증폭 프라이머 쌍, 5) 서열번호 9 및 서열번호 10으로 이루어진 마이코플라즈마 호미니스(Mycoplasma hominis) 증폭 프라이머 쌍, 6) 서열번호 11 및 서열번호 12로 이루어진 유레아플라즈마 유레아리티쿰(Ureaplasma urealyticum) 증폭 프라이머 쌍, 7) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍, 8) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍, 9) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍, 10) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형(Herpes simplex virus 2) 증폭 프라이머 쌍, 11) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및 12) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 증폭 프라이머 쌍으로 이루어진 군에서 선택된 어느 하나 이상의 프라이머를 제공한다.The present invention for solving the above problems, 1) a pair of Treponema pallidum amplification primers consisting of SEQ ID NO: 1 and SEQ ID NO: 2, 2) Mycoplasma genitalium consisting of SEQ ID NO: 3 and SEQ ID NO: 4 (Mycoplasma pallidum) genitalium) amplification primer pair, 3) Neisseria gonorrhoeae amplification primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, 4) Ureaplasma parvum amplification primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, 5 ) Mycoplasma hominis amplification primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, 6) Ureaplasma urealyticum amplification primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, 7) SEQ ID NO: Gardnerella vaginalis amplification primer pair consisting of SEQ ID NO: 13 and SEQ ID NO: 14, 8) Chlamydia trachomatis amplification primer pair consisting of SEQ ID NO: 15 and SEQ ID NO: 16, 9) SEQ ID NO: 17 and sequence Trichomonas vaginalis amplification primer pair consisting of No. 18, 10) Herpes simplex virus type 2 amplification primer pair consisting of SEQ ID NO. 19 and SEQ ID NO. 20, 11) SEQ ID NO. 21 and SEQ ID NO. Candida albicans amplification primer pair consisting of 22, and 12) any one or more primers selected from the group consisting of Herpes simplex virus 1 amplification primer pair consisting of SEQ ID NO: 23 and SEQ ID NO: 24 to provide.

본 발명의 또다른 구현예에 따르면, 1) 서열번호 1 및 서열번호 2로 이루어진 매독균(Treponema pallidum) 증폭 프라이머 쌍, 2) 서열번호 3 및 서열번호 4로 이루어진 마이코플라스마 제니탈리움(Mycoplasma genitalium) 증폭 프라이머 쌍, 3) 서열번호 5 및 서열번호 6으로 이루어진 임질구균(Neisseria gonorrhoeae) 증폭 프라이머 쌍, 4) 서열번호 7 및 서열번호 8로 이루어진 유레아플라즈마 파붐(Ureaplasma parvum) 증폭 프라이머 쌍, 5) 서열번호 9 및 서열번호 10으로 이루어진 마이코플라즈마 호미니스(Mycoplasma hominis) 증폭 프라이머 쌍, 및 6) 서열번호 11 및 서열번호 12로 이루어진 유레아플라즈마 유레아리티쿰(Ureaplasma urealyticum) 증폭 프라이머 쌍을 포함하는 프라이머 세트를 제공한다. According to another embodiment of the present invention, 1) Treponema pallidum amplification primer pair consisting of SEQ ID NO: 1 and SEQ ID NO: 2, 2) Mycoplasma genitalium consisting of SEQ ID NO: 3 and SEQ ID NO: 4 ) Amplification primer pair, 3) Neisseria gonorrhoeae amplification primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6, 4) Ureaplasma parvum amplification primer pair consisting of SEQ ID NO: 7 and SEQ ID NO: 8, 5) A primer set comprising a Mycoplasma hominis amplification primer pair consisting of SEQ ID NO: 9 and SEQ ID NO: 10, and 6) a Ureaplasma urealyticum amplification primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12 provides

본 발명의 또다른 구현예에 따르면, 1) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍, 2) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍, 3) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍, 4) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형(Herpes simplex virus 2) 증폭 프라이머 쌍, 5) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및 6) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 증폭 프라이머 쌍을 포함하는 프라이머 세트를 제공한다.According to another embodiment of the present invention, 1) a pair of Gardnerella vaginalis amplification primers consisting of SEQ ID NO: 13 and SEQ ID NO: 14, 2) Chlamydia trachomatis consisting of SEQ ID NO: 15 and SEQ ID NO: 16 ( Chlamydia trachomatis) amplification primer pair, 3) Trichomonas vaginalis amplification primer pair consisting of SEQ ID NO: 17 and SEQ ID NO: 18, 4) Herpes simplex virus type 2 consisting of SEQ ID NO: 19 and SEQ ID NO: 20 2) amplification primer pair, 5) Candida albicans amplification primer pair consisting of SEQ ID NO: 21 and SEQ ID NO: 22, and 6) Herpes simplex virus 1 consisting of SEQ ID NO: 23 and SEQ ID NO: 24 ) provides a primer set comprising an amplification primer pair.

본 발명의 구현예에 따르면, 상기 프라이머 세트를 포함하는 성매개 감염 진단용 조성물을 제공한다. 상기 조성물은 통상적으로 사용될 수 있는 성분, 예를 들면 완충액 등을 포함할 수 있다. 구체적으로, DNA 중합효소, dNTP 혼합물(dATP, dCTP, dGTP, dTTP), PCR 완충액, 및 DNA 중합 효소 조인자를 포함할 수 있다.According to an embodiment of the present invention, a composition for diagnosing a sexually transmitted infection comprising the primer set is provided. The composition may include commonly used components, such as a buffer solution. Specifically, it may include a DNA polymerase, a dNTP mixture (dATP, dCTP, dGTP, dTTP), a PCR buffer, and a DNA polymerase cofactor.

본 발명의 구현예에 따르면, 상기 프라이머 세트를 포함하는 성매개 감염 진단 키트를 제공한다.According to an embodiment of the present invention, a sexually transmitted infection diagnosis kit including the primer set is provided.

본 발명의 구현예에 따르면, 상기 키트는 DNA 중합효소를 더 포함하는 성매개 감염 진단 키트를 제공한다. 구체적으로 상기 DNA 중합효소는 Hot Start Taq이다.According to an embodiment of the present invention, the kit provides a sexually transmitted infection diagnosis kit further comprising a DNA polymerase. Specifically, the DNA polymerase is Hot Start Taq.

본 발명의 구현예에 따르면, 상기 프라이머 세트를 사용하여 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하여 단계를 포함하는 성매개 감염 여부 진단 방법을 제공한다.According to an embodiment of the present invention, there is provided a method for diagnosing sexually transmitted infection comprising the step of performing a polymerase chain reaction targeting DNA of a biological sample using the primer set.

본 발명의 성매개 감염 여부 진단은 본 발명의 프라이머 세트를 사용하여 생물학적 샘플로부터 각각 프라이머가 특이적으로 검출하는 병원체의 유전자를 검출하는 것이다.The diagnosis of sexually transmitted infections according to the present invention is to detect genes of pathogens specifically detected by each primer from a biological sample using the primer set of the present invention.

본 발명에서 용어 "생물학적 샘플"이란 성매개 감염의 병원체로 감염되거나, 감염을 의심받는 개체 또는 성매개 감염 백신으로 백신화된 개체의 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료 등을 포함할 수 있으나, 이에 제한되지 않으며, 바람직하게는 성매개 감염 개체의 생식기 분비물로부터 수득되는 시료이다. In the present invention, the term "biological sample" refers to tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or cerebrospinal fluid of an individual infected with a pathogen of a sexually transmitted infection, suspected of infection, or vaccinated with a sexually transmitted infection vaccine. Samples such as urine may be included, but are not limited thereto, and are preferably samples obtained from genital secretions of sexually transmitted infected individuals.

본 발명의 구현예에 따르면, 상기 성매개 감염 여부 진단 방법은 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 유레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 유레아플라즈마 유레아리티쿰 (Ureaplasma urealyticum), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 중에서 선택된 어느 하나 이상의 병원체를 검출하는 것을 특징으로 한다.According to an embodiment of the present invention, the method for diagnosing sexually transmitted infection is Treponema pallidum, Mycoplasma genitalium, Neisseria gonorrhoeae, Ureaplasma parvum, Mycoplasma Hominis, Ureaplasma urealyticum, Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus type 2 (Herpes simplex virus 2), Candida albicans, and herpes simplex virus type 1 (Herpes simplex virus 1) characterized by detecting any one or more pathogens.

본 발명의 구현예에 따르면, 상기 성매개 감염 여부 진단 방법은 서열번호 1 내지 12로 이루어진 6쌍의 프라이머 쌍을 포함하는 프라이머 세트를 이용하여, 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 유레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis) 및 유레아플라즈마 유레아리티쿰 (Ureaplasma urealyticum) 병원체 감염여부를 동시에 검출하는 것을 특징으로 한다.According to an embodiment of the present invention, the method for diagnosing sexually transmitted infections is performed by using a primer set including 6 pairs of primers composed of SEQ ID NOs: 1 to 12, including Treponema pallidum, Mycoplasma genitalium ( Mycoplasma genitalium), Neisseria gonorrhoeae, Ureaplasma parvum, Mycoplasma hominis, and Ureaplasma urealyticum.

본 발명의 구현예에 따르면, 상기 성매개 감염 여부 진단 방법은 서열번호 13 내지 24로 이루어진 6쌍의 프라이머 쌍을 포함하는 프라이머 세트를 이용하여, 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 병원체 감염여부를 동시에 검출하는 것을 특징으로 한다.According to an embodiment of the present invention, the method for diagnosing sexually transmitted infections is performed by using a primer set including 6 pairs of primers composed of SEQ ID NOs: 13 to 24, Gardnerella vaginalis, Chlamydia trachoma Infection with Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans, and Herpes simplex virus 1 It is characterized in that it detects at the same time.

상기와 같은 본 발명에 따르면, 본 발명은 12종의 성매개 감염을 효율이 높고 미량으로 존재하는 병원균도 검출할 수 있다. 또 초기에 자각 증상이 없기 때문에 초기 발견이 어려운 성병의 경우에도 쉽게 진단해 낼 수 있으므로 조기 예방하는데 아주 유용한 방법이라고 할 수 있다. 또한, 본 발명은 별도의 고가의 장비 없이 통상의 PCR 수행으로 복수의 성매개 감염을 높은 민감도와 특이도를 가지면서도 동시에 효과적으로 진단할 수 있다.According to the present invention as described above, the present invention can detect 12 types of sexually transmitted infections with high efficiency and even pathogens present in small amounts. In addition, since there are no subjective symptoms in the early stages, it can be easily diagnosed even in the case of sexually transmitted diseases that are difficult to detect in the early stages, so it can be said to be a very useful method for early prevention. In addition, the present invention can effectively diagnose multiple sexually transmitted infections with high sensitivity and specificity and at the same time by performing ordinary PCR without additional expensive equipment.

도 1은 본 발명 프라이머를 포함하는 진단 키트의 특이성 시험 결과이다. (a) 프라이머 set 1 전기영동 결과(실험예 1), (b) 프라미어 set 2 전기영동 결과(실험예 2).1 is a specificity test result of a diagnostic kit containing the primers of the present invention. (a) primer set 1 electrophoresis results (Experimental Example 1), (b) primer set 2 electrophoresis results (Experimental Example 2).

발명의 실시를 위한 최선의 형태BEST MODE FOR CARRYING OUT THE INVENTION

본 발명의 최선의 형태는, 서열번호 1 내지 서열번호 12의 프라이머, 총 6개의 프라이머쌍으로 이루어진 프라이머 세트, 서열번호 13 내지 서열번호 24의 프라이머, 총 6개의 프라이머쌍으로 이루어진 프라이머 세트이다. 이를 통해 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 유레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 유레아플라즈마 유레아리티쿰 (Ureaplasma urealyticum), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 병원체를 높은 민감도와 특이도를 갖고 동시에 효과적으로 검출할 수 있다.The best mode of the present invention is a primer set consisting of the primers of SEQ ID NO: 1 to SEQ ID NO: 12, a total of six primer pairs, and the primers of SEQ ID NO: 13 to SEQ ID NO: 24, a primer set consisting of a total of six primer pairs. Through this, Treponema pallidum, Mycoplasma genitalium, Neisseria gonorrhoeae, Ureaplasma parvum, Mycoplasma hominis, Ureaplasma urealyticum urealyticum), Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans , and herpes simplex virus type 1 pathogens can be effectively detected simultaneously with high sensitivity and specificity.

발명의 실시를 위한 형태Mode for Carrying Out the Invention

본 발명은 다중중합효소연쇄반응(Multiple Polymerase Chain Reaction; M-PCR)을 이용하여 성매개 감염의 원인이 되는 12종의 병원균을 신속 정확하게 검출해 내는 것으로 각 병원균의 특이적(species-specific) 염기서열의 프라이머를 이용하여 병원균 감염 여부를 진단해 내는 키트 및 방법을 제공한다.The present invention uses Multiple Polymerase Chain Reaction (M-PCR) to quickly and accurately detect 12 pathogens that cause sexually transmitted infections, and each pathogen's species-specific base A kit and method for diagnosing pathogen infection using sequenced primers are provided.

상기 중합효소연쇄반응(PCR)은 특정 DNA 단편을 선별적으로 증폭하는 방법으로서 이에 대한 내용은 Miller, H. I. (WO 89/06700) 및 Davey, C. et al. (EP 329,822))에 개시되어 있으며, 이 문헌은 본 명세서에 참조로써 삽입된다.The polymerase chain reaction (PCR) is a method for selectively amplifying a specific DNA fragment, and details thereof are described in Miller, H. I. (WO 89/06700) and Davey, C. et al. (EP 329,822), which is incorporated herein by reference.

본 발명의 용어 "성매개 감염"은 성적 접촉에 의해 감염자로부터 상대방에게 전염되는 것으로, 보다 자세하게는 명백한 임상적 증후를 갖고 있는 질환을 성 매개성질환은 물론 증상 및 증후가 없는 무증상 감염까지 포함한다.The term "sexually transmitted infection" of the present invention is transmitted from an infected person to the other person by sexual contact, and more specifically, includes diseases with clear clinical symptoms as well as sexually transmitted diseases as well as symptoms and asymptomatic infections without symptoms. .

본 발명의 용어 "프라이머(primer)"는 중합효소연쇄반응에서 이용되는 타깃 핵산에 인접해 있는 5'말단 서열 및 3'말단 서열에 상보적인 올리고뉴클레오타이드를 의미한다. 본 발명의 명세서에서 용어 "전방향(forward) 프라이머" 및 "역방향(reverse) 프라이머"는 중합효소연쇄반응에 의해 증폭되는 유전자의 일정 부위의 3'말단 및 5'말단에 각각 결합하는 프라이머를 의미한다.The term "primer" of the present invention refers to an oligonucleotide complementary to a 5' end sequence and a 3' end sequence adjacent to a target nucleic acid used in a polymerase chain reaction. In the specification of the present invention, the terms "forward primer" and "reverse primer" refer to primers that bind to the 3' and 5' ends of a certain region of a gene to be amplified by polymerase chain reaction, respectively. do.

특히 본 발명은 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 유레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis), 유레아플라즈마 유레아리티쿰(Ureaplasma urealyticum), 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1)를 특이적으로 검출할 수 있다.In particular, the present invention relates to Treponema pallidum, Mycoplasma genitalium, Neisseria gonorrhoeae, Ureaplasma parvum, Mycoplasma hominis, Ureaplasma urearyticum (Ureaplasma urealyticum), Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans albicans), and Herpes simplex virus 1 can be specifically detected.

일반적으로 하나의 병원균을 검출하는 PCR에는 1쌍의 프라이머가 이용되며, 따라서 12종류의 표적을 목적으로 PCR을 수행하기 위해서는 12쌍, 즉 24개의 프라이머가 필요하다. 이들을 1번에 확인할 수 있도록 공통의 PCR 반응조건을 갖는 프라이머 개발에 주력하였다. 그 결과 12쌍의 프라이머를 이용하여 이들을 PCR 반응에 적용하여 12종을 검출할 수 있게 되었다. 본 발명에 따른 PCR 프라이머를 제작할 때는 프라이머의 A, G, C, T 함량비, 프라이머의 복합체(dimmer) 형성 방지, 같은 염기서열의 3회 이상 반복 금지 등 여러 가지 제약이 따르고, 그 외에 PCR 반응조건에 있어서 주형(template) DNA 양, 프라이머 농도, dNTP의 농도, Mg2+의 농도, 반응온도, 반응시간 등의 조건이 적정해야 한다. 이에 본 발명에 의해 제공되는 12종의 성매매 감염 병원체의 검출이 적합하도록 개발된 것이다.Generally, one pair of primers is used for PCR to detect one pathogen, and therefore, 12 pairs of primers, that is, 24 primers, are required to perform PCR for 12 types of targets. We focused on developing primers with common PCR reaction conditions so that they can be identified at once. As a result, it was possible to detect 12 species by using 12 pairs of primers and applying them to the PCR reaction. When preparing the PCR primers according to the present invention, various restrictions are followed, such as the A, G, C, and T content ratio of the primers, prevention of primer complex (dimmer) formation, prohibition of repeating the same base sequence more than three times, and other PCR reactions Regarding the conditions, conditions such as the amount of template DNA, the concentration of the primer, the concentration of dNTP, the concentration of Mg2+, the reaction temperature, and the reaction time should be appropriate. Accordingly, it was developed to be suitable for detection of the 12 sex trafficking infection pathogens provided by the present invention.

특히, 본원발명은 12쌍의 프라이머 중 i) 서열번호 1 내지 12로 이루어진 6쌍의 프라이머 쌍을 세트로 포함하여 매독균(Treponema pallidum), 마이코플라스마 제니탈리움(Mycoplasma genitalium), 임질구균(Neisseria gonorrhoeae), 유레아플라즈마 파붐(Ureaplasma parvum), 마이코플라즈마 호미니스(Mycoplasma hominis) 및 유레아플라즈마 유레아리티쿰(Ureaplasma urealyticum) 병원체 감염여부를 동시에 검출할 수 있고, ii) 서열번호 13 내지 24로 이루어진 6쌍의 프라이머 쌍을 포함하는 프라이머 세트를 이용하여, 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형(Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 병원체 감염여부를 동시에 검출할 수 있는 효과를 발휘한다.In particular, the present invention includes i) 6 pairs of primers consisting of SEQ ID NOs: 1 to 12 among 12 pairs of primers as a set to treat Treponema pallidum, Mycoplasma genitalium, Neisseria gonorrhoeae), Ureaplasma parvum, Mycoplasma hominis and Ureaplasma urealyticum pathogen infection can be simultaneously detected, ii) 6 pairs consisting of SEQ ID NOs: 13 to 24 Using a primer set including a primer pair of, Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2 ), Candida albicans, and herpes simplex virus type 1 (Herpes simplex virus 1) pathogen infection can be detected at the same time.

본원발명에서 제공하는 프라이머는 각 성매개 감염을 일으키는 병원체를 간단한 PCR을 통하면서도 높은 특이도 및 민감도로 신속하게 검출할 수 있다.The primers provided in the present invention can rapidly detect pathogens causing each sexually transmitted infection with high specificity and sensitivity through simple PCR.

이하, 첨부된 도면을 참조하여 본 발명의 실시예를 상세하게 설명한다.Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

본 명세서에서 사용된 용어는 실시예들을 설명하기 위한 것이며 본 발명을 제한하고자 하는 것은 아니다. 본 명세서에서, 단수형은 문구에서 특별히 언급하지 않는 한 복수형도 포함한다. 명세서에서 사용되는 "포함한다(comprises)" 및/또는 "포함하는(comprising)"은 언급된 구성요소 외에 하나 이상의 다른 구성요소의 존재 또는 추가를 배제하지 않는다. Terminology used herein is for describing the embodiments and is not intended to limit the present invention. In this specification, singular forms also include plural forms unless specifically stated otherwise in a phrase. As used herein, "comprises" and/or "comprising" does not exclude the presence or addition of one or more other elements other than the recited elements.

다른 정의가 없다면, 본 명세서에서 사용되는 모든 용어(기술 및 과학적 용어를 포함)는 본 발명이 속하는 기술분야의 통상의 기술자에게 공통적으로 이해될 수 있는 의미로 사용될 수 있을 것이다. 또한, 일반적으로 사용되는 사전에 정의되어 있는 용어들은 명백하게 특별히 정의되어 있지 않는 한 이상적으로 또는 과도하게 해석되지 않는다.Unless otherwise defined, all terms (including technical and scientific terms) used in this specification may be used with meanings commonly understood by those skilled in the art to which the present invention belongs. In addition, terms defined in commonly used dictionaries are not interpreted ideally or excessively unless explicitly specifically defined.

[실시예1] 프라이머 제작[Example 1] Primer production

성매개 감염을 일으키는 12종의 병원체를 검출하기 위하여 다음의 프라이머를 디자인하였다. The following primers were designed to detect 12 pathogens that cause sexually transmitted infections.

병원균pathogen 구분division 서열order 서열번호sequence number mer 수number of mers 분자량Molecular Weight Target 유전자Target gene Treponema pallidum Treponema pallidum ForwardForward CTGCACGTAAGGTAAGCAGCATGGAGAGCTGCACGTAAGGTAAGCAGCATGGAGAG 1One 2828 8711.748711.74 treponemal membrane protein Btreponemal membrane protein B ReverseReverse CGCACAGAACCGAATTCCTTGAACCTAACCTCCGCACAGAACCGAATTCCTTGAACCTAACCTC 22 3232 9682.429682.42 Mycoplasma genitalium Mycoplasma genitalium ForwardForward AGGATTGGCAATTTTTATGCCTGGTTGCATCTTACTTTCAGGATTGGCAATTTTTATGCCTGGTTGCATCTTACTTTC 33 3939 11959.8811959.88 lipoproteinlipoprotein ReverseReverse ACGAGTTTGAACTTGGTAGTTCATCTCTTCTGGTTTGGACGAGTTTGAACTTGGTAGTTCATCTCTTCTGGTTTGG 44 3838 11711.7011711.70 Neisseria gonorrhea Neisseria gonorrhea ForwardForward CTTTATCGGCTTGGCAGGCGAATTCGGCTTTATCGGCTTGGCAGGCGAATTCGG 55 2727 8322.478322.47 putative MafA-like proteinputative MafA-like protein ReverseReverse CAATGGATCGGTATCACTCGCTCTGCCGCAATGGATCGGTATCACTCGCTCTGCCG 66 2828 8540.638540.63 Ureaplasma parvum Ureaplasma parvum ForwardForward GTCCATTTCAACAAGCACGCAAACTTGCAAAAGGTCCATTTCAACAAGCACGCAAACTTGCAAAAG 77 3333 10083.6910083.69 putative lipoproteinputative lipoprotein ReverseReverse TGCACCGAATCCTGGTAGTTCTTCAAAATCAGGTGCACCGAATCCTGGTAGTTTCTTCAAAATCAGG 88 3333 10112.6810112.68 Mycoplasma hominis Mycoplasma hominis ForwardForward CGCTGTAAGGCGCCACTAAAAGATGAGGCGCTGTAAGGCGCCACTAAAAGATGAGG 99 2828 8671.728671.72 glyceraldehyde 3-phosphate dehydrogenaseglyceraldehyde 3-phosphate dehydrogenase ReverseReverse GCTTTCTGACAAGGTACCGTCAGTCTGCGCTTTCTGACAAGGTACCGTCAGTCTGC 1010 2828 8555.648555.64 Ureaplasma urealyticum Ureaplasma urealyticum ForwardForward GGGGTAACTTTAGTGGGAGCAGGGGTAGTTGCTGGGGGTAACTTTAGTGGGGAGCAGGGGTAGTTGCTG 1111 3434 10689.9910689.99 multiple bandedantigen genemultiple banded antigen genes ReverseReverse CAGCTGATGTAATTGCAACATTGAATTCAGCTTCGCAGCTGATGTAATTGCAACATTGAATTCAGCTTCG 1212 3535 10745.1010745.10 Gardnerella vaginalis Gardnerella vaginalis ForwardForward GAGAACTGGATAGTGGACACGAGTAAGAATAGTGAGACGAGAACTGGATAGTGGACACGAGTAAGAATAGTGAGAC 1313 3838 11897.8411897.84 rRNA-23S ribosomal RNArRNA-23S ribosomal RNA ReverseReverse ACGGTCTGGGCAGATTCACGCGGGATTCCACGAGGACGGTCTGGGCAGATTCACGCGGGATTCCACGAGG 1414 3535 10838.1110838.11 Chlamydia trachomatis Chlamydia trachomatis ForwardForward GCGCATCTAAAGGAGCTAGCTCGCAACAATGCGCGCATCTAAAGGAGCTAGCTCGCAACAATGC 1515 3232 9827.499827.49 putative type III secretion system membraneputative type III secretion system membrane ReverseReverse TCAAGCCAAGACCGCAAGTGAATAATGCGGATACTCAAGCCAAGACCGCAAGTGAATAATGCGGATAC 1616 3434 10477.9310477.93 Trichomonas vaginalisTrichomonas vaginalis ForwardForward CGAATCCATCCTCGATGTCATCCGTAAGGAAGCCGAATCCATCCTCGATGTCATCCGTAAGGAAGC 1717 3333 10082.6610082.66 beta-tubulin (btub1) genebeta-tubulin (btub1) gene ReverseReverse CGAGCTTACGAAGGTCGGAGTTGAGCTGCGAGCTTACGAAGGTCGGAGTTGAGCTG 1818 2828 8709.728709.72 Herpes simplex virus 2 Herpes simplex virus 2 ForwardForward GTGATGTTTGCTTGGTCGTTCCTGGTCCTCAAGGTGATGTTTGCTTGGTCGTTCCTGGTCCTCAAG 1919 3333 10148.6610148.66 envelope protein UL20envelope protein UL20 ReverseReverse GCTGGCGGTGATCCAATGGAAAAGCCCGCTGGCGGTGATCCAATGGAAAAGCCC 2020 2727 8334.498334.49 Candida albicans Candida albicans ForwardForward GATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGATCCTTGGTTCTCGCATCGATGAAGAACGCAGC 2121 3535 10747.0810747.08 18S ribosomal RNA gene18S ribosomal RNA gene ReverseReverse ACCTAAGCCATTGTCAAAGCGATCCCGCCTTACACCTAAGCCATTGTCAAAGCGATCCCGCCTTAC 2222 3333 10002.6210002.62 Herpes simplex virus 1 Herpes simplex virus 1 ForwardForward GCGGCCAGCACGCTGTGGTTGCTTGGCCTGGACGGCGGCCAGCACGCTGTGGTTGCTTGGCCTGGACG 2323 3434 10507.8710507.87 capsid triplex subunit 1capsid triplex subunit 1 ReverseReverse CACGATCCGCGTTGGGTTGGCACAGATCCGTCAGCACGATCCGCGTTGGGTTGGCACAGATCCGTCAG 2424 3434 10459.8710459.87 GAPDHGAPDH ForwardForward CCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCC 2525 3636 10882.1910882.19 GAPDHGAPDH ReverseReverse GCAGAATCCAGATGCTCAAGGCCCTTCATAATATCCGCAGAATCCAGATGCTCAAGGCCCTTCATAATATCC 2626 3636 10973.2610973.26

[실시예2] 프라이머의 민감도[Example 2] Sensitivity of primers

상기에서 제조한 프라이머에 대하여 표준검체를 희석하여 95% 이상 검출되는 농도를 확인한 결과 각각 검출 한계는 다음과 같다.As a result of diluting the standard sample with respect to the primer prepared above and confirming the concentration at which 95% or more is detected, each detection limit is as follows.

NumberNumber SpecificitySpecificity LoD (단위 copies/㎖)LoD (unit copies/ml) 1One 유레아플라즈마 유레아리티쿰 (Ureaplasma urealyticum)Ureaplasma urealyticum 2.5*10³2.5*10³ 22 클라미디아 트라코마티스 (Chlamydia trachomatis)Chlamydia trachomatis 2.5*10²2.5*10² 33 유레아플라즈마 파붐 (Ureaplasma parvum)Ureaplasma parvum 2.5*10³2.5*10³ 44 마이코플라스마 제니탈리움 (Mycoplasma genitalium)Mycoplasma genitalium 2.5*10³2.5*10³ 55 가드네렐라 바지날리스 (Gardnerella vaginalis)Gardnerella vaginalis 2.5*10³2.5*10³ 66 임질구균 (Neisseria gonorrhea)Gonorrhea (Neisseria gonorrhea) 2.5*10²2.5*10² 77 칸디다 알비칸스 (Candida albicans)Candida albicans 2.5*10³2.5*10³ 88 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1)Herpes simplex virus 1 2.5*10³2.5*10³ 99 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2)Herpes simplex virus 2 2.5*10³2.5*10³ 1010 마이코플라즈마 호미니스 (Mycoplasma hominis)Mycoplasma hominis 2.5*10³2.5*10³ 1111 트리코모나스 바지날리스 (Trichomonas vaginalis)Trichomonas vaginalis 2.5*10³2.5*10³ 1212 매독균(Treponema pallidum)Syphilis (Treponema pallidum) 2.5*10³2.5*10³

[실시예3] 프라이머의 교차반응 여부[Example 3] Whether or not cross-reaction of primers

교차 반응성을 확인하고자 총 26종(Ureaplasma urealyticum, Chlamydia trachomatis, Ureaplasma parvum, Mycoplasma genitalium, Gardnerella vaginalis, Neisseria gonorrhea, Streptococcus agalactiae, Candida albicans, Herpes simplex virus 1, Herpes simplex virus 2, Mycoplasma hominis, Trichomonas vaginalis, Cytomegalovirus, Treponema pallidum, Enterococcus faecalis, Pseudomonas aeruginosa, E.Coli, Staphylococcus aureus, Enterococcus faecium, Klebsiella oxytoca, Proteus mirabilis, Veillonella parvula, HPV, Cytomegarovirus, Klebsiella pneumoniae, Lactobacillus)를 대상으로 실험을 수행하였다. To confirm cross-reactivity, a total of 26 species (Ureaplasma urealyticum, Chlamydia trachomatis, Ureaplasma parvum, Mycoplasma genitalium, Gardnerella vaginalis, Neisseria gonorrhea, Streptococcus agalactiae, Candida albicans, Herpes simplex virus 1, Herpes simplex virus 2, Mycoplasma hominis, Trichomonas vaginalis, Cytomegalovirus , Treponema pallidum, Enterococcus faecalis, Pseudomonas aeruginosa, E.Coli, Staphylococcus aureus, Enterococcus faecium, Klebsiella oxytoca, Proteus mirabilis, Veillonella parvula, HPV, Cytomegarovirus, Klebsiella pneumoniae, and Lactobacillus) were tested.

실험 결과, 모두 교차 반응이 없음을 확인 하였다.As a result of the experiment, it was confirmed that there was no cross-reaction.

[실시예4] 프라이머의 반복성 검증[Example 4] Verification of repeatability of primers

1) 반복성 시험1) Repeatability test

반복성 시험을 위해 동일한 시험자가 동일한 검체를 사용하여 20일간 매일 2회씩 검사마다 2회 반복 시험을 실시 하였다. 양성 표준물질 저농도 2.5*10³, 중농도 5*10³, 고농도 10*10³ 와 음성 표준물질을 이용하여 모두 동일한 결과를 보였다.For the repeatability test, the same tester conducted the test twice for each test twice daily for 20 days using the same sample. The same results were obtained using the positive standard material low concentration 2.5*10³, medium concentration 5*10³, high concentration 10*10³ and the negative standard material.

2) Lot 간 재현성2) Reproducibility between lots

동일 시험자가 동일한 검체로 3개의 다른 Lot을 사용하여 5일 동안 매일 2회씩 검사마다 2회 반복 시험을 실시하였다. 양성 표준물질 저농도 2.5*10³, 중농도 5*10³, 고농도 10*10³ 와 음성 표준물질을 이용하여 모두 동일한 결과를 보였다.The same tester repeated the test twice for each test twice daily for 5 days using 3 different lots with the same sample. The same results were obtained using the positive standard material low concentration 2.5*10³, medium concentration 5*10³, high concentration 10*10³ and the negative standard material.

3) 시험자간 재현성3) Reproducibility among testers

3명의 시험자가 동일한 검체로 동일한 Lot을 사용하여 3일 동안 매일 1회씩 검사마다 2회 반복 시험을 실시하였다. 양성 표준물질 저농도 2.5*10³, 중농도 5*10³, 고농도 10*10³ 와 음성 표준물질을 이용하여 모두 동일한 결과를 보였다.Three testers repeated the test twice per test, once daily for 3 days, using the same sample and the same lot. The same results were obtained using the positive standard material low concentration 2.5*10³, medium concentration 5*10³, high concentration 10*10³ and the negative standard material.

[실시예5] 프라이머의 임상적 성능[Example 5] Clinical performance of primers

A병원에서 타사의 기허가 대조시약 B제품으로 481개의 익명화된 질 도말 검체로 분석되었다.In hospital A, 481 anonymized vaginal smear samples were analyzed with another company's licensed control reagent B product.

균종fungal species 민감도responsiveness 특이도specificity 유레아플라즈마 유레아리티쿰(Ureaplasma urealyticum, UU)Ureaplasma urealyticum (UU) 99.39 % (163/164)99.39% (163/164) 100 % (317/317)100% (317/317) 마이코플라즈마 호미니스(Mycoplasma hominis, MH)Mycoplasma hominis (MH) 100 % (149/149)100% (149/149) 99.39 % (330/332)99.39% (330/332) 유레아플라즈마 파붐(Ureaplasma parvum, UP)Ureaplasma parvum (UP) 98.85 % (172/174)98.85% (172/174) 100 % (307/307)100% (307/307) 임질구균(Neisseria gonorrhea, NG)Neisseria gonorrhea (NG) 100 % (62/62)100% (62/62) 99.76 % (418/419)99.76% (418/419) 마이코플라스마 제니탈리움 ((Mycoplasma genitalium, MG)Mycoplasma genitalium ((Mycoplasma genitalium, MG) 100 % (74/74)100% (74/74) 99.75 % (406/407)99.75% (406/407) 매독균(Treponema pallidum)Syphilis (Treponema pallidum) 100 % (31/31)100% (31/31) 100 % (450/450)100% (450/450) 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1, HSV1)Herpes simplex virus 1 (HSV1) 100 % (33/33)100% (33/33) 100 % (448/448)100% (448/448) 칸디다 알비칸스(Candida albicans, CA)Candida albicans (CA) 98.63 % (145/147)98.63% (145/147) 99.70 % (333/334)99.70% (333/334) 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2, HSV2)Herpes simplex virus 2 (HSV2) 100 % (46/46)100% (46/46) 99.54 % (433/435)99.54% (433/435) 트리코모나스 바지날리스 (Trichomonas vaginalis, TV)Trichomonas vaginalis (TV) 100 % (37/37)100% (37/37) 99.77 % (443/444)99.77% (443/444) 클라미디아 트라코마티스 (Chlamydia trachomatis, CT)Chlamydia trachomatis (CT) 100 % (99/99)100% (99/99) 99.73 % (381/382)99.73% (381/382) 가드네렐라 바지날리스(Gardnerella vaginalis, GV)Gardnerella vaginalis (GV) 98.23 % (222/226)98.23% (222/226) 100 % (255/255)100% (255/255)

[실시예6] 성매개 감염 진단 키트 제작[Example 6] Production of sexually transmitted infection diagnosis kit

다음과 같은 구성으로 성매개 감염 진단 키트를 제작하였다A sexually transmitted infection diagnostic kit was produced with the following configuration.

구분division 명칭designation 원재료 및 성분명Raw material and ingredient name 1One Hot Taq MastermixHot Taq Mastermix Hot Start Taq (1,000U/Λ)*(2.5unit/λ), Tris-HCl(pH9.0), (NH4)2SO4,MgCl2, BSA, DMSO, 25mM MgCl2, 100% glycerol, dNTP(dATP, dCTP, dGTP, dTTP, dUTP), 0.4% Bromophenol BlueHot Start Taq (1,000U/Λ)*(2.5unit/λ), Tris-HCl(pH9.0), (NH 4 ) 2 SO 4 ,MgCl 2 , BSA, DMSO, 25mM MgCl 2 , 100% glycerol, dNTP (dATP, dCTP, dGTP, dTTP, dUTP), 0.4% Bromophenol Blue 22 STDPrimer set1STDPrimer set1 Treponema pallidum Forward PrimerTreponema pallidum Forward Primer (서열번호:1)(SEQ ID NO: 1) Treponema pallidum Reverse PrimerTreponema pallidum Reverse Primer (서열번호:2)(SEQ ID NO: 2) Mycoplasma genitalium Forward PrimerMycoplasma genitalium Forward Primer (서열번호:3)(SEQ ID NO: 3) Mycoplasma genitalium Reverse PrimerMycoplasma genitalium Reverse Primer (서열번호:4)(SEQ ID NO: 4) Neisseria gonorrhea Forward PrimerNeisseria gonorrhea Forward Primer (서열번호:5)(SEQ ID NO: 5) Neisseria gonorrhea Reverse PrimerNeisseria gonorrhea Reverse Primer (서열번호:6)(SEQ ID NO: 6) Ureaplasma parvum Forward PrimerUreaplasma parvum Forward Primer (서열번호:7)(SEQ ID NO: 7) Ureaplasma parvum Reverse PrimerUreaplasma parvum Reverse Primer (서열번호:8)(SEQ ID NO: 8) Mycoplasma hominis Forward PrimerMycoplasma hominis Forward Primer (서열번호:9)(SEQ ID NO: 9) Mycoplasma hominis Reverse PrimerMycoplasma hominis Reverse Primer (서열번호:10)(SEQ ID NO: 10) Ureaplasma urealyticum Forward PrimerUreaplasma urealyticum Forward Primer (서열번호:11)(SEQ ID NO: 11) Ureaplasma urealyticum Reverse PrimerUreaplasma urealyticum Reverse Primer (서열번호:12)(SEQ ID NO: 12) GAPDH Forward PrimerGAPDH Forward Primers (서열번호:25)(SEQ ID NO: 25) GAPDH Reverse PrimerGAPDH Reverse Primer (서열번호:26)(SEQ ID NO: 26) TE buffer (1M Tris-HCl(pH8.0), 0.1M EDTA)TE buffer (1M Tris-HCl (pH8.0), 0.1M EDTA) 33 STDPrimer set 2STDPrimer set 2 Gardnerella vaginalis Forward PrimerGardnerella vaginalis Forward Primer (서열번호:13)(SEQ ID NO: 13) Gardnerella vaginalis Reverse PrimerGardnerella vaginalis Reverse Primer (서열번호:14)(SEQ ID NO: 14) Chlamydia trachomatis Forward PrimerChlamydia trachomatis Forward Primer (서열번호:15)(SEQ ID NO: 15) Chlamydia trachomatis Reverse PrimerChlamydia trachomatis Reverse Primer (서열번호:16)(SEQ ID NO: 16) Trichomonas vaginalis Forward PrimerTrichomonas vaginalis Forward Primer (서열번호:17)(SEQ ID NO: 17) Trichomonas vaginalis Reverse PrimerTrichomonas vaginalis Reverse Primer (서열번호:18)(SEQ ID NO: 18) Herpes simplex virus 2 Forward PrimerHerpes simplex virus 2 Forward Primer (서열번호:19)(SEQ ID NO: 19) Herpes simplex virus 2 Reverse PrimerHerpes simplex virus 2 Reverse Primer (서열번호:20)(SEQ ID NO: 20) Candida albicans Forward PrimerCandida albicans Forward Primer (서열번호:21)(SEQ ID NO: 21) Candida albicans Reverse PrimerCandida albicans Reverse Primer (서열번호:22)(SEQ ID NO: 22) Herpes simplex virus 1 Forward PrimerHerpes simplex virus 1 Forward Primer (서열번호:23)(SEQ ID NO: 23) Herpes simplex virus 1 Reverse PrimerHerpes simplex virus 1 Reverse Primer (서열번호:24)(SEQ ID NO: 24) GAPDH Forward PrimerGAPDH Forward Primers (서열번호:25)(SEQ ID NO: 25) GAPDH Reverse PrimerGAPDH Reverse Primer (서열번호:26)(SEQ ID NO: 26) TE buffer (1M Tris-HCl(pH8.0), 0.1M EDTA)TE buffer (1M Tris-HCl (pH8.0), 0.1M EDTA) 44 STD 양성 대조군STD positive control Treponema pallidum DNATreponema pallidum DNA Mycoplasma genitalium DNAMycoplasma genitalium DNA Neisseria gonorrhea DNANeisseria gonorrhea DNA Ureaplasma parvum DNAUreaplasma parvum DNA Mycoplasma hominis DNAMycoplasma hominis DNA Ureaplasma urealyticum DNAUreaplasma urealyticum DNA Gardnerella vaginalis DNAGardnerella vaginalis DNA Chlamydia trachomatis DNAChlamydia trachomatis DNA Trichomonas vaginalis DNATrichomonas vaginalis DNA Herpes simplex virus 2 DNAHerpes simplex virus 2 DNA Candida albicans DNACandida albicans DNA Herpes simplex virus 1 DNAHerpes simplex virus 1 DNA TE buffer (1M Tris-HCl(pH8.0), 0.1M EDTA)TE buffer (1M Tris-HCl (pH8.0), 0.1M EDTA) 55 STD 음성 대조군STD negative control RNase-free waterRNase-free water

[실시예7] 진단 키트의 특이성 시험[Example 7] Specificity test of diagnostic kit

상기에서 제조한 진단 키트의 양성대조군을 사용하여 PCR 반응시켜 균주의 특이 유전자를 증폭하였다. 구체적으로, 다음과 같이 2 셋트로 실험을 진행하였다. A PCR reaction was performed using the positive control of the diagnostic kit prepared above to amplify the specific gene of the strain. Specifically, the experiment was conducted in two sets as follows.

실험예 1Experimental Example 1 실험예 2Experimental Example 2 Template DNATemplate DNA 4㎕4 μl Template DNATemplate DNA 4㎕4 μl STD Primer set 1STD Primer set 1 1㎕1 μl STD Primer set 2STD Primer set 2 1㎕1 μl Hot Taq MastermixHot Taq Mastermix 5㎕5 μl Hot Taq MastermixHot Taq Mastermix 5㎕5 μl Total VolumeTotal Volume 10㎕10 μl Total VolumeTotal Volume 10㎕10 μl

PCR 조건으로는 충분히 변성시키기 위해 다음의 조건으로 수행하였다. PCR conditions were performed under the following conditions in order to sufficiently denature.

Segmentsegment CyclesCycles TemperatureTemperature DurationDuration 1One 1One 95℃95℃ 10.0min10.0min 22 3535 95℃95℃ 0.5min0.5min 67℃67℃ 1.0min1.0min 72℃72℃ 1.0min1.0min 33 1One 72℃72℃ 5.0min5.0min

반응 후 증폭된 유전자 산물을 2~3% 아가로스 젤상에서 전기영동한 후 (0.5X TBE Buffer에서 110~250V로 30~50분), 특이 유전자의 증폭유무를 확인하였다. 실험 결과, 병원체별 특이 프라이머만이 중폭된 것을 확인 할 수 있다. (도 1 참조)After the reaction, the amplified gene product was electrophoresed on a 2-3% agarose gel (30-50 minutes at 110-250V in 0.5X TBE Buffer), and the presence or absence of amplification of the specific gene was confirmed. As a result of the experiment, it was confirmed that only the specific primers for each pathogen were amplified. (See Figure 1)

LaneLane 실험예 1Experimental Example 1 실험예 2Experimental Example 2 병원균pathogen 산물크기(bp)Product size (bp) 병원균pathogen 산물크기(bp) Product size (bp) 1One Treponema pallidum Treponema pallidum 646646 Gardnerella vaginalis Gardnerella vaginalis 660660 22 Mycoplasma genitalium Mycoplasma genitalium 530530 Chlamydia trachomatis Chlamydia trachomatis 523523 33 Neisseria gonorrhea Neisseria gonorrhea 435435 Trichomonas vaginalisTrichomonas vaginalis 420420 44 Ureaplasma parvum Ureaplasma parvum 350350 Herpes simplex virus 2 Herpes simplex virus 2 320320 55 Mycoplasma hominis Mycoplasma hominis 300300 Candida albicans Candida albicans 250250 66 Ureaplasma urealyticum Ureaplasma urealyticum 220220 Herpes simplex virus 1 Herpes simplex virus 1 200200

이상, 첨부된 도면을 참조로 하여 본 발명의 실시예를 설명하였지만, 본 발명이 속하는 기술분야의 통상의 기술자는 본 발명이 그 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 그러므로, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며, 제한적이 아닌 것으로 이해해야만 한다.Although the embodiments of the present invention have been described with reference to the accompanying drawings, those skilled in the art to which the present invention pertains can be implemented in other specific forms without changing the technical spirit or essential features of the present invention. you will be able to understand Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

본 발명은 여러 종의 성매개 감염을 조기에 효과적으로 검출하고 진단할 수 있는 프라이머 세트를 제공할 수 있다. 본 발명은 상기 프라이머를 포함하는 성매개 감염 진단 조성물 및 이를 이용한 성매개 감염 진담 방법을 제공할 수 있다. 이를 통해 건강에 위협이 되는 성매개 감염이 되는 병원균을 조기에 신속하고 효과적으로 검출하는데 사용될 수 있다.The present invention can provide a primer set capable of effectively detecting and diagnosing sexually transmitted infections of various species at an early stage. The present invention can provide a sexually transmitted infection diagnostic composition comprising the primer and a method for diagnosing sexually transmitted infection using the same. Through this, it can be used to quickly and effectively detect pathogens that become sexually transmitted infections that pose a threat to health.

<110> JH bioholdings <120> PRIMER SET FOR DIAGNOSING SEXUALLY TRANSMITTED INFECTION, DIAGNOSTIC COMPOSITION, AND METHOD FOR DIAGNOSING SEXUALLY TRANSMITTED INFECTION USING THE SAME <130> APP2020-0792KRD1 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 ctgcacgtaa ggtaagcagc atggagag 28 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 cgcacagaac cgaattcctt gaacctaacc tc 32 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 aggattggca atttttatgc ctggttgcat cttactttc 39 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 acgagtttga acttggtagt tcatctcttc tggtttgg 38 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 ctttatcggc ttggcaggcg aattcgg 27 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 caatggatcg gtatcactcg ctctgccg 28 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 7 gtccatttca acaagcacgc aaacttgcaa aag 33 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 8 tgcaccgaat cctggtagtt cttcaaaatc agg 33 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 cgctgtaagg cgccactaaa agatgagg 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 10 gctttctgac aaggtaccgt cagtctgc 28 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 11 ggggtaactt tagtgggagc aggggtagtt gctg 34 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 12 cagctgatgt aattgcaaca ttgaattcag cttcg 35 <210> 13 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 13 gagaactgga tagtggacac gagtaagaat agtgagac 38 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 14 acggtctggg cagattcacg cgggattcca cgagg 35 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 15 gcgcatctaa aggagctagc tcgcaacaat gc 32 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 16 tcaagccaag accgcaagtg aataatgcgg atac 34 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 17 cgaatccatc ctcgatgtca tccgtaagga agc 33 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 18 cgagcttacg aaggtcggag ttgagctg 28 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 19 gtgatgtttg cttggtcgtt cctggtcctc aag 33 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 20 gctggcggtg atccaatgga aaagccc 27 <210> 21 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 21 gatctcttgg ttctcgcatc gatgaagaac gcagc 35 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 22 acctaagcca ttgtcaaagc gatcccgcct tac 33 <210> 23 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 23 gcggccagca cgctgtggtt gcttggcctg gacg 34 <210> 24 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 24 cacgatccgc gttgggttgg cacagatccg tcag 34 <210> 25 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 25 cccacaagta tcactaagct cgctttcttg ctgtcc 36 <210> 26 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 26 gcagaatcca gatgctcaag gcccttcata atatcc 36 <110> JH bioholdings <120> PRIMER SET FOR DIAGNOSING SEXUALLY TRANSMITTED INFECTION, DIAGNOSTIC COMPOSITION, AND METHOD FOR DIAGNOSING SEXUALLY TRANSMITTED INFECTION USING THE SAME <130> APP2020-0792KRD1 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 28 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 1 ctgcacgtaa ggtaagcagc atggagag 28 <210> 2 <211> 32 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 2 cgcacagaac cgaattcctt gaacctaacc tc 32 <210> 3 <211> 39 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 3 aggattggca atttttatgc ctggttgcat cttactttc 39 <210> 4 <211> 38 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 4 acgagtttga acttggtagt tcatctcttc tggtttgg 38 <210> 5 <211> 27 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 5 ctttatcggc ttggcaggcg aattcgg 27 <210> 6 <211> 28 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 6 caatggatcg gtatcactcg ctctgccg 28 <210> 7 <211> 33 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 7 gtccatttca acaagcacgc aaacttgcaa aag 33 <210> 8 <211> 33 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 8 tgcaccgaat cctggtagtt cttcaaaatc agg 33 <210> 9 <211> 28 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 9 cgctgtaagg cgccactaaa agatgagg 28 <210> 10 <211> 28 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 10 gctttctgac aaggtaccgt cagtctgc 28 <210> 11 <211> 34 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 11 ggggtaactt tagtggggagc aggggtagtt gctg 34 <210> 12 <211> 35 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 12 cagctgatgt aattgcaaca ttgaattcag cttcg 35 <210> 13 <211> 38 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 13 gagaactgga tagtggacac gagtaagaat agtgagac 38 <210> 14 <211> 35 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 14 acggtctggg cagattcacg cgggattcca cgagg 35 <210> 15 <211> 32 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 15 gcgcatctaa aggagctagc tcgcaacaat gc 32 <210> 16 <211> 34 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 16 tcaagccaag accgcaagtg aataatgcgg atac 34 <210> 17 <211> 33 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 17 cgaatccatc ctcgatgtca tccgtaagga agc 33 <210> 18 <211> 28 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 18 cgagcttacg aaggtcggag ttgagctg 28 <210> 19 <211> 33 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 19 gtgatgtttg cttggtcgtt cctggtcctc aag 33 <210> 20 <211> 27 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 20 gctggcggtg atccaatgga aaagccc 27 <210> 21 <211> 35 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 21 gatctcttgg ttctcgcatc gatgaagaac gcagc 35 <210> 22 <211> 33 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 22 acctaagcca ttgtcaaagc gatcccgcct tac 33 <210> 23 <211> 34 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 23 gcggccagca cgctgtggtt gcttggcctg gacg 34 <210> 24 <211> 34 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 24 cacgatccgc gttgggttgg cacagatccg tcag 34 <210> 25 <211> 36 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 25 cccacaagta tcactaagct cgctttcttg ctgtcc 36 <210> 26 <211> 36 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 26 gcagaatcca gatgctcaag gcccttcata atatcc 36

Claims (7)

다음 군의 프라이머 쌍을 포함하는 성매개 감염 진단용 프라이머 세트;
1) 서열번호 13 및 서열번호 14로 이루어진 가드네렐라 바지날리스(Gardnerella vaginalis) 증폭 프라이머 쌍,
2) 서열번호 15 및 서열번호 16로 이루어진 클라미디아 트라코마티스(Chlamydia trachomatis) 증폭 프라이머 쌍,
3) 서열번호 17 및 서열번호 18로 이루어진 트리코모나스 바지날리스(Trichomonas vaginalis) 증폭 프라이머 쌍,
4) 서열번호 19 및 서열번호 20로 이루어진 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2) 증폭 프라이머 쌍,
5) 서열번호 21 및 서열번호 22로 이루어진 칸디다 알비칸스(Candida albicans) 증폭 프라이머 쌍, 및
6) 서열번호 23 및 서열번호 24로 이루어진 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1) 증폭 프라이머 쌍.
a primer set for diagnosing sexually transmitted infections, including the following groups of primer pairs;
1) a pair of Gardnerella vaginalis amplification primers consisting of SEQ ID NO: 13 and SEQ ID NO: 14;
2) a pair of Chlamydia trachomatis amplification primers consisting of SEQ ID NO: 15 and SEQ ID NO: 16;
3) a pair of Trichomonas vaginalis amplification primers consisting of SEQ ID NO: 17 and SEQ ID NO: 18;
4) a pair of herpes simplex virus 2 amplification primers consisting of SEQ ID NO: 19 and SEQ ID NO: 20;
5) a pair of Candida albicans amplification primers consisting of SEQ ID NO: 21 and SEQ ID NO: 22, and
6) Herpes simplex virus 1 amplification primer pair consisting of SEQ ID NO: 23 and SEQ ID NO: 24.
제1항에 따른 프라이머 세트를 포함하는 성매개 감염 진단용 조성물.A composition for diagnosing a sexually transmitted infection comprising the primer set according to claim 1. 제1항에 따른 프라이머 세트를 포함하는 성매개 감염 진단 키트.A diagnostic kit for sexually transmitted infection comprising the primer set according to claim 1. 제3항에 있어서, 상기 키트는 DNA 중합효소를 더 포함하는 성매개 감염 진단 키트.The kit for diagnosing sexually transmitted infection according to claim 3, wherein the kit further comprises a DNA polymerase. 제1항에 따른 프라이머 세트를 사용하여 분리된 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하는 단계를 포함하는 성매개 감염 여부 진단을 위한 정보제공방법.An information providing method for diagnosing sexually transmitted infection, comprising the step of performing a polymerase chain reaction targeting DNA of an isolated biological sample using the primer set according to claim 1. 제5항에 있어서, 상기 방법은 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형(Herpes simplex virus 1) 중에서 선택된 어느 하나 이상의 병원체를 검출하는 것을 특징으로 하는 성매개 감염 여부 진단을 위한 정보제공방법.The method of claim 5, wherein the method is used to treat Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida An information providing method for diagnosing sexually transmitted infection, characterized by detecting one or more pathogens selected from Candida albicans and Herpes simplex virus 1. 제1항에 따른 프라이머 세트를 사용하여 분리된 생물학적 샘플의 DNA를 표적으로 하는 중합효소연쇄 반응을 수행하는 단계를 포함하는 성매개 감염 여부 진단을 위한 정보제공방법으로, 상기 방법은 가드네렐라 바지날리스(Gardnerella vaginalis), 클라미디아 트라코마티스(Chlamydia trachomatis), 트리코모나스 바지날리스(Trichomonas vaginalis), 단순 헤르페스 바이러스 2형 (Herpes simplex virus 2), 칸디다 알비칸스(Candida albicans), 및 단순 헤르페스 바이러스 1형 (Herpes simplex virus 1) 병원체 감염 여부를 동시에 검출하는 성매개 감염 여부 진단을 위한 정보제공방법.An information providing method for diagnosing sexually transmitted infection, comprising the step of performing a polymerase chain reaction targeting DNA of an isolated biological sample using the primer set according to claim 1, wherein the method comprises Gardnerella pants. Gardnerella vaginalis, Chlamydia trachomatis, Trichomonas vaginalis, Herpes simplex virus 2, Candida albicans, and Herpes simplex virus type 1 (Herpes simplex virus 1) An information provision method for diagnosing sexually transmitted infections that simultaneously detects pathogen infection.
KR1020217019404A 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same KR102466562B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020207036615A KR102326566B1 (en) 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same
PCT/KR2020/018659 WO2022131406A1 (en) 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020207036615A Division KR102326566B1 (en) 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same

Publications (2)

Publication Number Publication Date
KR20220088629A KR20220088629A (en) 2022-06-28
KR102466562B1 true KR102466562B1 (en) 2022-11-11

Family

ID=78717131

Family Applications (2)

Application Number Title Priority Date Filing Date
KR1020207036615A KR102326566B1 (en) 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same
KR1020217019404A KR102466562B1 (en) 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same

Family Applications Before (1)

Application Number Title Priority Date Filing Date
KR1020207036615A KR102326566B1 (en) 2020-12-18 2020-12-18 Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same

Country Status (2)

Country Link
KR (2) KR102326566B1 (en)
WO (1) WO2022131406A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240254568A1 (en) * 2023-01-27 2024-08-01 Life Technologies Corporation Compositions, kits, and methods for detecting sti pathogen sequences

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101915211B1 (en) 2018-05-25 2018-11-05 김연수 Method for detecting lower urinary tract infection using melting peak analysis

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070099208A (en) * 2006-04-03 2007-10-09 (주)우먼바이오텍 Std kit
KR20060100339A (en) * 2006-08-30 2006-09-20 김연수 Novel type-specific primers and method for detection of sexual transmitted diseases by multiplex-pcr
KR20070047269A (en) * 2007-04-16 2007-05-04 김연수 High sensitivity method for detection of sexual transmitted diseases by multiplex pcr and automatic electrophoresis system
KR101101880B1 (en) * 2008-11-25 2012-01-05 문우철 DNA chip, Kit for Detecting or Genotyping Bacteria Causing Sexually Transmitted Diseases, Genotyping antibacterial drug resistance and Detecting or Genotyping Method Using The Same
KR101225522B1 (en) * 2009-10-16 2013-01-23 (주)지노첵 Probe for detecting microbes causing sexually transmitted diseases and detection chip, detection kit, and detection method using the same
KR101382638B1 (en) * 2011-03-11 2014-04-08 (주)팸메드 Methods for Simultaneously Detecting Sexually Transmitted Disease-Inducible Microorganisms
KR101482681B1 (en) * 2013-02-05 2015-01-16 (주)다이오진 A method for detecting microorganisms occuring sexually transmitted diseases using liquid beads array and multiplex pcr
KR101890472B1 (en) * 2016-06-20 2018-08-21 주식회사 티씨엠생명과학 Primers and the Composition for isothermal amplification reaction to detect the pathogens and Method for Rapid and Visual Diagnosis in sexually transmitted infections using thereof
KR102114469B1 (en) * 2018-04-25 2020-05-25 주식회사 이원생명과학연구원 Kits for Detecting Pathogens of Sexually Transmitted Infections

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101915211B1 (en) 2018-05-25 2018-11-05 김연수 Method for detecting lower urinary tract infection using melting peak analysis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Journal of Medical Microbiology (2007) 56:772-777

Also Published As

Publication number Publication date
KR102326566B1 (en) 2021-11-16
WO2022131406A1 (en) 2022-06-23
KR20220088629A (en) 2022-06-28

Similar Documents

Publication Publication Date Title
KR102338861B1 (en) PNA Probe and Primer for Detecting SARS-CoV-2 Causing Covid-19 Using RT-LAMP and Method for Detecting SARS-CoV-2 Infection Using Thereof
US20220136046A1 (en) Detection and antibiotic resistance profiling of microorganisms
US20110287428A1 (en) Neisseria gonorrhoeae detection
US20110287965A1 (en) Methods and compositions to detect clostridium difficile
KR102466562B1 (en) Primer set for diagnosing sexually transmitted infection, diagnostic composition, and method for diagnosing sexually transmitted infection using the same
KR20120103801A (en) Methods for simultaneously detecting sexually transmitted disease-inducible microorganisms
KR20060100339A (en) Novel type-specific primers and method for detection of sexual transmitted diseases by multiplex-pcr
KR100974861B1 (en) PCR Primer Set for Identification of Mycoplasma from Biological Medical Preparation and Detection Kit for Mycoplasma Comprising the Same
KR20190049280A (en) A method for simultaneously detecting and identifying Helicobacter pylori, and an antibiotics-resistance gene, and a use therefor based QuantaMatrix assay Platform
KR20070099208A (en) Std kit
US11884984B2 (en) Kits and methods for assessing a condition or a risk of developing a condition, and related methods of treatment
KR20190041314A (en) Oligonucleotide set for detection of chikungunya virus and uses thereof
CN111500774B (en) Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit
KR20220026367A (en) Composition for detection and identification of microorganisms associated with periodontal diseases
KR102444179B1 (en) Primer set for diagnosing hpv infection, diagnostic composition, and method of providing information for diagnosing hpv infection using the same
KR100846494B1 (en) Primer set for amplifying target sequences of Helicobacter pylori method for detecting Helicobacter pylori using the primer set and kit for detecting Helicobacter pylori comprising the primer set
KR20140114698A (en) Composition for diagnosing human papillomavirus infection and cervical cancer
EP2723891B1 (en) Diagnostic methods for detecting clostridium difficile
KR101649306B1 (en) Oligonucleotide for detecting Chlamydia trachomatis and/or Neisseria gonorrhoeae, and kit using the same
KR101742016B1 (en) Oligonucleotide for detecting Chlamydia trachomatis and/or Neisseria gonorrhoeae, and kit using the same
RU2416647C1 (en) Oligonucleotide primers, method and test system for identifying genome of sheep nairobi disease virus by reverse transcription - polymerase chain reaction
AU2005231862B2 (en) Neisseria gonorrhoeae detection
WO2020161651A1 (en) Early detection of multiple resistances to anti-bacterial treatment
CN116219039A (en) Primer and probe combination, composition, kit and detection method for helicobacter pylori detection
CN114592078A (en) Primer, probe, method and kit for detecting porcine helicobacter

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant